Ae. tauschii Small RNA miRNA Abundances

The data below are based on the microRNAs listed in the Sanger registry. Adjust libraries/reads to display on the control panel.

        

        miRNA         miRNA sequence Len Sum (norm) Average Max Min (>0)  AeT_En1AeT_En2AeT_En3TrU_En1TrU_En2TrU_En3TT_En1TT_En2TT_En3AeL_En1AeL_En2AeL_En3TT_En4TT_En5TT_En6TrU_En4TrU_En5TrU_En6TrA_SdlTrA_20d_SeedTrA_10d_SeedTrA_5d_SeedTrA_flag_leafTrA_11d_sd_natTrA_spk_nat_2TrA_spk_nat_1TrA_spk_S4TrA_11d_sd_S3_2TrA_11d_sd_S3_1TrA_spk_S3_2TrA_spk_S3_1TrA_7d_sdl_S3_2TrA_7d_sdl_S3_1TrA_11d_sd_S2TrA_spk_S1TrA_11d_sd_S1AeT_11d_sd_p_2AeT_11d_sd_p_1AeT_spk_p_2AeT_spk_p_1AeT_7d_sdl_p_2AeT_7d_sdl_p_1TT_11d_sd_m_2TT_11d_sd_m_1TT_spk_m_2TT_spk_m_1TT_7d_sdl_m_2TT_7d_sdl_m_1
ata-miR1432-3p UUGGUGUCACCUCGCCUGAAC 21 8 1 1 1    0 1 1 1 1 1 0 0 0 0 0 0 1 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR1432-5p UCAGGAGAGAUGACACCGACG 21 21 4 17 1    0 0 1 1 0 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 17 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR156a-3p GCUCACCCUCUCUCUGUCAGC 21 16 1 5 1    0 0 0 1 1 1 1 1 0 0 0 0 1 1 1 2 1 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR156a-5p UGACAGAAGAGAGUGAGCAC 20 20,761 716 8,123 23    106 82 91 23 64 32 60 127 32 116 43 75 30 55 84 167 139 164 312 221 0 0 363 611 8,123 0 0 0 0 777 5,591 0 0 0 0 0 0 0 316 2,592 181 0 0 0 0 184 0 0
ata-miR156b-3p GCUCAUUUCUCUCUCUGUCAGC 22 1 1 1 1    0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR156b-5p UGACAGAAGAGAGUGAGCAC 20 20,761 716 8,123 23    106 82 91 23 64 32 60 127 32 116 43 75 30 55 84 167 139 164 312 221 0 0 363 611 8,123 0 0 0 0 777 5,591 0 0 0 0 0 0 0 316 2,592 181 0 0 0 0 184 0 0
ata-miR156c-3p GCUCACUGCUCUAUCUGUCACC 22 19 1 2 1    0 0 1 1 2 2 1 0 1 2 1 2 1 2 1 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR156c-5p UGACAGAAGAGAGUGAGCAC 20 20,761 716 8,123 23    106 82 91 23 64 32 60 127 32 116 43 75 30 55 84 167 139 164 312 221 0 0 363 611 8,123 0 0 0 0 777 5,591 0 0 0 0 0 0 0 316 2,592 181 0 0 0 0 184 0 0
ata-miR156d-3p GCUCACUCCUCUUUCUGUCAGC 22 57 4 35 1    2 2 1 1 1 0 2 1 0 1 1 0 1 2 2 4 1 0 0 0 0 0 35 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR156d-5p UGACAGAAGAGAGUGAGCAC 20 20,761 716 8,123 23    106 82 91 23 64 32 60 127 32 116 43 75 30 55 84 167 139 164 312 221 0 0 363 611 8,123 0 0 0 0 777 5,591 0 0 0 0 0 0 0 316 2,592 181 0 0 0 0 184 0 0
ata-miR156e-3p GCUCACCCUCUCUCUGUCAGC 21 16 1 5 1    0 0 0 1 1 1 1 1 0 0 0 0 1 1 1 2 1 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR156e-5p UGACAGAAGAGAGUGAGCAC 20 20,761 716 8,123 23    106 82 91 23 64 32 60 127 32 116 43 75 30 55 84 167 139 164 312 221 0 0 363 611 8,123 0 0 0 0 777 5,591 0 0 0 0 0 0 0 316 2,592 181 0 0 0 0 184 0 0
ata-miR160a-3p GCGUUGGCUCUACCGCGGAUG 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR160a-5p UGCCUGGCUCCCUGUAUGCCA 21 294 16 34 8    12 14 8 17 25 11 14 15 9 20 14 13 10 16 34 18 18 26 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR160b-3p GCGUGCACGGAUCCAAGCAUA 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR160b-5p UGCCUGGCUCCCUGUAUGCCA 21 294 16 34 8    12 14 8 17 25 11 14 15 9 20 14 13 10 16 34 18 18 26 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR160c-3p GCGUGCAAGGAGCCAAGCAUG 21 14 1 2 1    0 0 0 1 1 0 2 1 1 1 0 0 1 1 0 2 1 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR160c-5p UGCCUGGCUCCCUGUAUGCCA 21 294 16 34 8    12 14 8 17 25 11 14 15 9 20 14 13 10 16 34 18 18 26 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR164a-3p CACGUGCGCUCCUUCUCCAGC 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR164a-5p UGGAGAAGCAGGGCACGUGCU 21 4 1 1 1    0 1 1 0 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR164b-3p CAUGUGCCUUUCUUCUCCACC 21 76 13 21 5    16 14 13 0 0 0 0 0 0 0 0 0 5 7 21 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR164b-5p UGGAGAAGCAGGGCACGUGCA 21 2,888 126 756 8    12 55 34 29 65 52 20 47 27 19 8 49 27 58 110 193 59 75 0 0 0 0 0 0 0 0 0 0 0 37 430 0 533 0 0 0 0 0 0 0 0 756 0 193 0 0 0 0
ata-miR164c-3p CACGUGUUCUUCUCCUCCAUC 21 2 1 1 1    0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR164c-5p UGGAGAAGCAGGGCACGUGCA 21 2,888 126 756 8    12 55 34 29 65 52 20 47 27 19 8 49 27 58 110 193 59 75 0 0 0 0 0 0 0 0 0 0 0 37 430 0 533 0 0 0 0 0 0 0 0 756 0 193 0 0 0 0
ata-miR166a-3p UCGGACCAGGCUUCAUUCCCC 21 290,717 8,306 28,735 26    6,134 5,113 10,286 14,671 18,610 12,930 12,226 19,378 6,950 23,916 10,355 8,353 15,009 19,680 28,735 27,446 15,133 24,682 52 133 0 272 35 61 2,565 388 2,963 0 405 0 215 0 1,066 0 0 0 482 0 26 0 543 1,511 0 193 0 0 0 200
ata-miR166a-5p GGAAUGUUGUCUGGUUCAAGG 21 180 10 18 1    1 3 6 18 16 10 6 8 7 11 5 8 10 14 12 18 13 14 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR166b-3p UCGGACCAGGCUUCAUUCCCC 21 290,717 8,306 28,735 26    6,134 5,113 10,286 14,671 18,610 12,930 12,226 19,378 6,950 23,916 10,355 8,353 15,009 19,680 28,735 27,446 15,133 24,682 52 133 0 272 35 61 2,565 388 2,963 0 405 0 215 0 1,066 0 0 0 482 0 26 0 543 1,511 0 193 0 0 0 200
ata-miR166b-5p GGGAAUGACGCCGGGUCCGAAA 22 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR166c-3p UCGGACCAGGCUUCAUUCCUU 21 270 15 46 2    7 7 9 27 27 14 12 9 4 7 2 4 15 29 46 11 13 27 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR166c-5p GGAACGUUGGCUGGCUCGAGG 21 20 5 17 1    0 0 0 1 0 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 0 0 17 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR166d-3p UCGGACCAGGCUUCAUUCCCC 21 290,717 8,306 28,735 26    6,134 5,113 10,286 14,671 18,610 12,930 12,226 19,378 6,950 23,916 10,355 8,353 15,009 19,680 28,735 27,446 15,133 24,682 52 133 0 272 35 61 2,565 388 2,963 0 405 0 215 0 1,066 0 0 0 482 0 26 0 543 1,511 0 193 0 0 0 200
ata-miR166d-5p GGAAUGUUGUCUGGCUCGGGG 21 278 15 36 4    5 4 15 14 15 8 9 11 7 15 7 8 10 33 18 36 18 28 17 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR166e-3p UCGGACCAGGCUUCAUUCCCC 21 290,717 8,306 28,735 26    6,134 5,113 10,286 14,671 18,610 12,930 12,226 19,378 6,950 23,916 10,355 8,353 15,009 19,680 28,735 27,446 15,133 24,682 52 133 0 272 35 61 2,565 388 2,963 0 405 0 215 0 1,066 0 0 0 482 0 26 0 543 1,511 0 193 0 0 0 200
ata-miR166e-5p GGAAUGUUGUCUGGUUGGAGA 21 16 2 3 1    1 2 3 1 0 0 0 0 0 2 1 1 1 2 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR167a-3p GAUCGUGCUGUGACAGUUUCACC 23 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR167a-5p UGAAGCUGCCAGCAUGAUCUA 21 3,736 129 756 1    1 1 2 3 2 2 3 2 1 1 1 2 3 2 4 0 2 2 17 0 0 0 0 0 428 0 0 0 0 37 430 145 0 0 128 0 241 0 0 0 181 756 0 0 218 551 570 0
ata-miR167b-3p AGGUCAUGCUGGAGUUUCAUC 21 218 12 27 3    6 5 10 12 17 13 7 7 4 21 11 3 11 16 19 27 10 19 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR167b-5p UGAAGCUGCCAGCAUGAUCUGA 22 29,633 706 4,703 26    245 184 280 231 429 182 189 343 153 222 85 112 372 499 413 784 582 832 35 177 0 54 138 107 4,703 1,553 988 0 2,432 37 430 1,305 1,066 0 638 0 1,204 0 26 1,296 1,268 1,511 0 578 1,090 919 1,140 801
ata-miR167c-3p GAUCAUGACUGACAGCCUCAUU 22 31 2 5 1    0 0 1 1 1 2 0 1 1 3 1 1 1 2 4 2 5 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR167c-5p UGAAGCUGCCAGCAUGAUCUA 21 3,736 129 756 1    1 1 2 3 2 2 3 2 1 1 1 2 3 2 4 0 2 2 17 0 0 0 0 0 428 0 0 0 0 37 430 145 0 0 128 0 241 0 0 0 181 756 0 0 218 551 570 0
ata-miR167d-3p AGGUCAUGUGGCAGCUUCAUU 21 157 8 24 2    3 2 3 7 8 9 7 9 4 4 3 3 4 9 12 16 13 24 17 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR167d-5p UGAAGCUGCCAGCAUGAUCUGA 22 29,633 706 4,703 26    245 184 280 231 429 182 189 343 153 222 85 112 372 499 413 784 582 832 35 177 0 54 138 107 4,703 1,553 988 0 2,432 37 430 1,305 1,066 0 638 0 1,204 0 26 1,296 1,268 1,511 0 578 1,090 919 1,140 801
ata-miR167e-3p GGUCAUGCUGCGGCAGCCUCACU 23 3 1 1 1    0 0 0 0 1 0 0 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR167e-5p UGAAGCUGCCAGCAUGAUCUA 21 3,736 129 756 1    1 1 2 3 2 2 3 2 1 1 1 2 3 2 4 0 2 2 17 0 0 0 0 0 428 0 0 0 0 37 430 145 0 0 128 0 241 0 0 0 181 756 0 0 218 551 570 0
ata-miR167f-3p CAGAUCAUGCUGCAGCUUCAU 21 1 1 1 1    0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR167f-5p UGAAGCUGCCAGCAUGAUCUGC 22 3,745 187 406 43    72 100 91 186 406 215 160 250 127 97 43 89 144 162 248 402 200 245 0 0 0 0 0 0 0 0 0 0 0 0 0 290 0 0 0 0 0 0 0 0 0 0 0 0 218 0 0 0
ata-miR168-3p CCCGCCUUGCACCAAGUGAAU 21 7,265 404 1,971 60    75 126 119 217 327 192 1,394 128 89 367 60 121 290 429 392 760 208 1,971 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR168-5p UCGCUUGGUGCAGAUCGGGAC 21 117,685 2,558 27,220 41    440 635 761 941 1,013 485 2,245 605 348 1,940 189 289 813 2,145 1,533 984 848 2,729 953 531 0 327 1,469 994 18,384 4,270 3,951 112 1,216 703 7,956 3,481 4,262 41 893 162 4,094 546 474 27,220 1,630 4,533 0 1,349 2,399 2,940 2,851 1,001
ata-miR169a-3p UGGGCAAGUCACCCUGGCUACC 22 8 1 2 1    0 1 0 0 0 0 0 0 1 1 1 2 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR169a-5p UAGCCAAGGAUGAUUUGCCUGUG 23 4 1 2 1    0 0 0 0 0 0 1 2 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR169b-3p UGGGCAAGUCAUCCUGGCUACCC 23 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR169b-5p UAGCCAAGGAUGAUUUGCCUGUG 23 4 1 2 1    0 0 0 0 0 0 1 2 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR169c-3p GGCGGUCACCUUGGCUAGC 19 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR169c-5p UAGCCAAGGAUGACUUGCCUA 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR169d-3p GGCAAGUUGUCCUUGGCUACA 21 15 3 5 1    3 1 5 0 0 0 0 0 0 0 0 0 1 1 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR169d-5p CAGCCAAGGAUGACUUGCCGG 21 41 3 10 1    4 9 10 1 1 1 0 1 0 1 0 0 1 1 5 2 2 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR169e-5p CAGCCAAGGAUGACUUGCCGA 21 71 4 9 1    1 1 3 3 4 2 9 5 2 5 3 4 2 5 8 4 3 7 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR169f-3p GGCAAGUCCGUCCUUGGCUACA 22 7 2 3 1    3 1 2 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR169f-5p CAGCCAAGGAUGACUUGCCGA 21 71 4 9 1    1 1 3 3 4 2 9 5 2 5 3 4 2 5 8 4 3 7 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR169g-3p GGCGAGUUGUUCUUGGCUACA 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR169g-5p CAGCCAAGGAUGACUUGCCGA 21 71 4 9 1    1 1 3 3 4 2 9 5 2 5 3 4 2 5 8 4 3 7 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR169h-3p GCAAGUUGUUCUUGGCUAGC 20 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR169h-5p UAGCCAAGGAUGACUUGCCGG 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR169i-3p GGCAGUCUCCUUGGCUAGC 19 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR169i-5p UAGCCAAGGAUGACUUGCCUG 21 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR169j-3p UGGGCAAGUCACCCUGGCUACC 22 8 1 2 1    0 1 0 0 0 0 0 0 1 1 1 2 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR169j-5p UAGCCAAGGAUGAUUUGCCUGUG 23 4 1 2 1    0 0 0 0 0 0 1 2 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR171a-3p UGAGCCGAACCAAUAUCACUC 21 18 2 4 1    0 2 1 0 1 2 0 1 0 1 1 0 2 2 4 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR171a-5p UGGUAUUGUUUCGGCUCAUG 20 2 1 1 1    0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR171b-3p UGAUUGAGCCGUGCCAAUAUC 21 305 17 31 8    10 17 14 18 21 14 16 12 15 31 22 30 8 9 24 16 8 20 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR171b-5p UGUUGGCAUGGCUCAAUCAAA 21 1 1 1 1    0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR171c-3p UUGAGCCGUGCCAAUAUCACG 21 56 3 7 1    2 6 3 5 2 2 3 3 1 1 1 2 3 7 7 2 4 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR171c-5p CGGUAUUGGUGCGGUUCAAUC 21 45 3 6 1    3 2 3 2 3 1 3 1 1 1 1 1 3 6 6 4 2 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR171d-3p UGAUUGAGCCGUGCCAAUAUC 21 305 17 31 8    10 17 14 18 21 14 16 12 15 31 22 30 8 9 24 16 8 20 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR171d-5p UGUUGGCUCGACUCACUCAGA 21 66 4 21 1    3 3 2 1 2 2 5 3 1 21 7 9 2 1 3 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR172a-3p AGAAUCUUGAUGAUGCUGCGU 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR172a-5p GCGGCACCAUCAAGAUUCACA 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR172b-3p AGAAUCUUGAUGAUGCUGCAU 21 279 16 218 1    1 1 1 0 2 0 2 2 1 2 2 5 1 1 3 0 1 2 17 0 0 0 17 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 218 0 0 0
ata-miR172b-5p GCAGCACCACCAAGAUUCACA 21 12 1 4 1    0 0 0 1 1 0 0 1 0 0 1 1 0 1 1 4 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR172c-3p GGAAUCUUGAUGAUGCUGCAU 21 124 7 17 1    7 6 4 4 2 1 14 10 9 15 13 7 5 3 17 2 1 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR172c-5p GUGGCAUCAUCAAGAUUCACACA 23 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR2118a-3p GGGAAUGGGAACAUGGAGGAA 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR2118a-5p UUCCUAAUGUCUCCCAUUCCUA 22 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR2118b-3p GGGAAUGGGAACAUGGAGGAA 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR2118b-5p UUCCCGAUGCCUCCCAUUCCUA 22 1 1 1 1    0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR2118c-3p UUCCUGAUGCCUCCCAUGCCUA 22 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR2118d-3p UUCCUGAUGCCUCCCAUGCCUA 22 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR2275a-3p UUUGUUUUUCUCCAAUAUCUCA 22 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR2275a-5p UGAGUGUUCGAGGAAAGCAA 20 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR2275b-3p CUUGUUUUCCUCCAAUAUCUCA 22 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR2275b-5p AGAGUUGGAGGAAAACAAACA 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR2275c-3p UUUGGUUUCCUCCAAUAUCUCA 22 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR2275c-5p AGUGUUGGAUGGGACCAAAUC 21 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR319-3p ACUGGAUGACGCGGGAGCUAA 21 1,792 299 533 44    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 44 0 0 0 0 428 388 0 0 0 0 0 0 533 0 0 0 0 0 0 0 181 0 0 0 218 0 0 0
ata-miR319-5p AGCUGCCGAUUCAUUCAUUCA 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR390-3p CGCUAUCUAUCCUGAGCUCC 20 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR390-5p AAGCUCAGGAGGGAUAGCGCC 21 40 2 5 1    1 2 1 1 1 1 2 2 1 3 5 2 2 2 4 0 5 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR393-3p CAGUGCAAUCCCUUUGGAAUU 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR393-5p UUCCAAAGGGAUCGCAUUGAU 21 397 21 44 2    40 39 44 20 26 10 22 18 9 17 2 6 27 39 35 9 5 12 0 0 0 0 17 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR394-3p AGGUGGGCAUACUGCCAAUGG 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR394-5p UUGGCAUUCUGUCCACCUCC 20 46 3 5 1    1 1 1 2 5 3 2 4 1 4 3 3 1 1 5 2 5 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR395a-3p UGAAGUGUUUGGGGGAACUC 20 6 1 1 1    1 0 0 0 1 0 1 0 0 0 0 0 1 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR395a-5p GUUCCCUUCAAGCACUUCAGG 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR395b-3p AAGUGUUUGGGGGAACUC 18 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR395b-5p GUUCCCUGCAAACACUUCACG 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR395c-3p UGAAGUGUUUGGGGGAACUC 20 6 1 1 1    1 0 0 0 1 0 1 0 0 0 0 0 1 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR395c-5p GUUCUCCUCAAAUCACUUCA 20 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR395d-3p UGAAGUGUUUGGGGGAACUC 20 6 1 1 1    1 0 0 0 1 0 1 0 0 0 0 0 1 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR395d-5p AGUUCCCUUCAAGCACUUUACG 22 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR395e-3p UGAAGUGUUUGGGGGAACUC 20 6 1 1 1    1 0 0 0 1 0 1 0 0 0 0 0 1 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR395e-5p GUUCCUUACAAGCACUUCACG 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR395f-3p UGAAGUGUUUGGGGGAACUC 20 6 1 1 1    1 0 0 0 1 0 1 0 0 0 0 0 1 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR395f-5p GUUCCCUUCAAGCACUUCAGG 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR396a-3p GUUCAAGAAAGUCCUUGGAAA 21 5 1 1 1    0 0 1 1 0 0 0 0 1 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR396a-5p UCCACAGGCUUUCUUGAACUG 21 23,945 1,088 3,158 145    1,203 1,100 1,742 610 1,325 861 1,517 1,904 861 1,089 569 996 849 1,330 1,357 3,158 945 1,486 0 0 0 0 0 0 0 0 0 0 0 0 0 145 533 0 0 0 0 0 0 0 181 0 0 0 0 184 0 0
ata-miR396b-3p GUUCAAGAAAGUCCUUGGAA 20 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR396b-5p UCCACAGGCUUUCUUGAACUG 21 23,945 1,088 3,158 145    1,203 1,100 1,742 610 1,325 861 1,517 1,904 861 1,089 569 996 849 1,330 1,357 3,158 945 1,486 0 0 0 0 0 0 0 0 0 0 0 0 0 145 533 0 0 0 0 0 0 0 181 0 0 0 0 184 0 0
ata-miR396c-3p GGUCAAGAAAGCUGUGGGAAG 21 50 4 26 1    1 1 1 1 0 0 2 2 1 5 2 1 2 1 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 26 0 0 0 0 0 0 0 0 0
ata-miR396c-5p UUCCACAGCUUUCUUGAACUU 21 3,178 177 335 61    164 116 233 61 109 70 327 335 172 300 162 115 223 202 318 87 83 101 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR396d-3p GUUCAAGAAAGCCCAUGGAAA 21 10 1 1 1    0 0 0 1 1 0 0 1 1 1 0 1 1 1 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR396d-5p UCCACAGGCUUUCUUGAACUG 21 23,945 1,088 3,158 145    1,203 1,100 1,742 610 1,325 861 1,517 1,904 861 1,089 569 996 849 1,330 1,357 3,158 945 1,486 0 0 0 0 0 0 0 0 0 0 0 0 0 145 533 0 0 0 0 0 0 0 181 0 0 0 0 184 0 0
ata-miR396e-3p GUUCAAUAAAGCUGUGGGAAA 21 35 2 4 1    1 1 3 1 2 1 4 2 2 4 1 1 1 3 4 2 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR396e-5p UUCCACAGCUUUCUUGAACUG 21 1,974 110 180 51    117 127 141 88 159 106 79 125 64 96 53 99 99 151 167 180 51 72 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR398f-3p UGUGUUCUCAGGUCGCCCCCG 21 782 49 756 1    0 1 2 2 3 1 1 2 1 1 0 0 1 1 4 2 3 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 756 0 0 0 0 0 0
ata-miR398f-5p GGGUCGAACUGAGAACACAUG 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR398g-3p UGUGUUCUCAGGUCGCCCCCG 21 782 49 756 1    0 1 2 2 3 1 1 2 1 1 0 0 1 1 4 2 3 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 756 0 0 0 0 0 0
ata-miR398g-5p GGGUCGAGCUGGGAACACAUG 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR399a-3p UGCCAAAGGAGAAUUGCCCUG 21 58 3 16 1    1 1 1 1 2 0 3 9 2 3 3 1 2 1 1 16 3 8 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR399a-5p GGGCGCUUCUCCAUUGGCACGG 22 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR399b-3p UGCCAAAGGAGAAUUGCCCUG 21 58 3 16 1    1 1 1 1 2 0 3 9 2 3 3 1 2 1 1 16 3 8 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR399b-5p CAGGGCGCUUCUCCUUUGGCA 21 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR408-3p UGCACUGCCUCUUCCCUGCC 20 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR408-5p CAGGGAUGGAGCAGAGCAAGG 21 6 1 1 1    1 0 0 1 1 0 0 0 0 0 0 0 1 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR5062a-3p GUGGAUUUUUCACCAAGAUUCAAG 24 3 1 1 1    0 0 0 0 1 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR5062a-5p UGAACCUUAGGGAAAAGCCGCAU 23 409 51 181 8    25 9 20 0 0 0 0 0 0 0 0 0 8 26 12 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 128 0 0 0 0 0 181 0 0 0 0 0 0 0
ata-miR5062b-3p UGAACCUUAGGGAAAAGCCGCAU 23 409 51 181 8    25 9 20 0 0 0 0 0 0 0 0 0 8 26 12 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 128 0 0 0 0 0 181 0 0 0 0 0 0 0
ata-miR5062b-5p GCGGAUUUUUCACCAAGAUUCAAG 24 17 1 3 1    1 2 3 0 1 0 1 1 1 1 1 1 1 1 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR5070-3p UUGAACUAAGUAGGGUCGGAG 21 17 17 17 17    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 17 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR5070-5p UCUGACCCUUCUUAGUUCAAC 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR5084-3p ACCAUACGGUACUGCAGAGGAUC 23 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR5084-5p AUCCUCUACAGUACUGUACGGUGC 24 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR5168-3p UCGGACCAGGCUUCAAUCCCU 21 15,166 632 2,021 17    481 440 854 648 646 355 760 772 352 2,021 559 521 717 1,113 1,605 384 289 670 35 0 0 54 17 0 0 0 0 0 0 0 215 0 0 0 0 0 0 0 0 1,296 362 0 0 0 0 0 0 0
ata-miR5168-5p GGGUUGUUGUCUGGUUCAAGG 21 31 2 6 1    1 2 1 2 1 1 2 0 1 6 1 1 2 2 6 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR5181-3p CACUUAUUUUGGACCGGAGGG 21 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR5181-5p UCCGAUCCAGAAUAAGUGUCG 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR5200-3p UGUAGAUACUCCCUAAGGCUU 21 109 16 69 1    0 0 1 0 0 0 0 0 0 0 0 0 1 1 1 0 0 1 69 0 0 0 35 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR5200-5p AAGCCUUAGUGAAUAUCUACA 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR528-3p CCUGUGCCUGCCUCUUCCAUU 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR528-5p UGGAAGGGGCAUGCAGAGGAG 21 2,393 342 1,296 1    0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 35 15 428 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1,296 0 0 0 0 218 0 0 400
ata-miR6201-3p GUACGAGUGUCUCAGGGCCAA 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR6201-5p UGACCCUGAGGCACUCAUACCG 22 24 2 5 1    1 0 2 0 0 0 2 2 1 5 4 4 1 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR9672-3p UACCACGACUGUCAUUAAGCA 21 13,624 649 5,860 1    251 120 310 0 1 1 0 1 1 0 0 0 107 150 178 0 1 0 0 0 0 0 17 0 0 0 0 0 0 0 1,290 1,015 5,860 0 128 0 0 0 0 0 0 2,267 0 0 218 368 1,140 200
ata-miR9672-5p CUUAAUGACAGUCGUGGUGUC 21 35 4 7 1    6 5 7 1 1 0 0 0 1 0 0 0 2 5 5 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR9674a-3p GUAAGAUGGCUGAUGCUAUGG 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR9674a-5p AUAGCAUCAUCCAUCCUACCC 21 16,768 838 3,876 194    322 254 255 327 415 194 1,163 1,599 631 3,876 1,477 1,831 243 357 628 816 420 890 0 0 0 0 0 0 855 0 0 0 0 0 215 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR9674b-3p UGAAUUUGUCCAUAGCAUCAG 21 1,619 90 193 36    40 67 45 48 72 36 111 140 93 193 119 159 60 64 112 113 63 84 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR9674b-5p GGUGCUAUGGAUAGCUUCAAC 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR9674c-3p GGUGCUAUGGAUAAAUUCAAC 21 149 8 29 1    3 1 3 11 8 3 15 19 7 29 7 5 6 7 4 7 6 8 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR9674c-5p UGAAUUUUUCCAUAGCAUCAG 21 20 1 2 1    2 1 2 1 1 1 2 2 0 2 1 1 1 1 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR9677-3p UGGCCGUUGGUAGAGUAGGAGA 22 24,331 1,431 4,561 14    17 16 28 0 0 0 0 0 0 0 0 0 14 16 20 0 0 0 0 0 0 0 0 0 428 2,717 3,951 0 0 0 0 1,450 1,066 0 0 0 1,686 0 0 0 1,811 2,267 0 0 1,526 2,757 4,561 0
ata-miR9677-5p UUCCACUCUACCAACAGCCACG 22 5 1 1 1    1 1 1 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR9772a-3p AGGGGGCAAUCUCACCUCAAC 21 11 1 1 1    0 1 1 1 0 0 0 1 1 1 1 1 1 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR9772a-5p UGAGAUGAGAUUACCCCAUAC 21 556 29 67 12    12 15 15 16 27 13 24 37 22 37 20 34 17 30 67 64 37 54 0 0 0 0 0 15 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR9772b-3p AGGGGGCAAUCUCACCUCAAC 21 11 1 1 1    0 1 1 1 0 0 0 1 1 1 1 1 1 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR9772b-5p UGAGAUGAGAUUACCCCAUAC 21 556 29 67 12    12 15 15 16 27 13 24 37 22 37 20 34 17 30 67 64 37 54 0 0 0 0 0 15 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR9776-3p GCACAUCCAUGUCCAAGCUCU 21 37 5 18 1    1 2 7 0 0 0 0 0 0 0 1 0 3 5 18 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR9776-5p AGCUUGGACGAGGAUGUGCAA 21 255 21 128 1    22 5 19 0 1 0 0 0 1 1 1 1 5 56 15 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 128 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR9783-3p AUAAGCACCGGUGCUUAAGGA 21 1 1 1 1    0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR9783-5p UUUGAAGCACUGACGCCUAUUUCU 24 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR9863a-3p UGAGAAGGUAGAUCAUAAUAGC 22 63,399 1,546 6,814 1    4,337 5,691 6,814 3 4 1 244 444 248 499 196 335 3,430 4,646 4,731 2 1 2 277 1,018 0 654 35 76 855 1,941 0 0 405 407 5,161 3,191 4,795 124 4,718 0 1,445 0 53 0 724 756 0 771 1,308 1,286 570 1,201
ata-miR9863a-5p UGUUAUGAUCUGCUUCUCAUC 21 329 18 41 1    22 19 26 17 21 6 11 19 7 3 1 3 16 34 36 27 20 41 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR9863b-3p UGAGAAGGUAGAUCAUAAUAGC 22 63,399 1,546 6,814 1    4,337 5,691 6,814 3 4 1 244 444 248 499 196 335 3,430 4,646 4,731 2 1 2 277 1,018 0 654 35 76 855 1,941 0 0 405 407 5,161 3,191 4,795 124 4,718 0 1,445 0 53 0 724 756 0 771 1,308 1,286 570 1,201
ata-miR9863b-5p UGUUAUGAUCUGCUUCUCAUC 21 329 18 41 1    22 19 26 17 21 6 11 19 7 3 1 3 16 34 36 27 20 41 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0