Wheat miRNA Abundances

The data below are based on the microRNAs listed in the Sanger registry. Adjust libraries/reads to display on the control panel.

        

        miRNA         miRNA sequence Len Sum (norm) Average Max Min (>0)  Tae_DR2Tae_FM1Tae_FM2Tae_AM1Tae_AM2Tae_TS1Tae_TS2
tae-miR10516 UCCUCUGCAGUCGACUGC 18 0 0 0 0    0 0 0 0 0 0 0
tae-miR10517 ACAUUCAGUCAUUGACAU 18 0 0 0 0    0 0 0 0 0 0 0
tae-miR10518 AAGAGAUUUUGAAGGGAU 18 0 0 0 0    0 0 0 0 0 0 0
tae-miR10519 UGUCAAAAGUUGGAUAUU 18 0 0 0 0    0 0 0 0 0 0 0
tae-miR10520 CUUGGAUGAGAACAUGGCAU 20 0 0 0 0    0 0 0 0 0 0 0
tae-miR10521 UUCGUUUUUUAUAGGAUGG 19 0 0 0 0    0 0 0 0 0 0 0
tae-miR1117 UAGUACCGGUUCGUGGCACGAACC 24 4 1 2 1    0 1 2 0 1 0 0
tae-miR1118 CACUACAUUAUGGAAUGGAGGGA 23 0 0 0 0    0 0 0 0 0 0 0
tae-miR1119 UGGCACGGCGUGAUGCUGAGUCAG 24 0 0 0 0    0 0 0 0 0 0 0
tae-miR1120a ACAUUCUUAUAUUAUGAGACGGAG 24 0 0 0 0    0 0 0 0 0 0 0
tae-miR1120b-3p UUCUUAUAUUGUGGGACAGAG 21 118 17 26 6    6 14 23 13 13 23 26
tae-miR1120c-5p UAAUAUAAGAACGUUUUUGAC 21 50 8 18 2    0 4 2 15 5 18 6
tae-miR1121 AGUAGUGAUCUAAACGCUCUUA 22 0 0 0 0    0 0 0 0 0 0 0
tae-miR1122a UAGAUACAUCCGUAUCUAGA 20 0 0 0 0    0 0 0 0 0 0 0
tae-miR1122b-3p AGACUUAUAUGUAGGAACGGA 21 7 1 3 1    1 1 1 0 3 0 1
tae-miR1122c-3p UCUAAUAUUAUGGGACGGAGG 21 140 20 33 12    12 22 17 14 24 18 33
tae-miR1123 UCCGUGAGACCUGGUCUCAUAGA 23 0 0 0 0    0 0 0 0 0 0 0
tae-miR1124 GCAGGACGUGAAGAGCGAGUCC 22 0 0 0 0    0 0 0 0 0 0 0
tae-miR1125 AACCAACGAGACCAACUGCGGCGG 24 0 0 0 0    0 0 0 0 0 0 0
tae-miR1127a UCCUUCCGUUCGGAAUUAC 19 0 0 0 0    0 0 0 0 0 0 0
tae-miR1127b-3p ACAAGUAUUUCUGGACGGAGG 21 31 4 6 2    3 6 2 6 6 5 3
tae-miR1128 UACUACUCCCUCCGUCCGAAA 21 0 0 0 0    0 0 0 0 0 0 0
tae-miR1129 CAGCGAGCCAGCGGAGACCGGCAG 24 0 0 0 0    0 0 0 0 0 0 0
tae-miR1130a CCUCCGUCUCGUAAUGUAAGACG 23 0 0 0 0    0 0 0 0 0 0 0
tae-miR1130b-3p UCUUAUAUUAUGGGACGGAGG 21 1,546 221 305 108    108 216 209 198 225 285 305
tae-miR1131 UAGUACCGGUUCGUGGCUAACC 22 0 0 0 0    0 0 0 0 0 0 0
tae-miR1133 CAUAUACUCCCUCCGUCCGAAA 22 0 0 0 0    0 0 0 0 0 0 0
tae-miR1134 CAACAACAACAAGAAGAAGAAGAU 24 0 0 0 0    0 0 0 0 0 0 0
tae-miR1135 CUGCGACAAGUAAUUCCGAACGGA 24 179 26 43 17    17 22 28 43 22 27 20
tae-miR1136 UUGUCGCAGGUAUGGAUGUAUCUA 24 8 2 3 1    2 1 0 0 3 2 0
tae-miR1137a UAGUACAAAGUUGAGUCAUC 20 0 0 0 0    0 0 0 0 0 0 0
tae-miR1137b-5p UCCGUUCCAGAAUAGAUGACC 21 169 24 35 14    14 23 19 24 28 35 26
tae-miR1138 GCUUAGAUGUGACAUCCUUAAAA 23 0 0 0 0    0 0 0 0 0 0 0
tae-miR1139 AGAGUAACAUACACUAGUAACA 22 0 0 0 0    0 0 0 0 0 0 0
tae-miR156 UGACAGAAGAGAGUGAGCACA 21 18 6 8 2    0 2 0 0 0 8 8
tae-miR159a UUUGGAUUGAAGGGAGCUCUG 21 384,687 54,955 75,208 31,204    75,208 63,110 60,388 50,238 72,712 31,204 31,827
tae-miR159b UUUGGAUUGAAGGGAGCUCUG 21 384,687 54,955 75,208 31,204    75,208 63,110 60,388 50,238 72,712 31,204 31,827
tae-miR160 UGCCUGGCUCCCUGUAUGCCA 21 1,265 181 325 119    151 325 144 140 119 178 208
tae-miR164 UGGAGAAGCAGGGCACGUGCA 21 580 83 125 42    66 102 125 99 95 51 42
tae-miR167a UGAAGCUGCCAGCAUGAUCUA 21 18,529 2,647 5,043 674    5,043 2,002 4,830 2,108 3,045 827 674
tae-miR167b UGAAGCUGACAGCAUGAUCUA 21 9 2 4 1    4 0 1 1 0 3 0
tae-miR167c-5p UGAAGCUGCCAGCAUGAUCUGC 22 361 52 175 1    4 5 1 4 5 175 167
tae-miR169 GGGCAAGUCACCCUGGGCUACC 22 0 0 0 0    0 0 0 0 0 0 0
tae-miR171a UGAUUGAGCCGUGCCAAUAUC 21 131 19 50 6    6 6 10 21 10 50 28
tae-miR171b UUGAGCCGUGCCAAUAUCACG 21 207 30 96 1    1 2 4 9 3 92 96
tae-miR1847-5p ACCUGCAGUUGGGCCAAUGAC 21 6 2 2 1    1 0 1 2 2 0 0
tae-miR2275-3p UUUGGUUUCCUCCAAUAUCUCG 22 2 2 2 2    0 0 0 0 0 2 0
tae-miR319 UUGGACUGAAGGGAGCUCCCU 21 464 66 113 21    113 98 95 39 54 44 21
tae-miR395a GUGAAGUGUUUGGGGGAACUC 21 6 2 2 1    1 2 2 0 0 0 1
tae-miR395b UGAAGUGUUUGGGGGAACUC 20 193 28 47 7    18 10 35 7 32 44 47
tae-miR396-5p AACUGUGAACUCGCGGGGAUG 21 4 2 3 1    0 0 0 0 0 3 1
tae-miR397-5p UCACCGGCGCUGCACACAAUG 21 73 10 16 5    6 10 5 16 8 15 13
tae-miR398 UGUGUUCUCAGGUCGCCCCCG 21 19 10 11 8    0 0 0 0 0 11 8
tae-miR399 UGCCAAAGGAGAAUUGCCC 19 0 0 0 0    0 0 0 0 0 0 0
tae-miR408 CUGCACUGCCUCUUCCCUGGC 21 0 0 0 0    0 0 0 0 0 0 0
tae-miR444a UUGCUGCCUCAAGCUUGCUGC 21 0 0 0 0    0 0 0 0 0 0 0
tae-miR444b UUGCUGCCUCAAGCUUGCUGC 21 0 0 0 0    0 0 0 0 0 0 0
tae-miR5048-5p UUUGCAGGUUUUAGGUCUAAGU 22 24,345 3,478 4,329 2,901    2,948 4,329 2,901 4,026 3,716 3,310 3,115
tae-miR5049-3p AAUAUGGAUCGGAGGGAGUAC 21 0 0 0 0    0 0 0 0 0 0 0
tae-miR5050 UUGAACGACCUCACCAUGUCG 21 2 2 2 2    0 0 0 0 0 2 0
tae-miR5062-5p UGAACCUUAGGGAACAGCCGCAU 23 277 40 59 28    59 39 40 48 28 30 33
tae-miR5084 AUACAGUACUGCAGAGGAUCCUAA 24 6 2 3 1    0 1 0 1 1 3 0
tae-miR5085 AAGGACAUUUUUUGUGGCCUG 21 0 0 0 0    0 0 0 0 0 0 0
tae-miR5086 ACAUUGGUGGAAGGCGUGGUA 21 0 0 0 0    0 0 0 0 0 0 0
tae-miR5175-5p UUCCAAAUUACUCGUCGUGGU 21 294 42 80 7    7 22 16 80 45 57 67
tae-miR5200 UGUAGAUACUCCCUAAGGCUU 21 27 7 11 5    0 0 0 6 5 5 11
tae-miR530 UGCAGUGGCAUAUGCAACUCU 21 0 0 0 0    0 0 0 0 0 0 0
tae-miR531 CGCUCGCCGGAGCAGCGUGCA 21 0 0 0 0    0 0 0 0 0 0 0
tae-miR5384-3p UGAGCGCGCCGCCGUCGAAUG 21 9 3 6 1    0 0 1 0 2 6 0
tae-miR6197-5p UCUGUAAACAAAUGUAGGACG 21 171 24 35 14    27 21 35 19 14 33 22
tae-miR6201 UGACCCUGAGGCACUCAUACCG 22 3,772 539 1,054 65    65 120 169 761 621 1,054 982
tae-miR7757-5p AUAAAACCUUCAGCUAUCCAUC 22 19,160 2,737 3,558 1,978    3,392 2,156 2,602 3,558 3,471 1,978 2,003
tae-miR9652-3p AAGCUUAAUGAGAACAUGUG 20 1 1 1 1    0 0 0 0 1 0 0
tae-miR9652-5p CCUGUUUGUCAUUAAGUUUCUU 22 18 5 10 1    6 1 10 0 1 0 0
tae-miR9653a-3p UUUGAGACUUUGGCCAUGGCC 21 1,291 184 279 58    58 191 123 212 178 250 279
tae-miR9653b UGGCCAAGGUCUCUUGAGGCU 21 0 0 0 0    0 0 0 0 0 0 0
tae-miR9654a-3p UUCUGAAAGGCUUGAAGCGAAU 22 0 0 0 0    0 0 0 0 0 0 0
tae-miR9654b-3p UUCCGAAAGGCUUGAAGCGAAU 22 52 7 18 3    3 3 6 9 5 18 8
tae-miR9655-3p CAAGGGAAGGAAGUAGCCAAC 21 17 6 8 1    0 0 0 0 1 8 8
tae-miR9656-3p CUUCGAGACUCUGAACAGCGG 21 130 26 62 1    0 2 0 5 1 62 60
tae-miR9657a-3p UGUGCUUCCUCGUCGAACGGU 21 0 0 0 0    0 0 0 0 0 0 0
tae-miR9657b-3p CGUGCUUCCUCGUCGAACGGU 21 0 0 0 0    0 0 0 0 0 0 0
tae-miR9657b-5p UUCGUCGGAGAAGCAUGUUGC 21 0 0 0 0    0 0 0 0 0 0 0
tae-miR9657c-3p CGUGCUUCCUCGUCGAACGGU 21 0 0 0 0    0 0 0 0 0 0 0
tae-miR9658-3p AUCGUUCUGGGUGAAUAGGCC 21 1,411 202 303 91    234 303 284 166 233 91 100
tae-miR9659-3p UCCAAUGGUUGUUCACGGCAUC 22 2 1 1 1    1 1 0 0 0 0 0
tae-miR9660-5p UUGCGAGCAACGGAUGAAUC 20 7 2 5 1    1 0 1 0 5 0 0
tae-miR9661-5p UGAAGUAGAGCAGGGACCUCA 21 15 3 5 1    4 1 0 0 2 5 3
tae-miR9662a-3p UUGAACAUCCCAGAGCCACCG 21 30,770 4,396 6,684 2,680    3,879 3,902 2,680 4,235 3,060 6,330 6,684
tae-miR9662b-3p UGAACAUCCCAGAGCCACCGG 21 6,620 946 1,134 799    1,134 973 799 900 914 827 1,073
tae-miR9663-5p AAGCGUAGUCGAACGAAUCUG 21 2,685 384 623 218    285 218 341 302 320 623 596
tae-miR9664-3p UUGCAGUCCUCGAUGUCGUAG 21 194 28 91 1    1 5 1 8 14 91 74
tae-miR9665-3p GCUAGCAGUGUAAACUCAAAUCA 23 0 0 0 0    0 0 0 0 0 0 0
tae-miR9666a-3p CGGUAGGGCUGUAUGAUGGCGA 22 240 40 122 1    1 0 2 6 5 122 104
tae-miR9666b-3p CGGUUGGGCUGUAUGAUGGCGA 22 465 66 219 3    3 6 11 26 26 219 174
tae-miR9666b-5p GCCAUCAUACGUCCAACCGUG 21 9 3 5 1    0 0 0 3 0 5 1
tae-miR9666c-5p GCCAUCAUACGUCCAACCGUG 21 9 3 5 1    0 0 0 3 0 5 1
tae-miR9667-5p AAAUAUGGCAAACAAUGAAUG 21 0 0 0 0    0 0 0 0 0 0 0
tae-miR9668-5p CCAAUGACAAGUAUUUUCGGA 21 0 0 0 0    0 0 0 0 0 0 0
tae-miR9669-5p UACUGUGGGCACUUAUUUGAC 21 3,808 544 647 411    582 647 539 411 520 534 575
tae-miR9670-3p AGGUGGAAUACUUGAAGAAGA 21 1,938 277 514 137    218 207 137 246 216 514 400
tae-miR9671-5p UGACUUUACACAACUGUCCGGC 22 6 2 3 1    0 0 0 0 1 2 3
tae-miR9672a-3p CCACGACUGUCAUUAAGCAUC 21 6,217 888 2,066 54    54 334 261 1,123 756 1,623 2,066
tae-miR9672b UACCACGACUGUCAUUAAGCA 21 144,545 20,649 56,230 648    648 3,981 1,346 26,872 19,290 36,178 56,230
tae-miR9673-5p UAAGAAGCAAAUAGCACAUG 20 12 2 3 1    1 2 2 2 2 3 0
tae-miR9674a-5p GCAUCAUCCAUCCUACCAUUC 21 0 0 0 0    0 0 0 0 0 0 0
tae-miR9674b-5p AUAGCAUCAUCCAUCCUACCC 21 5,043 720 968 525    821 641 775 774 968 525 539
tae-miR9675-3p UUUAUGAUCACUCUCGUUUUG 21 49 12 29 1    1 0 0 1 0 29 18
tae-miR9676-5p UGGAUGUCAUCGUGGCCGUACA 22 295 49 145 1    0 1 5 18 6 145 120
tae-miR9677a UGGCCGUUGGUAGAGUAGGAGA 22 5,550 793 2,865 2    2 2 3 12 5 2,865 2,661
tae-miR9677b CAGGGCGGGGAACAGGUGGCC 21 315 158 169 146    0 0 0 0 0 169 146
tae-miR9678-3p UCUGGCGAGGGACAUACACUGU 22 0 0 0 0    0 0 0 0 0 0 0
tae-miR9679-5p CAGAACCAGAAUGAGUAGCUC 21 58 8 20 2    10 2 5 7 4 20 10
tae-miR9772 UGAGAUGAGAUUACCCCAUAC 21 815 116 157 95    157 95 108 133 95 118 109
tae-miR9773 UUUGUUUUUAUGUUAUUUUGUGAA 24 665 95 192 14    14 63 46 104 96 192 150
tae-miR9774 CAAGAUAUUGGGUAUUUCUGUC 22 1 1 1 1    0 0 0 1 0 0 0
tae-miR9775 UGUGCGCAAUAAGAUUUUGCUA 22 7 2 3 1    0 0 0 3 3 0 1
tae-miR9776 UUGGACGAGGAUGUGCAACUG 21 775 111 321 4    4 10 13 72 47 321 308
tae-miR9777 AGCAAACAUAUCUGAGCACA 20 18 3 5 1    5 2 1 4 5 0 1
tae-miR9778 UGCAUCAUCUCGAACUCGUCG 21 2 2 2 2    2 0 0 0 0 0 0
tae-miR9779 CUUAUGCAACGUCUGAGGAU 20 0 0 0 0    0 0 0 0 0 0 0
tae-miR9780 CGGGUCGGCGCUGCACGCGGC 21 0 0 0 0    0 0 0 0 0 0 0
tae-miR9781 UUUUGUCACAUAUAAUACAUA 21 0 0 0 0    0 0 0 0 0 0 0
tae-miR9782 GUAUUAGGUUGGUCAAAUUGACGA 24 68 11 18 4    0 4 8 16 12 18 10
tae-miR9783 AUAAGCACCGGUGCUUAAGAA 21 0 0 0 0    0 0 0 0 0 0 0