Ae. tauschii Small RNA miRNA Abundances

The data below are based on the microRNAs listed in the Sanger registry. Adjust libraries/reads to display on the control panel.


        miRNA         miRNA sequence Len Sum (norm) Average Max Min (>0)  TrA_0dCntrl_3TrA_0dHt_3TrA_0dLt_3TrA_0dUV_3TrA_0dCntrl_2TrA_0dHt_2TrA_0dLt_2TrA_0dUV_2TrA_0dCntrl_1TrA_0dHt_1TrA_0dLt_1TrA_0dUV_1TrA_1dCntrl_3TrA_1dHt_3TrA_1dLt_3TrA_1dUV_3TrA_1dCntrl_2TrA_1dHt_2TrA_1dLt_2TrA_1dUV_2TrA_1dCntrl_1TrA_1dHt_1TrA_1dLt_1TrA_1dUV_1TrA_2dCntrl_3TrA_2dHt_3TrA_2dLt_3TrA_2dUV_3TrA_2dCntrl_2TrA_2dHt_2TrA_2dLt_2TrA_2dUV_2TrA_2dCntrl_1TrA_2dHt_1TrA_2dLt_1TrA_2dUV_1TrA_3dCntrl_3TrA_3dHt_3TrA_3dLt_3TrA_3dUV_3TrA_3dCntrl_2TrA_3dHt_2TrA_3dLt_2TrA_3dUV_2TrA_3dCntrl_1TrA_3dHt_1TrA_3dLt_1TrA_3dUV_1TrA_7dCntrl_3TrA_7dHt_3TrA_7dLt_3TrA_7dUV_3TrA_7dCntrl_2TrA_7dHt_2TrA_7dLt_2TrA_7dUV_2TrA_7dCntrl_1TrA_7dHt_1TrA_7dLt_1TrA_7dUV_1TrA_10dCntrl_3TrA_10dHt_3TrA_10dLt_3TrA_10dUV_3TrA_10dCntrl_2TrA_10dHt_2TrA_10dLt_2TrA_10dUV_2TrA_10dCntrl_1TrA_10dHt_1TrA_10dLt_1TrA_10dUV_1
ata-miR1432-3p UUGGUGUCACCUCGCCUGAAC 21 887 12 35 1    8 5 7 2 7 9 10 1 17 6 20 5 4 11 4 1 8 6 4 3 17 2 2 1 13 14 6 8 10 10 17 4 6 14 6 8 12 20 8 3 11 8 5 14 8 16 11 10 17 27 16 14 16 9 20 9 18 28 15 11 34 22 17 20 35 34 23 16 23 32 15 14
ata-miR1432-5p UCAGGAGAGAUGACACCGACG 21 1,701 24 79 3    18 5 17 13 18 11 15 5 17 8 22 10 8 16 4 7 7 15 13 7 20 10 26 5 27 11 22 13 17 19 23 3 11 34 27 12 13 9 9 5 23 8 5 13 7 14 21 22 36 56 59 19 42 29 45 7 34 55 27 25 79 49 45 21 76 54 58 46 35 63 46 30
ata-miR156a-3p GCUCACCCUCUCUCUGUCAGC 21 29,869 415 1,009 89    581 167 335 551 521 171 619 646 615 153 552 1,009 791 182 481 956 554 145 535 523 674 180 717 840 295 435 228 520 233 631 580 774 647 320 455 927 435 409 547 572 443 205 498 481 481 367 458 515 242 143 186 358 376 177 100 243 348 212 230 378 89 357 244 484 235 104 309 230 107 147 154 462
ata-miR156a-5p UGACAGAAGAGAGUGAGCAC 20 42,516 591 1,738 57    455 57 415 483 279 95 492 958 700 157 1,009 494 1,307 164 619 238 448 200 365 674 766 266 150 701 402 369 188 466 146 1,738 489 524 1,290 498 160 288 401 550 738 361 580 531 250 966 879 347 390 1,146 552 873 527 572 806 897 367 452 978 952 262 244 469 1,630 710 503 904 620 1,270 812 336 644 606 1,341
ata-miR156b-3p GCUCAUUUCUCUCUCUGUCAGC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR156b-5p UGACAGAAGAGAGUGAGCAC 20 42,516 591 1,738 57    455 57 415 483 279 95 492 958 700 157 1,009 494 1,307 164 619 238 448 200 365 674 766 266 150 701 402 369 188 466 146 1,738 489 524 1,290 498 160 288 401 550 738 361 580 531 250 966 879 347 390 1,146 552 873 527 572 806 897 367 452 978 952 262 244 469 1,630 710 503 904 620 1,270 812 336 644 606 1,341
ata-miR156c-3p GCUCACUGCUCUAUCUGUCACC 22 329 5 11 1    4 2 2 5 2 0 2 1 6 0 6 4 6 2 3 4 5 4 3 1 6 7 6 4 9 5 9 7 2 4 3 1 7 4 8 1 4 5 3 3 8 5 5 5 10 11 9 5 9 10 5 3 6 6 3 3 2 4 7 3 4 9 2 4 4 4 7 5 2 3 4 2
ata-miR156c-5p UGACAGAAGAGAGUGAGCAC 20 42,516 591 1,738 57    455 57 415 483 279 95 492 958 700 157 1,009 494 1,307 164 619 238 448 200 365 674 766 266 150 701 402 369 188 466 146 1,738 489 524 1,290 498 160 288 401 550 738 361 580 531 250 966 879 347 390 1,146 552 873 527 572 806 897 367 452 978 952 262 244 469 1,630 710 503 904 620 1,270 812 336 644 606 1,341
ata-miR156d-3p GCUCACUCCUCUUUCUGUCAGC 22 417,877 5,804 10,456 366    7,949 366 4,097 7,541 8,567 813 6,167 5,819 6,146 609 7,207 6,625 7,174 373 6,842 8,354 6,139 400 6,115 6,572 9,839 436 9,660 7,856 7,763 5,295 734 8,232 1,347 8,122 8,519 9,960 10,294 1,096 9,339 9,823 9,162 3,283 9,190 9,800 10,456 1,528 9,475 9,565 8,333 3,192 9,795 7,310 3,482 1,816 3,343 7,934 7,973 3,448 1,722 5,259 7,516 3,459 5,723 6,350 2,437 6,127 4,707 9,964 4,217 1,724 6,129 4,495 2,076 2,871 2,887 8,939
ata-miR156d-5p UGACAGAAGAGAGUGAGCAC 20 42,516 591 1,738 57    455 57 415 483 279 95 492 958 700 157 1,009 494 1,307 164 619 238 448 200 365 674 766 266 150 701 402 369 188 466 146 1,738 489 524 1,290 498 160 288 401 550 738 361 580 531 250 966 879 347 390 1,146 552 873 527 572 806 897 367 452 978 952 262 244 469 1,630 710 503 904 620 1,270 812 336 644 606 1,341
ata-miR156e-3p GCUCACCCUCUCUCUGUCAGC 21 29,869 415 1,009 89    581 167 335 551 521 171 619 646 615 153 552 1,009 791 182 481 956 554 145 535 523 674 180 717 840 295 435 228 520 233 631 580 774 647 320 455 927 435 409 547 572 443 205 498 481 481 367 458 515 242 143 186 358 376 177 100 243 348 212 230 378 89 357 244 484 235 104 309 230 107 147 154 462
ata-miR156e-5p UGACAGAAGAGAGUGAGCAC 20 42,516 591 1,738 57    455 57 415 483 279 95 492 958 700 157 1,009 494 1,307 164 619 238 448 200 365 674 766 266 150 701 402 369 188 466 146 1,738 489 524 1,290 498 160 288 401 550 738 361 580 531 250 966 879 347 390 1,146 552 873 527 572 806 897 367 452 978 952 262 244 469 1,630 710 503 904 620 1,270 812 336 644 606 1,341
ata-miR160a-3p GCGUUGGCUCUACCGCGGAUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR160a-5p UGCCUGGCUCCCUGUAUGCCA 21 198,434 2,756 5,151 1,236    1,742 3,775 2,453 2,370 2,778 3,229 2,811 2,585 5,151 4,217 2,895 3,245 1,328 3,465 2,516 1,714 2,327 3,469 2,393 2,148 3,827 3,321 2,881 2,728 2,780 3,301 2,919 2,705 3,464 3,592 2,235 2,775 3,546 4,320 2,680 3,582 2,142 3,838 3,311 2,566 2,946 4,563 2,965 4,082 3,818 2,854 1,677 3,193 1,999 2,557 1,484 1,552 1,825 2,239 1,532 1,988 2,878 2,345 2,298 2,460 1,236 1,739 2,868 2,865 2,197 2,257 2,965 2,211 1,742 2,342 2,345 3,288
ata-miR160b-3p GCGUGCACGGAUCCAAGCAUA 21 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR160b-5p UGCCUGGCUCCCUGUAUGCCA 21 198,434 2,756 5,151 1,236    1,742 3,775 2,453 2,370 2,778 3,229 2,811 2,585 5,151 4,217 2,895 3,245 1,328 3,465 2,516 1,714 2,327 3,469 2,393 2,148 3,827 3,321 2,881 2,728 2,780 3,301 2,919 2,705 3,464 3,592 2,235 2,775 3,546 4,320 2,680 3,582 2,142 3,838 3,311 2,566 2,946 4,563 2,965 4,082 3,818 2,854 1,677 3,193 1,999 2,557 1,484 1,552 1,825 2,239 1,532 1,988 2,878 2,345 2,298 2,460 1,236 1,739 2,868 2,865 2,197 2,257 2,965 2,211 1,742 2,342 2,345 3,288
ata-miR160c-3p GCGUGCAAGGAGCCAAGCAUG 21 796 11 26 1    10 7 11 6 15 0 6 11 17 2 19 18 8 2 23 10 14 8 19 13 12 0 26 10 13 11 2 18 8 17 14 7 11 8 23 8 16 9 7 11 19 9 18 13 14 7 13 22 9 14 8 15 12 17 7 3 12 7 8 9 1 7 7 14 11 6 12 9 2 16 4 21
ata-miR160c-5p UGCCUGGCUCCCUGUAUGCCA 21 198,434 2,756 5,151 1,236    1,742 3,775 2,453 2,370 2,778 3,229 2,811 2,585 5,151 4,217 2,895 3,245 1,328 3,465 2,516 1,714 2,327 3,469 2,393 2,148 3,827 3,321 2,881 2,728 2,780 3,301 2,919 2,705 3,464 3,592 2,235 2,775 3,546 4,320 2,680 3,582 2,142 3,838 3,311 2,566 2,946 4,563 2,965 4,082 3,818 2,854 1,677 3,193 1,999 2,557 1,484 1,552 1,825 2,239 1,532 1,988 2,878 2,345 2,298 2,460 1,236 1,739 2,868 2,865 2,197 2,257 2,965 2,211 1,742 2,342 2,345 3,288
ata-miR164a-3p CACGUGCGCUCCUUCUCCAGC 21 48 2 5 1    0 5 0 2 1 0 2 0 3 2 0 2 0 0 0 0 1 0 0 2 4 0 2 1 1 3 2 0 0 0 0 0 1 0 1 1 2 0 0 0 0 0 0 1 1 0 0 1 0 0 1 0 0 0 1 1 1 0 0 0 0 1 0 0 0 0 0 0 1 0 1 0
ata-miR164a-5p UGGAGAAGCAGGGCACGUGCU 21 1,061 15 45 2    9 2 31 17 14 5 12 16 22 18 20 22 10 16 21 4 8 15 8 13 22 5 11 14 13 23 16 23 16 20 15 11 23 8 5 15 14 15 17 13 18 14 11 18 25 3 13 45 13 21 12 10 17 26 13 10 15 15 8 9 6 13 22 19 15 6 13 16 9 10 15 19
ata-miR164b-3p CAUGUGCCUUUCUUCUCCACC 21 57 2 4 1    1 0 0 1 0 0 0 0 1 2 1 0 2 0 0 0 1 2 3 2 1 2 0 1 2 0 2 0 0 0 2 0 0 4 1 0 0 2 0 0 1 0 2 0 1 1 2 0 0 1 3 0 1 0 0 0 0 1 1 1 0 0 0 1 1 1 3 0 1 1 0 1
ata-miR164b-5p UGGAGAAGCAGGGCACGUGCA 21 2,064 29 66 7    12 22 58 17 18 29 14 29 28 20 43 22 10 24 42 14 11 50 21 34 30 17 7 31 28 21 17 29 21 25 21 12 41 32 15 15 17 15 34 25 18 22 21 41 56 20 11 66 18 34 38 23 38 45 26 29 28 45 19 18 22 61 44 35 44 36 58 31 25 38 35 48
ata-miR164c-3p CACGUGUUCUUCUCCUCCAUC 21 1,098 17 90 1    1 0 25 10 9 2 12 8 6 0 20 10 0 2 8 3 3 0 10 5 7 0 11 17 10 7 2 9 2 13 8 1 9 0 16 6 6 29 16 9 9 9 11 14 13 20 7 18 25 26 33 43 38 28 22 30 15 35 13 21 21 90 23 36 20 32 23 23 17 40 13 18
ata-miR164c-5p UGGAGAAGCAGGGCACGUGCA 21 2,064 29 66 7    12 22 58 17 18 29 14 29 28 20 43 22 10 24 42 14 11 50 21 34 30 17 7 31 28 21 17 29 21 25 21 12 41 32 15 15 17 15 34 25 18 22 21 41 56 20 11 66 18 34 38 23 38 45 26 29 28 45 19 18 22 61 44 35 44 36 58 31 25 38 35 48
ata-miR166a-3p UCGGACCAGGCUUCAUUCCCC 21 174,068 2,418 3,940 1,477    1,888 2,571 1,913 2,172 2,087 2,379 2,115 2,309 2,807 2,717 2,557 2,346 2,115 2,612 3,059 1,656 2,192 2,797 2,136 1,933 2,660 2,280 2,533 2,222 2,437 2,677 2,668 2,273 2,869 2,772 2,044 1,837 2,638 3,940 1,994 2,078 2,358 2,914 2,581 2,254 2,510 3,490 2,656 2,978 3,410 2,459 2,012 2,556 2,347 2,567 1,477 1,640 1,977 2,395 1,724 1,799 2,366 2,550 2,205 2,547 1,764 2,705 2,658 2,775 2,400 2,627 3,098 1,913 2,018 2,686 2,312 3,057
ata-miR166a-5p GGAAUGUUGUCUGGUUCAAGG 21 444 7 33 1    2 5 14 7 2 7 11 4 20 4 33 6 0 0 4 5 4 13 2 2 10 2 7 10 5 21 0 4 4 5 11 1 9 0 12 3 3 2 7 5 5 8 9 6 29 4 4 11 5 1 11 2 5 1 9 1 3 6 3 2 2 0 6 5 4 2 8 8 3 0 4 11
ata-miR166b-3p UCGGACCAGGCUUCAUUCCCC 21 174,068 2,418 3,940 1,477    1,888 2,571 1,913 2,172 2,087 2,379 2,115 2,309 2,807 2,717 2,557 2,346 2,115 2,612 3,059 1,656 2,192 2,797 2,136 1,933 2,660 2,280 2,533 2,222 2,437 2,677 2,668 2,273 2,869 2,772 2,044 1,837 2,638 3,940 1,994 2,078 2,358 2,914 2,581 2,254 2,510 3,490 2,656 2,978 3,410 2,459 2,012 2,556 2,347 2,567 1,477 1,640 1,977 2,395 1,724 1,799 2,366 2,550 2,205 2,547 1,764 2,705 2,658 2,775 2,400 2,627 3,098 1,913 2,018 2,686 2,312 3,057
ata-miR166b-5p GGGAAUGACGCCGGGUCCGAAA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR166c-3p UCGGACCAGGCUUCAUUCCUU 21 10,484 146 237 79    102 109 153 134 139 106 152 120 155 118 196 137 110 127 151 118 92 171 122 116 166 145 172 150 151 152 235 150 122 171 128 135 181 237 102 165 96 190 210 146 183 173 137 196 206 185 104 213 94 126 119 118 135 219 90 104 136 153 83 117 79 198 137 213 154 162 133 158 108 150 100 169
ata-miR166c-5p GGAACGUUGGCUGGCUCGAGG 21 17,118 238 614 5    125 37 391 256 144 5 269 262 275 62 268 216 122 213 197 152 161 169 170 122 227 108 144 257 208 229 614 167 364 213 202 182 307 519 117 167 170 478 206 219 221 395 208 239 317 575 140 262 185 405 230 187 160 408 197 204 219 468 103 154 129 439 254 253 237 370 199 217 197 371 146 315
ata-miR166d-3p UCGGACCAGGCUUCAUUCCCC 21 174,068 2,418 3,940 1,477    1,888 2,571 1,913 2,172 2,087 2,379 2,115 2,309 2,807 2,717 2,557 2,346 2,115 2,612 3,059 1,656 2,192 2,797 2,136 1,933 2,660 2,280 2,533 2,222 2,437 2,677 2,668 2,273 2,869 2,772 2,044 1,837 2,638 3,940 1,994 2,078 2,358 2,914 2,581 2,254 2,510 3,490 2,656 2,978 3,410 2,459 2,012 2,556 2,347 2,567 1,477 1,640 1,977 2,395 1,724 1,799 2,366 2,550 2,205 2,547 1,764 2,705 2,658 2,775 2,400 2,627 3,098 1,913 2,018 2,686 2,312 3,057
ata-miR166d-5p GGAAUGUUGUCUGGCUCGGGG 21 102,637 1,426 3,402 101    1,651 124 1,752 2,106 1,234 101 1,861 2,299 1,988 125 2,567 1,580 2,511 744 3,402 1,599 1,660 986 2,051 1,872 2,116 763 1,726 2,140 1,673 1,732 824 2,027 1,275 1,974 2,361 1,894 2,537 1,357 1,596 1,285 2,551 1,145 1,704 1,996 1,590 1,138 2,215 2,340 2,290 1,191 1,961 1,756 938 611 715 1,090 1,093 773 549 731 1,429 1,117 829 824 503 976 1,055 1,387 702 464 965 814 505 691 923 1,583
ata-miR166e-3p UCGGACCAGGCUUCAUUCCCC 21 174,068 2,418 3,940 1,477    1,888 2,571 1,913 2,172 2,087 2,379 2,115 2,309 2,807 2,717 2,557 2,346 2,115 2,612 3,059 1,656 2,192 2,797 2,136 1,933 2,660 2,280 2,533 2,222 2,437 2,677 2,668 2,273 2,869 2,772 2,044 1,837 2,638 3,940 1,994 2,078 2,358 2,914 2,581 2,254 2,510 3,490 2,656 2,978 3,410 2,459 2,012 2,556 2,347 2,567 1,477 1,640 1,977 2,395 1,724 1,799 2,366 2,550 2,205 2,547 1,764 2,705 2,658 2,775 2,400 2,627 3,098 1,913 2,018 2,686 2,312 3,057
ata-miR166e-5p GGAAUGUUGUCUGGUUGGAGA 21 1,218 18 40 2    22 0 31 40 22 0 27 25 13 2 23 35 15 11 28 14 20 15 16 27 14 0 24 35 31 28 17 27 12 35 28 13 16 22 24 12 15 11 11 24 24 14 7 21 28 11 13 10 19 24 11 4 7 10 12 14 16 25 8 9 4 13 6 8 9 23 9 4 8 23 25 14
ata-miR167a-3p GAUCGUGCUGUGACAGUUUCACC 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR167a-5p UGAAGCUGCCAGCAUGAUCUA 21 23,794 330 851 25    265 398 631 505 274 273 214 365 495 661 851 411 108 422 185 155 272 567 423 332 519 323 114 529 716 521 508 758 227 593 395 198 706 387 321 259 269 334 439 577 447 353 358 416 821 527 113 433 130 81 369 167 155 184 169 172 130 294 25 169 52 62 223 240 200 61 75 277 100 60 124 307
ata-miR167b-3p AGGUCAUGCUGGAGUUUCAUC 21 42,097 585 2,131 124    1,452 473 779 790 750 282 1,173 487 622 516 1,110 497 1,490 682 690 980 822 710 916 489 645 638 809 506 674 702 1,636 736 1,584 671 859 504 544 2,131 512 518 640 577 507 680 444 863 529 595 480 684 692 335 124 312 166 193 160 385 188 153 180 535 191 188 150 309 232 165 161 532 183 166 157 393 225 244
ata-miR167b-5p UGAAGCUGCCAGCAUGAUCUGA 22 592,424 8,228 24,549 2,627    12,254 6,866 7,291 10,115 6,037 5,002 8,997 11,859 8,575 7,557 17,094 6,726 24,549 8,833 13,144 7,618 8,597 9,965 8,105 10,924 10,063 6,517 4,557 9,450 8,762 7,237 7,822 10,809 8,651 11,432 12,887 6,247 9,930 12,593 5,905 4,518 10,384 9,785 9,240 9,601 9,158 9,509 7,486 11,657 10,525 10,985 9,488 6,644 3,006 5,982 5,703 5,511 6,985 11,739 3,204 3,466 6,734 9,571 2,838 3,719 3,108 12,102 6,223 6,352 5,354 5,779 5,973 4,990 2,627 8,112 4,375 7,021
ata-miR167c-3p GAUCAUGACUGACAGCCUCAUU 22 926 14 96 1    6 85 4 13 5 16 5 9 17 70 15 12 0 29 16 10 26 21 22 7 6 17 34 5 7 7 96 13 89 2 6 4 4 28 7 8 15 9 4 19 8 36 22 10 20 14 10 9 1 1 1 1 0 1 1 1 1 2 1 3 0 1 4 2 1 1 1 1 2 0 1 1
ata-miR167c-5p UGAAGCUGCCAGCAUGAUCUA 21 23,794 330 851 25    265 398 631 505 274 273 214 365 495 661 851 411 108 422 185 155 272 567 423 332 519 323 114 529 716 521 508 758 227 593 395 198 706 387 321 259 269 334 439 577 447 353 358 416 821 527 113 433 130 81 369 167 155 184 169 172 130 294 25 169 52 62 223 240 200 61 75 277 100 60 124 307
ata-miR167d-3p AGGUCAUGUGGCAGCUUCAUU 21 1,304 18 33 2    28 2 24 26 16 9 25 23 11 12 26 16 31 24 20 33 25 11 28 18 25 10 13 28 23 17 12 30 23 22 33 33 28 20 19 18 25 16 17 19 27 14 26 30 28 10 21 31 3 6 13 14 15 9 7 13 15 11 13 11 8 25 10 7 13 6 8 16 10 15 8 22
ata-miR167d-5p UGAAGCUGCCAGCAUGAUCUGA 22 592,424 8,228 24,549 2,627    12,254 6,866 7,291 10,115 6,037 5,002 8,997 11,859 8,575 7,557 17,094 6,726 24,549 8,833 13,144 7,618 8,597 9,965 8,105 10,924 10,063 6,517 4,557 9,450 8,762 7,237 7,822 10,809 8,651 11,432 12,887 6,247 9,930 12,593 5,905 4,518 10,384 9,785 9,240 9,601 9,158 9,509 7,486 11,657 10,525 10,985 9,488 6,644 3,006 5,982 5,703 5,511 6,985 11,739 3,204 3,466 6,734 9,571 2,838 3,719 3,108 12,102 6,223 6,352 5,354 5,779 5,973 4,990 2,627 8,112 4,375 7,021
ata-miR167e-3p GGUCAUGCUGCGGCAGCCUCACU 23 70 2 7 1    1 0 1 0 2 0 0 0 4 2 1 0 0 0 1 0 0 2 1 2 0 7 0 3 1 3 2 3 0 2 0 0 2 0 1 0 0 2 0 1 0 5 1 0 4 1 0 1 0 0 1 0 0 4 1 1 0 0 0 1 0 0 2 0 1 1 0 1 0 0 0 1
ata-miR167e-5p UGAAGCUGCCAGCAUGAUCUA 21 23,794 330 851 25    265 398 631 505 274 273 214 365 495 661 851 411 108 422 185 155 272 567 423 332 519 323 114 529 716 521 508 758 227 593 395 198 706 387 321 259 269 334 439 577 447 353 358 416 821 527 113 433 130 81 369 167 155 184 169 172 130 294 25 169 52 62 223 240 200 61 75 277 100 60 124 307
ata-miR167f-3p CAGAUCAUGCUGCAGCUUCAU 21 309 5 15 1    2 0 5 10 3 0 5 4 3 0 8 6 4 2 9 3 1 2 4 4 2 0 2 6 1 3 0 5 2 7 3 1 6 4 6 8 3 0 7 4 6 0 3 12 12 0 3 7 9 0 2 3 7 2 3 5 8 2 3 11 6 6 7 15 4 0 1 8 3 1 6 9
ata-miR167f-5p UGAAGCUGCCAGCAUGAUCUGC 22 82,704 1,149 2,156 238    617 791 1,873 880 832 955 564 743 1,106 1,281 1,039 1,057 351 1,357 615 238 593 1,154 482 676 1,065 569 350 868 1,080 1,030 1,647 1,020 953 1,042 878 583 1,224 1,448 736 794 619 1,324 1,016 822 1,239 1,524 727 1,159 1,635 1,723 617 1,703 1,009 1,781 1,675 1,340 1,060 1,824 1,141 1,369 1,264 1,493 603 1,307 1,166 1,861 1,884 1,804 1,856 1,452 1,649 1,624 1,616 2,156 1,293 1,878
ata-miR168-3p CCCGCCUUGCACCAAGUGAAU 21 108,168 1,502 3,096 194    2,372 194 1,813 1,885 1,777 198 2,329 2,073 2,025 219 3,096 2,141 2,136 680 2,276 2,079 1,799 899 2,620 1,607 2,414 867 2,524 2,447 1,513 2,844 853 2,188 1,194 2,256 2,530 2,115 2,704 1,331 3,040 2,370 1,688 1,154 2,217 1,830 1,429 701 2,376 1,848 1,914 824 1,779 2,584 630 483 791 1,088 1,053 850 574 653 1,046 790 655 921 453 1,005 1,041 1,661 726 519 923 1,071 477 645 854 1,507
ata-miR168-5p UCGCUUGGUGCAGAUCGGGAC 21 10,823,414 150,325 275,965 39,105    160,689 52,887 209,418 195,554 171,179 39,105 207,686 211,426 275,965 54,754 256,894 214,777 218,551 73,707 249,708 145,710 171,265 89,883 193,254 161,170 225,858 88,282 167,200 219,144 181,343 252,146 84,002 211,307 97,932 221,945 209,476 160,083 226,022 121,249 189,166 164,593 167,690 120,316 190,019 197,930 168,929 102,028 224,485 208,166 221,350 107,324 161,726 211,567 92,953 60,842 96,232 111,016 110,612 74,541 82,358 93,460 129,691 86,647 124,958 120,224 70,249 108,343 155,031 174,509 100,712 63,618 130,868 111,178 82,926 84,230 134,435 168,921
ata-miR169a-3p UGGGCAAGUCACCCUGGCUACC 22 1,564 24 109 2    6 0 9 10 16 2 5 11 15 0 7 15 2 0 9 4 11 0 4 2 26 2 4 22 8 7 0 24 0 5 13 13 29 0 3 13 2 11 12 3 8 4 2 10 18 10 5 28 40 10 35 102 80 13 20 39 35 17 40 55 47 67 25 66 97 6 54 93 17 46 41 109
ata-miR169a-5p UAGCCAAGGAUGAUUUGCCUGUG 23 3,295 46 251 2    7 2 29 34 30 11 11 25 49 10 13 49 12 4 37 5 29 11 17 20 60 5 11 33 16 5 8 32 8 24 22 13 57 6 3 16 9 15 16 23 19 30 5 17 76 30 7 61 78 40 71 122 150 30 47 63 82 27 63 67 92 103 40 197 193 18 100 201 55 107 66 251
ata-miR169b-3p UGGGCAAGUCAUCCUGGCUACCC 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR169b-5p UAGCCAAGGAUGAUUUGCCUGUG 23 3,295 46 251 2    7 2 29 34 30 11 11 25 49 10 13 49 12 4 37 5 29 11 17 20 60 5 11 33 16 5 8 32 8 24 22 13 57 6 3 16 9 15 16 23 19 30 5 17 76 30 7 61 78 40 71 122 150 30 47 63 82 27 63 67 92 103 40 197 193 18 100 201 55 107 66 251
ata-miR169c-3p GGCGGUCACCUUGGCUAGC 19 28,711 399 1,776 9    57 67 284 332 358 403 310 471 1,776 396 137 1,084 50 62 499 450 455 171 356 147 985 167 440 755 151 516 159 501 402 337 286 719 630 363 159 665 84 261 127 316 243 251 511 185 865 171 46 758 426 27 338 877 691 34 220 444 594 69 610 725 172 228 187 1,115 347 9 222 454 137 74 228 1,565
ata-miR169c-5p UAGCCAAGGAUGACUUGCCUA 21 285 5 22 1    1 2 11 7 8 0 0 3 10 2 2 12 4 0 3 1 5 0 4 2 7 0 0 9 1 5 3 4 0 6 6 1 6 2 1 10 0 0 4 4 10 3 2 1 3 4 2 7 2 2 8 6 4 1 1 3 7 4 0 0 3 22 2 5 6 2 0 3 2 5 4 15
ata-miR169d-3p GGCAAGUUGUCCUUGGCUACA 21 1,496 24 153 1    10 2 51 19 28 5 29 19 153 2 20 52 14 2 42 34 39 0 106 5 65 0 22 60 7 88 3 65 0 22 27 32 36 0 15 54 4 0 11 23 19 0 130 12 24 4 4 32 1 2 15 3 9 1 9 2 5 2 2 6 0 6 10 5 1 0 0 4 1 4 4 13
ata-miR169d-5p CAGCCAAGGAUGACUUGCCGG 21 8,460 118 457 10    99 37 290 146 138 70 178 247 457 34 167 404 185 58 302 166 161 38 226 123 295 62 88 385 23 189 61 273 27 200 210 153 192 51 33 200 32 13 128 109 81 23 205 127 129 45 53 259 23 16 77 64 95 17 56 36 140 16 22 51 15 35 91 60 67 10 14 42 17 29 71 224
ata-miR169e-5p CAGCCAAGGAUGACUUGCCGA 21 1,345 19 56 2    8 5 51 20 36 9 11 24 14 10 12 35 2 11 30 10 9 13 13 8 35 2 13 41 24 25 6 25 2 24 19 7 16 8 8 27 2 4 26 15 14 9 4 12 32 7 3 49 30 15 22 19 28 9 21 19 31 7 8 21 23 17 24 25 50 9 25 41 14 20 21 56
ata-miR169f-3p GGCAAGUCCGUCCUUGGCUACA 22 4,132 59 195 2    22 7 185 103 145 14 84 102 82 18 58 130 15 0 167 57 64 8 102 83 135 5 71 161 19 50 5 122 6 63 79 50 87 8 58 104 28 5 79 38 49 10 49 34 62 8 21 70 57 9 36 91 91 2 24 51 66 10 58 64 22 6 34 115 85 0 65 59 21 21 28 195
ata-miR169f-5p CAGCCAAGGAUGACUUGCCGA 21 1,345 19 56 2    8 5 51 20 36 9 11 24 14 10 12 35 2 11 30 10 9 13 13 8 35 2 13 41 24 25 6 25 2 24 19 7 16 8 8 27 2 4 26 15 14 9 4 12 32 7 3 49 30 15 22 19 28 9 21 19 31 7 8 21 23 17 24 25 50 9 25 41 14 20 21 56
ata-miR169g-3p GGCGAGUUGUUCUUGGCUACA 21 219 4 12 1    1 0 5 0 5 0 1 3 7 4 3 8 0 9 5 1 4 2 0 0 6 0 2 10 2 11 8 8 4 1 2 0 4 2 2 7 1 5 0 1 3 1 3 3 12 3 0 3 3 0 6 2 1 2 2 3 1 4 0 5 3 1 2 2 4 0 1 3 2 2 1 7
ata-miR169g-5p CAGCCAAGGAUGACUUGCCGA 21 1,345 19 56 2    8 5 51 20 36 9 11 24 14 10 12 35 2 11 30 10 9 13 13 8 35 2 13 41 24 25 6 25 2 24 19 7 16 8 8 27 2 4 26 15 14 9 4 12 32 7 3 49 30 15 22 19 28 9 21 19 31 7 8 21 23 17 24 25 50 9 25 41 14 20 21 56
ata-miR169h-3p GCAAGUUGUUCUUGGCUAGC 20 3,530 53 418 1    6 0 42 42 59 7 40 35 418 0 24 102 17 0 66 63 73 0 78 17 191 2 62 114 13 81 3 92 4 67 17 78 83 2 28 72 12 2 12 36 43 0 97 16 142 1 7 89 40 1 50 92 109 2 22 30 54 4 64 53 27 62 9 62 62 1 13 32 13 18 19 236
ata-miR169h-5p UAGCCAAGGAUGACUUGCCGG 21 332 6 21 1    4 2 13 10 9 0 5 12 21 2 3 11 8 0 12 5 5 2 7 3 12 12 7 13 1 15 5 8 0 5 3 5 10 6 0 9 2 0 3 1 3 9 3 6 4 3 3 9 1 0 1 1 3 0 2 1 8 2 0 3 0 0 1 2 2 2 1 1 0 0 2 8
ata-miR169i-3p GGCAGUCUCCUUGGCUAGC 19 3,938 61 450 1    32 20 65 58 94 7 384 86 450 0 20 129 120 2 123 129 97 2 179 32 164 10 79 126 4 82 2 104 8 75 91 100 46 2 35 138 7 2 30 32 45 0 200 17 88 0 14 50 11 0 24 13 43 1 20 3 32 0 11 24 1 17 9 13 18 0 2 3 2 0 6 105
ata-miR169i-5p UAGCCAAGGAUGACUUGCCUG 21 148 3 9 1    4 0 4 1 2 0 1 4 8 0 4 6 0 2 3 0 3 0 2 1 1 0 2 6 1 4 5 2 0 5 8 1 2 0 2 6 0 0 3 1 5 0 0 1 3 0 0 9 1 0 2 2 4 0 2 1 5 1 0 2 1 3 0 0 0 0 1 3 0 2 3 3
ata-miR169j-3p UGGGCAAGUCACCCUGGCUACC 22 1,564 24 109 2    6 0 9 10 16 2 5 11 15 0 7 15 2 0 9 4 11 0 4 2 26 2 4 22 8 7 0 24 0 5 13 13 29 0 3 13 2 11 12 3 8 4 2 10 18 10 5 28 40 10 35 102 80 13 20 39 35 17 40 55 47 67 25 66 97 6 54 93 17 46 41 109
ata-miR169j-5p UAGCCAAGGAUGAUUUGCCUGUG 23 3,295 46 251 2    7 2 29 34 30 11 11 25 49 10 13 49 12 4 37 5 29 11 17 20 60 5 11 33 16 5 8 32 8 24 22 13 57 6 3 16 9 15 16 23 19 30 5 17 76 30 7 61 78 40 71 122 150 30 47 63 82 27 63 67 92 103 40 197 193 18 100 201 55 107 66 251
ata-miR171a-3p UGAGCCGAACCAAUAUCACUC 21 690 10 22 1    17 7 12 8 9 11 11 16 8 0 17 11 21 11 19 4 7 8 11 6 21 12 11 22 6 9 9 9 8 14 14 15 14 12 6 10 11 13 12 9 6 12 12 14 17 11 8 6 7 1 13 8 8 3 5 3 5 6 10 8 4 3 4 8 6 4 5 12 2 7 6 15
ata-miR171a-5p UGGUAUUGUUUCGGCUCAUG 20 135 3 20 1    0 0 2 1 1 0 3 3 0 0 4 5 0 4 5 0 1 0 2 0 2 10 0 3 1 0 9 0 6 1 1 3 2 20 0 1 1 4 0 3 0 5 1 2 0 8 1 0 0 0 4 1 0 2 3 0 0 0 1 0 0 0 0 0 1 0 1 1 1 0 3 2
ata-miR171b-3p UGAUUGAGCCGUGCCAAUAUC 21 16,033 223 395 95    173 239 272 193 188 333 193 191 395 303 293 276 178 362 170 114 175 259 185 165 295 143 142 232 211 289 334 253 233 301 242 149 338 348 183 205 128 279 263 137 178 304 183 213 295 241 158 342 161 193 207 200 202 311 178 149 215 269 95 154 113 247 198 219 196 180 191 274 150 219 174 262
ata-miR171b-5p UGUUGGCAUGGCUCAAUCAAA 21 4 1 1 1    0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0
ata-miR171c-3p UUGAGCCGUGCCAAUAUCACG 21 3,941 55 201 17    31 62 37 31 26 59 32 35 32 54 44 40 39 102 17 27 25 91 42 23 26 64 37 28 31 32 179 52 121 35 33 29 46 201 25 36 30 128 40 48 32 108 42 54 46 119 31 49 28 76 45 38 30 130 27 35 30 166 35 35 22 109 45 36 42 121 35 50 31 137 37 50
ata-miR171c-5p CGGUAUUGGUGCGGUUCAAUC 21 394 6 69 1    2 5 4 2 3 2 1 3 4 2 2 2 8 11 4 1 6 10 1 4 4 12 2 3 2 4 28 3 29 1 0 7 3 69 1 7 0 22 2 3 3 8 1 5 0 14 3 4 2 4 1 1 1 6 1 0 2 17 0 2 0 6 4 1 1 8 1 4 3 3 2 7
ata-miR171d-3p UGAUUGAGCCGUGCCAAUAUC 21 16,033 223 395 95    173 239 272 193 188 333 193 191 395 303 293 276 178 362 170 114 175 259 185 165 295 143 142 232 211 289 334 253 233 301 242 149 338 348 183 205 128 279 263 137 178 304 183 213 295 241 158 342 161 193 207 200 202 311 178 149 215 269 95 154 113 247 198 219 196 180 191 274 150 219 174 262
ata-miR171d-5p UGUUGGCUCGACUCACUCAGA 21 667 9 24 2    10 5 19 10 14 2 14 7 24 6 19 19 0 2 15 10 6 6 9 8 6 5 7 14 10 9 3 10 4 14 4 13 19 8 8 8 3 7 11 8 9 5 17 13 15 8 5 11 6 6 6 7 7 9 10 10 13 11 6 8 6 3 14 5 10 6 11 19 9 6 11 9
ata-miR172a-3p AGAAUCUUGAUGAUGCUGCGU 21 15 1 3 1    0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 2 0 0 0 0 0 1 0 0 1 1 0 1 0 1 0 3 1
ata-miR172a-5p GCGGCACCAUCAAGAUUCACA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR172b-3p AGAAUCUUGAUGAUGCUGCAU 21 21,954 305 960 48    80 169 358 130 132 146 127 159 330 253 275 153 77 202 203 48 104 204 152 113 217 116 154 140 283 205 325 169 148 268 127 65 228 267 177 169 152 274 252 122 271 397 145 259 403 337 268 758 388 789 452 501 281 960 499 249 259 536 338 166 425 609 454 419 498 734 484 792 469 585 492 464
ata-miR172b-5p GCAGCACCACCAAGAUUCACA 21 2,115 29 67 4    45 20 39 40 29 16 42 51 15 22 52 16 33 11 61 40 37 34 58 31 34 15 67 45 39 25 16 40 29 24 45 35 37 26 54 25 50 26 30 39 39 19 35 38 35 23 63 51 8 22 9 33 19 21 5 14 14 17 13 13 4 26 24 26 14 13 21 18 10 31 10 34
ata-miR172c-3p GGAAUCUUGAUGAUGCUGCAU 21 25 1 3 1    1 0 0 0 0 2 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 1 0 1 0 1 0 2 0 1 0 0 0 0 0 3 2 0 0 0 1 1 0 1 0 0 1 1 0 0 1 0 0 1 0 1 0 0 1 0 0 0 0 0 0 0
ata-miR172c-5p GUGGCAUCAUCAAGAUUCACACA 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR2118a-3p GGGAAUGGGAACAUGGAGGAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR2118a-5p UUCCUAAUGUCUCCCAUUCCUA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR2118b-3p GGGAAUGGGAACAUGGAGGAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR2118b-5p UUCCCGAUGCCUCCCAUUCCUA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR2118c-3p UUCCUGAUGCCUCCCAUGCCUA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR2118d-3p UUCCUGAUGCCUCCCAUGCCUA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR2275a-3p UUUGUUUUUCUCCAAUAUCUCA 22 4 1 2 1    0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR2275a-5p UGAGUGUUCGAGGAAAGCAA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR2275b-3p CUUGUUUUCCUCCAAUAUCUCA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR2275b-5p AGAGUUGGAGGAAAACAAACA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR2275c-3p UUUGGUUUCCUCCAAUAUCUCA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR2275c-5p AGUGUUGGAUGGGACCAAAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR319-3p ACUGGAUGACGCGGGAGCUAA 21 25 3 8 1    0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 2 0 0 0 7 0 0 0 0 0 0 2 0 0 0 0 8 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0
ata-miR319-5p AGCUGCCGAUUCAUUCAUUCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR390-3p CGCUAUCUAUCCUGAGCUCC 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR390-5p AAGCUCAGGAGGGAUAGCGCC 21 7,078 98 239 28    84 117 144 73 144 90 114 53 171 155 89 89 29 131 69 77 79 139 76 64 101 123 112 94 109 187 196 80 239 92 91 109 139 237 89 98 65 152 83 92 109 147 109 94 190 134 84 132 73 34 66 75 55 65 56 64 77 70 84 102 28 38 107 98 69 48 74 66 53 47 65 90
ata-miR393-3p CAGUGCAAUCCCUUUGGAAUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR393-5p UUCCAAAGGGAUCGCAUUGAU 21 278,920 3,874 8,496 1,298    2,798 3,135 6,044 2,680 4,309 3,346 2,874 2,047 4,081 4,294 3,825 3,839 1,309 3,318 1,551 1,298 2,659 3,764 2,562 1,765 3,990 2,171 2,284 2,858 5,863 5,510 8,496 3,786 4,080 4,177 3,009 2,044 4,132 4,651 3,423 3,987 2,042 3,981 3,909 3,002 4,437 4,455 3,023 3,333 4,808 4,026 2,457 6,305 5,119 3,876 5,420 4,207 3,214 4,661 5,431 5,466 2,775 4,032 3,505 4,930 4,508 3,143 4,904 4,046 4,705 4,452 3,742 5,873 6,386 3,844 4,121 4,823
ata-miR394-3p AGGUGGGCAUACUGCCAAUGG 21 22 1 2 1    0 0 2 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 2 2 0 0 0 2 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 1 1 0 2 1 1 0 0 0 0 1 0 0 0 0 0 0 0 1 0 0 0
ata-miR394-5p UUGGCAUUCUGUCCACCUCC 20 9,815 136 279 36    69 139 219 105 88 160 95 144 176 241 186 188 48 195 121 36 83 187 113 107 173 113 101 176 190 212 177 173 97 179 104 57 209 134 108 106 97 133 130 121 147 161 126 164 260 142 91 279 147 108 142 138 84 163 132 106 125 118 69 100 70 122 139 162 93 92 138 167 97 79 138 226
ata-miR395a-3p UGAAGUGUUUGGGGGAACUC 20 26,617 370 2,392 40    44 57 224 124 209 50 215 203 378 78 577 823 83 40 491 162 1,379 236 388 93 257 49 94 859 407 157 50 789 54 153 135 199 2,392 71 1,090 124 522 68 94 160 383 195 367 467 385 116 101 967 634 40 652 149 1,623 49 537 50 459 210 227 453 319 76 1,848 350 324 89 804 126 102 88 160 689
ata-miR395a-5p GUUCCCUUCAAGCACUUCAGG 21 1,666 29 460 1    0 0 4 1 3 0 9 0 3 2 19 82 2 0 1 1 210 6 3 0 11 2 2 4 25 6 0 9 0 2 0 1 26 0 126 0 11 0 2 0 10 4 8 9 9 0 2 78 46 2 105 1 44 6 76 6 3 6 18 56 10 4 460 13 7 2 26 9 1 0 7 65
ata-miR395b-3p AAGUGUUUGGGGGAACUC 18 4 1 1 1    0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR395b-5p GUUCCCUGCAAACACUUCACG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR395c-3p UGAAGUGUUUGGGGGAACUC 20 26,617 370 2,392 40    44 57 224 124 209 50 215 203 378 78 577 823 83 40 491 162 1,379 236 388 93 257 49 94 859 407 157 50 789 54 153 135 199 2,392 71 1,090 124 522 68 94 160 383 195 367 467 385 116 101 967 634 40 652 149 1,623 49 537 50 459 210 227 453 319 76 1,848 350 324 89 804 126 102 88 160 689
ata-miR395c-5p GUUCUCCUCAAAUCACUUCA 20 2 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR395d-3p UGAAGUGUUUGGGGGAACUC 20 26,617 370 2,392 40    44 57 224 124 209 50 215 203 378 78 577 823 83 40 491 162 1,379 236 388 93 257 49 94 859 407 157 50 789 54 153 135 199 2,392 71 1,090 124 522 68 94 160 383 195 367 467 385 116 101 967 634 40 652 149 1,623 49 537 50 459 210 227 453 319 76 1,848 350 324 89 804 126 102 88 160 689
ata-miR395d-5p AGUUCCCUUCAAGCACUUUACG 22 1,672 23 145 1    6 12 13 7 15 7 14 4 15 26 27 17 6 7 9 5 75 40 29 8 7 12 6 36 34 7 8 33 8 12 11 8 89 12 93 8 34 4 8 6 25 19 24 17 19 14 15 42 56 1 35 9 145 7 22 5 9 22 16 56 26 10 80 11 22 15 82 31 7 12 10 30
ata-miR395e-3p UGAAGUGUUUGGGGGAACUC 20 26,617 370 2,392 40    44 57 224 124 209 50 215 203 378 78 577 823 83 40 491 162 1,379 236 388 93 257 49 94 859 407 157 50 789 54 153 135 199 2,392 71 1,090 124 522 68 94 160 383 195 367 467 385 116 101 967 634 40 652 149 1,623 49 537 50 459 210 227 453 319 76 1,848 350 324 89 804 126 102 88 160 689
ata-miR395e-5p GUUCCUUACAAGCACUUCACG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR395f-3p UGAAGUGUUUGGGGGAACUC 20 26,617 370 2,392 40    44 57 224 124 209 50 215 203 378 78 577 823 83 40 491 162 1,379 236 388 93 257 49 94 859 407 157 50 789 54 153 135 199 2,392 71 1,090 124 522 68 94 160 383 195 367 467 385 116 101 967 634 40 652 149 1,623 49 537 50 459 210 227 453 319 76 1,848 350 324 89 804 126 102 88 160 689
ata-miR395f-5p GUUCCCUUCAAGCACUUCAGG 21 1,666 29 460 1    0 0 4 1 3 0 9 0 3 2 19 82 2 0 1 1 210 6 3 0 11 2 2 4 25 6 0 9 0 2 0 1 26 0 126 0 11 0 2 0 10 4 8 9 9 0 2 78 46 2 105 1 44 6 76 6 3 6 18 56 10 4 460 13 7 2 26 9 1 0 7 65
ata-miR396a-3p GUUCAAGAAAGUCCUUGGAAA 21 34 1 4 1    1 0 1 0 0 0 0 0 1 2 1 1 2 2 0 0 0 0 0 0 0 0 0 0 0 0 2 1 0 0 2 0 0 4 0 0 0 0 1 0 0 0 0 0 0 1 1 0 0 1 1 0 1 1 0 0 0 0 0 0 0 1 0 1 0 2 1 0 1 1 0 0
ata-miR396a-5p UCCACAGGCUUUCUUGAACUG 21 388,849 5,401 16,041 2,295    4,114 7,331 7,343 4,436 4,132 8,724 4,157 3,780 4,757 8,746 6,382 5,118 2,295 9,024 3,791 2,750 3,484 9,558 4,105 3,660 5,152 6,408 3,892 5,078 4,943 5,464 16,041 4,965 11,751 4,605 5,023 3,469 5,476 11,849 5,788 5,113 3,737 8,675 5,251 3,955 5,182 7,662 3,459 4,167 6,648 8,695 3,076 5,342 4,422 6,148 5,087 4,120 4,317 7,444 3,949 3,924 3,169 6,400 2,725 3,965 3,517 5,152 4,244 4,269 4,621 5,584 3,834 5,876 4,198 5,285 2,990 5,056
ata-miR396b-3p GUUCAAGAAAGUCCUUGGAA 20 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR396b-5p UCCACAGGCUUUCUUGAACUG 21 388,849 5,401 16,041 2,295    4,114 7,331 7,343 4,436 4,132 8,724 4,157 3,780 4,757 8,746 6,382 5,118 2,295 9,024 3,791 2,750 3,484 9,558 4,105 3,660 5,152 6,408 3,892 5,078 4,943 5,464 16,041 4,965 11,751 4,605 5,023 3,469 5,476 11,849 5,788 5,113 3,737 8,675 5,251 3,955 5,182 7,662 3,459 4,167 6,648 8,695 3,076 5,342 4,422 6,148 5,087 4,120 4,317 7,444 3,949 3,924 3,169 6,400 2,725 3,965 3,517 5,152 4,244 4,269 4,621 5,584 3,834 5,876 4,198 5,285 2,990 5,056
ata-miR396c-3p GGUCAAGAAAGCUGUGGGAAG 21 2,432 34 297 1    61 35 12 106 23 11 20 20 46 8 70 30 31 11 26 26 40 13 25 181 14 34 9 128 91 18 5 247 14 26 6 19 37 8 29 18 236 9 33 19 8 6 22 68 100 10 297 35 2 4 1 7 3 4 4 2 8 1 1 6 1 1 7 11 3 2 3 3 0 2 7 8
ata-miR396c-5p UUCCACAGCUUUCUUGAACUU 21 33,979 472 1,219 191    385 659 641 473 391 757 359 374 425 775 521 470 378 686 433 335 328 815 342 404 531 697 389 515 385 456 1,079 416 1,126 406 458 360 575 1,219 471 477 394 694 491 330 446 594 419 485 700 719 342 467 304 425 398 282 363 482 260 359 317 471 227 343 282 440 348 440 378 292 259 308 326 368 191 524
ata-miR396d-3p GUUCAAGAAAGCCCAUGGAAA 21 174 3 9 1    1 0 6 2 0 0 1 1 3 2 8 3 2 0 4 0 2 2 6 0 1 0 4 3 0 6 5 2 2 2 2 1 3 2 9 3 2 4 3 0 3 5 3 4 3 3 1 4 2 6 3 2 3 4 3 2 1 5 1 1 0 4 1 2 2 2 2 1 1 2 0 1
ata-miR396d-5p UCCACAGGCUUUCUUGAACUG 21 388,849 5,401 16,041 2,295    4,114 7,331 7,343 4,436 4,132 8,724 4,157 3,780 4,757 8,746 6,382 5,118 2,295 9,024 3,791 2,750 3,484 9,558 4,105 3,660 5,152 6,408 3,892 5,078 4,943 5,464 16,041 4,965 11,751 4,605 5,023 3,469 5,476 11,849 5,788 5,113 3,737 8,675 5,251 3,955 5,182 7,662 3,459 4,167 6,648 8,695 3,076 5,342 4,422 6,148 5,087 4,120 4,317 7,444 3,949 3,924 3,169 6,400 2,725 3,965 3,517 5,152 4,244 4,269 4,621 5,584 3,834 5,876 4,198 5,285 2,990 5,056
ata-miR396e-3p GUUCAAUAAAGCUGUGGGAAA 21 12 1 2 1    0 0 0 0 0 0 1 1 0 0 0 0 0 0 1 0 1 0 0 0 1 0 0 0 0 0 0 0 2 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1
ata-miR396e-5p UUCCACAGCUUUCUUGAACUG 21 2,272 32 95 11    22 57 59 23 18 56 27 28 38 52 32 43 29 51 33 15 34 69 32 30 37 32 19 28 28 32 95 28 35 37 40 15 51 63 34 42 35 37 34 24 24 30 16 29 35 48 11 41 15 30 34 22 26 22 15 21 28 32 19 18 15 25 29 25 19 14 16 22 29 32 15 21
ata-miR398f-3p UGUGUUCUCAGGUCGCCCCCG 21 110,306 1,532 5,052 147    886 147 688 623 692 397 1,760 997 676 349 2,162 691 975 215 1,100 653 900 286 1,259 1,260 554 266 1,288 602 689 672 928 879 1,139 730 1,365 591 405 1,888 1,473 534 725 1,296 832 511 715 873 888 1,263 470 1,307 999 597 2,874 2,169 4,732 3,689 4,437 2,452 3,097 2,050 4,053 3,192 3,181 3,148 1,943 5,052 3,155 2,837 2,178 1,427 3,719 1,657 738 1,987 3,243 2,101
ata-miR398f-5p GGGUCGAACUGAGAACACAUG 21 87,412 1,214 7,396 5    769 5 888 650 587 20 1,602 652 561 20 885 558 382 38 522 553 778 135 833 601 354 84 749 547 786 672 118 837 227 732 629 533 483 282 699 429 582 214 519 561 344 195 644 680 443 207 603 644 5,451 964 6,280 4,044 4,342 979 7,396 3,575 3,895 1,079 5,768 5,420 1,411 911 1,154 865 1,441 559 1,551 1,233 677 575 1,964 1,042
ata-miR398g-3p UGUGUUCUCAGGUCGCCCCCG 21 110,306 1,532 5,052 147    886 147 688 623 692 397 1,760 997 676 349 2,162 691 975 215 1,100 653 900 286 1,259 1,260 554 266 1,288 602 689 672 928 879 1,139 730 1,365 591 405 1,888 1,473 534 725 1,296 832 511 715 873 888 1,263 470 1,307 999 597 2,874 2,169 4,732 3,689 4,437 2,452 3,097 2,050 4,053 3,192 3,181 3,148 1,943 5,052 3,155 2,837 2,178 1,427 3,719 1,657 738 1,987 3,243 2,101
ata-miR398g-5p GGGUCGAGCUGGGAACACAUG 21 161,490 2,243 15,858 16    908 22 1,091 702 610 16 2,760 1,041 673 22 1,468 540 606 80 800 486 1,072 331 1,338 730 416 229 1,166 569 814 716 168 982 432 758 929 600 539 502 1,056 343 943 427 652 683 445 369 964 910 426 392 914 545 10,408 1,628 12,560 10,807 11,856 1,947 13,168 6,754 10,137 2,716 15,858 11,341 1,982 2,059 1,671 1,452 1,785 733 2,597 1,395 612 931 2,712 1,196
ata-miR399a-3p UGCCAAAGGAGAAUUGCCCUG 21 8,720 121 292 30    75 109 129 153 95 56 121 148 185 92 137 180 77 36 147 97 98 105 123 184 151 111 56 193 37 165 30 106 51 115 88 165 91 47 110 146 61 252 123 99 144 161 132 140 165 120 57 58 163 221 123 97 150 292 79 101 65 223 78 179 69 247 121 89 105 173 74 85 56 198 77 134
ata-miR399a-5p GGGCGCUUCUCCAUUGGCACGG 22 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0
ata-miR399b-3p UGCCAAAGGAGAAUUGCCCUG 21 8,720 121 292 30    75 109 129 153 95 56 121 148 185 92 137 180 77 36 147 97 98 105 123 184 151 111 56 193 37 165 30 106 51 115 88 165 91 47 110 146 61 252 123 99 144 161 132 140 165 120 57 58 163 221 123 97 150 292 79 101 65 223 78 179 69 247 121 89 105 173 74 85 56 198 77 134
ata-miR399b-5p CAGGGCGCUUCUCCUUUGGCA 21 30 2 6 1    0 0 1 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 0 0 3 0 1 0 0 0 0 0 0 1 1 0 6 0 0 0 2 0 0 0 4 0 0 0 4 0 0 0 2 1 1
ata-miR408-3p UGCACUGCCUCUUCCCUGCC 20 26 2 9 1    0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 0 0 0 0 0 0 0 0 1 0 0 0 0 2 0 1 0 0 0 0 0 0 0 1 0 0 0 3 1 0 0 1 0 0 9 1 0 0 0 0 1 0 1 0 0
ata-miR408-5p CAGGGAUGGAGCAGAGCAAGG 21 5 1 2 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 1 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR5062a-3p GUGGAUUUUUCACCAAGAUUCAAG 24 37 1 4 1    0 0 0 0 2 0 0 1 0 0 0 1 2 0 0 1 1 0 0 0 0 0 2 1 0 0 3 1 0 0 1 0 1 4 0 0 1 0 1 1 0 0 0 0 1 0 0 0 2 0 0 1 0 0 0 1 1 0 0 0 0 0 1 1 0 3 0 0 1 0 0 1
ata-miR5062a-5p UGAACCUUAGGGAAAAGCCGCAU 23 19,914 277 436 138    216 259 358 241 394 187 220 182 314 291 275 291 166 244 176 146 278 223 207 237 340 138 187 342 330 302 253 276 270 284 266 232 359 251 261 297 204 279 295 294 307 201 318 283 349 286 209 405 239 252 272 290 276 240 253 311 277 211 266 329 318 247 434 436 371 221 326 335 344 285 353 305
ata-miR5062b-3p UGAACCUUAGGGAAAAGCCGCAU 23 19,914 277 436 138    216 259 358 241 394 187 220 182 314 291 275 291 166 244 176 146 278 223 207 237 340 138 187 342 330 302 253 276 270 284 266 232 359 251 261 297 204 279 295 294 307 201 318 283 349 286 209 405 239 252 272 290 276 240 253 311 277 211 266 329 318 247 434 436 371 221 326 335 344 285 353 305
ata-miR5062b-5p GCGGAUUUUUCACCAAGAUUCAAG 24 1,963 28 51 2    39 0 24 29 44 7 27 21 24 2 36 37 42 29 17 12 33 32 27 38 41 15 13 22 31 30 28 33 10 37 20 38 40 12 31 38 34 15 29 26 30 12 30 32 40 21 40 40 20 12 21 26 35 27 17 22 25 22 19 43 28 41 49 51 18 17 34 34 25 30 13 26
ata-miR5070-3p UUGAACUAAGUAGGGUCGGAG 21 324 6 34 1    0 0 4 2 3 2 3 0 18 2 7 8 0 0 17 7 6 6 2 1 6 0 6 10 4 12 2 11 2 2 11 15 34 0 5 0 2 2 0 3 0 0 5 4 14 1 3 7 4 0 0 1 0 1 2 2 3 1 3 2 1 0 18 9 4 0 3 5 5 0 1 10
ata-miR5070-5p UCUGACCCUUCUUAGUUCAAC 21 91 2 8 1    0 0 0 0 0 0 0 0 4 4 1 2 0 0 4 1 4 0 1 0 2 0 2 4 1 3 0 4 2 0 2 4 4 0 3 1 0 0 1 1 0 0 0 2 1 1 0 6 3 0 1 0 0 0 0 1 3 0 0 0 1 0 8 0 1 0 1 1 2 1 0 3
ata-miR5084-3p ACCAUACGGUACUGCAGAGGAUC 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR5084-5p AUCCUCUACAGUACUGUACGGUGC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR5168-3p UCGGACCAGGCUUCAAUCCCU 21 121,433 1,687 2,499 1,095    1,342 1,471 1,595 1,307 1,361 1,095 1,618 1,885 2,071 1,669 1,956 1,279 1,102 1,317 2,057 1,212 1,235 1,462 1,205 1,905 1,900 1,613 1,576 1,670 1,654 1,391 1,674 1,611 1,411 1,768 1,492 1,392 1,671 2,418 1,470 1,636 1,520 1,877 2,348 1,530 2,080 1,729 1,528 2,227 1,994 1,584 1,580 1,987 1,333 1,629 1,567 1,784 1,787 1,951 1,338 1,526 1,818 1,875 1,585 1,503 1,470 1,767 1,994 2,208 2,488 1,895 2,499 1,726 1,280 1,823 1,751 2,361
ata-miR5168-5p GGGUUGUUGUCUGGUUCAAGG 21 40,708 565 1,268 10    414 30 645 635 432 20 700 894 969 26 962 556 301 22 1,268 424 433 15 690 830 674 10 635 802 713 722 44 649 80 644 712 598 1,064 51 912 617 847 323 754 840 819 233 1,017 1,167 971 241 747 727 618 286 604 741 742 210 490 572 964 273 676 659 353 321 633 826 585 157 693 480 351 282 560 753
ata-miR5181-3p CACUUAUUUUGGACCGGAGGG 21 31 1 2 1    0 0 1 1 0 0 0 0 0 0 0 2 0 2 1 0 0 0 0 0 0 0 0 0 1 1 0 2 0 0 0 1 0 2 1 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 1 1 0 1 0 0 2 2 0 0 1 0 0 1 1 0 0 1 0 2 1
ata-miR5181-5p UCCGAUCCAGAAUAAGUGUCG 21 49 2 4 1    0 0 0 2 4 2 0 0 1 2 0 0 2 0 0 1 0 2 0 0 0 0 2 0 1 0 2 0 0 0 0 1 1 2 0 0 0 2 0 0 0 3 0 0 1 1 0 1 0 0 1 0 0 1 0 0 0 0 0 0 0 3 1 1 1 0 1 3 1 2 1 0
ata-miR5200-3p UGUAGAUACUCCCUAAGGCUU 21 248,267 3,448 6,635 797    3,207 2,939 4,543 4,707 2,937 2,823 3,941 5,740 4,632 2,641 5,229 4,857 5,105 3,607 6,635 3,349 3,155 3,800 3,914 5,270 5,536 4,188 2,986 4,934 2,326 3,538 1,501 3,738 2,440 4,103 4,746 3,993 4,280 3,334 2,780 4,132 4,382 1,857 6,235 3,901 3,965 1,978 4,405 6,042 5,377 1,897 4,033 4,162 1,803 1,369 2,387 2,731 2,985 1,729 1,884 2,270 3,723 1,760 2,430 2,498 1,541 1,450 3,078 4,161 2,368 797 2,917 2,616 1,820 1,315 2,680 6,135
ata-miR5200-5p AAGCCUUAGUGAAUAUCUACA 21 1,815 25 51 7    29 20 40 40 36 25 32 25 13 20 43 35 39 16 24 21 19 21 38 20 31 15 19 40 22 27 16 22 8 27 40 32 13 28 34 44 27 9 51 24 41 14 27 32 27 10 35 42 15 7 28 17 27 9 33 31 18 13 32 15 28 10 20 21 36 15 18 19 22 9 24 35
ata-miR528-3p CCUGUGCCUGCCUCUUCCAUU 21 10,724 153 614 4    117 0 121 101 98 0 194 122 77 4 121 89 56 7 64 59 108 46 117 108 62 27 86 109 167 145 11 154 49 147 90 117 111 69 118 98 97 64 110 91 63 43 109 149 103 52 93 91 523 83 564 351 549 195 501 428 462 188 389 614 144 157 128 158 210 87 167 124 59 127 144 138
ata-miR528-5p UGGAAGGGGCAUGCAGAGGAG 21 94,607 1,314 4,567 87    921 87 744 733 358 137 1,103 1,489 1,217 223 2,897 563 1,079 89 1,391 245 906 297 1,332 1,595 650 231 354 890 1,118 735 250 1,293 377 2,243 992 474 1,395 1,675 419 238 963 911 1,261 588 609 1,211 355 1,641 1,437 716 749 1,707 2,531 1,725 3,307 2,880 3,833 1,751 2,344 1,574 3,309 2,628 1,701 1,373 742 3,659 2,426 1,307 1,849 628 4,567 1,210 403 926 1,953 3,093
ata-miR6201-3p GUACGAGUGUCUCAGGGCCAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR6201-5p UGACCCUGAGGCACUCAUACCG 22 128 2 8 1    4 0 5 0 3 2 2 1 1 4 2 4 0 0 4 3 2 4 4 5 4 0 2 4 1 1 0 1 4 0 3 0 8 0 1 0 1 2 4 4 1 3 2 1 1 0 3 5 0 1 1 0 3 0 1 1 2 0 1 1 1 0 0 1 0 3 3 0 1 0 1 1
ata-miR9672-3p UACCACGACUGUCAUUAAGCA 21 159,909 2,221 7,385 969    1,740 2,598 1,750 2,816 1,323 1,755 1,827 4,358 2,851 2,376 3,573 2,177 3,870 2,059 7,385 1,687 2,532 2,570 2,353 3,066 2,778 2,021 2,050 2,394 1,871 1,566 985 2,563 1,810 2,521 2,592 1,615 2,792 1,584 2,170 1,414 3,811 2,100 2,731 2,680 2,482 2,037 2,694 4,269 4,172 1,767 2,492 2,297 1,357 1,600 1,285 1,914 1,773 1,549 1,055 1,149 1,951 1,757 1,227 1,387 969 1,902 2,147 2,349 1,564 1,221 1,981 1,436 1,093 1,881 1,259 3,179
ata-miR9672-5p CUUAAUGACAGUCGUGGUGUC 21 38,888 540 1,063 185    309 266 504 571 384 185 401 868 736 299 724 557 427 253 739 234 512 299 561 524 739 199 427 441 609 523 281 648 257 695 559 413 750 267 564 445 716 551 796 614 800 556 572 943 1,063 470 521 760 625 470 603 603 599 576 445 472 621 612 414 410 373 565 611 781 513 484 597 638 425 586 428 905
ata-miR9674a-3p GUAAGAUGGCUGAUGCUAUGG 21 15 2 4 1    0 0 0 0 0 0 0 0 0 0 0 0 0 4 0 0 1 0 0 0 0 0 2 0 0 0 2 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0
ata-miR9674a-5p AUAGCAUCAUCCAUCCUACCC 21 769,687 10,690 19,194 6,468    10,276 13,895 8,119 8,510 7,574 13,509 8,210 10,909 10,899 15,520 11,776 8,463 12,323 17,653 7,927 6,468 8,311 15,481 7,451 8,636 11,033 12,031 7,812 9,607 8,258 8,717 15,212 10,017 13,052 10,837 9,970 7,272 9,951 18,057 7,624 7,904 7,299 14,542 9,580 7,772 8,488 15,378 7,997 12,079 10,404 14,487 8,826 12,444 8,492 12,318 8,300 12,377 11,674 19,194 6,552 8,585 12,540 13,182 8,231 9,050 7,237 16,465 9,355 13,360 10,712 10,852 11,594 11,242 6,598 11,331 9,297 12,589
ata-miR9674b-3p UGAAUUUGUCCAUAGCAUCAG 21 372,554 5,174 9,149 2,828    4,319 6,059 5,140 5,095 3,572 5,995 3,589 5,675 4,512 6,718 6,658 5,287 6,002 7,158 5,349 3,540 4,069 7,782 4,364 5,283 6,288 4,914 3,417 5,045 4,125 3,622 7,502 4,956 7,778 4,862 4,899 3,528 4,789 9,149 4,485 4,246 4,939 7,339 4,920 4,356 4,509 6,550 3,298 5,567 5,676 7,358 3,650 5,054 5,090 5,952 5,428 5,222 7,132 7,662 3,543 3,946 5,644 7,968 2,828 2,940 4,076 6,412 4,254 5,479 5,172 4,769 3,690 5,659 3,259 4,880 2,981 5,581
ata-miR9674b-5p GGUGCUAUGGAUAGCUUCAAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR9674c-3p GGUGCUAUGGAUAAAUUCAAC 21 3,140 44 71 16    54 32 29 36 71 16 34 41 35 30 43 38 44 58 17 34 49 44 55 32 57 25 51 33 45 62 64 46 54 59 46 41 43 55 54 60 34 37 42 37 50 52 32 49 27 38 54 40 66 34 36 24 35 27 55 51 49 50 56 55 61 58 36 28 61 51 35 18 46 49 42 38
ata-miR9674c-5p UGAAUUUUUCCAUAGCAUCAG 21 7,396 103 163 44    125 107 105 142 101 126 99 122 77 106 132 114 110 107 87 79 114 128 97 123 127 101 94 127 110 76 154 115 163 104 103 78 109 142 123 132 113 141 130 95 95 95 68 98 96 140 69 104 124 71 97 120 137 99 67 76 94 119 48 50 94 87 79 89 89 80 60 113 73 92 44 91
ata-miR9677-3p UGGCCGUUGGUAGAGUAGGAGA 22 4,253 59 102 34    48 37 70 54 58 38 47 55 79 70 67 52 56 56 102 38 66 63 42 48 52 34 39 80 44 67 76 70 78 53 66 53 84 87 45 42 68 75 70 39 65 68 66 42 67 75 58 61 40 47 40 49 58 82 37 36 66 80 66 63 46 62 75 57 51 56 59 63 62 69 58 61
ata-miR9677-5p UUCCACUCUACCAACAGCCACG 22 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR9772a-3p AGGGGGCAAUCUCACCUCAAC 21 888 13 32 2    8 5 10 9 4 2 3 7 10 2 7 10 19 11 5 0 8 6 8 8 10 0 6 6 7 6 9 7 10 13 6 5 7 2 8 9 4 15 9 6 9 15 5 23 9 4 12 8 32 30 30 28 30 20 20 20 30 29 18 18 16 29 24 24 22 11 16 18 7 14 10 20
ata-miR9772a-5p UGAGAUGAGAUUACCCCAUAC 21 344,022 4,778 11,298 1,025    2,166 2,192 6,859 2,318 3,379 3,037 2,045 2,274 4,582 4,486 3,146 3,937 1,639 4,267 1,338 1,025 2,345 3,557 1,948 1,805 4,170 1,590 1,423 2,570 4,201 3,822 8,386 3,856 3,505 3,710 2,826 1,920 3,909 4,201 2,508 3,165 1,747 4,386 3,447 2,134 3,792 5,217 2,247 2,715 3,928 6,178 2,042 5,795 6,701 10,360 10,749 4,941 5,027 11,298 9,444 6,531 5,625 8,514 3,725 4,501 8,834 8,780 7,188 6,136 10,232 9,636 6,033 8,054 9,612 10,768 8,080 5,518
ata-miR9772b-3p AGGGGGCAAUCUCACCUCAAC 21 888 13 32 2    8 5 10 9 4 2 3 7 10 2 7 10 19 11 5 0 8 6 8 8 10 0 6 6 7 6 9 7 10 13 6 5 7 2 8 9 4 15 9 6 9 15 5 23 9 4 12 8 32 30 30 28 30 20 20 20 30 29 18 18 16 29 24 24 22 11 16 18 7 14 10 20
ata-miR9772b-5p UGAGAUGAGAUUACCCCAUAC 21 344,022 4,778 11,298 1,025    2,166 2,192 6,859 2,318 3,379 3,037 2,045 2,274 4,582 4,486 3,146 3,937 1,639 4,267 1,338 1,025 2,345 3,557 1,948 1,805 4,170 1,590 1,423 2,570 4,201 3,822 8,386 3,856 3,505 3,710 2,826 1,920 3,909 4,201 2,508 3,165 1,747 4,386 3,447 2,134 3,792 5,217 2,247 2,715 3,928 6,178 2,042 5,795 6,701 10,360 10,749 4,941 5,027 11,298 9,444 6,531 5,625 8,514 3,725 4,501 8,834 8,780 7,188 6,136 10,232 9,636 6,033 8,054 9,612 10,768 8,080 5,518
ata-miR9776-3p GCACAUCCAUGUCCAAGCUCU 21 40 2 5 1    2 0 1 0 0 2 0 1 1 4 1 0 0 0 0 1 5 2 0 0 0 0 4 1 0 0 5 1 2 0 0 0 1 0 1 0 0 0 0 0 2 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 0 0 0 0 0 0
ata-miR9776-5p AGCUUGGACGAGGAUGUGCAA 21 3,605 50 148 11    148 70 65 55 74 41 82 37 78 48 86 41 95 69 32 41 82 53 70 48 46 54 51 35 92 74 131 79 95 68 59 52 37 130 37 47 49 89 45 37 27 77 33 32 44 67 51 48 17 19 21 24 27 47 16 26 34 49 18 27 16 42 12 16 20 45 11 14 16 40 23 24
ata-miR9783-3p AUAAGCACCGGUGCUUAAGGA 21 1,221 17 29 4    12 7 29 16 16 23 15 19 22 22 26 10 17 27 11 4 11 15 15 5 14 12 9 12 25 24 25 22 25 19 20 7 19 20 15 20 9 15 17 17 24 14 8 10 19 14 21 16 20 20 25 19 8 17 20 13 12 19 13 15 13 13 24 18 24 10 22 12 29 14 20 27
ata-miR9783-5p UUUGAAGCACUGACGCCUAUUUCU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR9863a-3p UGAGAAGGUAGAUCAUAAUAGC 22 87,139 1,210 2,531 357    1,072 358 1,185 1,045 701 487 735 1,295 1,385 765 2,161 964 2,003 717 1,229 357 1,061 868 778 1,502 1,364 719 382 1,295 1,212 717 794 1,175 542 2,253 1,063 650 2,135 1,112 475 506 944 1,046 1,507 882 1,250 1,383 511 1,411 1,781 926 905 2,073 936 2,531 1,395 1,106 1,489 2,111 1,065 798 1,318 1,910 724 456 1,093 2,316 1,678 850 2,216 1,479 2,099 1,687 1,121 2,005 1,284 1,791
ata-miR9863a-5p UGUUAUGAUCUGCUUCUCAUC 21 10,635 148 366 56    159 67 137 113 129 56 82 131 169 88 187 127 232 129 87 96 122 133 103 99 208 91 88 126 135 125 230 159 126 143 103 77 111 209 103 88 86 159 144 121 119 241 83 140 135 177 98 134 149 274 154 124 172 316 122 113 159 294 136 78 161 247 151 101 200 366 167 161 151 302 161 171
ata-miR9863b-3p UGAGAAGGUAGAUCAUAAUAGC 22 87,139 1,210 2,531 357    1,072 358 1,185 1,045 701 487 735 1,295 1,385 765 2,161 964 2,003 717 1,229 357 1,061 868 778 1,502 1,364 719 382 1,295 1,212 717 794 1,175 542 2,253 1,063 650 2,135 1,112 475 506 944 1,046 1,507 882 1,250 1,383 511 1,411 1,781 926 905 2,073 936 2,531 1,395 1,106 1,489 2,111 1,065 798 1,318 1,910 724 456 1,093 2,316 1,678 850 2,216 1,479 2,099 1,687 1,121 2,005 1,284 1,791
ata-miR9863b-5p UGUUAUGAUCUGCUUCUCAUC 21 10,635 148 366 56    159 67 137 113 129 56 82 131 169 88 187 127 232 129 87 96 122 133 103 99 208 91 88 126 135 125 230 159 126 143 103 77 111 209 103 88 86 159 144 121 119 241 83 140 135 177 98 134 149 274 154 124 172 316 122 113 159 294 136 78 161 247 151 101 200 366 167 161 151 302 161 171