Tomato miRNA Abundances

The data below are based on the microRNAs listed in the Sanger registry. Adjust libraries/reads to display on the control panel.


        miRNA         miRNA sequence Len Sum (norm) Average Max Min (>0)  SLY1SLY2SLY3
sly-miR156a UUGACAGAAGAUAGAGAGCAC 21 245,047 81,682 214,955 8,555    214,955 21,537 8,555
sly-miR156b UUGACAGAAGAUAGAGAGCAC 21 245,047 81,682 214,955 8,555    214,955 21,537 8,555
sly-miR156c UUGACAGAAGAUAGAGAGCAC 21 245,047 81,682 214,955 8,555    214,955 21,537 8,555
sly-miR156d-3p GCUCACUGCUCUAUCUGUCACC 22 0 0 0 0    0 0 0
sly-miR156d-5p UGACAGAAGAGAGUGAGCAC 20 11,560 3,853 8,106 570    8,106 2,884 570
sly-miR156e-3p GCUUACUCUCUAUCUGUCACC 21 0 0 0 0    0 0 0
sly-miR156e-5p UGAUAGAAGAGAGUGAGCAC 20 210 70 126 8    8 76 126
sly-miR159 UUUGGAUUGAAGGGAGCUCUA 21 2,363 788 961 448    954 448 961
sly-miR160a UGCCUGGCUCCCUGUAUGCCA 21 50 17 36 7    7 36 7
sly-miR162 UCGAUAAACCUCUGCAUCCAG 21 7,781 2,594 4,079 1,586    4,079 1,586 2,116
sly-miR164a-3p CAUGUGCCUGUUUUCCCCAUC 21 13 7 9 4    0 4 9
sly-miR164a-5p UGGAGAAGCAGGGCACGUGCA 21 15,014 5,005 9,989 122    122 4,903 9,989
sly-miR164b-3p CACGUGUUCUCCUUCUCCAAC 21 0 0 0 0    0 0 0
sly-miR164b-5p UGGAGAAGCAGGGCACGUGCA 21 15,014 5,005 9,989 122    122 4,903 9,989
sly-miR166a UCGGACCAGGCUUCAUUCCCC 21 320,083 106,694 136,465 65,159    136,465 65,159 118,459
sly-miR166b UCGGACCAGGCUUCAUUCCCC 21 320,083 106,694 136,465 65,159    136,465 65,159 118,459
sly-miR166c-3p UCGGACCAGGCUUCAUUCCUC 21 141,404 47,135 103,289 5,124    32,991 103,289 5,124
sly-miR166c-5p GGGAUGUUGUCUGGCUCGACA 21 11 4 9 1    1 9 1
sly-miR167a UGAAGCUGCCAGCAUGAUCUA 21 12,531 4,177 7,711 81    4,739 7,711 81
sly-miR167b-3p AGGUCAUCUAGCAGCUUCAAU 21 11 6 8 3    3 0 8
sly-miR167b-5p UAAAGCUGCCAGCAUGAUCUGG 22 38 19 24 14    24 0 14
sly-miR168a-3p CCUGCCUUGCAUCAACUGAAU 21 14 5 8 2    4 2 8
sly-miR168a-5p UCGCUUGGUGCAGGUCGGGAC 21 11,415 3,805 8,528 1,407    8,528 1,480 1,407
sly-miR168b-3p CCCGCCUUGCAUCAACUGAAU 21 39 13 17 8    14 17 8
sly-miR168b-5p UCGCUUGGUGCAGGUCGGGAC 21 11,415 3,805 8,528 1,407    8,528 1,480 1,407
sly-miR169a CAGCCAAGGAUGACUUGCCGG 21 15 8 13 2    0 13 2
sly-miR169b UAGCCAAGGAUGACUUGCCUG 21 8 4 5 3    0 3 5
sly-miR169c CAGCCAAGGAUGACUUGCCGA 21 0 0 0 0    0 0 0
sly-miR169d UAGCCAAGGAUGACUUGCCUA 21 0 0 0 0    0 0 0
sly-miR169e-3p UGGCAAGCAUCUUUGGCGACU 21 68 23 60 1    1 60 7
sly-miR169e-5p UAGCCAAGGAUGACUUGCCUUU 22 0 0 0 0    0 0 0
sly-miR171a UGAUUGAGCCGUGCCAAUAUC 21 165 55 136 1    28 136 1
sly-miR171b UUGAGCCGUGCCAAUAUCACG 21 12 6 10 2    10 2 0
sly-miR171c UAUUGGUGCGGUUCAAUGAGA 21 10 3 6 2    2 6 2
sly-miR171d UUGAGCCGCGCCAAUAUCAC 20 0 0 0 0    0 0 0
sly-miR171e UUGAGCCGCGUCAAUAUCUCU 21 60 20 34 3    34 3 23
sly-miR172a AGAAUCUUGAUGAUGCUGCAU 21 10,358 3,453 4,369 2,071    4,369 2,071 3,918
sly-miR172b AGAAUCUUGAUGAUGCUGCAU 21 10,358 3,453 4,369 2,071    4,369 2,071 3,918
sly-miR1916 AUUUCACUUAGACACCUCAA 20 0 0 0 0    0 0 0
sly-miR1917 AUUAAUAAAGAGUGCUAAAGU 21 0 0 0 0    0 0 0
sly-miR1918 UGUUGGUGAGAGUUCGAUUCUC 22 0 0 0 0    0 0 0
sly-miR1919a ACGAGAGUCAUCUGUGACAGG 21 56 19 25 10    25 21 10
sly-miR1919b ACGAGAGUCAUCUGUGACAGG 21 56 19 25 10    25 21 10
sly-miR1919c-3p ACGAGAGUCAUCUGUGACAGG 21 56 19 25 10    25 21 10
sly-miR1919c-5p UGUCGCAGAUGACUUUCGCCC 21 3,204 1,068 1,298 871    1,035 871 1,298
sly-miR319a CUUGGACUGAAGGGAGCUCC 20 0 0 0 0    0 0 0
sly-miR319b UUGGACUGAAGGGAGCUCCCU 21 8 8 8 8    0 8 0
sly-miR319c-3p UUGGACUGAAGGGAGCUCCUU 21 6 2 3 1    3 2 1
sly-miR319c-5p AGAGCUUCCUUCAGCCCACUC 21 0 0 0 0    0 0 0
sly-miR390a-3p CGCUAUCCAUCCUGAGUUUUA 21 0 0 0 0    0 0 0
sly-miR390a-5p AAGCUCAGGAGGGAUAGCACC 21 474 158 304 59    304 111 59
sly-miR390b-3p CGCUAUCCAUCCUGAGUUUCA 21 16 16 16 16    0 16 0
sly-miR390b-5p AAGCUCAGGAGGGAUAGCGCC 21 1,984 661 1,942 8    34 1,942 8
sly-miR394-3p AGGUGGGCAUACUGUCAACA 20 74 25 49 4    49 21 4
sly-miR394-5p UUGGCAUUCUGUCCACCUCC 20 568 189 281 34    253 281 34
sly-miR395a CUGAAGUGUUUGGGGGAACUCC 22 0 0 0 0    0 0 0
sly-miR395b CUGAAGUGUUUGGGGGAACUCC 22 0 0 0 0    0 0 0
sly-miR396a-3p GUUCAAUAAAGCUGUGGGAAG 21 814 271 294 232    232 288 294
sly-miR396a-5p UUCCACAGCUUUCUUGAACUG 21 6,197 2,066 4,108 583    1,506 583 4,108
sly-miR396b UUCCACAGCUUUCUUGAACUU 21 1,163 388 410 368    368 385 410
sly-miR397 AUUGAGUGCAGCGUUGAUGA 20 13 4 10 1    10 1 2
sly-miR399 UGCCAAAGGAGAGUUGCCCUA 21 13 7 10 3    0 3 10
sly-miR403-3p CUAGAUUCACGCACAAGCUCG 21 970 323 438 148    438 148 384
sly-miR403-5p CGUUUGUGCGUGAAUCUAACA 21 0 0 0 0    0 0 0
sly-miR4376 ACGCAGGAGAGAUGAUGCUGGA 22 5,063 1,688 3,713 350    3,713 1,000 350
sly-miR477-3p AGUUCUUGUAGGGUGAGACAAC 22 0 0 0 0    0 0 0
sly-miR477-5p UGUCUCUCCCUCAAGGGCUCC 21 0 0 0 0    0 0 0
sly-miR482a UUUCCAAUUCCACCCAUUCCUA 22 28 14 19 9    0 19 9
sly-miR482b UCUUGCCUACACCGCCCAUGCC 22 61 20 28 13    20 13 28
sly-miR482c UCUUGCCAAUACCGCCCAUUCC 22 12 4 9 1    1 2 9
sly-miR482d-3p UUUCCUAUUCCACCCAUGCCAA 22 48 16 22 12    12 22 14
sly-miR482d-5p GGAGUGGGUGGGAUGGAAAAA 21 11 4 8 1    8 1 2
sly-miR482e-3p UCUUUCCUACUCCUCCCAUACC 22 222 74 88 62    72 62 88
sly-miR482e-5p UGUGGGUGGGGUGGAAAGAUU 21 23 8 10 6    10 7 6
sly-miR5300 UCCCCAGUCCAGGCAUUCCAAC 22 914 305 517 93    304 517 93
sly-miR5302a AAACGAGGUUUGUUACUUUGG 21 1 1 1 1    0 1 0
sly-miR5302b-3p UUUUCAACUAUAGCAUUAUUUU 22 0 0 0 0    0 0 0
sly-miR5302b-5p UGAAAUGCUAUAGUUGGAAAGU 22 8 8 8 8    0 8 0
sly-miR5303 UUUUUGAAGAGUUCGAGCAAC 21 3 2 2 1    2 0 1
sly-miR5304 UCAAUGCUACAUACUCAUCCC 21 60 20 24 18    24 18 18
sly-miR6022 UGGAAGGGAGAAUAUCCAGGA 21 37,026 12,342 17,677 4,171    15,178 4,171 17,677
sly-miR6023 UUCCAUGAAAGAGUUUUUGGAU 22 647 216 349 113    349 113 185
sly-miR6024 UUUUAGCAAGAGUUGUUUUACC 22 777 259 382 196    382 196 199
sly-miR6026 UUCUUGGCUAGAGUUGUAUUGC 22 200 67 115 38    47 38 115
sly-miR6027-3p UGAAUCCUUCGGCUAUCCAUAA 22 4,972 1,657 2,489 817    817 1,666 2,489
sly-miR6027-5p AUGGGUAGCACAAGGAUUAAUG 22 596 199 238 144    214 238 144
sly-miR9469-3p AUUCGGUCUUCUUAUGUGGAC 21 0 0 0 0    0 0 0
sly-miR9469-5p CCACAUAAGAAGACCGAAUUC 21 0 0 0 0    0 0 0
sly-miR9470-3p UUUGGCUCAUGGAUUUUAGC 20 74 25 46 10    10 18 46
sly-miR9470-5p UGAAAUCCAUGAGCCUAAACU 21 1 1 1 1    0 0 1
sly-miR9471a-3p UUGGCUGAGUGAGCAUCACGG 21 157,275 52,425 77,320 24,183    55,772 24,183 77,320
sly-miR9471a-5p CAGGUGCUCACUCAGCUAAUA 21 3 2 2 1    0 1 2
sly-miR9471b-3p UUGGCUGAGUGAGCAUCACUG 21 49,844 16,615 20,846 8,173    20,825 8,173 20,846
sly-miR9471b-5p GAGGUGCUCACUCAGCUAAUA 21 2 1 1 1    1 0 1
sly-miR9472-3p UUCACAAUCUCUGCUGAAAAA 21 5 3 4 1    1 0 4
sly-miR9472-5p UUUCAGUAGACGUUGUGAAUA 21 1,469 490 1,195 106    168 106 1,195
sly-miR9473-3p AAACGAGUUCAGAUUUACAGC 21 0 0 0 0    0 0 0
sly-miR9473-5p UGGCUGUAAAUCUAAACUCGU 21 0 0 0 0    0 0 0
sly-miR9474-3p UUUUGUUCGCAGAUACUACAGU 22 1 1 1 1    0 1 0
sly-miR9474-5p UGUAGAAGUCAUGAAUAAAAUG 22 0 0 0 0    0 0 0
sly-miR9475-3p CUACAAUGUAGAGAUCGUUUU 21 77 26 34 15    15 34 28
sly-miR9475-5p AACGAUCUCUACAUUGUAGGC 21 134 45 53 35    35 53 46
sly-miR9476-3p AAAAAGAUGCAGGACUAGACC 21 15 5 8 2    5 8 2
sly-miR9476-5p UCUAGUCCUGCAUCUUUUUUU 21 0 0 0 0    0 0 0
sly-miR9477-3p UUGGGAAAGGGAACAACUGAUAGU 24 0 0 0 0    0 0 0
sly-miR9477-5p UAUCCGUUGUUCCCUUUUCCUACC 24 0 0 0 0    0 0 0
sly-miR9478-3p UUCGAUGACAUAUUUGAGCCU 21 134 45 80 15    39 80 15
sly-miR9478-5p GCUUAAAUAUGUAGAUCGAACU 22 0 0 0 0    0 0 0
sly-miR9479-3p GAGAAUGGUAGAGGGUCGGACC 22 0 0 0 0    0 0 0
sly-miR9479-5p UCCAGUCCUCUACCCUUCUCCA 22 0 0 0 0    0 0 0