Wheat miRNA Abundances

The data below are based on the microRNAs listed in the Sanger registry. Adjust libraries/reads to display on the control panel.

        

        miRNA         miRNA sequence Len Sum (norm) Average Max Min (>0)  sRNA_WHEAT_DR2sRNA_WHEAT_FM1sRNA_WHEAT_FM2sRNA_WHEAT_AM1sRNA_WHEAT_AM2sRNA_WHEAT_TS1sRNA_WHEAT_TS2
tae-miR1117 UAGUACCGGUUCGUGGCACGAACC 24 4 1 2 1    0 1 2 0 1 0 0
tae-miR1118 CACUACAUUAUGGAAUGGAGGGA 23 0 0 0 0    0 0 0 0 0 0 0
tae-miR1119 UGGCACGGCGUGAUGCUGAGUCAG 24 0 0 0 0    0 0 0 0 0 0 0
tae-miR1120a ACAUUCUUAUAUUAUGAGACGGAG 24 0 0 0 0    0 0 0 0 0 0 0
tae-miR1120b-3p UUCUUAUAUUGUGGGACAGAG 21 133 19 28 8    8 16 27 15 15 24 28
tae-miR1120c-5p UAAUAUAAGAACGUUUUUGAC 21 56 9 19 3    0 5 3 17 6 19 6
tae-miR1121 AGUAGUGAUCUAAACGCUCUUA 22 0 0 0 0    0 0 0 0 0 0 0
tae-miR1122a UAGAUACAUCCGUAUCUAGA 20 0 0 0 0    0 0 0 0 0 0 0
tae-miR1122b-3p AGACUUAUAUGUAGGAACGGA 21 7 1 3 1    1 1 1 0 3 0 1
tae-miR1122c-3p UCUAAUAUUAUGGGACGGAGG 21 160 23 36 14    14 26 21 16 28 19 36
tae-miR1123 UCCGUGAGACCUGGUCUCAUAGA 23 0 0 0 0    0 0 0 0 0 0 0
tae-miR1124 GCAGGACGUGAAGAGCGAGUCC 22 0 0 0 0    0 0 0 0 0 0 0
tae-miR1125 AACCAACGAGACCAACUGCGGCGG 24 0 0 0 0    0 0 0 0 0 0 0
tae-miR1127a UCCUUCCGUUCGGAAUUAC 19 0 0 0 0    0 0 0 0 0 0 0
tae-miR1127b-3p ACAAGUAUUUCUGGACGGAGG 21 34 5 7 2    3 7 2 7 7 5 3
tae-miR1128 UACUACUCCCUCCGUCCGAAA 21 0 0 0 0    0 0 0 0 0 0 0
tae-miR1129 CAGCGAGCCAGCGGAGACCGGCAG 24 0 0 0 0    0 0 0 0 0 0 0
tae-miR1130a CCUCCGUCUCGUAAUGUAAGACG 23 0 0 0 0    0 0 0 0 0 0 0
tae-miR1130b-3p UCUUAUAUUAUGGGACGGAGG 21 1,742 249 325 131    131 258 250 219 256 303 325
tae-miR1131 UAGUACCGGUUCGUGGCUAACC 22 0 0 0 0    0 0 0 0 0 0 0
tae-miR1133 CAUAUACUCCCUCCGUCCGAAA 22 0 0 0 0    0 0 0 0 0 0 0
tae-miR1134 CAACAACAACAAGAAGAAGAAGAU 24 0 0 0 0    0 0 0 0 0 0 0
tae-miR1135 CUGCGACAAGUAAUUCCGAACGGA 24 204 29 48 20    20 27 34 48 25 29 21
tae-miR1136 UUGUCGCAGGUAUGGAUGUAUCUA 24 9 2 3 1    3 1 0 0 3 2 0
tae-miR1137a UAGUACAAAGUUGAGUCAUC 20 0 0 0 0    0 0 0 0 0 0 0
tae-miR1137b-5p UCCGUUCCAGAAUAGAUGACC 21 192 27 37 17    17 28 23 27 32 37 28
tae-miR1138 GCUUAGAUGUGACAUCCUUAAAA 23 0 0 0 0    0 0 0 0 0 0 0
tae-miR1139 AGAGUAACAUACACUAGUAACA 22 0 0 0 0    0 0 0 0 0 0 0
tae-miR156 UGACAGAAGAGAGUGAGCACA 21 19 6 9 2    0 2 0 0 0 8 9
tae-miR159a UUUGGAUUGAAGGGAGCUCUG 21 443,810 63,401 90,616 33,140    90,616 75,389 72,416 55,831 82,516 33,140 33,902
tae-miR159b UUUGGAUUGAAGGGAGCUCUG 21 443,810 63,401 90,616 33,140    90,616 75,389 72,416 55,831 82,516 33,140 33,902
tae-miR160 UGCCUGGCUCCCUGUAUGCCA 21 1,444 206 388 135    182 388 173 156 135 189 221
tae-miR164 UGGAGAAGCAGGGCACGUGCA 21 668 95 150 45    79 122 150 110 108 54 45
tae-miR167a UGAAGCUGCCAGCAUGAUCUA 21 21,655 3,094 6,076 718    6,076 2,392 5,792 2,343 3,456 878 718
tae-miR167b UGAAGCUGACAGCAUGAUCUA 21 9 2 4 1    4 0 1 1 0 3 0
tae-miR167c-5p UGAAGCUGCCAGCAUGAUCUGC 22 386 55 186 1    4 6 1 5 6 186 178
tae-miR169 GGGCAAGUCACCCUGGGCUACC 22 0 0 0 0    0 0 0 0 0 0 0
tae-miR171a UGAUUGAGCCGUGCCAAUAUC 21 145 21 53 7    8 7 12 24 11 53 30
tae-miR171b UUGAGCCGUGCCAAUAUCACG 21 222 32 102 2    2 2 5 10 3 98 102
tae-miR1847-5p ACCUGCAGUUGGGCCAAUGAC 21 6 2 2 1    1 0 1 2 2 0 0
tae-miR2275-3p UUUGGUUUCCUCCAAUAUCUCG 22 2 2 2 2    0 0 0 0 0 2 0
tae-miR319 UUGGACUGAAGGGAGCUCCCU 21 539 77 136 22    136 117 114 43 61 46 22
tae-miR395a GUGAAGUGUUUGGGGGAACUC 21 7 2 3 1    1 2 3 0 0 0 1
tae-miR395b UGAAGUGUUUGGGGGAACUC 20 216 31 50 8    22 11 42 8 37 46 50
tae-miR396-5p AACUGUGAACUCGCGGGGAUG 21 4 2 3 1    0 0 0 0 0 3 1
tae-miR397-5p UCACCGGCGCUGCACACAAUG 21 81 12 18 7    7 11 7 18 9 16 13
tae-miR398 UGUGUUCUCAGGUCGCCCCCG 21 20 10 11 9    0 0 0 0 0 11 9
tae-miR399 UGCCAAAGGAGAAUUGCCC 19 0 0 0 0    0 0 0 0 0 0 0
tae-miR408 CUGCACUGCCUCUUCCCUGGC 21 0 0 0 0    0 0 0 0 0 0 0
tae-miR444a UUGCUGCCUCAAGCUUGCUGC 21 0 0 0 0    0 0 0 0 0 0 0
tae-miR444b UUGCUGCCUCAAGCUUGCUGC 21 0 0 0 0    0 0 0 0 0 0 0
tae-miR5048-5p UUUGCAGGUUUUAGGUCUAAGU 22 27,727 3,961 5,171 3,318    3,552 5,171 3,479 4,475 4,217 3,515 3,318
tae-miR5049-3p AAUAUGGAUCGGAGGGAGUAC 21 0 0 0 0    0 0 0 0 0 0 0
tae-miR5050 UUGAACGACCUCACCAUGUCG 21 2 2 2 2    0 0 0 0 0 2 0
tae-miR5062-5p UGAACCUUAGGGAACAGCCGCAU 23 319 46 71 32    71 47 48 53 32 32 36
tae-miR5084 AUACAGUACUGCAGAGGAUCCUAA 24 6 2 3 1    0 1 0 1 1 3 0
tae-miR5085 AAGGACAUUUUUUGUGGCCUG 21 0 0 0 0    0 0 0 0 0 0 0
tae-miR5086 ACAUUGGUGGAAGGCGUGGUA 21 0 0 0 0    0 0 0 0 0 0 0
tae-miR5175-5p UUCCAAAUUACUCGUCGUGGU 21 326 47 89 9    9 26 19 89 51 61 71
tae-miR5200 UGUAGAUACUCCCUAAGGCUU 21 30 8 12 5    0 0 0 7 6 5 12
tae-miR530 UGCAGUGGCAUAUGCAACUCU 21 0 0 0 0    0 0 0 0 0 0 0
tae-miR531 CGCUCGCCGGAGCAGCGUGCA 21 0 0 0 0    0 0 0 0 0 0 0
tae-miR5384-3p UGAGCGCGCCGCCGUCGAAUG 21 9 3 6 1    0 0 1 0 2 6 0
tae-miR6197-5p UCUGUAAACAAAUGUAGGACG 21 195 28 41 16    33 25 41 21 16 35 24
tae-miR6201 UGACCCUGAGGCACUCAUACCG 22 4,138 591 1,120 78    78 143 202 845 704 1,120 1,046
tae-miR7757-5p AUAAAACCUUCAGCUAUCCAUC 22 21,909 3,130 4,086 2,100    4,086 2,575 3,121 3,954 3,939 2,100 2,134
tae-miR9652-3p AAGCUUAAUGAGAACAUGUG 20 1 1 1 1    0 0 0 0 1 0 0
tae-miR9652-5p CCUGUUUGUCAUUAAGUUUCUU 22 21 5 12 1    7 1 12 0 1 0 0
tae-miR9653a-3p UUUGAGACUUUGGCCAUGGCC 21 1,446 207 297 70    70 228 148 235 202 266 297
tae-miR9653b UGGCCAAGGUCUCUUGAGGCU 21 0 0 0 0    0 0 0 0 0 0 0
tae-miR9654a-3p UUCUGAAAGGCUUGAAGCGAAU 22 0 0 0 0    0 0 0 0 0 0 0
tae-miR9654b-3p UUCCGAAAGGCUUGAAGCGAAU 22 59 8 19 3    3 4 8 10 6 19 9
tae-miR9655-3p CAAGGGAAGGAAGUAGCCAAC 21 18 6 9 1    0 0 0 0 1 8 9
tae-miR9656-3p CUUCGAGACUCUGAACAGCGG 21 139 28 66 1    0 2 0 6 1 66 64
tae-miR9657a-3p UGUGCUUCCUCGUCGAACGGU 21 0 0 0 0    0 0 0 0 0 0 0
tae-miR9657b-3p CGUGCUUCCUCGUCGAACGGU 21 0 0 0 0    0 0 0 0 0 0 0
tae-miR9657b-5p UUCGUCGGAGAAGCAUGUUGC 21 0 0 0 0    0 0 0 0 0 0 0
tae-miR9657c-3p CGUGCUUCCUCGUCGAACGGU 21 0 0 0 0    0 0 0 0 0 0 0
tae-miR9658-3p AUCGUUCUGGGUGAAUAGGCC 21 1,637 234 362 96    282 362 341 184 265 96 107
tae-miR9659-3p UCCAAUGGUUGUUCACGGCAUC 22 2 1 1 1    1 1 0 0 0 0 0
tae-miR9660-5p UUGCGAGCAACGGAUGAAUC 20 9 3 6 1    2 0 1 0 6 0 0
tae-miR9661-5p UGAAGUAGAGCAGGGACCUCA 21 15 3 5 1    4 1 0 0 2 5 3
tae-miR9662a-3p UUGAACAUCCCAGAGCCACCG 21 34,572 4,939 7,120 3,214    4,674 4,662 3,214 4,707 3,473 6,722 7,120
tae-miR9662b-3p UGAACAUCCCAGAGCCACCGG 21 7,545 1,078 1,366 878    1,366 1,163 958 1,000 1,037 878 1,143
tae-miR9663-5p AAGCGUAGUCGAACGAAUCUG 21 3,010 430 662 260    344 260 410 336 363 662 635
tae-miR9664-3p UUGCAGUCCUCGAUGUCGUAG 21 209 30 96 1    2 6 1 9 16 96 79
tae-miR9665-3p GCUAGCAGUGUAAACUCAAAUCA 23 0 0 0 0    0 0 0 0 0 0 0
tae-miR9666a-3p CGGUAGGGCUGUAUGAUGGCGA 22 258 43 130 1    1 0 3 7 6 130 111
tae-miR9666b-3p CGGUUGGGCUGUAUGAUGGCGA 22 499 71 232 3    3 7 13 29 30 232 185
tae-miR9666b-5p GCCAUCAUACGUCCAACCGUG 21 9 3 5 1    0 0 0 3 0 5 1
tae-miR9666c-5p GCCAUCAUACGUCCAACCGUG 21 9 3 5 1    0 0 0 3 0 5 1
tae-miR9667-5p AAAUAUGGCAAACAAUGAAUG 21 0 0 0 0    0 0 0 0 0 0 0
tae-miR9668-5p CCAAUGACAAGUAUUUUCGGA 21 0 0 0 0    0 0 0 0 0 0 0
tae-miR9669-5p UACUGUGGGCACUUAUUUGAC 21 4,348 621 773 457    701 773 647 457 590 567 613
tae-miR9670-3p AGGUGGAAUACUUGAAGAAGA 21 2,167 310 546 165    263 247 165 274 246 546 426
tae-miR9671-5p UGACUUUACACAACUGUCCGGC 22 6 2 3 1    0 0 0 0 1 2 3
tae-miR9672a-3p CCACGACUGUCAUUAAGCAUC 21 6,808 973 2,201 65    65 399 313 1,248 858 1,724 2,201
tae-miR9672b UACCACGACUGUCAUUAAGCA 21 157,222 22,460 59,896 780    780 4,755 1,614 29,864 21,891 38,422 59,896
tae-miR9673-5p UAAGAAGCAAAUAGCACAUG 20 13 2 3 2    2 2 2 2 2 3 0
tae-miR9674a-5p GCAUCAUCCAUCCUACCAUUC 21 0 0 0 0    0 0 0 0 0 0 0
tae-miR9674b-5p AUAGCAUCAUCCAUCCUACCC 21 5,775 825 1,099 558    989 766 929 860 1,099 558 574
tae-miR9675-3p UUUAUGAUCACUCUCGUUUUG 21 51 13 30 1    1 0 0 1 0 30 19
tae-miR9676-5p UGGAUGUCAUCGUGGCCGUACA 22 316 53 154 1    0 1 6 20 7 154 128
tae-miR9677a UGGCCGUUGGUAGAGUAGGAGA 22 5,905 844 3,042 2    3 2 4 14 6 3,042 2,834
tae-miR9677b CAGGGCGGGGAACAGGUGGCC 21 335 168 179 156    0 0 0 0 0 179 156
tae-miR9678-3p UCUGGCGAGGGACAUACACUGU 22 0 0 0 0    0 0 0 0 0 0 0
tae-miR9679-5p CAGAACCAGAAUGAGUAGCUC 21 64 9 21 2    12 2 6 8 5 21 10
tae-miR9772 UGAGAUGAGAUUACCCCAUAC 21 931 133 190 108    190 114 130 148 108 125 116
tae-miR9773 UUUGUUUUUAUGUUAUUUUGUGAA 24 736 105 203 17    17 76 56 115 109 203 160
tae-miR9774 CAAGAUAUUGGGUAUUUCUGUC 22 1 1 1 1    0 0 0 1 0 0 0
tae-miR9775 UGUGCGCAAUAAGAUUUUGCUA 22 7 2 3 1    0 0 0 3 3 0 1
tae-miR9776 UUGGACGAGGAUGUGCAACUG 21 834 119 341 4    4 12 16 80 53 341 328
tae-miR9777 AGCAAACAUAUCUGAGCACA 20 21 4 6 1    6 2 1 5 6 0 1
tae-miR9778 UGCAUCAUCUCGAACUCGUCG 21 3 3 3 3    3 0 0 0 0 0 0
tae-miR9779 CUUAUGCAACGUCUGAGGAU 20 0 0 0 0    0 0 0 0 0 0 0
tae-miR9780 CGGGUCGGCGCUGCACGCGGC 21 0 0 0 0    0 0 0 0 0 0 0
tae-miR9781 UUUUGUCACAUAUAAUACAUA 21 0 0 0 0    0 0 0 0 0 0 0
tae-miR9782 GUAUUAGGUUGGUCAAAUUGACGA 24 74 12 19 5    0 5 9 18 13 19 10
tae-miR9783 AUAAGCACCGGUGCUUAAGAA 21 0 0 0 0    0 0 0 0 0 0 0