Bread Wheat Small RNA miRNA Abundances

The data below are based on the microRNAs listed in the miRBase registry. Adjust libraries/reads to display on the control panel.


        miRNA         miRNA sequence Len Sum (norm) Average Max Min (>0)  Tae_DR2Tae_FM1Tae_FM2Tae_AM1Tae_AM2Tae_TS1Tae_TS2
tae-miR10516 UCCUCUGCAGUCGACUGC 18 0 0 0 0    0 0 0 0 0 0 0
tae-miR10517 ACAUUCAGUCAUUGACAU 18 0 0 0 0    0 0 0 0 0 0 0
tae-miR10518 AAGAGAUUUUGAAGGGAU 18 0 0 0 0    0 0 0 0 0 0 0
tae-miR10519 UGUCAAAAGUUGGAUAUU 18 0 0 0 0    0 0 0 0 0 0 0
tae-miR10520 CUUGGAUGAGAACAUGGCAU 20 0 0 0 0    0 0 0 0 0 0 0
tae-miR10521 UUCGUUUUUUAUAGGAUGG 19 0 0 0 0    0 0 0 0 0 0 0
tae-miR1117 UAGUACCGGUUCGUGGCACGAACC 24 4 1 2 1    0 1 2 0 1 0 0
tae-miR1118 CACUACAUUAUGGAAUGGAGGGA 23 0 0 0 0    0 0 0 0 0 0 0
tae-miR1119 UGGCACGGCGUGAUGCUGAGUCAG 24 0 0 0 0    0 0 0 0 0 0 0
tae-miR1120a ACAUUCUUAUAUUAUGAGACGGAG 24 0 0 0 0    0 0 0 0 0 0 0
tae-miR1120b-3p UUCUUAUAUUGUGGGACAGAG 21 143 20 36 10    10 21 36 14 16 21 25
tae-miR1120c-5p UAAUAUAAGAACGUUUUUGAC 21 54 8 17 4    0 6 4 16 6 17 5
tae-miR1121 AGUAGUGAUCUAAACGCUCUUA 22 0 0 0 0    0 0 0 0 0 0 0
tae-miR1122a UAGAUACAUCCGUAUCUAGA 20 0 0 0 0    0 0 0 0 0 0 0
tae-miR1122b-3p AGACUUAUAUGUAGGAACGGA 21 7 1 3 1    1 1 1 0 3 0 1
tae-miR1122c-3p UCUAAUAUUAUGGGACGGAGG 21 170 24 33 15    18 33 27 15 29 17 31
tae-miR1123 UCCGUGAGACCUGGUCUCAUAGA 23 0 0 0 0    0 0 0 0 0 0 0
tae-miR1124 GCAGGACGUGAAGAGCGAGUCC 22 0 0 0 0    0 0 0 0 0 0 0
tae-miR1125 AACCAACGAGACCAACUGCGGCGG 24 0 0 0 0    0 0 0 0 0 0 0
tae-miR1127a UCCUUCCGUUCGGAAUUAC 19 0 0 0 0    0 0 0 0 0 0 0
tae-miR1127b-3p ACAAGUAUUUCUGGACGGAGG 21 37 5 9 2    5 9 2 6 8 4 3
tae-miR1128 UACUACUCCCUCCGUCCGAAA 21 0 0 0 0    0 0 0 0 0 0 0
tae-miR1129 CAGCGAGCCAGCGGAGACCGGCAG 24 0 0 0 0    0 0 0 0 0 0 0
tae-miR1130a CCUCCGUCUCGUAAUGUAAGACG 23 0 0 0 0    0 0 0 0 0 0 0
tae-miR1130b-3p UCUUAUAUUAUGGGACGGAGG 21 1,847 264 333 171    171 333 327 202 270 260 284
tae-miR1131 UAGUACCGGUUCGUGGCUAACC 22 0 0 0 0    0 0 0 0 0 0 0
tae-miR1133 CAUAUACUCCCUCCGUCCGAAA 22 0 0 0 0    0 0 0 0 0 0 0
tae-miR1134 CAACAACAACAAGAAGAAGAAGAU 24 0 0 0 0    0 0 0 0 0 0 0
tae-miR1135 CUGCGACAAGUAAUUCCGAACGGA 24 218 31 44 18    26 34 44 44 27 25 18
tae-miR1136 UUGUCGCAGGUAUGGAUGUAUCUA 24 8 1 3 1    3 1 0 0 3 1 0
tae-miR1137a UAGUACAAAGUUGAGUCAUC 20 0 0 0 0    0 0 0 0 0 0 0
tae-miR1137b-5p UCCGUUCCAGAAUAGAUGACC 21 203 29 36 22    22 36 30 25 33 32 25
tae-miR1138 GCUUAGAUGUGACAUCCUUAAAA 23 0 0 0 0    0 0 0 0 0 0 0
tae-miR1139 AGAGUAACAUACACUAGUAACA 22 0 0 0 0    0 0 0 0 0 0 0
tae-miR156 UGACAGAAGAGAGUGAGCACA 21 17 2 8 2    0 2 0 0 0 7 8
tae-miR159a UUUGGAUUGAAGGGAGCUCUG 21 507,347 72,478 118,976 28,501    118,976 97,121 94,637 51,504 86,985 28,501 29,623
tae-miR159b UUUGGAUUGAAGGGAGCUCUG 21 507,347 72,478 118,976 28,501    118,976 97,121 94,637 51,504 86,985 28,501 29,623
tae-miR160 UGCCUGGCUCCCUGUAUGCCA 21 1,607 230 500 142    239 500 226 144 142 163 193
tae-miR164 UGGAGAAGCAGGGCACGUGCA 21 759 108 196 39    104 158 196 101 114 47 39
tae-miR167a UGAAGCUGCCAGCAUGAUCUA 21 25,817 3,688 7,978 628    7,978 3,081 7,570 2,162 3,643 755 628
tae-miR167b UGAAGCUGACAGCAUGAUCUA 21 11 2 6 1    6 0 1 1 0 3 0
tae-miR167c-5p UGAAGCUGCCAGCAUGAUCUGC 22 340 49 160 1    6 7 1 4 6 160 156
tae-miR169 GGGCAAGUCACCCUGGGCUACC 22 0 0 0 0    0 0 0 0 0 0 0
tae-miR171a UGAUUGAGCCGUGCCAAUAUC 21 140 20 45 9    10 9 16 22 12 45 26
tae-miR171b UUGAGCCGUGCCAAUAUCACG 21 195 28 89 2    2 2 6 9 3 84 89
tae-miR1847-5p ACCUGCAGUUGGGCCAAUGAC 21 6 1 2 1    1 0 1 2 2 0 0
tae-miR2275-3p UUUGGUUUCCUCCAAUAUCUCG 22 1 0 1 1    0 0 0 0 0 1 0
tae-miR319 UUGGACUGAAGGGAGCUCCCU 21 640 91 178 19    178 150 149 40 64 40 19
tae-miR395a GUGAAGUGUUUGGGGGAACUC 21 8 1 4 1    1 2 4 0 0 0 1
tae-miR395b UGAAGUGUUUGGGGGAACUC 20 229 33 55 7    29 15 55 7 39 40 44
tae-miR396-5p AACUGUGAACUCGCGGGGAUG 21 4 1 3 1    0 0 0 0 0 3 1
tae-miR397-5p UCACCGGCGCUGCACACAAUG 21 86 12 17 9    9 15 9 17 10 14 12
tae-miR398 UGUGUUCUCAGGUCGCCCCCG 21 18 3 10 8    0 0 0 0 0 10 8
tae-miR399 UGCCAAAGGAGAAUUGCCC 19 0 0 0 0    0 0 0 0 0 0 0
tae-miR408 CUGCACUGCCUCUUCCCUGGC 21 0 0 0 0    0 0 0 0 0 0 0
tae-miR444a UUGCUGCCUCAAGCUUGCUGC 21 0 0 0 0    0 0 0 0 0 0 0
tae-miR444b UUGCUGCCUCAAGCUUGCUGC 21 0 0 0 0    0 0 0 0 0 0 0
tae-miR5048-5p UUUGCAGGUUUUAGGUCUAAGU 22 30,368 4,338 6,662 2,899    4,664 6,662 4,547 4,128 4,445 3,023 2,899
tae-miR5049-3p AAUAUGGAUCGGAGGGAGUAC 21 0 0 0 0    0 0 0 0 0 0 0
tae-miR5050 UUGAACGACCUCACCAUGUCG 21 1 0 1 1    0 0 0 0 0 1 0
tae-miR5062-5p UGAACCUUAGGGAACAGCCGCAU 23 358 51 94 28    94 60 63 49 33 28 31
tae-miR5084 AUACAGUACUGCAGAGGAUCCUAA 24 6 1 3 1    0 1 0 1 1 3 0
tae-miR5085 AAGGACAUUUUUUGUGGCCUG 21 0 0 0 0    0 0 0 0 0 0 0
tae-miR5086 ACAUUGGUGGAAGGCGUGGUA 21 0 0 0 0    0 0 0 0 0 0 0
tae-miR5175-5p UUCCAAAUUACUCGUCGUGGU 21 319 46 82 11    11 33 25 82 54 52 62
tae-miR5200 UGUAGAUACUCCCUAAGGCUU 21 26 4 10 4    0 0 0 6 6 4 10
tae-miR530 UGCAGUGGCAUAUGCAACUCU 21 0 0 0 0    0 0 0 0 0 0 0
tae-miR531 CGCUCGCCGGAGCAGCGUGCA 21 0 0 0 0    0 0 0 0 0 0 0
tae-miR5384-3p UGAGCGCGCCGCCGUCGAAUG 21 9 1 6 1    0 0 1 0 2 6 0
tae-miR6197-5p UCUGUAAACAAAUGUAGGACG 21 217 31 54 17    43 32 54 20 17 30 21
tae-miR6201 UGACCCUGAGGCACUCAUACCG 22 3,952 565 963 103    103 185 265 780 742 963 914
tae-miR7757-5p AUAAAACCUUCAGCUAUCCAUC 22 24,231 3,462 5,365 1,806    5,365 3,317 4,078 3,648 4,152 1,806 1,865
tae-miR9652-3p AAGCUUAAUGAGAACAUGUG 20 1 0 1 1    0 0 0 0 1 0 0
tae-miR9652-5p CCUGUUUGUCAUUAAGUUUCUU 22 27 4 16 1    9 1 16 0 1 0 0
tae-miR9653a-3p UUUGAGACUUUGGCCAUGGCC 21 1,497 214 293 93    93 293 193 217 213 229 259
tae-miR9653b UGGCCAAGGUCUCUUGAGGCU 21 0 0 0 0    0 0 0 0 0 0 0
tae-miR9654a-3p UUCUGAAAGGCUUGAAGCGAAU 22 0 0 0 0    0 0 0 0 0 0 0
tae-miR9654b-3p UUCCGAAAGGCUUGAAGCGAAU 22 60 9 17 5    5 5 10 9 6 17 8
tae-miR9655-3p CAAGGGAAGGAAGUAGCCAAC 21 16 2 8 1    0 0 0 0 1 7 8
tae-miR9656-3p CUUCGAGACUCUGAACAGCGG 21 120 17 56 1    0 2 0 5 1 56 56
tae-miR9657a-3p UGUGCUUCCUCGUCGAACGGU 21 0 0 0 0    0 0 0 0 0 0 0
tae-miR9657b-3p CGUGCUUCCUCGUCGAACGGU 21 0 0 0 0    0 0 0 0 0 0 0
tae-miR9657b-5p UUCGUCGGAGAAGCAUGUUGC 21 0 0 0 0    0 0 0 0 0 0 0
tae-miR9657c-3p CGUGCUUCCUCGUCGAACGGU 21 0 0 0 0    0 0 0 0 0 0 0
tae-miR9658-3p AUCGUUCUGGGUGAAUAGGCC 21 1,907 272 467 83    370 467 445 170 279 83 93
tae-miR9659-3p UCCAAUGGUUGUUCACGGCAUC 22 2 0 1 1    1 1 0 0 0 0 0
tae-miR9660-5p UUGCGAGCAACGGAUGAAUC 20 9 1 6 1    2 0 1 0 6 0 0
tae-miR9661-5p UGAAGUAGAGCAGGGACCUCA 21 16 2 6 1    6 1 0 0 2 4 3
tae-miR9662a-3p UUGAACAUCCCAGAGCCACCG 21 36,347 5,192 6,221 3,661    6,137 6,005 4,200 4,342 3,661 5,781 6,221
tae-miR9662b-3p UGAACAUCCCAGAGCCACCGG 21 8,313 1,188 1,793 755    1,793 1,498 1,252 923 1,094 755 998
tae-miR9663-5p AAGCGUAGUCGAACGAAUCUG 21 3,137 448 569 310    451 335 535 310 382 569 555
tae-miR9664-3p UUGCAGUCCUCGAUGUCGUAG 21 187 27 83 1    2 7 1 8 17 83 69
tae-miR9665-3p GCUAGCAGUGUAAACUCAAAUCA 23 0 0 0 0    0 0 0 0 0 0 0
tae-miR9666a-3p CGGUAGGGCUGUAUGAUGGCGA 22 226 32 112 1    1 0 4 6 6 112 97
tae-miR9666b-3p CGGUUGGGCUGUAUGAUGGCGA 22 451 64 200 5    5 9 17 27 31 200 162
tae-miR9666b-5p GCCAUCAUACGUCCAACCGUG 21 8 1 4 1    0 0 0 3 0 4 1
tae-miR9666c-5p GCCAUCAUACGUCCAACCGUG 21 8 1 4 1    0 0 0 3 0 4 1
tae-miR9667-5p AAAUAUGGCAAACAAUGAAUG 21 0 0 0 0    0 0 0 0 0 0 0
tae-miR9668-5p CCAAUGACAAGUAUUUUCGGA 21 0 0 0 0    0 0 0 0 0 0 0
tae-miR9669-5p UACUGUGGGCACUUAUUUGAC 21 4,828 690 995 422    921 995 845 422 622 488 535
tae-miR9670-3p AGGUGGAAUACUUGAAGAAGA 21 2,232 319 470 215    345 318 215 253 259 470 372
tae-miR9671-5p UGACUUUACACAACUGUCCGGC 22 5 1 3 1    0 0 0 0 1 1 3
tae-miR9672a-3p CCACGACUGUCAUUAAGCAUC 21 6,469 924 1,923 86    86 514 408 1,151 905 1,482 1,923
tae-miR9672b UACCACGACUGUCAUUAAGCA 21 145,266 20,752 52,337 1,025    1,025 6,126 2,110 27,549 23,076 33,043 52,337
tae-miR9673-5p UAAGAAGCAAAUAGCACAUG 20 13 2 3 2    2 2 2 2 2 3 0
tae-miR9674a-5p GCAUCAUCCAUCCUACCAUUC 21 0 0 0 0    0 0 0 0 0 0 0
tae-miR9674b-5p AUAGCAUCAUCCAUCCUACCC 21 6,432 919 1,299 479    1,299 987 1,214 793 1,158 479 502
tae-miR9675-3p UUUAUGAUCACUCUCGUUUUG 21 45 6 26 1    1 0 0 1 0 26 17
tae-miR9676-5p UGGAUGUCAUCGUGGCCGUACA 22 279 40 132 1    0 1 7 19 8 132 112
tae-miR9677a UGGCCGUUGGUAGAGUAGGAGA 22 5,121 732 2,616 2    3 2 5 13 6 2,616 2,476
tae-miR9677b CAGGGCGGGGAACAGGUGGCC 21 290 41 154 136    0 0 0 0 0 154 136
tae-miR9678-3p UCUGGCGAGGGACAUACACUGU 22 0 0 0 0    0 0 0 0 0 0 0
tae-miR9679-5p CAGAACCAGAAUGAGUAGCUC 21 64 9 18 2    16 2 7 7 5 18 9
tae-miR9772 UGAGAUGAGAUUACCCCAUAC 21 1,025 146 249 101    249 147 170 137 114 107 101
tae-miR9773 UUUGUUUUUAUGUUAUUUUGUGAA 24 729 104 175 23    23 97 73 106 115 175 140
tae-miR9774 CAAGAUAUUGGGUAUUUCUGUC 22 1 0 1 1    0 0 0 1 0 0 0
tae-miR9775 UGUGCGCAAUAAGAUUUUGCUA 22 7 1 3 1    0 0 0 3 3 0 1
tae-miR9776 UUGGACGAGGAUGUGCAACUG 21 753 108 293 6    6 16 21 74 56 293 287
tae-miR9777 AGCAAACAUAUCUGAGCACA 20 22 3 8 1    8 2 1 4 6 0 1
tae-miR9778 UGCAUCAUCUCGAACUCGUCG 21 3 0 3 3    3 0 0 0 0 0 0
tae-miR9779 CUUAUGCAACGUCUGAGGAU 20 0 0 0 0    0 0 0 0 0 0 0
tae-miR9780 CGGGUCGGCGCUGCACGCGGC 21 0 0 0 0    0 0 0 0 0 0 0
tae-miR9781 UUUUGUCACAUAUAAUACAUA 21 0 0 0 0    0 0 0 0 0 0 0
tae-miR9782 GUAUUAGGUUGGUCAAAUUGACGA 24 75 11 17 6    0 6 12 17 14 17 9
tae-miR9783 AUAAGCACCGGUGCUUAAGAA 21 0 0 0 0    0 0 0 0 0 0 0