Tomato Small RNA miRNA Abundances

The data below are based on the microRNAs listed in the Sanger registry. Adjust libraries/reads to display on the control panel.


        miRNA         miRNA sequence Len Sum (norm) Average Max Min (>0)  SLY1SLY2SLY3sly_1sly_2sly_3sly_4sly_5sly_6sly_7sly_8sly_9sly_10sly_11sly_12sly_13sly_14sly_15sly_16sly_17sly_18
sly-miR10528 AAUGCAAUGUCAUAUACCAUC 21 1,707 81 248 20    248 115 76 64 68 56 78 44 81 93 83 40 108 95 56 132 50 62 68 20 70
sly-miR10529 AACGAGUGAGACUUGCUCAGUUGG 24 101,138 4,816 7,999 4    4 39 12 3,991 4,184 3,623 3,862 3,807 4,328 6,654 7,364 7,999 7,164 6,831 5,070 5,648 5,734 6,848 4,964 5,063 7,949
sly-miR10530 ACGUCCCUUCCCCAUCGUUCAACA 24 1,943 93 203 4    4 12 12 166 104 116 111 95 146 113 97 115 140 203 103 37 85 34 97 110 43
sly-miR10531 UGGGGUCCUAGUAGAGUCGGUUC 23 112 5 45 1    7 45 34 4 3 4 3 4 0 1 1 0 0 3 0 0 0 0 0 0 3
sly-miR10532 AAGUGUGUCUCUGAGAUUUCGGGC 24 3,725 177 296 104    104 126 164 263 221 229 296 227 230 175 196 192 207 192 169 129 105 112 125 158 105
sly-miR10533 UCUUAUGAAUUCUAGGUCUUCU 22 214 10 35 3    7 12 35 23 10 12 18 8 24 10 3 6 11 9 10 3 0 5 4 0 4
sly-miR10534 CAAAAUACCCUUGUCAUCCAA 21 34 2 6 1    0 6 3 5 2 3 2 0 4 1 1 0 5 0 2 0 0 0 0 0 0
sly-miR10535a UUGGCAUAAGUUUGUGAAAGCCGG 24 2,246 107 1,017 20    104 280 1,017 23 22 20 37 24 42 75 116 62 62 52 43 48 32 39 40 51 57
sly-miR10535b UUGGCAUGAGUUUGUGAAAGCCGG 24 386 18 291 1    39 36 291 2 0 0 0 1 1 4 1 0 3 0 0 3 0 0 4 0 1
sly-miR10536 AGACAUGUUCUAAUCGUCAGCUUC 24 19 1 3 1    3 1 3 2 0 3 2 0 0 0 1 0 0 0 2 0 0 2 0 0 0
sly-miR10537 AUUUACCCCAAGUUCGUUGUC 21 726 35 145 5    48 73 145 36 40 38 37 52 44 25 20 18 13 20 45 20 12 5 8 6 21
sly-miR10538 AGAUUGAUAUACGUUACUCACAGU 24 778 37 67 6    47 67 38 42 66 65 48 56 58 33 41 23 51 43 41 8 17 9 8 11 6
sly-miR10539 CUUGGAACCACAGUUACCACC 21 11 1 5 1    0 0 0 0 2 3 5 0 1 0 0 0 0 0 0 0 0 0 0 0 0
sly-miR10540 AUAAUAACUAUUAGUUGAAUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
sly-miR10541 AGUCACUUUGAUGAUUGUCAAACA 24 42 2 6 1    3 4 6 1 1 2 0 3 0 3 4 3 3 0 2 2 2 0 0 3 0
sly-miR10542 UAGAAGAAUCAUAUAUACCCCUA 23 20 1 5 1    1 0 1 0 1 0 0 0 0 0 1 1 5 3 2 2 0 0 0 3 0
sly-miR156a UUGACAGAAGAUAGAGAGCAC 21 409,834 19,516 319,991 262    319,991 33,409 13,194 4,797 4,826 4,005 4,509 4,774 5,070 2,066 1,654 1,472 1,866 1,816 3,308 689 484 395 551 262 696
sly-miR156b UUGACAGAAGAUAGAGAGCAC 21 409,834 19,516 319,991 262    319,991 33,409 13,194 4,797 4,826 4,005 4,509 4,774 5,070 2,066 1,654 1,472 1,866 1,816 3,308 689 484 395 551 262 696
sly-miR156c UUGACAGAAGAUAGAGAGCAC 21 409,834 19,516 319,991 262    319,991 33,409 13,194 4,797 4,826 4,005 4,509 4,774 5,070 2,066 1,654 1,472 1,866 1,816 3,308 689 484 395 551 262 696
sly-miR156d-3p GCUCACUGCUCUAUCUGUCACC 22 252 12 46 2    0 0 0 0 5 0 2 6 3 16 24 17 13 46 8 8 12 11 36 31 14
sly-miR156d-5p UGACAGAAGAGAGUGAGCAC 20 22,288 1,061 12,067 18    12,067 4,474 880 18 26 19 51 37 24 449 581 317 492 415 180 436 309 344 366 436 367
sly-miR156e-3p GCUUACUCUCUAUCUGUCACC 21 2,800 133 437 1    0 0 0 0 0 1 3 0 0 90 83 218 56 135 49 282 352 420 362 312 437
sly-miR156e-5p UGAUAGAAGAGAGUGAGCAC 20 4,296 205 591 1    12 118 195 1 3 0 5 3 0 211 156 287 35 132 67 474 534 463 531 478 591
sly-miR159 UUUGGAUUGAAGGGAGCUCUA 21 43,580 2,075 4,711 461    1,420 695 1,483 4,711 2,718 4,406 3,627 2,866 4,111 1,845 1,104 3,003 3,371 1,137 2,139 1,693 479 461 945 611 755
sly-miR159b UUGGAAAGAAGGGAGCUCUAC 21 10,951 521 2,204 2    0 65 0 14 2 0 8 4 0 138 102 299 62 120 60 1,469 1,571 1,378 2,128 2,204 1,327
sly-miR160a UGCCUGGCUCCCUGUAUGCCA 21 4,064 194 973 10    10 57 10 62 43 73 81 58 76 75 67 185 83 175 62 205 317 246 973 946 260
sly-miR162 UCGAUAAACCUCUGCAUCCAG 21 116,349 5,540 11,189 2,460    6,072 2,460 3,264 3,013 2,555 3,090 3,247 2,605 3,451 5,629 5,550 5,890 5,419 5,158 3,957 8,310 8,380 7,896 9,437 11,189 9,777
sly-miR164a-3p CAUGUGCCUGUUUUCCCCAUC 21 463 22 87 1    0 6 13 2 1 3 6 8 4 36 12 8 24 34 21 87 32 16 84 23 43
sly-miR164a-5p UGGAGAAGCAGGGCACGUGCA 21 40,202 1,914 15,405 90    182 7,605 15,405 203 112 141 239 90 154 1,121 653 331 1,223 896 530 2,895 1,222 846 3,049 1,818 1,487
sly-miR164b-3p CACGUGUUCUCCUUCUCCAAC 21 185 9 32 4    0 0 0 32 21 21 21 14 25 4 8 8 5 9 11 0 0 0 0 6 0
sly-miR164b-5p UGGAGAAGCAGGGCACGUGCA 21 40,202 1,914 15,405 90    182 7,605 15,405 203 112 141 239 90 154 1,121 653 331 1,223 896 530 2,895 1,222 846 3,049 1,818 1,487
sly-miR166a UCGGACCAGGCUUCAUUCCCC 21 511,981 24,380 203,147 675    203,147 101,076 182,694 958 679 899 1,120 675 976 1,020 770 1,200 1,392 1,312 811 1,649 1,826 1,759 3,174 3,062 1,782
sly-miR166b UCGGACCAGGCUUCAUUCCCC 21 511,981 24,380 203,147 675    203,147 101,076 182,694 958 679 899 1,120 675 976 1,020 770 1,200 1,392 1,312 811 1,649 1,826 1,759 3,174 3,062 1,782
sly-miR166c-3p UCGGACCAGGCUUCAUUCCUC 21 235,110 11,196 160,223 588    49,112 160,223 7,902 800 588 848 990 602 937 1,262 649 927 1,457 1,469 1,096 1,411 738 723 1,509 782 1,085
sly-miR166c-5p GGGAUGUUGUCUGGCUCGACA 21 494 24 73 1    1 13 1 52 45 73 38 31 34 43 24 39 13 23 17 2 5 14 4 8 14
sly-miR167a UGAAGCUGCCAGCAUGAUCUA 21 109,861 5,231 11,962 124    7,054 11,962 124 3,517 2,773 4,434 4,456 2,592 4,376 7,133 5,427 3,620 10,473 7,499 4,633 8,653 3,619 3,292 4,751 3,439 6,034
sly-miR167b-3p AGGUCAUCUAGCAGCUUCAAU 21 23 1 12 1    4 0 12 0 1 0 0 1 1 1 0 0 3 0 0 0 0 0 0 0 0
sly-miR167b-5p UAAAGCUGCCAGCAUGAUCUGG 22 2,081 99 320 4    36 0 22 239 171 135 320 282 197 115 90 62 38 66 270 7 5 5 4 6 11
sly-miR168a-3p CCUGCCUUGCAUCAACUGAAU 21 477 23 49 3    6 3 12 14 18 16 10 18 20 29 35 36 16 49 16 25 47 27 32 28 20
sly-miR168a-5p UCGCUUGGUGCAGGUCGGGAC 21 36,413 1,734 12,696 335    12,696 2,297 2,170 510 335 367 489 442 441 880 938 906 960 813 498 1,246 1,519 1,239 2,538 3,726 1,403
sly-miR168b-3p CCCGCCUUGCAUCAACUGAAU 21 685 33 54 12    20 27 12 20 26 25 29 21 41 37 46 50 54 37 16 39 37 48 44 39 17
sly-miR168b-5p UCGCUUGGUGCAGGUCGGGAC 21 36,413 1,734 12,696 335    12,696 2,297 2,170 510 335 367 489 442 441 880 938 906 960 813 498 1,246 1,519 1,239 2,538 3,726 1,403
sly-miR169a CAGCCAAGGAUGACUUGCCGG 21 928 44 184 3    0 21 3 113 73 98 88 48 184 37 37 22 43 26 59 19 15 18 4 3 17
sly-miR169b UAGCCAAGGAUGACUUGCCUG 21 357 17 48 4    0 4 7 30 16 8 19 8 23 23 14 6 19 20 21 48 20 11 24 11 25
sly-miR169c CAGCCAAGGAUGACUUGCCGA 21 47 2 9 1    0 0 0 1 4 4 3 8 3 4 3 0 3 9 5 0 0 0 0 0 0
sly-miR169d UAGCCAAGGAUGACUUGCCUA 21 18 1 5 1    0 0 0 1 0 0 2 0 0 3 5 3 0 0 0 2 2 0 0 0 0
sly-miR169e-3p UGGCAAGCAUCUUUGGCGACU 21 182 9 94 1    1 94 10 4 3 4 2 3 1 0 1 3 5 3 2 15 5 7 12 6 1
sly-miR169e-5p UAGCCAAGGAUGACUUGCCUUU 22 10 0 3 1    0 0 0 0 2 0 2 0 0 0 0 0 0 0 0 3 0 2 0 0 1
sly-miR169f UAGGCGUUGUCUGAGGCUAAC 21 772 37 87 14    0 40 20 22 21 43 41 14 41 27 27 19 48 26 32 87 27 48 80 53 56
sly-miR171a UGAUUGAGCCGUGCCAAUAUC 21 10,265 489 1,380 1    42 211 1 1,025 753 875 863 529 1,380 584 360 643 564 438 617 324 175 141 330 152 258
sly-miR171b-3p UUGAGCCGUGCCAAUAUCACG 21 270 13 31 3    15 3 0 12 18 25 30 13 31 13 11 17 13 14 29 12 7 0 0 0 7
sly-miR171b-5p AUAUUGGUGCGGUUCAAUUAG 21 117 6 17 1    1 3 0 10 4 8 5 8 8 9 7 3 11 17 8 3 0 2 4 3 3
sly-miR171c UAUUGGUGCGGUUCAAUGAGA 21 76 4 9 1    3 9 3 6 2 9 2 6 8 4 4 0 5 0 5 2 0 0 4 3 1
sly-miR171d UUGAGCCGCGCCAAUAUCAC 20 13 1 3 1    0 0 0 1 1 1 0 3 1 3 1 0 0 0 0 2 0 0 0 0 0
sly-miR171e UUGAGCCGCGUCAAUAUCUCU 21 263 13 51 1    51 4 35 0 2 3 2 1 1 1 3 7 16 0 2 27 7 11 24 28 38
sly-miR171f UAUUGGCCUGGUUCACUCAGA 21 1,277 61 171 11    0 25 0 85 78 146 121 73 171 69 50 81 81 52 103 32 22 11 40 17 20
sly-miR172a AGAAUCUUGAUGAUGCUGCAU 21 24,314 1,158 6,505 158    6,505 3,213 6,043 606 387 287 517 376 346 706 524 433 925 679 484 689 337 322 382 158 395
sly-miR172b AGAAUCUUGAUGAUGCUGCAU 21 24,314 1,158 6,505 158    6,505 3,213 6,043 606 387 287 517 376 346 706 524 433 925 679 484 689 337 322 382 158 395
sly-miR172c AGAAUCUUGAUGAUGCUGCAG 21 100,405 4,781 14,225 3    3 2,767 6 3,208 1,943 2,422 3,347 1,943 1,827 7,674 6,168 3,190 12,865 7,613 3,377 14,225 6,093 5,135 5,829 2,766 8,004
sly-miR172d GGAAUCUUGAUGAUGCUGCAG 21 83,848 3,993 10,965 25    25 809 26 655 377 577 571 555 293 5,087 4,417 4,784 6,865 5,370 1,937 10,965 8,952 8,017 8,009 6,174 9,383
sly-miR1916 AUUUCACUUAGACACCUCAA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
sly-miR1917 AUUAAUAAAGAGUGCUAAAGU 21 1 0 1 1    0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
sly-miR1918 UGUUGGUGAGAGUUCGAUUCUC 22 376 18 32 6    0 0 0 25 16 14 25 10 17 23 23 29 30 29 22 32 12 16 20 6 27
sly-miR1919a ACGAGAGUCAUCUGUGACAGG 21 1,340 64 160 16    38 33 16 25 21 34 29 37 30 42 30 61 24 54 45 115 125 121 149 160 151
sly-miR1919b ACGAGAGUCAUCUGUGACAGG 21 1,340 64 160 16    38 33 16 25 21 34 29 37 30 42 30 61 24 54 45 115 125 121 149 160 151
sly-miR1919c-3p ACGAGAGUCAUCUGUGACAGG 21 1,340 64 160 16    38 33 16 25 21 34 29 37 30 42 30 61 24 54 45 115 125 121 149 160 151
sly-miR1919c-5p UGUCGCAGAUGACUUUCGCCC 21 25,610 1,220 2,002 785    1,541 1,351 2,002 1,230 1,200 1,101 1,351 1,255 1,490 1,064 961 854 1,513 1,074 1,078 931 900 785 1,525 1,311 1,093
sly-miR319a CUUGGACUGAAGGGAGCUCC 20 121 6 39 1    0 0 0 2 0 1 2 0 3 1 3 1 3 3 2 5 10 7 28 39 11
sly-miR319b UUGGACUGAAGGGAGCUCCCU 21 52,901 2,519 11,924 12    0 12 0 854 566 1,035 866 564 761 1,057 1,061 920 1,266 957 732 5,252 6,178 6,262 6,364 11,924 6,270
sly-miR319c-3p UUGGACUGAAGGGAGCUCCUU 21 17,942 854 1,492 1    4 3 1 1,226 1,064 1,096 1,286 1,290 1,492 773 755 651 978 713 1,150 1,007 733 757 809 1,016 1,138
sly-miR319c-5p AGAGCUUCCUUCAGCCCACUC 21 104 5 13 1    0 0 0 6 2 9 6 3 7 10 5 1 11 0 13 2 7 2 8 8 4
sly-miR319d AGGAAACUGUUUAGUCCAACC 21 3,026 144 2,128 1    1 2,128 1 0 0 0 0 0 0 15 10 6 19 23 5 301 140 64 137 65 111
sly-miR390a-3p CGCUAUCCAUCCUGAGUUUUA 21 211 10 25 3    0 0 0 20 14 19 22 21 25 13 5 8 13 9 10 5 7 5 8 3 4
sly-miR390a-5p AAGCUCAGGAGGGAUAGCACC 21 1,875 89 452 31    452 173 91 73 68 105 80 87 100 47 31 58 38 37 67 75 47 62 72 45 67
sly-miR390b-3p CGCUAUCCAUCCUGAGUUUCA 21 350 17 82 3    0 25 0 15 7 8 8 4 6 6 3 11 0 3 5 82 27 34 40 25 41
sly-miR390b-5p AAGCUCAGGAGGGAUAGCGCC 21 7,708 367 3,012 12    51 3,012 12 63 51 90 59 60 51 56 14 87 78 66 60 958 491 411 881 608 549
sly-miR391 ACGCAGGAGAGAUGAUGCUGGA 22 7,770 370 5,528 3    5,528 1,551 540 30 3 18 16 14 14 9 5 7 5 3 6 8 0 0 4 6 3
sly-miR393 AUCAUGCGAUCUCUUCGGAAU 21 318 15 274 1    274 22 0 0 0 3 2 3 0 4 3 0 0 0 0 2 2 2 0 0 1
sly-miR394-3p AGGUGGGCAUACUGUCAACA 20 144 7 73 1    73 33 6 4 2 1 2 0 3 0 0 1 3 3 0 5 0 0 4 3 1
sly-miR394-5p UUGGCAUUCUGUCCACCUCC 20 7,159 341 782 53    376 436 53 441 298 423 501 317 345 485 408 308 782 484 364 402 107 105 197 93 234
sly-miR395a CUGAAGUGUUUGGGGGAACUCC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
sly-miR395b CUGAAGUGUUUGGGGGAACUCC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
sly-miR396a-3p GUUCAAUAAAGCUGUGGGAAG 21 11,825 563 1,905 34    346 446 454 47 36 34 68 49 66 226 156 326 207 275 89 1,382 1,427 1,389 1,609 1,905 1,288
sly-miR396a-5p UUCCACAGCUUUCUUGAACUG 21 145,411 6,924 17,144 904    2,243 904 6,336 3,117 2,916 2,117 4,088 2,887 3,047 8,966 7,918 5,659 11,752 9,102 5,659 17,144 9,625 9,061 10,954 8,052 13,864
sly-miR396b UUCCACAGCUUUCUUGAACUU 21 37,447 1,783 4,753 548    548 598 632 1,803 1,571 1,678 2,585 1,111 1,880 2,837 2,452 1,203 4,753 3,053 1,759 2,861 1,220 1,102 1,187 811 1,803
sly-miR397-3p UCAACGCUAAACUCGAUCAUG 21 274 13 82 2    69 82 20 2 2 5 3 0 6 8 4 3 13 6 10 17 0 5 12 3 4
sly-miR397-5p AUUGAGUGCAGCGUUGAUGA 20 26 1 15 1    15 1 3 0 0 1 0 1 0 0 1 0 0 0 2 0 0 2 0 0 0
sly-miR398a UAUGUUCUCAGGUCGCCCCUG 21 214 10 127 1    127 7 4 1 4 4 0 6 1 8 7 3 0 3 13 0 5 5 12 3 1
sly-miR399 UGCCAAAGGAGAGUUGCCCUA 21 47 2 16 1    0 4 16 1 0 0 2 3 4 0 1 1 3 0 2 2 2 5 0 0 1
sly-miR399b GGGCUACUCUCUAUUGGCAUG 21 326 16 300 1    300 25 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
sly-miR403-3p CUAGAUUCACGCACAAGCUCG 21 5,067 241 652 121    652 229 593 272 235 247 277 275 325 202 152 131 199 169 196 200 142 125 157 121 168
sly-miR403-5p CGUUUGUGCGUGAAUCUAACA 21 87 4 10 1    0 0 0 1 4 5 5 3 3 6 3 6 0 6 3 7 10 2 8 8 7
sly-miR408 ACGGGGACGAGCCAGAGCAUG 21 466 22 300 1    300 97 42 2 0 0 0 0 0 3 1 0 3 0 0 5 0 2 0 8 3
sly-miR477-3p AGUUCUUGUAGGGUGAGACAAC 22 8 0 3 1    0 0 0 0 1 1 0 0 3 0 0 0 0 0 0 2 0 0 0 0 1
sly-miR477-5p UGUCUCUCCCUCAAGGGCUCC 21 226 11 30 4    0 0 0 10 4 16 11 8 17 11 5 11 30 11 10 15 10 9 24 14 10
sly-miR482a UUUCCAAUUCCACCCAUUCCUA 22 76,677 3,651 7,928 15    0 30 15 7,287 5,536 5,721 6,622 6,327 7,369 4,862 3,158 3,394 4,914 4,279 7,928 2,737 1,068 1,129 1,657 929 1,715
sly-miR482b UCUUGCCUACACCGCCCAUGCC 22 22,442 1,069 3,878 21    29 21 44 1,012 526 612 573 571 752 1,122 798 884 1,629 1,793 915 1,228 1,494 1,189 3,878 2,302 1,070
sly-miR482c UCUUGCCAAUACCGCCCAUUCC 22 7,923 377 754 1    1 3 15 371 269 290 398 312 382 419 388 395 543 478 393 442 377 463 748 754 482
sly-miR482d-3p UUUCCUAUUCCACCCAUGCCAA 22 4,658 222 424 17    17 34 22 323 236 279 279 298 424 258 207 218 355 266 262 192 155 157 221 242 213
sly-miR482d-5p GGAGUGGGUGGGAUGGAAAAA 21 37 2 12 1    12 1 3 4 3 2 2 1 1 0 0 0 3 3 0 2 0 0 0 0 0
sly-miR482e-3p UCUUUCCUACUCCUCCCAUACC 22 41,922 1,996 3,806 97    106 97 136 3,228 1,993 2,234 2,941 2,008 3,194 3,037 1,935 1,869 3,806 2,916 2,966 2,275 1,115 906 2,546 1,196 1,418
sly-miR482e-5p UGUGGGUGGGGUGGAAAGAUU 21 1,381 66 107 9    15 10 9 97 59 71 84 49 93 93 39 62 105 86 72 104 42 34 105 107 45
sly-miR530 AGGUGUAGGUGUUCAUGCAGA 21 97 5 64 1    64 24 0 0 1 0 0 1 1 0 0 0 0 3 0 0 0 0 0 3 0
sly-miR5300 UCCCCAGUCCAGGCAUUCCAAC 22 11,329 539 1,295 143    452 802 143 241 295 281 299 286 295 418 534 495 914 991 329 425 536 502 1,295 1,272 524
sly-miR5302a AAACGAGGUUUGUUACUUUGG 21 16,866 803 2,493 1    0 1 0 1,840 2,285 1,981 1,958 1,998 2,493 511 491 339 390 338 1,950 32 70 62 48 6 73
sly-miR5302b-3p UUUUCAACUAUAGCAUUAUUUU 22 25,182 1,199 3,834 10    0 0 0 3,297 2,631 1,945 3,834 3,106 2,938 1,277 959 963 777 745 2,569 10 22 34 28 23 24
sly-miR5302b-5p UGAAAUGCUAUAGUUGGAAAGU 22 172,563 8,217 23,700 12    0 12 0 23,700 16,834 16,237 23,656 21,063 21,558 7,455 5,382 5,147 6,951 5,055 17,452 375 324 301 354 326 381
sly-miR5303 UUUUUGAAGAGUUCGAGCAAC 21 4 0 3 1    3 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
sly-miR5304 UCAAUGCUACAUACUCAUCCC 21 378 18 36 7    36 28 28 14 28 28 11 14 35 13 12 11 13 11 27 15 7 11 8 14 14
sly-miR6022 UGGAAGGGAGAAUAUCCAGGA 21 76,621 3,649 27,262 419    22,595 6,470 27,262 1,892 1,158 1,229 1,996 1,455 1,333 1,311 790 768 1,594 985 1,404 1,413 634 484 652 419 777
sly-miR6023 UUCCAUGAAAGAGUUUUUGGAU 22 1,363 65 519 3    519 176 285 26 19 32 37 32 40 22 8 14 11 11 30 31 15 7 28 3 17
sly-miR6024 UUUUAGCAAGAGUUGUUUUACC 22 10,522 501 880 236    569 303 307 656 560 412 880 522 573 817 706 400 667 444 552 630 264 306 257 236 461
sly-miR6025 UACCAAUAAUUGAGAUAACAUC 22 943 45 83 10    12 10 12 37 43 37 60 45 31 43 49 54 38 83 60 71 52 73 48 25 60
sly-miR6026 UUCUUGGCUAGAGUUGUAUUGC 22 4,619 220 328 59    70 59 177 132 107 148 134 93 146 327 295 240 328 281 205 314 319 297 314 310 323
sly-miR6027-3p UGAAUCCUUCGGCUAUCCAUAA 22 16,921 806 3,839 292    1,216 2,584 3,839 762 623 638 692 647 830 459 449 375 454 390 456 411 312 292 652 504 336
sly-miR6027-5p AUGGGUAGCACAAGGAUUAAUG 22 3,089 147 369 48    318 369 222 153 125 124 127 110 154 161 92 61 137 123 134 262 90 84 80 48 115
sly-miR7981a ACCCCUUUUCGGCCUACGUGGCAC 24 45 2 7 1    0 1 0 5 3 0 5 6 1 4 0 7 5 0 6 2 0 0 0 0 0
sly-miR7981b ACCCCUUUUUAGCUUACGUGGCAC 24 83 4 10 1    4 1 1 5 5 4 3 6 0 1 1 10 5 6 8 3 5 7 0 0 8
sly-miR7981c UCGAAAUCUCAGAGACACACUUAU 24 200 10 75 1    13 45 75 12 4 4 13 4 4 4 1 6 3 0 5 0 0 0 4 0 3
sly-miR7981d UCGAAAUCUCAGAGACACACUUAU 24 200 10 75 1    13 45 75 12 4 4 13 4 4 4 1 6 3 0 5 0 0 0 4 0 3
sly-miR7981e AAGUGUGUCUCUGAGAUUUCGGAU 24 112 5 12 1    10 12 6 1 6 5 8 10 4 8 4 1 5 3 8 3 2 2 0 8 6
sly-miR7981f AAGUGUGUCUCUGGAAUUUCGGGC 24 605 29 48 4    9 4 15 48 37 30 37 37 42 34 31 40 46 34 29 12 17 21 20 28 34
sly-miR827 UUAGAUGAACAUCAACAAACA 21 364 17 150 1    150 62 1 17 7 11 21 10 7 4 15 1 24 9 8 0 2 5 4 3 3
sly-miR9469-3p AUUCGGUCUUCUUAUGUGGAC 21 1 0 1 1    0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
sly-miR9469-5p CCACAUAAGAAGACCGAAUUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
sly-miR9470-3p UUUGGCUCAUGGAUUUUAGC 20 10,909 519 973 15    15 28 70 769 698 595 944 842 862 588 574 415 527 467 973 360 339 324 455 371 693
sly-miR9470-5p UGAAAUCCAUGAGCCUAAACU 21 187 9 25 1    0 0 1 11 10 11 18 17 8 11 7 6 3 9 25 14 0 5 8 8 15
sly-miR9471a-3p UUGGCUGAGUGAGCAUCACGG 21 246,448 11,736 119,246 210    83,024 37,513 119,246 451 352 379 497 388 488 387 343 261 419 306 421 489 287 210 326 293 368
sly-miR9471a-5p CAGGUGCUCACUCAGCUAAUA 21 329 16 37 1    0 1 3 15 10 16 24 7 14 27 16 8 22 17 24 37 7 11 36 14 20
sly-miR9471b-3p UUGGCUGAGUGAGCAUCACUG 21 87,654 4,174 32,150 356    31,001 12,679 32,150 766 597 665 929 623 853 763 608 560 747 596 776 869 422 356 575 462 657
sly-miR9471b-5p GAGGUGCUCACUCAGCUAAUA 21 106 5 14 1    1 0 1 6 5 9 8 3 1 5 14 4 5 9 8 3 7 5 0 6 6
sly-miR9472-3p UUCACAAUCUCUGCUGAAAAA 21 34 2 7 1    1 0 6 0 0 0 0 0 0 0 7 4 3 3 0 2 2 2 0 0 4
sly-miR9472-5p UUUCAGUAGACGUUGUGAAUA 21 2,455 117 1,843 1    251 165 1,843 5 1 0 0 0 1 8 14 10 11 14 14 19 15 23 28 20 13
sly-miR9473-3p AAACGAGUUCAGAUUUACAGC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
sly-miR9473-5p UGGCUGUAAAUCUAAACUCGU 21 72 3 10 1    0 0 0 5 1 4 2 1 3 1 1 3 5 3 3 7 10 9 4 6 4
sly-miR9474-3p UUUUGUUCGCAGAUACUACAGU 22 11 1 3 1    0 1 0 0 1 0 0 0 0 0 1 1 0 3 0 0 2 2 0 0 0
sly-miR9474-5p UGUAGAAGUCAUGAAUAAAAUG 22 17 1 4 1    0 0 0 1 1 4 3 0 0 1 3 1 3 0 0 0 0 0 0 0 0
sly-miR9475-3p CUACAAUGUAGAGAUCGUUUU 21 347 17 52 2    22 52 42 21 30 17 24 11 21 15 19 18 16 11 6 10 2 0 0 0 10
sly-miR9475-5p AACGAUCUCUACAUUGUAGGC 21 1,121 53 109 11    52 82 72 64 67 91 91 60 109 62 48 39 65 40 65 31 12 14 12 11 34
sly-miR9476-3p AAAAAGAUGCAGGACUAGACC 21 73 3 12 1    7 12 3 1 0 3 2 3 3 4 4 4 8 3 2 8 5 0 0 0 1
sly-miR9476-5p UCUAGUCCUGCAUCUUUUUUU 21 39 2 11 1    0 0 0 1 2 2 0 4 3 0 3 3 11 0 0 2 2 2 4 0 0
sly-miR9477-3p UUGGGAAAGGGAACAACUGAUAGU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
sly-miR9477-5p UAUCCGUUGUUCCCUUUUCCUACC 24 1 0 1 1    0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
sly-miR9478-3p UUCGAUGACAUAUUUGAGCCU 21 222 11 123 1    58 123 23 0 0 0 0 0 0 1 0 3 0 0 0 7 2 2 0 0 3
sly-miR9478-5p GCUUAAAUAUGUAGAUCGAACU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
sly-miR9479-3p GAGAAUGGUAGAGGGUCGGACC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
sly-miR9479-5p UCCAGUCCUCUACCCUUCUCCA 22 1 0 1 1    0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0