Ae. tauschii Small RNA miRNA Abundances

The data below are based on the microRNAs listed in the Sanger registry. Adjust libraries/reads to display on the control panel.


        miRNA         miRNA sequence Len Sum (norm) Average Max Min (>0)  TrA_0dCntrl_3TrA_0dHt_3TrA_0dLt_3TrA_0dUV_3TrA_0dCntrl_2TrA_0dHt_2TrA_0dLt_2TrA_0dUV_2TrA_0dCntrl_1TrA_0dHt_1TrA_0dLt_1TrA_0dUV_1TrA_1dCntrl_3TrA_1dHt_3TrA_1dLt_3TrA_1dUV_3TrA_1dCntrl_2TrA_1dHt_2TrA_1dLt_2TrA_1dUV_2TrA_1dCntrl_1TrA_1dHt_1TrA_1dLt_1TrA_1dUV_1TrA_2dCntrl_3TrA_2dHt_3TrA_2dLt_3TrA_2dUV_3TrA_2dCntrl_2TrA_2dHt_2TrA_2dLt_2TrA_2dUV_2TrA_2dCntrl_1TrA_2dHt_1TrA_2dLt_1TrA_2dUV_1TrA_3dCntrl_3TrA_3dHt_3TrA_3dLt_3TrA_3dUV_3TrA_3dCntrl_2TrA_3dHt_2TrA_3dLt_2TrA_3dUV_2TrA_3dCntrl_1TrA_3dHt_1TrA_3dLt_1TrA_3dUV_1TrA_7dCntrl_3TrA_7dHt_3TrA_7dLt_3TrA_7dUV_3TrA_7dCntrl_2TrA_7dHt_2TrA_7dLt_2TrA_7dUV_2TrA_7dCntrl_1TrA_7dHt_1TrA_7dLt_1TrA_7dUV_1TrA_10dCntrl_3TrA_10dHt_3TrA_10dLt_3TrA_10dUV_3TrA_10dCntrl_2TrA_10dHt_2TrA_10dLt_2TrA_10dUV_2TrA_10dCntrl_1TrA_10dHt_1TrA_10dLt_1TrA_10dUV_1
ata-miR1432-3p UUGGUGUCACCUCGCCUGAAC 21 843 12 33 1    8 5 7 2 7 8 10 1 16 6 20 5 4 10 4 1 7 5 4 3 17 2 2 1 13 14 6 7 9 9 17 4 5 13 5 8 11 19 8 3 10 7 5 13 8 15 10 10 16 25 16 13 15 8 19 8 17 26 15 11 33 20 17 19 33 32 22 15 22 30 14 13
ata-miR1432-5p UCAGGAGAGAUGACACCGACG 21 1,614 22 76 3    17 5 16 12 17 10 15 5 16 7 21 10 7 15 4 7 6 14 13 7 19 9 25 5 26 11 20 13 16 18 22 3 11 32 26 12 12 9 9 5 22 7 5 12 7 13 20 21 34 52 57 18 40 28 43 7 32 51 26 24 76 45 42 20 73 51 54 43 33 59 44 28
ata-miR156a-3p GCUCACCCUCUCUCUGUCAGC 21 28,530 396 966 85    564 155 322 527 503 155 600 610 590 142 530 966 760 171 463 929 528 136 512 504 644 170 692 809 283 419 213 496 219 604 560 750 617 302 438 892 414 383 525 550 423 193 478 459 458 343 440 490 230 133 178 341 357 167 95 232 334 199 221 360 85 328 231 460 224 99 291 216 101 138 146 433
ata-miR156a-5p UGACAGAAGAGAGUGAGCAC 20 40,426 561 1,665 53    442 53 398 462 270 86 477 906 672 145 970 473 1,255 155 596 232 427 188 350 650 732 252 145 675 385 356 176 444 137 1,665 472 508 1,232 470 154 278 381 515 708 347 555 500 240 922 836 325 374 1,091 523 810 504 545 766 845 351 433 937 891 251 233 448 1,497 674 477 860 587 1,195 764 319 604 573 1,257
ata-miR156b-3p GCUCAUUUCUCUCUCUGUCAGC 22 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR156b-5p UGACAGAAGAGAGUGAGCAC 20 40,426 561 1,665 53    442 53 398 462 270 86 477 906 672 145 970 473 1,255 155 596 232 427 188 350 650 732 252 145 675 385 356 176 444 137 1,665 472 508 1,232 470 154 278 381 515 708 347 555 500 240 922 836 325 374 1,091 523 810 504 545 766 845 351 433 937 891 251 233 448 1,497 674 477 860 587 1,195 764 319 604 573 1,257
ata-miR156c-3p GCUCACUGCUCUAUCUGUCACC 22 311 4 11 1    3 2 2 5 2 0 2 1 5 0 5 4 6 2 3 4 5 4 3 1 6 7 5 4 9 5 9 6 2 3 3 1 6 4 8 1 4 5 3 3 8 5 5 5 10 11 9 5 8 9 5 3 6 5 3 3 1 3 6 3 4 8 2 3 3 3 6 5 2 3 4 2
ata-miR156c-5p UGACAGAAGAGAGUGAGCAC 20 40,426 561 1,665 53    442 53 398 462 270 86 477 906 672 145 970 473 1,255 155 596 232 427 188 350 650 732 252 145 675 385 356 176 444 137 1,665 472 508 1,232 470 154 278 381 515 708 347 555 500 240 922 836 325 374 1,091 523 810 504 545 766 845 351 433 937 891 251 233 448 1,497 674 477 860 587 1,195 764 319 604 573 1,257
ata-miR156d-3p GCUCACUCCUCUUUCUGUCAGC 22 399,354 5,547 9,991 339    7,721 339 3,931 7,219 8,277 735 5,981 5,501 5,901 565 6,927 6,345 6,888 351 6,592 8,123 5,858 375 5,856 6,337 9,400 413 9,324 7,566 7,442 5,103 685 7,850 1,267 7,779 8,222 9,662 9,830 1,035 8,994 9,455 8,720 3,078 8,818 9,423 9,991 1,438 9,092 9,125 7,925 2,988 9,411 6,961 3,300 1,685 3,195 7,557 7,580 3,248 1,647 5,035 7,203 3,240 5,490 6,052 2,327 5,628 4,464 9,463 4,015 1,632 5,767 4,231 1,974 2,694 2,728 8,380
ata-miR156d-5p UGACAGAAGAGAGUGAGCAC 20 40,426 561 1,665 53    442 53 398 462 270 86 477 906 672 145 970 473 1,255 155 596 232 427 188 350 650 732 252 145 675 385 356 176 444 137 1,665 472 508 1,232 470 154 278 381 515 708 347 555 500 240 922 836 325 374 1,091 523 810 504 545 766 845 351 433 937 891 251 233 448 1,497 674 477 860 587 1,195 764 319 604 573 1,257
ata-miR156e-3p GCUCACCCUCUCUCUGUCAGC 21 28,530 396 966 85    564 155 322 527 503 155 600 610 590 142 530 966 760 171 463 929 528 136 512 504 644 170 692 809 283 419 213 496 219 604 560 750 617 302 438 892 414 383 525 550 423 193 478 459 458 343 440 490 230 133 178 341 357 167 95 232 334 199 221 360 85 328 231 460 224 99 291 216 101 138 146 433
ata-miR156e-5p UGACAGAAGAGAGUGAGCAC 20 40,426 561 1,665 53    442 53 398 462 270 86 477 906 672 145 970 473 1,255 155 596 232 427 188 350 650 732 252 145 675 385 356 176 444 137 1,665 472 508 1,232 470 154 278 381 515 708 347 555 500 240 922 836 325 374 1,091 523 810 504 545 766 845 351 433 937 891 251 233 448 1,497 674 477 860 587 1,195 764 319 604 573 1,257
ata-miR160a-3p GCGUUGGCUCUACCGCGGAUG 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR160a-5p UGCCUGGCUCCCUGUAUGCCA 21 188,653 2,620 4,945 1,180    1,692 3,499 2,354 2,268 2,683 2,918 2,727 2,444 4,945 3,917 2,783 3,108 1,275 3,262 2,424 1,667 2,221 3,257 2,292 2,072 3,657 3,150 2,781 2,628 2,665 3,182 2,727 2,580 3,259 3,440 2,157 2,692 3,386 4,079 2,581 3,448 2,039 3,599 3,176 2,467 2,815 4,294 2,845 3,895 3,631 2,671 1,611 3,041 1,895 2,372 1,419 1,478 1,735 2,109 1,466 1,903 2,758 2,196 2,205 2,345 1,180 1,597 2,720 2,721 2,091 2,136 2,789 2,081 1,657 2,198 2,216 3,082
ata-miR160b-3p GCGUGCACGGAUCCAAGCAUA 21 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR160b-5p UGCCUGGCUCCCUGUAUGCCA 21 188,653 2,620 4,945 1,180    1,692 3,499 2,354 2,268 2,683 2,918 2,727 2,444 4,945 3,917 2,783 3,108 1,275 3,262 2,424 1,667 2,221 3,257 2,292 2,072 3,657 3,150 2,781 2,628 2,665 3,182 2,727 2,580 3,259 3,440 2,157 2,692 3,386 4,079 2,581 3,448 2,039 3,599 3,176 2,467 2,815 4,294 2,845 3,895 3,631 2,671 1,611 3,041 1,895 2,372 1,419 1,478 1,735 2,109 1,466 1,903 2,758 2,196 2,205 2,345 1,180 1,597 2,720 2,721 2,091 2,136 2,789 2,081 1,657 2,198 2,216 3,082
ata-miR160c-3p GCGUGCAAGGAGCCAAGCAUG 21 754 11 25 1    10 7 11 6 15 0 6 10 16 2 18 18 7 2 22 9 13 7 18 12 12 0 25 10 12 11 1 17 7 16 14 6 11 7 22 8 15 9 7 10 18 8 17 12 13 7 12 21 8 13 7 14 11 16 6 3 11 7 8 9 1 7 6 13 11 5 11 9 2 15 4 20
ata-miR160c-5p UGCCUGGCUCCCUGUAUGCCA 21 188,653 2,620 4,945 1,180    1,692 3,499 2,354 2,268 2,683 2,918 2,727 2,444 4,945 3,917 2,783 3,108 1,275 3,262 2,424 1,667 2,221 3,257 2,292 2,072 3,657 3,150 2,781 2,628 2,665 3,182 2,727 2,580 3,259 3,440 2,157 2,692 3,386 4,079 2,581 3,448 2,039 3,599 3,176 2,467 2,815 4,294 2,845 3,895 3,631 2,671 1,611 3,041 1,895 2,372 1,419 1,478 1,735 2,109 1,466 1,903 2,758 2,196 2,205 2,345 1,180 1,597 2,720 2,721 2,091 2,136 2,789 2,081 1,657 2,198 2,216 3,082
ata-miR164a-3p CACGUGCGCUCCUUCUCCAGC 21 47 2 5 1    0 5 0 2 1 0 2 0 3 2 0 2 0 0 0 0 1 0 0 2 4 0 2 1 1 3 1 0 0 0 0 0 1 0 1 1 2 0 0 0 0 0 0 1 1 0 0 1 0 0 1 0 0 0 1 1 1 0 0 0 0 1 0 0 0 0 0 0 1 0 1 0
ata-miR164a-5p UGGAGAAGCAGGGCACGUGCU 21 1,008 14 43 2    9 2 30 16 14 4 12 15 21 17 20 21 9 15 20 4 7 14 7 12 21 5 11 14 13 22 15 22 15 19 15 10 22 7 5 14 13 14 17 12 17 13 11 17 24 3 12 43 12 20 11 10 16 24 12 9 15 14 8 9 6 12 21 18 14 5 13 15 9 9 14 17
ata-miR164b-3p CAUGUGCCUUUCUUCUCCACC 21 55 1 4 1    1 0 0 1 0 0 0 0 1 2 1 0 2 0 0 0 1 2 3 2 1 2 0 1 2 0 1 0 0 0 2 0 0 4 1 0 0 2 0 0 1 0 2 0 1 1 2 0 0 1 3 0 1 0 0 0 0 1 1 1 0 0 0 1 1 1 2 0 1 1 0 1
ata-miR164b-5p UGGAGAAGCAGGGCACGUGCA 21 1,959 27 63 7    12 21 56 16 17 26 14 28 27 19 41 21 9 23 41 13 10 46 20 33 29 16 7 30 26 20 16 28 20 24 21 12 39 30 15 14 16 14 33 24 17 21 20 39 53 19 10 63 17 31 36 22 36 42 25 27 27 42 18 17 21 56 41 34 42 34 54 29 24 36 34 45
ata-miR164c-3p CACGUGUUCUUCUCCUCCAUC 21 1,044 16 83 1    1 0 24 10 9 2 12 8 5 0 19 10 0 2 8 3 3 0 10 5 7 0 11 16 9 6 1 8 2 13 8 1 8 0 15 5 6 27 16 8 9 8 11 13 12 19 7 18 24 24 32 41 36 26 21 28 15 33 12 20 20 83 22 35 19 31 21 22 17 38 13 16
ata-miR164c-5p UGGAGAAGCAGGGCACGUGCA 21 1,959 27 63 7    12 21 56 16 17 26 14 28 27 19 41 21 9 23 41 13 10 46 20 33 29 16 7 30 26 20 16 28 20 24 21 12 39 30 15 14 16 14 33 24 17 21 20 39 53 19 10 63 17 31 36 22 36 42 25 27 27 42 18 17 21 56 41 34 42 34 54 29 24 36 34 45
ata-miR166a-3p UCGGACCAGGCUUCAUUCCCC 21 165,459 2,298 3,721 1,412    1,834 2,383 1,835 2,079 2,016 2,150 2,051 2,182 2,695 2,524 2,458 2,246 2,031 2,459 2,947 1,611 2,092 2,626 2,046 1,864 2,542 2,162 2,445 2,140 2,336 2,580 2,493 2,168 2,700 2,655 1,973 1,781 2,519 3,721 1,920 2,001 2,244 2,732 2,476 2,168 2,398 3,285 2,549 2,841 3,243 2,301 1,934 2,434 2,224 2,381 1,412 1,562 1,880 2,256 1,650 1,722 2,268 2,389 2,115 2,428 1,684 2,485 2,521 2,635 2,285 2,487 2,914 1,800 1,920 2,521 2,184 2,866
ata-miR166a-5p GGAAUGUUGUCUGGUUCAAGG 21 430 7 32 1    2 5 13 7 2 6 11 4 19 4 32 6 0 0 4 5 4 13 2 2 10 2 7 10 5 20 0 4 4 5 11 1 8 0 12 3 3 2 7 5 4 7 9 6 27 4 4 11 5 1 10 2 5 1 9 1 3 6 3 2 2 0 6 4 3 2 8 8 3 0 4 10
ata-miR166b-3p UCGGACCAGGCUUCAUUCCCC 21 165,459 2,298 3,721 1,412    1,834 2,383 1,835 2,079 2,016 2,150 2,051 2,182 2,695 2,524 2,458 2,246 2,031 2,459 2,947 1,611 2,092 2,626 2,046 1,864 2,542 2,162 2,445 2,140 2,336 2,580 2,493 2,168 2,700 2,655 1,973 1,781 2,519 3,721 1,920 2,001 2,244 2,732 2,476 2,168 2,398 3,285 2,549 2,841 3,243 2,301 1,934 2,434 2,224 2,381 1,412 1,562 1,880 2,256 1,650 1,722 2,268 2,389 2,115 2,428 1,684 2,485 2,521 2,635 2,285 2,487 2,914 1,800 1,920 2,521 2,184 2,866
ata-miR166b-5p GGGAAUGACGCCGGGUCCGAAA 22 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR166c-3p UCGGACCAGGCUUCAUUCCUU 21 9,975 139 224 76    99 101 147 129 134 96 148 114 149 110 188 131 106 119 146 114 88 161 117 112 158 138 166 145 145 147 219 143 115 164 123 131 173 224 98 159 91 178 201 140 175 163 132 187 196 174 100 203 89 117 114 112 128 206 86 100 130 143 80 111 76 182 130 202 147 154 125 149 103 141 95 158
ata-miR166c-5p GGAACGUUGGCUGGCUCGAGG 21 16,259 226 574 4    122 35 375 245 139 4 261 248 264 58 258 207 117 201 190 148 154 159 163 118 217 103 139 247 199 220 574 159 342 204 195 176 293 491 113 160 162 449 197 211 211 371 200 228 301 538 135 249 175 376 220 178 152 384 188 195 210 439 99 147 124 403 241 240 226 350 187 205 188 349 138 295
ata-miR166d-3p UCGGACCAGGCUUCAUUCCCC 21 165,459 2,298 3,721 1,412    1,834 2,383 1,835 2,079 2,016 2,150 2,051 2,182 2,695 2,524 2,458 2,246 2,031 2,459 2,947 1,611 2,092 2,626 2,046 1,864 2,542 2,162 2,445 2,140 2,336 2,580 2,493 2,168 2,700 2,655 1,973 1,781 2,519 3,721 1,920 2,001 2,244 2,732 2,476 2,168 2,398 3,285 2,549 2,841 3,243 2,301 1,934 2,434 2,224 2,381 1,412 1,562 1,880 2,256 1,650 1,722 2,268 2,389 2,115 2,428 1,684 2,485 2,521 2,635 2,285 2,487 2,914 1,800 1,920 2,521 2,184 2,866
ata-miR166d-5p GGAAUGUUGUCUGGCUCGGGG 21 98,019 1,361 3,278 92    1,604 115 1,682 2,016 1,192 92 1,805 2,173 1,909 116 2,467 1,513 2,411 700 3,278 1,555 1,584 926 1,965 1,805 2,022 724 1,666 2,061 1,604 1,669 770 1,933 1,200 1,890 2,279 1,837 2,423 1,281 1,537 1,237 2,428 1,073 1,635 1,919 1,519 1,071 2,125 2,233 2,178 1,114 1,884 1,672 889 567 683 1,038 1,039 728 525 700 1,370 1,046 795 785 480 897 1,000 1,317 669 439 908 767 481 648 872 1,484
ata-miR166e-3p UCGGACCAGGCUUCAUUCCCC 21 165,459 2,298 3,721 1,412    1,834 2,383 1,835 2,079 2,016 2,150 2,051 2,182 2,695 2,524 2,458 2,246 2,031 2,459 2,947 1,611 2,092 2,626 2,046 1,864 2,542 2,162 2,445 2,140 2,336 2,580 2,493 2,168 2,700 2,655 1,973 1,781 2,519 3,721 1,920 2,001 2,244 2,732 2,476 2,168 2,398 3,285 2,549 2,841 3,243 2,301 1,934 2,434 2,224 2,381 1,412 1,562 1,880 2,256 1,650 1,722 2,268 2,389 2,115 2,428 1,684 2,485 2,521 2,635 2,285 2,487 2,914 1,800 1,920 2,521 2,184 2,866
ata-miR166e-5p GGAAUGUUGUCUGGUUGGAGA 21 1,163 17 38 2    22 0 30 38 21 0 26 24 12 2 22 33 15 10 27 13 19 14 15 26 13 0 23 33 30 27 16 25 11 33 27 13 15 21 23 12 14 10 11 23 22 13 7 20 27 11 12 10 18 22 11 4 7 10 12 13 15 24 7 9 4 12 6 8 9 22 9 4 8 22 23 13
ata-miR167a-3p GAUCGUGCUGUGACAGUUUCACC 23 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR167a-5p UGAAGCUGCCAGCAUGAUCUA 21 22,656 315 818 24    258 369 606 483 265 246 207 345 475 614 818 394 104 397 179 150 259 533 405 320 496 306 110 510 687 502 475 723 214 568 381 192 675 366 309 250 256 313 421 555 427 332 344 397 781 493 108 412 123 75 353 159 147 174 162 165 124 275 24 161 50 57 212 228 191 58 71 261 95 56 117 288
ata-miR167b-3p AGGUCAUGCUGGAGUUUCAUC 21 40,117 557 2,013 118    1,411 438 747 756 724 255 1,138 460 597 479 1,067 476 1,431 642 665 953 785 667 877 472 616 605 781 487 646 676 1,529 702 1,491 643 829 489 520 2,013 493 498 609 541 486 654 424 812 507 568 457 640 665 319 118 290 159 184 152 363 180 147 173 501 183 179 143 284 220 157 153 504 172 156 150 368 213 228
ata-miR167b-5p UGAAGCUGCCAGCAUGAUCUGA 22 563,947 7,833 23,573 2,499    11,903 6,364 6,997 9,683 5,833 4,521 8,725 11,210 8,232 7,019 16,432 6,441 23,573 8,315 12,664 7,408 8,204 9,357 7,762 10,534 9,615 6,181 4,398 9,101 8,400 6,974 7,308 10,308 8,139 10,949 12,437 6,060 9,483 11,893 5,686 4,349 9,882 9,175 8,865 9,232 8,751 8,948 7,183 11,121 10,010 10,282 9,116 6,327 2,849 5,549 5,451 5,249 6,641 11,058 3,065 3,318 6,453 8,965 2,722 3,545 2,968 11,116 5,903 6,033 5,098 5,470 5,619 4,696 2,499 7,614 4,134 6,582
ata-miR167c-3p GAUCAUGACUGACAGCCUCAUU 22 878 13 90 1    6 78 4 12 4 14 5 9 16 65 14 12 0 27 15 9 25 20 21 7 6 16 33 5 7 6 90 13 84 2 6 4 4 26 6 8 14 9 4 19 8 34 21 10 19 13 10 9 1 1 1 1 0 1 1 1 1 2 1 3 0 1 4 2 1 1 1 1 2 0 1 1
ata-miR167c-5p UGAAGCUGCCAGCAUGAUCUA 21 22,656 315 818 24    258 369 606 483 265 246 207 345 475 614 818 394 104 397 179 150 259 533 405 320 496 306 110 510 687 502 475 723 214 568 381 192 675 366 309 250 256 313 421 555 427 332 344 397 781 493 108 412 123 75 353 159 147 174 162 165 124 275 24 161 50 57 212 228 191 58 71 261 95 56 117 288
ata-miR167d-3p AGGUCAUGUGGCAGCUUCAUU 21 1,249 17 32 2    27 2 23 25 16 8 24 21 11 11 25 16 30 23 19 32 24 11 27 17 24 9 13 27 22 17 12 29 22 21 32 32 27 19 18 17 24 15 17 19 26 13 25 29 27 9 20 29 3 6 12 13 14 8 6 12 15 10 13 11 8 23 9 7 12 5 8 15 10 14 8 21
ata-miR167d-5p UGAAGCUGCCAGCAUGAUCUGA 22 563,947 7,833 23,573 2,499    11,903 6,364 6,997 9,683 5,833 4,521 8,725 11,210 8,232 7,019 16,432 6,441 23,573 8,315 12,664 7,408 8,204 9,357 7,762 10,534 9,615 6,181 4,398 9,101 8,400 6,974 7,308 10,308 8,139 10,949 12,437 6,060 9,483 11,893 5,686 4,349 9,882 9,175 8,865 9,232 8,751 8,948 7,183 11,121 10,010 10,282 9,116 6,327 2,849 5,549 5,451 5,249 6,641 11,058 3,065 3,318 6,453 8,965 2,722 3,545 2,968 11,116 5,903 6,033 5,098 5,470 5,619 4,696 2,499 7,614 4,134 6,582
ata-miR167e-3p GGUCAUGCUGCGGCAGCCUCACU 23 68 2 7 1    1 0 1 0 2 0 0 0 4 2 1 0 0 0 1 0 0 2 1 2 0 7 0 2 1 3 1 3 0 2 0 0 2 0 1 0 0 2 0 1 0 5 1 0 4 1 0 1 0 0 1 0 0 4 1 1 0 0 0 1 0 0 2 0 1 1 0 1 0 0 0 1
ata-miR167e-5p UGAAGCUGCCAGCAUGAUCUA 21 22,656 315 818 24    258 369 606 483 265 246 207 345 475 614 818 394 104 397 179 150 259 533 405 320 496 306 110 510 687 502 475 723 214 568 381 192 675 366 309 250 256 313 421 555 427 332 344 397 781 493 108 412 123 75 353 159 147 174 162 165 124 275 24 161 50 57 212 228 191 58 71 261 95 56 117 288
ata-miR167f-3p CAGAUCAUGCUGCAGCUUCAU 21 299 5 15 1    2 0 4 10 3 0 5 4 3 0 8 6 4 2 9 3 1 2 4 4 2 0 2 6 1 3 0 5 2 7 3 1 5 4 5 8 3 0 7 4 6 0 3 11 12 0 3 7 8 0 2 3 7 2 3 5 7 2 2 11 6 5 6 15 4 0 1 8 3 1 6 8
ata-miR167f-5p UGAAGCUGCCAGCAUGAUCUGC 22 78,472 1,090 2,023 232    599 733 1,797 843 804 863 547 703 1,062 1,190 999 1,012 337 1,278 592 232 566 1,083 462 652 1,017 539 338 836 1,035 993 1,539 973 896 998 847 565 1,169 1,367 709 764 589 1,241 975 790 1,184 1,434 698 1,106 1,555 1,612 593 1,621 957 1,652 1,601 1,276 1,008 1,718 1,091 1,311 1,212 1,398 579 1,246 1,113 1,710 1,787 1,713 1,767 1,374 1,551 1,528 1,537 2,023 1,222 1,761
ata-miR168-3p CCCGCCUUGCACCAAGUGAAU 21 103,393 1,436 2,976 179    2,305 180 1,740 1,804 1,717 179 2,259 1,960 1,944 203 2,976 2,050 2,052 640 2,193 2,022 1,716 844 2,509 1,550 2,306 822 2,436 2,357 1,450 2,741 797 2,087 1,123 2,160 2,442 2,052 2,582 1,257 2,928 2,282 1,606 1,082 2,127 1,760 1,365 660 2,280 1,763 1,820 771 1,709 2,460 597 448 756 1,036 1,001 801 549 625 1,003 740 629 878 432 924 988 1,578 692 492 869 1,008 454 605 807 1,413
ata-miR168-5p UCGCUUGGUGCAGAUCGGGAC 21 10,332,124 143,502 264,939 35,343    156,088 49,019 200,982 187,188 165,374 35,343 201,417 199,857 264,939 50,858 246,941 205,677 209,861 69,388 240,597 141,685 163,426 84,392 185,076 155,417 215,796 83,740 161,380 211,062 173,843 243,003 78,488 201,517 92,138 212,562 202,173 155,283 215,841 114,503 182,172 158,431 159,590 112,808 182,325 190,323 161,410 96,017 215,414 198,594 210,510 100,452 155,386 201,482 88,081 56,439 91,982 105,747 105,163 70,214 78,784 89,470 124,292 81,161 119,873 114,588 67,072 99,514 147,050 165,737 95,887 60,216 123,119 104,648 78,877 79,054 127,032 158,356
ata-miR169a-3p UGGGCAAGUCACCCUGGCUACC 22 1,491 23 102 2    6 0 9 10 16 2 5 10 15 0 6 15 2 0 9 4 10 0 4 2 25 2 4 21 8 6 0 23 0 5 13 13 28 0 3 13 2 10 12 3 8 4 2 10 17 9 5 26 38 9 34 97 76 13 19 37 33 16 39 53 45 61 24 63 93 5 50 88 17 43 39 102
ata-miR169a-5p UAGCCAAGGAUGAUUUGCCUGUG 23 3,128 43 235 2    7 2 27 32 29 10 11 24 47 9 12 47 11 4 36 5 28 11 16 19 57 5 11 32 15 5 7 31 7 23 21 13 54 6 3 15 9 14 16 22 18 28 5 16 73 28 7 58 74 37 68 116 142 29 45 60 79 25 61 64 88 95 38 187 184 17 94 189 52 100 63 235
ata-miR169b-3p UGGGCAAGUCAUCCUGGCUACCC 23 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR169b-5p UAGCCAAGGAUGAUUUGCCUGUG 23 3,128 43 235 2    7 2 27 32 29 10 11 24 47 9 12 47 11 4 36 5 28 11 16 19 57 5 11 32 15 5 7 31 7 23 21 13 54 6 3 15 9 14 16 22 18 28 5 16 73 28 7 58 74 37 68 116 142 29 45 60 79 25 61 64 88 95 38 187 184 17 94 189 52 100 63 235
ata-miR169c-3p GGCGGUCACCUUGGCUAGC 19 27,371 380 1,705 9    55 62 273 317 346 365 300 445 1,705 367 131 1,038 48 59 481 438 434 161 341 142 941 159 425 727 145 498 148 478 379 323 276 698 601 343 153 640 80 245 122 304 232 237 490 177 823 160 45 722 404 25 323 835 657 32 210 425 570 65 585 691 164 210 178 1,059 331 9 209 427 131 70 215 1,467
ata-miR169c-5p UAGCCAAGGAUGACUUGCCUA 21 276 5 20 1    1 2 11 7 8 0 0 3 9 2 2 12 4 0 3 1 5 0 4 2 7 0 0 9 1 5 3 4 0 6 6 1 5 2 1 10 0 0 4 4 10 2 2 1 3 4 2 7 2 2 8 6 4 1 1 3 7 3 0 0 3 20 2 4 5 2 0 3 2 5 4 14
ata-miR169d-3p GGCAAGUUGUCCUUGGCUACA 21 1,434 23 147 1    10 2 49 18 27 4 28 18 147 2 19 50 13 2 41 33 37 0 102 5 62 0 22 58 6 85 3 62 0 21 26 31 34 0 15 52 4 0 11 22 18 0 125 11 23 4 4 30 1 2 14 3 9 1 8 2 5 2 2 6 0 5 9 4 1 0 0 4 1 4 3 12
ata-miR169d-5p CAGCCAAGGAUGACUUGCCGG 21 8,092 112 439 10    96 35 278 140 133 63 173 234 439 32 161 387 178 54 291 161 154 36 216 119 282 58 85 371 22 182 57 261 26 191 202 148 184 48 32 193 30 12 123 105 77 22 197 121 123 42 51 247 22 15 74 61 90 16 53 34 134 15 21 49 14 32 87 57 64 10 13 39 16 27 67 210
ata-miR169e-5p CAGCCAAGGAUGACUUGCCGA 21 1,284 18 52 2    8 5 49 19 35 8 11 23 13 9 12 33 2 10 29 9 8 13 13 8 33 2 13 40 23 24 6 24 2 23 19 6 15 7 8 26 2 3 25 15 14 8 4 11 30 7 3 47 29 14 21 18 27 8 20 18 30 7 8 20 22 16 23 23 48 9 24 38 13 19 20 52
ata-miR169f-3p GGCAAGUCCGUCCUUGGCUACA 22 3,947 56 183 2    21 7 178 98 140 12 82 96 79 17 55 124 15 0 161 56 61 7 97 80 129 5 69 155 18 48 4 117 5 61 76 49 83 7 55 100 27 5 76 36 47 10 47 32 59 8 20 66 54 8 34 86 86 2 23 49 63 9 56 61 21 5 32 110 81 0 61 56 20 20 27 183
ata-miR169f-5p CAGCCAAGGAUGACUUGCCGA 21 1,284 18 52 2    8 5 49 19 35 8 11 23 13 9 12 33 2 10 29 9 8 13 13 8 33 2 13 40 23 24 6 24 2 23 19 6 15 7 8 26 2 3 25 15 14 8 4 11 30 7 3 47 29 14 21 18 27 8 20 18 30 7 8 20 22 16 23 23 48 9 24 38 13 19 20 52
ata-miR169g-3p GGCGAGUUGUUCUUGGCUACA 21 210 4 12 1    1 0 4 0 4 0 1 3 7 4 3 8 0 8 5 1 4 2 0 0 6 0 2 10 2 11 7 7 4 1 2 0 4 2 2 6 1 5 0 1 3 1 3 3 12 3 0 3 3 0 6 2 1 2 2 2 1 3 0 5 3 1 2 2 4 0 1 3 2 2 1 6
ata-miR169g-5p CAGCCAAGGAUGACUUGCCGA 21 1,284 18 52 2    8 5 49 19 35 8 11 23 13 9 12 33 2 10 29 9 8 13 13 8 33 2 13 40 23 24 6 24 2 23 19 6 15 7 8 26 2 3 25 15 14 8 4 11 30 7 3 47 29 14 21 18 27 8 20 18 30 7 8 20 22 16 23 23 48 9 24 38 13 19 20 52
ata-miR169h-3p GCAAGUUGUUCUUGGCUAGC 20 3,378 50 402 1    6 0 41 40 57 6 39 33 402 0 23 98 17 0 64 61 69 0 75 16 182 2 60 110 13 78 3 88 4 64 17 76 80 2 27 69 11 2 12 34 42 0 93 15 135 1 7 85 38 1 48 87 103 2 21 29 52 3 61 51 26 57 8 59 59 1 13 31 13 17 18 221
ata-miR169h-5p UAGCCAAGGAUGACUUGCCGG 21 320 5 20 1    3 2 12 10 9 0 5 11 20 2 3 11 7 0 11 5 5 2 6 3 12 12 7 12 1 15 4 7 0 5 3 5 10 6 0 9 2 0 3 1 3 8 3 6 4 3 3 9 1 0 1 1 3 0 2 1 8 2 0 3 0 0 1 2 2 2 1 1 0 0 2 7
ata-miR169i-3p GGCAGUCUCCUUGGCUAGC 19 3,775 58 432 1    31 18 63 55 91 6 372 81 432 0 20 123 115 2 119 125 93 2 171 31 157 9 76 121 4 79 1 100 7 72 88 97 43 2 34 132 7 2 29 31 43 0 192 16 83 0 13 48 10 0 23 12 41 1 19 2 31 0 11 23 1 16 8 12 17 0 2 3 2 0 6 99
ata-miR169i-5p UAGCCAAGGAUGACUUGCCUG 21 144 3 9 1    3 0 4 1 2 0 1 4 8 0 4 6 0 2 3 0 3 0 2 1 1 0 2 6 1 4 4 2 0 5 8 1 2 0 2 5 0 0 3 1 4 0 0 1 3 0 0 9 1 0 2 2 4 0 2 1 5 1 0 2 1 3 0 0 0 0 1 3 0 2 3 3
ata-miR169j-3p UGGGCAAGUCACCCUGGCUACC 22 1,491 23 102 2    6 0 9 10 16 2 5 10 15 0 6 15 2 0 9 4 10 0 4 2 25 2 4 21 8 6 0 23 0 5 13 13 28 0 3 13 2 10 12 3 8 4 2 10 17 9 5 26 38 9 34 97 76 13 19 37 33 16 39 53 45 61 24 63 93 5 50 88 17 43 39 102
ata-miR169j-5p UAGCCAAGGAUGAUUUGCCUGUG 23 3,128 43 235 2    7 2 27 32 29 10 11 24 47 9 12 47 11 4 36 5 28 11 16 19 57 5 11 32 15 5 7 31 7 23 21 13 54 6 3 15 9 14 16 22 18 28 5 16 73 28 7 58 74 37 68 116 142 29 45 60 79 25 61 64 88 95 38 187 184 17 94 189 52 100 63 235
ata-miR171a-3p UGAGCCGAACCAAUAUCACUC 21 660 9 21 1    16 7 11 8 9 10 11 15 8 0 16 11 20 10 18 4 6 7 11 6 20 12 11 21 6 8 9 9 7 14 14 14 14 11 5 10 10 12 12 8 6 11 12 13 16 11 8 6 7 1 13 8 8 3 5 2 4 6 10 8 4 3 4 8 5 3 5 11 2 6 6 14
ata-miR171a-5p UGGUAUUGUUUCGGCUCAUG 20 130 3 19 1    0 0 2 1 1 0 3 3 0 0 4 5 0 4 5 0 1 0 2 0 2 9 0 2 1 0 9 0 5 1 1 3 2 19 0 1 1 3 0 3 0 5 1 2 0 8 1 0 0 0 4 1 0 2 3 0 0 0 1 0 0 0 0 0 1 0 1 1 1 0 3 2
ata-miR171b-3p UGAUUGAGCCGUGCCAAUAUC 21 15,230 212 379 91    168 221 261 185 182 301 187 181 379 282 282 265 170 341 163 110 167 243 178 159 282 135 137 224 202 278 312 242 219 288 234 144 322 328 176 197 121 262 253 132 170 286 176 203 281 225 152 325 153 179 198 191 192 293 170 142 206 252 91 147 108 227 188 208 187 170 180 258 143 206 164 246
ata-miR171b-5p UGUUGGCAUGGCUCAAUCAAA 21 4 1 1 1    0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0
ata-miR171c-3p UUGAGCCGUGCCAAUAUCACG 21 3,723 52 190 17    30 58 35 30 25 53 31 33 31 50 42 38 37 96 17 27 24 86 41 22 25 61 36 27 29 30 167 50 113 33 32 28 43 190 24 34 28 120 38 46 30 102 40 52 43 111 29 47 27 70 43 36 28 123 26 33 29 156 33 34 21 100 42 35 40 114 33 47 29 128 35 47
ata-miR171c-5p CGGUAUUGGUGCGGUUCAAUC 21 372 6 65 1    2 5 4 2 3 2 1 3 4 2 2 2 7 10 4 1 6 9 1 4 4 12 2 2 2 4 26 3 27 1 0 6 3 65 1 6 0 21 2 3 3 7 1 5 0 13 3 4 2 3 1 1 1 5 1 0 2 16 0 2 0 5 4 1 1 8 1 4 3 3 2 6
ata-miR171d-3p UGAUUGAGCCGUGCCAAUAUC 21 15,230 212 379 91    168 221 261 185 182 301 187 181 379 282 282 265 170 341 163 110 167 243 178 159 282 135 137 224 202 278 312 242 219 288 234 144 322 328 176 197 121 262 253 132 170 286 176 203 281 225 152 325 153 179 198 191 192 293 170 142 206 252 91 147 108 227 188 208 187 170 180 258 143 206 164 246
ata-miR171d-5p UGUUGGCUCGACUCACUCAGA 21 639 9 23 2    10 5 19 10 13 2 14 6 23 6 18 19 0 2 14 9 6 5 9 8 6 5 7 14 10 8 3 10 4 14 4 13 18 7 7 8 3 7 11 7 9 5 16 12 14 8 5 11 5 6 6 7 7 8 10 9 12 10 6 8 6 3 13 4 9 6 10 18 9 5 10 8
ata-miR172a-3p AGAAUCUUGAUGAUGCUGCGU 21 15 1 3 1    0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 2 0 0 0 0 0 1 0 0 1 1 0 1 0 1 0 3 1
ata-miR172a-5p GCGGCACCAUCAAGAUUCACA 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR172b-3p AGAAUCUUGAUGAUGCUGCAU 21 20,808 289 905 47    78 157 344 125 128 132 123 150 317 235 264 147 74 190 195 47 99 191 145 109 207 110 148 135 271 197 303 161 139 256 122 63 217 252 171 163 145 257 242 117 259 374 139 247 383 315 257 722 368 732 432 477 267 905 477 238 248 502 324 158 406 559 431 398 474 695 455 745 446 549 465 435
ata-miR172b-5p GCAGCACCACCAAGAUUCACA 21 2,016 28 65 4    43 18 37 38 28 14 41 48 15 21 50 16 32 10 59 39 35 32 56 30 32 14 65 43 37 24 15 38 27 23 43 33 35 24 52 24 47 24 29 37 37 18 34 36 34 21 61 49 8 21 9 32 18 20 5 13 13 16 13 12 4 24 23 25 13 12 20 17 10 29 9 32
ata-miR172c-3p GGAAUCUUGAUGAUGCUGCAU 21 24 1 2 1    1 0 0 0 0 2 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 1 0 1 0 1 0 2 0 1 0 0 0 0 0 2 2 0 0 0 1 1 0 1 0 0 1 1 0 0 1 0 0 1 0 1 0 0 1 0 0 0 0 0 0 0
ata-miR172c-5p GUGGCAUCAUCAAGAUUCACACA 23 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR2118a-3p GGGAAUGGGAACAUGGAGGAA 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR2118a-5p UUCCUAAUGUCUCCCAUUCCUA 22 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR2118b-3p GGGAAUGGGAACAUGGAGGAA 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR2118b-5p UUCCCGAUGCCUCCCAUUCCUA 22 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR2118c-3p UUCCUGAUGCCUCCCAUGCCUA 22 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR2118d-3p UUCCUGAUGCCUCCCAUGCCUA 22 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR2275a-3p UUUGUUUUUCUCCAAUAUCUCA 22 4 1 2 1    0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR2275a-5p UGAGUGUUCGAGGAAAGCAA 20 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR2275b-3p CUUGUUUUCCUCCAAUAUCUCA 22 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR2275b-5p AGAGUUGGAGGAAAACAAACA 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR2275c-3p UUUGGUUUCCUCCAAUAUCUCA 22 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR2275c-5p AGUGUUGGAUGGGACCAAAUC 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR319-3p ACUGGAUGACGCGGGAGCUAA 21 24 3 7 1    0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 2 0 0 0 7 0 0 0 0 0 0 2 0 0 0 0 7 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0
ata-miR319-5p AGCUGCCGAUUCAUUCAUUCA 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR390-3p CGCUAUCUAUCCUGAGCUCC 20 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR390-5p AAGCUCAGGAGGGAUAGCGCC 21 6,730 93 225 26    81 108 138 70 139 81 111 51 165 144 86 85 28 123 66 75 75 130 73 61 96 117 108 90 104 181 183 76 225 88 88 106 133 224 85 95 62 142 80 88 104 138 105 90 181 126 81 126 69 31 63 72 52 61 54 61 74 66 81 97 26 35 101 93 66 45 69 62 51 44 61 84
ata-miR393-3p CAGUGCAAUCCCUUUGGAAUU 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR393-5p UUCCAAAGGGAUCGCAUUGAU 21 265,092 3,682 7,939 1,256    2,717 2,906 5,801 2,566 4,163 3,024 2,787 1,935 3,918 3,988 3,677 3,676 1,256 3,124 1,495 1,262 2,537 3,534 2,453 1,702 3,812 2,060 2,205 2,753 5,621 5,311 7,939 3,610 3,839 4,000 2,904 1,982 3,946 4,393 3,296 3,838 1,943 3,732 3,751 2,887 4,239 4,192 2,901 3,180 4,572 3,768 2,361 6,004 4,850 3,595 5,181 4,008 3,055 4,391 5,195 5,233 2,660 3,777 3,362 4,699 4,304 2,887 4,651 3,843 4,480 4,214 3,521 5,528 6,074 3,608 3,894 4,522
ata-miR394-3p AGGUGGGCAUACUGCCAAUGG 21 21 1 2 1    0 0 2 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 2 2 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 1 1 0 2 1 1 0 0 0 0 1 0 0 0 0 0 0 0 1 0 0 0
ata-miR394-5p UUGGCAUUCUGUCCACCUCC 20 9,328 130 266 35    67 129 210 100 85 145 92 136 169 224 179 180 46 184 116 35 80 175 108 104 165 107 98 169 182 205 166 165 91 172 101 55 199 127 104 102 92 125 124 116 140 152 121 156 247 132 87 266 140 100 136 131 80 153 126 102 120 110 66 95 67 112 132 154 89 87 130 158 93 74 131 212
ata-miR395a-3p UGAAGUGUUUGGGGGAACUC 20 25,376 352 2,284 37    43 53 215 119 202 45 208 192 363 73 554 788 80 38 474 157 1,316 222 371 90 245 47 90 828 390 151 46 752 51 146 130 193 2,284 67 1,049 119 497 63 90 154 366 183 353 446 366 109 97 921 600 37 624 142 1,543 47 513 48 440 197 217 432 304 69 1,753 332 308 84 756 118 97 82 151 646
ata-miR395a-5p GUUCCCUUCAAGCACUUCAGG 21 1,590 28 436 1    0 0 4 1 3 0 9 0 3 2 18 78 2 0 1 1 201 5 3 0 11 2 2 4 24 6 0 9 0 2 0 1 24 0 122 0 10 0 2 0 10 4 8 9 9 0 2 74 43 2 100 1 42 5 73 6 3 6 17 54 9 4 436 12 7 2 24 9 1 0 7 61
ata-miR395b-3p AAGUGUUUGGGGGAACUC 18 4 1 1 1    0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR395b-5p GUUCCCUGCAAACACUUCACG 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR395c-3p UGAAGUGUUUGGGGGAACUC 20 25,376 352 2,284 37    43 53 215 119 202 45 208 192 363 73 554 788 80 38 474 157 1,316 222 371 90 245 47 90 828 390 151 46 752 51 146 130 193 2,284 67 1,049 119 497 63 90 154 366 183 353 446 366 109 97 921 600 37 624 142 1,543 47 513 48 440 197 217 432 304 69 1,753 332 308 84 756 118 97 82 151 646
ata-miR395c-5p GUUCUCCUCAAAUCACUUCA 20 2 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR395d-3p UGAAGUGUUUGGGGGAACUC 20 25,376 352 2,284 37    43 53 215 119 202 45 208 192 363 73 554 788 80 38 474 157 1,316 222 371 90 245 47 90 828 390 151 46 752 51 146 130 193 2,284 67 1,049 119 497 63 90 154 366 183 353 446 366 109 97 921 600 37 624 142 1,543 47 513 48 440 197 217 432 304 69 1,753 332 308 84 756 118 97 82 151 646
ata-miR395d-5p AGUUCCCUUCAAGCACUUUACG 22 1,591 22 137 1    6 12 12 7 15 6 14 4 15 24 26 17 6 6 9 5 71 38 28 8 7 12 5 35 33 6 7 32 7 11 11 8 85 11 90 8 32 3 8 6 24 18 23 16 18 13 14 40 53 1 34 9 137 6 21 5 9 20 15 54 25 9 75 10 21 14 77 29 7 11 9 28
ata-miR395e-3p UGAAGUGUUUGGGGGAACUC 20 25,376 352 2,284 37    43 53 215 119 202 45 208 192 363 73 554 788 80 38 474 157 1,316 222 371 90 245 47 90 828 390 151 46 752 51 146 130 193 2,284 67 1,049 119 497 63 90 154 366 183 353 446 366 109 97 921 600 37 624 142 1,543 47 513 48 440 197 217 432 304 69 1,753 332 308 84 756 118 97 82 151 646
ata-miR395e-5p GUUCCUUACAAGCACUUCACG 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR395f-3p UGAAGUGUUUGGGGGAACUC 20 25,376 352 2,284 37    43 53 215 119 202 45 208 192 363 73 554 788 80 38 474 157 1,316 222 371 90 245 47 90 828 390 151 46 752 51 146 130 193 2,284 67 1,049 119 497 63 90 154 366 183 353 446 366 109 97 921 600 37 624 142 1,543 47 513 48 440 197 217 432 304 69 1,753 332 308 84 756 118 97 82 151 646
ata-miR395f-5p GUUCCCUUCAAGCACUUCAGG 21 1,590 28 436 1    0 0 4 1 3 0 9 0 3 2 18 78 2 0 1 1 201 5 3 0 11 2 2 4 24 6 0 9 0 2 0 1 24 0 122 0 10 0 2 0 10 4 8 9 9 0 2 74 43 2 100 1 42 5 73 6 3 6 17 54 9 4 436 12 7 2 24 9 1 0 7 61
ata-miR396a-3p GUUCAAGAAAGUCCUUGGAAA 21 33 1 4 1    1 0 1 0 0 0 0 0 1 2 1 1 2 2 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 2 0 0 4 0 0 0 0 1 0 0 0 0 0 0 1 1 0 0 1 1 0 1 1 0 0 0 0 0 0 0 1 0 1 0 2 1 0 1 1 0 0
ata-miR396a-5p UCCACAGGCUUUCUUGAACUG 21 368,808 5,122 14,988 2,203    3,996 6,795 7,047 4,246 3,992 7,885 4,031 3,574 4,567 8,124 6,135 4,901 2,203 8,495 3,653 2,674 3,325 8,974 3,931 3,530 4,923 6,079 3,757 4,890 4,739 5,265 14,988 4,735 11,056 4,410 4,848 3,365 5,230 11,190 5,574 4,921 3,556 8,134 5,038 3,803 4,951 7,211 3,320 3,976 6,323 8,138 2,956 5,087 4,191 5,703 4,862 3,924 4,105 7,012 3,777 3,756 3,037 5,995 2,614 3,779 3,358 4,732 4,026 4,054 4,400 5,286 3,607 5,530 3,993 4,960 2,826 4,740
ata-miR396b-3p GUUCAAGAAAGUCCUUGGAA 20 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR396b-5p UCCACAGGCUUUCUUGAACUG 21 368,808 5,122 14,988 2,203    3,996 6,795 7,047 4,246 3,992 7,885 4,031 3,574 4,567 8,124 6,135 4,901 2,203 8,495 3,653 2,674 3,325 8,974 3,931 3,530 4,923 6,079 3,757 4,890 4,739 5,265 14,988 4,735 11,056 4,410 4,848 3,365 5,230 11,190 5,574 4,921 3,556 8,134 5,038 3,803 4,951 7,211 3,320 3,976 6,323 8,138 2,956 5,087 4,191 5,703 4,862 3,924 4,105 7,012 3,777 3,756 3,037 5,995 2,614 3,779 3,358 4,732 4,026 4,054 4,400 5,286 3,607 5,530 3,993 4,960 2,826 4,740
ata-miR396c-3p GGUCAAGAAAGCUGUGGGAAG 21 2,324 33 285 1    59 32 11 101 22 10 19 19 44 7 67 28 30 10 26 25 38 13 24 174 13 33 9 124 87 18 4 235 13 25 6 18 35 7 28 17 225 9 32 19 8 6 21 65 95 9 285 33 2 3 1 7 3 4 4 2 7 1 1 6 1 1 6 10 3 2 3 3 0 2 7 7
ata-miR396c-5p UUCCACAGCUUUCUUGAACUU 21 32,260 448 1,151 181    374 611 615 453 378 684 348 354 408 720 501 450 363 646 417 326 313 765 327 389 507 661 376 496 369 440 1,008 397 1,059 389 442 349 549 1,151 454 460 375 651 472 317 427 559 402 463 666 673 329 444 288 395 381 268 345 454 249 344 304 441 218 327 269 404 330 418 360 276 244 290 310 345 181 492
ata-miR396d-3p GUUCAAGAAAGCCCAUGGAAA 21 170 3 9 1    1 0 6 2 0 0 1 1 3 2 8 3 2 0 4 0 2 2 5 0 1 0 4 2 0 6 4 2 2 2 2 1 3 2 9 3 2 3 3 0 3 5 3 4 3 3 1 4 2 6 3 2 3 4 3 2 1 5 1 1 0 4 1 2 2 2 2 1 1 2 0 1
ata-miR396d-5p UCCACAGGCUUUCUUGAACUG 21 368,808 5,122 14,988 2,203    3,996 6,795 7,047 4,246 3,992 7,885 4,031 3,574 4,567 8,124 6,135 4,901 2,203 8,495 3,653 2,674 3,325 8,974 3,931 3,530 4,923 6,079 3,757 4,890 4,739 5,265 14,988 4,735 11,056 4,410 4,848 3,365 5,230 11,190 5,574 4,921 3,556 8,134 5,038 3,803 4,951 7,211 3,320 3,976 6,323 8,138 2,956 5,087 4,191 5,703 4,862 3,924 4,105 7,012 3,777 3,756 3,037 5,995 2,614 3,779 3,358 4,732 4,026 4,054 4,400 5,286 3,607 5,530 3,993 4,960 2,826 4,740
ata-miR396e-3p GUUCAAUAAAGCUGUGGGAAA 21 12 1 2 1    0 0 0 0 0 0 1 1 0 0 0 0 0 0 1 0 1 0 0 0 1 0 0 0 0 0 0 0 2 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1
ata-miR396e-5p UUCCACAGCUUUCUUGAACUG 21 2,153 30 89 10    21 53 57 22 17 51 26 27 36 48 30 41 28 48 32 15 32 64 31 29 36 30 18 27 27 30 89 27 33 35 39 14 49 60 33 41 33 34 33 23 22 28 15 28 34 45 10 39 15 28 32 21 25 21 14 20 26 30 18 17 14 23 28 23 18 13 15 20 28 30 14 20
ata-miR398f-3p UGUGUUCUCAGGUCGCCCCCG 21 104,782 1,455 4,640 136    861 136 660 597 669 358 1,707 943 649 325 2,078 662 936 203 1,059 635 859 268 1,205 1,215 530 252 1,243 580 661 648 867 838 1,072 699 1,317 573 387 1,783 1,419 514 690 1,216 798 492 683 821 852 1,205 447 1,223 960 568 2,723 2,012 4,523 3,514 4,218 2,310 2,963 1,962 3,885 2,990 3,051 3,001 1,855 4,640 2,993 2,695 2,074 1,351 3,499 1,560 702 1,865 3,064 1,969
ata-miR398f-5p GGGUCGAACUGAGAACACAUG 21 83,366 1,158 7,075 5    747 5 852 622 567 18 1,554 617 538 19 851 534 367 36 503 538 742 127 798 580 338 79 723 527 754 648 110 798 214 701 607 517 461 267 674 413 554 200 498 540 329 183 618 649 421 193 580 613 5,165 894 6,003 3,852 4,128 923 7,075 3,422 3,732 1,011 5,533 5,166 1,347 837 1,094 822 1,372 529 1,459 1,161 644 540 1,856 977
ata-miR398g-3p UGUGUUCUCAGGUCGCCCCCG 21 104,782 1,455 4,640 136    861 136 660 597 669 358 1,707 943 649 325 2,078 662 936 203 1,059 635 859 268 1,205 1,215 530 252 1,243 580 661 648 867 838 1,072 699 1,317 573 387 1,783 1,419 514 690 1,216 798 492 683 821 852 1,205 447 1,223 960 568 2,723 2,012 4,523 3,514 4,218 2,310 2,963 1,962 3,885 2,990 3,051 3,001 1,855 4,640 2,993 2,695 2,074 1,351 3,499 1,560 702 1,865 3,064 1,969
ata-miR398g-5p GGGUCGAGCUGGGAACACAUG 21 153,975 2,139 15,213 14    882 21 1,047 672 589 14 2,677 984 647 21 1,411 517 582 75 771 473 1,023 311 1,281 704 397 217 1,126 548 780 690 157 936 406 725 897 582 514 474 1,017 330 897 401 625 657 426 347 925 868 406 367 878 519 9,863 1,510 12,006 10,295 11,272 1,834 12,597 6,466 9,715 2,544 15,213 10,809 1,893 1,891 1,585 1,379 1,700 693 2,443 1,313 582 874 2,563 1,121
ata-miR399a-3p UGCCAAAGGAGAAUUGCCCUG 21 8,294 115 275 28    73 101 124 147 91 51 118 140 178 86 131 172 74 33 142 95 93 98 118 177 144 105 54 186 35 159 28 101 48 110 85 160 87 45 106 141 58 236 118 96 138 152 127 134 157 113 55 56 154 205 117 92 142 275 76 97 62 209 75 171 66 227 115 85 100 164 69 80 53 186 73 125
ata-miR399a-5p GGGCGCUUCUCCAUUGGCACGG 22 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0
ata-miR399b-3p UGCCAAAGGAGAAUUGCCCUG 21 8,294 115 275 28    73 101 124 147 91 51 118 140 178 86 131 172 74 33 142 95 93 98 118 177 144 105 54 186 35 159 28 101 48 110 85 160 87 45 106 141 58 236 118 96 138 152 127 134 157 113 55 56 154 205 117 92 142 275 76 97 62 209 75 171 66 227 115 85 100 164 69 80 53 186 73 125
ata-miR399b-5p CAGGGCGCUUCUCCUUUGGCA 21 27 2 5 1    0 0 1 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 0 0 2 0 1 0 0 0 0 0 0 1 1 0 5 0 0 0 2 0 0 0 4 0 0 0 3 0 0 0 2 1 1
ata-miR408-3p UGCACUGCCUCUUCCCUGCC 20 24 2 8 1    0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 1 0 0 0 0 2 0 1 0 0 0 0 0 0 0 1 0 0 0 3 1 0 0 1 0 0 8 1 0 0 0 0 1 0 1 0 0
ata-miR408-5p CAGGGAUGGAGCAGAGCAAGG 21 5 1 2 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 1 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR5062a-3p GUGGAUUUUUCACCAAGAUUCAAG 24 37 1 4 1    0 0 0 0 2 0 0 1 0 0 0 1 2 0 0 1 1 0 0 0 0 0 2 1 0 0 3 1 0 0 1 0 1 4 0 0 1 0 1 1 0 0 0 0 1 0 0 0 2 0 0 1 0 0 0 1 1 0 0 0 0 0 1 1 0 3 0 0 1 0 0 1
ata-miR5062a-5p UGAACCUUAGGGAAAAGCCGCAU 23 18,950 263 414 131    210 240 344 231 380 169 213 172 301 270 264 278 159 230 170 142 266 209 198 228 325 131 181 329 316 291 237 263 254 272 257 225 343 237 251 286 194 262 283 283 293 189 306 270 332 268 200 386 227 234 260 276 263 226 242 298 265 198 255 313 304 227 411 414 354 210 307 315 327 267 333 286
ata-miR5062b-3p UGAACCUUAGGGAAAAGCCGCAU 23 18,950 263 414 131    210 240 344 231 380 169 213 172 301 270 264 278 159 230 170 142 266 209 198 228 325 131 181 329 316 291 237 263 254 272 257 225 343 237 251 286 194 262 283 283 293 189 306 270 332 268 200 386 227 234 260 276 263 226 242 298 265 198 255 313 304 227 411 414 354 210 307 315 327 267 333 286
ata-miR5062b-5p GCGGAUUUUUCACCAAGAUUCAAG 24 1,872 26 48 2    38 0 23 28 43 6 26 20 23 2 35 35 41 27 17 12 31 30 26 36 39 14 13 21 29 29 26 32 9 35 20 37 38 11 30 37 32 14 28 25 29 11 29 31 38 20 38 38 19 12 20 25 33 25 16 21 24 20 19 41 26 37 47 48 17 16 32 32 24 28 13 25
ata-miR5070-3p UUGAACUAAGUAGGGUCGGAG 21 312 6 33 1    0 0 4 2 3 2 3 0 17 2 6 8 0 0 17 7 6 5 2 1 6 0 5 10 4 12 1 11 2 2 11 14 33 0 5 0 2 2 0 3 0 0 5 4 13 1 3 7 4 0 0 1 0 1 2 2 3 1 2 2 1 0 17 9 4 0 2 5 5 0 1 9
ata-miR5070-5p UCUGACCCUUCUUAGUUCAAC 21 90 2 7 1    0 0 0 0 0 0 0 0 4 4 1 2 0 0 4 1 4 0 1 0 2 0 2 4 1 3 0 4 2 0 2 4 4 0 3 1 0 0 1 1 0 0 0 2 1 1 0 6 3 0 1 0 0 0 0 1 3 0 0 0 1 0 7 0 1 0 1 1 2 1 0 3
ata-miR5084-3p ACCAUACGGUACUGCAGAGGAUC 23 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR5084-5p AUCCUCUACAGUACUGUACGGUGC 24 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR5168-3p UCGGACCAGGCUUCAAUCCCU 21 115,502 1,604 2,368 990    1,304 1,363 1,531 1,251 1,315 990 1,569 1,782 1,988 1,550 1,880 1,225 1,058 1,240 1,982 1,178 1,179 1,373 1,154 1,837 1,816 1,530 1,521 1,608 1,586 1,341 1,564 1,536 1,328 1,694 1,440 1,350 1,595 2,283 1,415 1,574 1,446 1,760 2,253 1,471 1,987 1,627 1,466 2,125 1,897 1,483 1,518 1,892 1,263 1,511 1,498 1,699 1,699 1,838 1,280 1,461 1,742 1,756 1,520 1,433 1,403 1,623 1,891 2,097 2,368 1,794 2,351 1,625 1,217 1,711 1,654 2,213
ata-miR5168-5p GGGUUGUUGUCUGGUUCAAGG 21 38,892 540 1,221 9    402 28 619 608 417 18 679 845 930 24 925 532 289 21 1,221 413 414 14 661 800 644 9 613 772 684 696 41 619 75 617 687 581 1,016 48 878 594 806 303 723 808 783 220 976 1,113 924 225 717 693 586 265 577 706 705 198 469 548 924 256 648 628 337 295 600 785 557 148 652 451 333 265 529 705
ata-miR5181-3p CACUUAUUUUGGACCGGAGGG 21 31 1 2 1    0 0 1 1 0 0 0 0 0 0 0 2 0 2 1 0 0 0 0 0 0 0 0 0 1 1 0 2 0 0 0 1 0 2 1 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 1 1 0 1 0 0 2 2 0 0 1 0 0 1 1 0 0 1 0 2 1
ata-miR5181-5p UCCGAUCCAGAAUAAGUGUCG 21 46 2 3 1    0 0 0 2 3 2 0 0 1 2 0 0 2 0 0 1 0 2 0 0 0 0 2 0 1 0 1 0 0 0 0 1 1 2 0 0 0 2 0 0 0 2 0 0 1 1 0 1 0 0 1 0 0 1 0 0 0 0 0 0 0 3 1 1 1 0 1 3 1 2 1 0
ata-miR5200-3p UGUAGAUACUCCCUAAGGCUU 21 236,732 3,288 6,393 754    3,115 2,724 4,360 4,505 2,838 2,552 3,822 5,426 4,447 2,453 5,027 4,651 4,902 3,396 6,393 3,256 3,011 3,568 3,749 5,081 5,289 3,972 2,882 4,752 2,230 3,410 1,403 3,565 2,295 3,930 4,581 3,873 4,087 3,149 2,677 3,978 4,171 1,741 5,983 3,751 3,788 1,861 4,227 5,764 5,113 1,775 3,875 3,964 1,709 1,270 2,281 2,601 2,838 1,628 1,802 2,173 3,568 1,648 2,331 2,381 1,472 1,332 2,919 3,952 2,254 754 2,744 2,463 1,731 1,234 2,533 5,752
ata-miR5200-5p AAGCCUUAGUGAAUAUCUACA 21 1,729 24 49 7    28 18 38 38 35 22 31 24 12 19 41 33 37 15 23 20 19 20 36 19 30 14 18 38 21 26 15 21 7 26 39 31 13 26 33 42 26 9 49 23 39 13 26 31 26 9 33 40 15 7 26 16 26 8 31 30 17 13 31 14 27 9 19 20 34 14 17 18 21 8 23 33
ata-miR528-3p CCUGUGCCUGCCUCUUCCAUU 21 10,225 146 586 4    113 0 117 96 95 0 188 115 74 4 116 85 54 6 61 57 103 43 112 104 59 26 83 105 160 140 10 147 46 141 87 113 106 65 113 95 92 60 106 87 61 40 105 142 98 49 89 87 496 77 539 335 522 184 479 410 443 176 373 586 137 144 121 150 200 82 157 117 56 119 137 130
ata-miR528-5p UGGAAGGGGCAUGCAGAGGAG 21 89,920 1,249 4,296 81    895 81 714 701 346 124 1,070 1,408 1,169 207 2,784 539 1,036 84 1,340 238 864 279 1,276 1,539 621 220 342 857 1,072 709 234 1,233 355 2,148 958 460 1,332 1,582 404 229 916 854 1,210 566 582 1,139 341 1,566 1,366 670 719 1,625 2,399 1,600 3,161 2,743 3,644 1,649 2,242 1,507 3,171 2,461 1,632 1,308 709 3,360 2,301 1,241 1,761 595 4,296 1,139 383 869 1,845 2,900
ata-miR6201-3p GUACGAGUGUCUCAGGGCCAA 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR6201-5p UGACCCUGAGGCACUCAUACCG 22 122 2 7 1    3 0 4 0 3 2 2 1 1 4 2 4 0 0 4 3 2 4 4 5 4 0 2 4 1 1 0 1 4 0 3 0 7 0 1 0 1 2 4 4 1 2 2 1 1 0 3 5 0 1 1 0 3 0 1 1 1 0 1 1 1 0 0 1 0 3 2 0 1 0 1 1
ata-miR9672-3p UACCACGACUGUCAUUAAGCA 21 152,270 2,115 7,116 921    1,690 2,408 1,679 2,695 1,278 1,586 1,772 4,119 2,737 2,207 3,434 2,085 3,716 1,938 7,116 1,640 2,416 2,413 2,253 2,956 2,655 1,917 1,979 2,306 1,794 1,509 921 2,444 1,703 2,414 2,502 1,567 2,666 1,496 2,090 1,361 3,627 1,969 2,620 2,577 2,371 1,917 2,586 4,072 3,968 1,654 2,394 2,188 1,286 1,484 1,228 1,824 1,685 1,459 1,009 1,100 1,870 1,646 1,177 1,322 925 1,747 2,037 2,231 1,489 1,156 1,864 1,351 1,040 1,765 1,190 2,980
ata-miR9672-5p CUUAAUGACAGUCGUGGUGUC 21 37,029 514 1,011 167    300 247 484 546 371 167 389 820 707 278 696 533 410 238 712 228 489 281 537 505 706 189 412 424 584 504 263 618 241 666 539 400 716 252 543 428 682 517 764 591 765 523 549 900 1,011 440 501 724 593 436 576 574 570 543 426 452 595 573 397 391 357 519 580 741 489 458 561 600 405 550 405 848
ata-miR9674a-3p GUAAGAUGGCUGAUGCUAUGG 21 14 1 4 1    0 0 0 0 0 0 0 0 0 0 0 0 0 4 0 0 1 0 0 0 0 0 2 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0
ata-miR9674a-5p AUAGCAUCAUCCAUCCUACCC 21 730,495 10,146 18,080 6,268    9,982 12,879 7,792 8,146 7,317 12,210 7,962 10,312 10,464 14,416 11,320 8,105 11,833 16,618 7,638 6,290 7,931 14,535 7,136 8,327 10,541 11,412 7,541 9,252 7,916 8,401 14,213 9,553 12,280 10,379 9,622 7,054 9,503 17,052 7,342 7,608 6,946 13,635 9,192 7,473 8,110 14,472 7,674 11,524 9,895 13,560 8,480 11,851 8,047 11,426 7,933 11,789 11,099 18,080 6,268 8,219 12,018 12,348 7,896 8,625 6,909 15,123 8,874 12,689 10,199 10,272 10,907 10,582 6,276 10,635 8,785 11,802
ata-miR9674b-3p UGAAUUUGUCCAUAGCAUCAG 21 353,771 4,913 8,640 2,713    4,195 5,616 4,933 4,877 3,450 5,419 3,481 5,364 4,332 6,240 6,400 5,063 5,764 6,739 5,154 3,442 3,883 7,306 4,180 5,094 6,008 4,661 3,298 4,859 3,955 3,490 7,009 4,726 7,318 4,656 4,729 3,423 4,573 8,640 4,319 4,087 4,701 6,881 4,720 4,189 4,308 6,164 3,165 5,311 5,398 6,887 3,507 4,813 4,823 5,521 5,188 4,974 6,781 7,217 3,389 3,778 5,409 7,464 2,713 2,802 3,892 5,889 4,035 5,203 4,924 4,514 3,472 5,327 3,100 4,580 2,817 5,232
ata-miR9674b-5p GGUGCUAUGGAUAGCUUCAAC 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR9674c-3p GGUGCUAUGGAUAAAUUCAAC 21 2,985 41 69 14    52 30 27 34 69 14 33 39 33 28 41 36 43 54 17 33 47 41 52 31 55 23 49 32 44 60 60 43 51 56 44 40 41 52 52 58 32 34 40 35 48 49 31 47 26 36 52 38 62 31 34 23 33 25 53 49 47 47 53 53 58 53 34 27 58 48 33 17 44 46 39 36
ata-miR9674c-5p UGAAUUUUUCCAUAGCAUCAG 21 7,036 98 154 42    121 99 101 136 98 114 96 115 74 99 127 109 106 100 84 77 109 120 93 119 121 96 90 122 105 73 144 110 154 100 100 76 104 134 119 127 107 132 124 91 91 90 65 94 91 131 67 99 117 66 93 114 130 93 64 72 90 111 46 48 89 80 75 85 85 76 57 107 70 87 42 85
ata-miR9677-3p UGGCCGUUGGUAGAGUAGGAGA 22 4,047 56 98 33    47 35 67 51 56 35 46 52 76 65 64 50 54 52 98 37 63 59 41 46 50 33 38 77 42 65 71 67 73 50 64 51 81 82 44 41 64 70 67 37 62 64 63 40 64 70 56 58 38 44 38 47 55 77 36 34 63 75 63 60 44 57 71 54 48 53 56 60 59 65 54 58
ata-miR9677-5p UUCCACUCUACCAACAGCCACG 22 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR9772a-3p AGGGGGCAAUCUCACCUCAAC 21 844 12 30 2    8 5 10 9 3 2 3 6 9 2 7 10 19 10 5 0 7 5 7 8 10 0 5 6 6 6 9 6 9 13 6 5 6 2 7 9 4 14 9 6 9 15 5 22 9 4 11 8 30 28 28 27 28 19 19 19 29 27 17 17 16 27 23 22 21 10 15 17 7 14 9 19
ata-miR9772a-5p UGAGAUGAGAUUACCCCAUAC 21 326,279 4,532 10,642 997    2,104 2,032 6,583 2,219 3,264 2,745 1,984 2,149 4,399 4,167 3,025 3,770 1,573 4,017 1,289 997 2,237 3,339 1,865 1,741 3,984 1,509 1,373 2,475 4,027 3,683 7,835 3,677 3,298 3,553 2,727 1,863 3,733 3,967 2,416 3,047 1,662 4,112 3,308 2,052 3,623 4,909 2,156 2,590 3,736 5,782 1,962 5,519 6,350 9,610 10,275 4,707 4,780 10,642 9,034 6,252 5,391 7,975 3,573 4,290 8,435 8,065 6,818 5,827 9,742 9,121 5,676 7,581 9,143 10,107 7,635 5,173
ata-miR9772b-3p AGGGGGCAAUCUCACCUCAAC 21 844 12 30 2    8 5 10 9 3 2 3 6 9 2 7 10 19 10 5 0 7 5 7 8 10 0 5 6 6 6 9 6 9 13 6 5 6 2 7 9 4 14 9 6 9 15 5 22 9 4 11 8 30 28 28 27 28 19 19 19 29 27 17 17 16 27 23 22 21 10 15 17 7 14 9 19
ata-miR9772b-5p UGAGAUGAGAUUACCCCAUAC 21 326,279 4,532 10,642 997    2,104 2,032 6,583 2,219 3,264 2,745 1,984 2,149 4,399 4,167 3,025 3,770 1,573 4,017 1,289 997 2,237 3,339 1,865 1,741 3,984 1,509 1,373 2,475 4,027 3,683 7,835 3,677 3,298 3,553 2,727 1,863 3,733 3,967 2,416 3,047 1,662 4,112 3,308 2,052 3,623 4,909 2,156 2,590 3,736 5,782 1,962 5,519 6,350 9,610 10,275 4,707 4,780 10,642 9,034 6,252 5,391 7,975 3,573 4,290 8,435 8,065 6,818 5,827 9,742 9,121 5,676 7,581 9,143 10,107 7,635 5,173
ata-miR9776-3p GCACAUCCAUGUCCAAGCUCU 21 39 2 5 1    2 0 1 0 0 2 0 1 1 4 1 0 0 0 0 1 5 2 0 0 0 0 4 1 0 0 4 1 2 0 0 0 1 0 1 0 0 0 0 0 2 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 0 0 0 0 0 0
ata-miR9776-5p AGCUUGGACGAGGAUGUGCAA 21 3,432 48 143 10    143 65 63 52 71 37 80 35 75 45 83 39 91 65 31 40 79 50 67 46 44 51 49 33 89 71 122 75 90 65 57 50 35 123 35 45 46 84 43 35 26 73 32 31 42 62 49 46 16 17 20 23 26 44 16 25 32 45 17 26 16 39 11 16 19 43 10 13 15 38 22 23
ata-miR9783-3p AUAAGCACCGGUGCUUAAGGA 21 1,163 16 28 4    11 7 28 15 16 20 15 18 21 21 25 10 17 25 10 4 10 14 14 5 13 12 9 11 24 23 23 21 24 18 20 6 18 19 15 19 9 14 17 17 22 13 8 10 18 13 20 16 18 18 24 18 8 16 19 12 12 18 12 14 13 12 23 17 23 10 20 11 28 14 19 26
ata-miR9783-5p UUUGAAGCACUGACGCCUAUUUCU 24 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR9863a-3p UGAGAAGGUAGAUCAUAAUAGC 22 82,813 1,150 2,348 332    1,041 332 1,137 1,001 677 440 713 1,224 1,329 711 2,077 923 1,924 675 1,184 347 1,012 815 745 1,448 1,303 682 369 1,247 1,162 691 742 1,121 510 2,158 1,026 631 2,039 1,050 458 488 898 981 1,446 848 1,195 1,302 490 1,346 1,694 867 869 1,974 887 2,348 1,333 1,054 1,415 1,988 1,019 764 1,263 1,789 694 435 1,043 2,127 1,591 807 2,110 1,400 1,975 1,588 1,066 1,882 1,214 1,679
ata-miR9863a-5p UGUUAUGAUCUGCUUCUCAUC 21 10,103 140 347 51    154 62 132 108 125 51 80 124 162 82 179 122 222 121 84 93 117 125 98 96 199 86 85 121 129 121 215 152 119 137 100 75 106 198 99 85 82 149 138 116 113 227 80 134 128 166 94 128 141 254 147 118 164 297 117 108 152 275 130 75 154 227 144 96 191 347 157 151 143 284 152 160
ata-miR9863b-3p UGAGAAGGUAGAUCAUAAUAGC 22 82,813 1,150 2,348 332    1,041 332 1,137 1,001 677 440 713 1,224 1,329 711 2,077 923 1,924 675 1,184 347 1,012 815 745 1,448 1,303 682 369 1,247 1,162 691 742 1,121 510 2,158 1,026 631 2,039 1,050 458 488 898 981 1,446 848 1,195 1,302 490 1,346 1,694 867 869 1,974 887 2,348 1,333 1,054 1,415 1,988 1,019 764 1,263 1,789 694 435 1,043 2,127 1,591 807 2,110 1,400 1,975 1,588 1,066 1,882 1,214 1,679
ata-miR9863b-5p UGUUAUGAUCUGCUUCUCAUC 21 10,103 140 347 51    154 62 132 108 125 51 80 124 162 82 179 122 222 121 84 93 117 125 98 96 199 86 85 121 129 121 215 152 119 137 100 75 106 198 99 85 82 149 138 116 113 227 80 134 128 166 94 128 141 254 147 118 164 297 117 108 152 275 130 75 154 227 144 96 191 347 157 151 143 284 152 160