Ae. tauschii Small RNA miRNA Abundances

The data below are based on the microRNAs listed in the Sanger registry. Adjust libraries/reads to display on the control panel.


        miRNA         miRNA sequence Len Sum (norm) Average Max Min (>0)  AeT_En1AeT_En2AeT_En3TrU_En1TrU_En2TrU_En3TT_En1TT_En2TT_En3AeL_En1AeL_En2AeL_En3TT_En4TT_En5TT_En6TrU_En4TrU_En5TrU_En6TrA_SdlTrA_20d_SeedTrA_10d_SeedTrA_5d_SeedTrA_flag_leafTrA_11d_sd_natTrA_spk_nat_2TrA_spk_nat_1TrA_spk_S4TrA_11d_sd_S3_2TrA_11d_sd_S3_1TrA_spk_S3_2TrA_spk_S3_1TrA_7d_sdl_S3_2TrA_7d_sdl_S3_1TrA_11d_sd_S2TrA_spk_S1TrA_11d_sd_S1AeT_11d_sd_p_2AeT_11d_sd_p_1AeT_spk_p_2AeT_spk_p_1AeT_7d_sdl_p_2AeT_7d_sdl_p_1TT_11d_sd_m_2TT_11d_sd_m_1TT_spk_m_2TT_spk_m_1TT_7d_sdl_m_2TT_7d_sdl_m_1
ata-miR1432-3p UUGGUGUCACCUCGCCUGAAC 21 8 1 1 1    0 1 1 1 1 1 0 0 0 0 0 0 1 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR1432-5p UCAGGAGAGAUGACACCGACG 21 22 4 18 1    0 0 1 1 0 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 18 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR156a-3p GCUCACCCUCUCUCUGUCAGC 21 19 2 6 1    0 0 0 1 1 1 1 1 0 0 0 0 1 1 2 3 1 6 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR156a-5p UGACAGAAGAGAGUGAGCAC 20 22,802 786 8,992 27    110 86 97 27 75 36 67 145 36 132 46 83 33 63 97 225 160 200 320 244 0 0 369 622 8,992 0 0 0 0 808 6,103 0 0 0 0 0 0 0 323 2,859 229 0 0 0 0 215 0 0
ata-miR156b-3p GCUCAUUUCUCUCUCUGUCAGC 22 1 1 1 1    0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR156b-5p UGACAGAAGAGAGUGAGCAC 20 22,802 786 8,992 27    110 86 97 27 75 36 67 145 36 132 46 83 33 63 97 225 160 200 320 244 0 0 369 622 8,992 0 0 0 0 808 6,103 0 0 0 0 0 0 0 323 2,859 229 0 0 0 0 215 0 0
ata-miR156c-3p GCUCACUGCUCUAUCUGUCACC 22 21 2 2 1    0 0 1 1 2 2 1 0 1 2 1 2 1 2 2 0 2 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR156c-5p UGACAGAAGAGAGUGAGCAC 20 22,802 786 8,992 27    110 86 97 27 75 36 67 145 36 132 46 83 33 63 97 225 160 200 320 244 0 0 369 622 8,992 0 0 0 0 808 6,103 0 0 0 0 0 0 0 323 2,859 229 0 0 0 0 215 0 0
ata-miR156d-3p GCUCACUCCUCUUUCUGUCAGC 22 60 4 35 1    2 2 1 1 1 0 2 1 0 1 1 0 1 3 2 6 1 0 0 0 0 0 35 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR156d-5p UGACAGAAGAGAGUGAGCAC 20 22,802 786 8,992 27    110 86 97 27 75 36 67 145 36 132 46 83 33 63 97 225 160 200 320 244 0 0 369 622 8,992 0 0 0 0 808 6,103 0 0 0 0 0 0 0 323 2,859 229 0 0 0 0 215 0 0
ata-miR156e-3p GCUCACCCUCUCUCUGUCAGC 21 19 2 6 1    0 0 0 1 1 1 1 1 0 0 0 0 1 1 2 3 1 6 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR156e-5p UGACAGAAGAGAGUGAGCAC 20 22,802 786 8,992 27    110 86 97 27 75 36 67 145 36 132 46 83 33 63 97 225 160 200 320 244 0 0 369 622 8,992 0 0 0 0 808 6,103 0 0 0 0 0 0 0 323 2,859 229 0 0 0 0 215 0 0
ata-miR160a-3p GCGUUGGCUCUACCGCGGAUG 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR160a-5p UGCCUGGCUCCCUGUAUGCCA 21 339 19 39 9    13 15 9 20 29 13 16 18 10 23 15 14 10 18 39 24 21 32 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR160b-3p GCGUGCACGGAUCCAAGCAUA 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR160b-5p UGCCUGGCUCCCUGUAUGCCA 21 339 19 39 9    13 15 9 20 29 13 16 18 10 23 15 14 10 18 39 24 21 32 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR160c-3p GCGUGCAAGGAGCCAAGCAUG 21 15 1 3 1    0 0 0 1 1 0 2 1 1 1 0 0 1 1 0 3 1 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR160c-5p UGCCUGGCUCCCUGUAUGCCA 21 339 19 39 9    13 15 9 20 29 13 16 18 10 23 15 14 10 18 39 24 21 32 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR164a-3p CACGUGCGCUCCUUCUCCAGC 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR164a-5p UGGAGAAGCAGGGCACGUGCU 21 4 1 1 1    0 1 1 0 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR164b-3p CAUGUGCCUUUCUUCUCCACC 21 83 14 24 6    17 15 13 0 0 0 0 0 0 0 0 0 6 8 24 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR164b-5p UGGAGAAGCAGGGCACGUGCA 21 3,216 140 819 8    13 57 36 33 76 59 22 53 30 21 8 54 29 67 127 261 68 92 0 0 0 0 0 0 0 0 0 0 0 38 469 0 575 0 0 0 0 0 0 0 0 819 0 209 0 0 0 0
ata-miR164c-3p CACGUGUUCUUCUCCUCCAUC 21 2 1 1 1    0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR164c-5p UGGAGAAGCAGGGCACGUGCA 21 3,216 140 819 8    13 57 36 33 76 59 22 53 30 21 8 54 29 67 127 261 68 92 0 0 0 0 0 0 0 0 0 0 0 38 469 0 575 0 0 0 0 0 0 0 0 819 0 209 0 0 0 0
ata-miR166a-3p UCGGACCAGGCUUCAUUCCCC 21 336,628 9,618 37,019 27    6,404 5,358 10,988 16,943 21,850 14,512 13,812 22,102 7,645 27,363 11,132 9,268 16,384 22,581 33,184 37,019 17,418 30,155 53 146 0 286 35 62 2,840 458 3,419 0 455 0 235 0 1,151 0 0 0 588 0 27 0 687 1,639 0 209 0 0 0 220
ata-miR166a-5p GGAAUGUUGUCUGGUUCAAGG 21 207 12 24 1    1 3 6 21 19 11 7 9 7 13 6 8 10 16 14 24 15 17 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR166b-3p UCGGACCAGGCUUCAUUCCCC 21 336,628 9,618 37,019 27    6,404 5,358 10,988 16,943 21,850 14,512 13,812 22,102 7,645 27,363 11,132 9,268 16,384 22,581 33,184 37,019 17,418 30,155 53 146 0 286 35 62 2,840 458 3,419 0 455 0 235 0 1,151 0 0 0 588 0 27 0 687 1,639 0 209 0 0 0 220
ata-miR166b-5p GGGAAUGACGCCGGGUCCGAAA 22 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR166c-3p UCGGACCAGGCUUCAUUCCUU 21 314 17 53 3    8 7 10 32 32 16 13 10 5 8 3 5 16 33 53 15 15 33 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR166c-5p GGAACGUUGGCUGGCUCGAGG 21 21 5 18 1    0 0 0 1 0 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 0 0 18 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR166d-3p UCGGACCAGGCUUCAUUCCCC 21 336,628 9,618 37,019 27    6,404 5,358 10,988 16,943 21,850 14,512 13,812 22,102 7,645 27,363 11,132 9,268 16,384 22,581 33,184 37,019 17,418 30,155 53 146 0 286 35 62 2,840 458 3,419 0 455 0 235 0 1,151 0 0 0 588 0 27 0 687 1,639 0 209 0 0 0 220
ata-miR166d-5p GGAAUGUUGUCUGGCUCGGGG 21 321 17 48 4    5 4 16 16 17 9 10 12 7 17 8 9 11 37 21 48 21 35 18 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR166e-3p UCGGACCAGGCUUCAUUCCCC 21 336,628 9,618 37,019 27    6,404 5,358 10,988 16,943 21,850 14,512 13,812 22,102 7,645 27,363 11,132 9,268 16,384 22,581 33,184 37,019 17,418 30,155 53 146 0 286 35 62 2,840 458 3,419 0 455 0 235 0 1,151 0 0 0 588 0 27 0 687 1,639 0 209 0 0 0 220
ata-miR166e-5p GGAAUGUUGUCUGGUUGGAGA 21 19 2 3 1    1 2 3 1 0 0 0 0 0 3 2 1 1 2 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR167a-3p GAUCGUGCUGUGACAGUUUCACC 23 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR167a-5p UGAAGCUGCCAGCAUGAUCUA 21 4,219 145 819 1    1 1 2 3 2 3 4 3 1 1 1 2 3 2 4 0 2 3 18 0 0 0 0 0 473 0 0 0 0 38 469 171 0 0 137 0 294 0 0 0 229 819 0 0 252 645 636 0
ata-miR167b-3p AGGUCAUGCUGGAGUUUCAUC 21 251 14 36 3    6 5 10 14 20 14 8 8 4 24 12 3 12 18 22 36 12 23 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR167b-5p UGAAGCUGCCAGCAUGAUCUGA 22 33,778 804 5,206 27    256 193 299 267 503 204 214 392 169 254 91 124 406 573 477 1,058 669 1,017 36 195 0 57 141 109 5,206 1,832 1,140 0 2,730 38 469 1,539 1,151 0 686 0 1,470 0 27 1,430 1,602 1,639 0 627 1,260 1,075 1,272 881
ata-miR167c-3p GAUCAUGACUGACAGCCUCAUU 22 37 2 6 1    0 0 1 1 1 3 0 1 1 4 1 1 1 3 5 3 5 6 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR167c-5p UGAAGCUGCCAGCAUGAUCUA 21 4,219 145 819 1    1 1 2 3 2 3 4 3 1 1 1 2 3 2 4 0 2 3 18 0 0 0 0 0 473 0 0 0 0 38 469 171 0 0 137 0 294 0 0 0 229 819 0 0 252 645 636 0
ata-miR167d-3p AGGUCAUGUGGCAGCUUCAUU 21 181 10 30 2    3 2 3 8 10 10 8 10 5 4 3 3 5 10 13 21 15 30 18 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR167d-5p UGAAGCUGCCAGCAUGAUCUGA 22 33,778 804 5,206 27    256 193 299 267 503 204 214 392 169 254 91 124 406 573 477 1,058 669 1,017 36 195 0 57 141 109 5,206 1,832 1,140 0 2,730 38 469 1,539 1,151 0 686 0 1,470 0 27 1,430 1,602 1,639 0 627 1,260 1,075 1,272 881
ata-miR167e-3p GGUCAUGCUGCGGCAGCCUCACU 23 3 1 1 1    0 0 0 0 1 0 0 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR167e-5p UGAAGCUGCCAGCAUGAUCUA 21 4,219 145 819 1    1 1 2 3 2 3 4 3 1 1 1 2 3 2 4 0 2 3 18 0 0 0 0 0 473 0 0 0 0 38 469 171 0 0 137 0 294 0 0 0 229 819 0 0 252 645 636 0
ata-miR167f-3p CAGAUCAUGCUGCAGCUUCAU 21 1 1 1 1    0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR167f-5p UGAAGCUGCCAGCAUGAUCUGC 22 4,370 219 543 46    76 105 97 215 477 241 181 285 139 112 46 99 158 186 287 543 230 299 0 0 0 0 0 0 0 0 0 0 0 0 0 342 0 0 0 0 0 0 0 0 0 0 0 0 252 0 0 0
ata-miR168-3p CCCGCCUUGCACCAAGUGAAU 21 8,559 476 2,408 65    79 132 127 251 384 215 1,575 146 97 420 65 134 316 492 453 1,025 240 2,408 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR168-5p UCGCUUGGUGCAGAUCGGGAC 21 132,010 2,870 30,021 43    459 666 813 1,087 1,190 544 2,536 690 382 2,220 203 320 887 2,462 1,770 1,328 976 3,334 979 585 0 343 1,493 1,010 20,350 5,038 4,558 115 1,365 731 8,684 4,104 4,603 43 960 167 4,999 579 484 30,021 2,060 4,916 0 1,464 2,771 3,439 3,181 1,101
ata-miR169a-3p UGGGCAAGUCACCCUGGCUACC 22 8 1 2 1    0 1 0 0 0 0 0 0 1 1 1 2 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR169a-5p UAGCCAAGGAUGAUUUGCCUGUG 23 4 1 2 1    0 0 0 0 0 0 1 2 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR169b-3p UGGGCAAGUCAUCCUGGCUACCC 23 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR169b-5p UAGCCAAGGAUGAUUUGCCUGUG 23 4 1 2 1    0 0 0 0 0 0 1 2 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR169c-3p GGCGGUCACCUUGGCUAGC 19 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR169c-5p UAGCCAAGGAUGACUUGCCUA 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR169d-3p GGCAAGUUGUCCUUGGCUACA 21 15 3 5 1    3 1 5 0 0 0 0 0 0 0 0 0 1 1 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR169d-5p CAGCCAAGGAUGACUUGCCGG 21 44 3 10 1    4 9 10 1 1 1 0 1 0 2 0 0 1 1 6 3 2 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR169e-5p CAGCCAAGGAUGACUUGCCGA 21 80 4 10 1    1 1 3 4 4 3 10 5 2 6 3 4 2 5 9 6 4 8 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR169f-3p GGCAAGUCCGUCCUUGGCUACA 22 7 2 3 1    3 1 2 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR169f-5p CAGCCAAGGAUGACUUGCCGA 21 80 4 10 1    1 1 3 4 4 3 10 5 2 6 3 4 2 5 9 6 4 8 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR169g-3p GGCGAGUUGUUCUUGGCUACA 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR169g-5p CAGCCAAGGAUGACUUGCCGA 21 80 4 10 1    1 1 3 4 4 3 10 5 2 6 3 4 2 5 9 6 4 8 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR169h-3p GCAAGUUGUUCUUGGCUAGC 20 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR169h-5p UAGCCAAGGAUGACUUGCCGG 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR169i-3p GGCAGUCUCCUUGGCUAGC 19 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR169i-5p UAGCCAAGGAUGACUUGCCUG 21 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR169j-3p UGGGCAAGUCACCCUGGCUACC 22 8 1 2 1    0 1 0 0 0 0 0 0 1 1 1 2 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR169j-5p UAGCCAAGGAUGAUUUGCCUGUG 23 4 1 2 1    0 0 0 0 0 0 1 2 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR171a-3p UGAGCCGAACCAAUAUCACUC 21 19 2 4 1    0 2 1 0 1 2 0 1 0 1 1 0 2 3 4 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR171a-5p UGGUAUUGUUUCGGCUCAUG 20 2 1 1 1    0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR171b-3p UGAUUGAGCCGUGCCAAUAUC 21 345 19 35 9    10 17 14 21 25 16 18 14 16 35 24 34 9 10 28 21 9 24 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR171b-5p UGUUGGCAUGGCUCAAUCAAA 21 1 1 1 1    0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR171c-3p UUGAGCCGUGCCAAUAUCACG 21 64 4 8 1    2 6 3 5 3 2 4 3 1 2 1 2 3 8 8 3 5 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR171c-5p CGGUAUUGGUGCGGUUCAAUC 21 54 3 7 1    3 2 3 2 4 1 4 1 1 2 2 1 3 7 7 6 2 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR171d-3p UGAUUGAGCCGUGCCAAUAUC 21 345 19 35 9    10 17 14 21 25 16 18 14 16 35 24 34 9 10 28 21 9 24 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR171d-5p UGUUGGCUCGACUCACUCAGA 21 73 5 24 1    3 3 2 1 3 2 6 3 1 24 8 10 2 1 3 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR172a-3p AGAAUCUUGAUGAUGCUGCGU 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR172a-5p GCGGCACCAUCAAGAUUCACA 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR172b-3p AGAAUCUUGAUGAUGCUGCAU 21 319 18 252 1    1 1 1 0 2 0 2 2 1 2 3 6 1 1 4 0 2 2 18 0 0 0 18 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 252 0 0 0
ata-miR172b-5p GCAGCACCACCAAGAUUCACA 21 14 2 6 1    0 0 0 1 1 0 0 1 0 0 1 1 0 1 1 6 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR172c-3p GGAAUCUUGAUGAUGCUGCAU 21 137 8 19 1    7 6 4 4 3 1 16 11 9 17 14 7 5 4 19 3 2 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR172c-5p GUGGCAUCAUCAAGAUUCACACA 23 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR2118a-3p GGGAAUGGGAACAUGGAGGAA 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR2118a-5p UUCCUAAUGUCUCCCAUUCCUA 22 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR2118b-3p GGGAAUGGGAACAUGGAGGAA 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR2118b-5p UUCCCGAUGCCUCCCAUUCCUA 22 1 1 1 1    0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR2118c-3p UUCCUGAUGCCUCCCAUGCCUA 22 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR2118d-3p UUCCUGAUGCCUCCCAUGCCUA 22 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR2275a-3p UUUGUUUUUCUCCAAUAUCUCA 22 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR2275a-5p UGAGUGUUCGAGGAAAGCAA 20 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR2275b-3p CUUGUUUUCCUCCAAUAUCUCA 22 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR2275b-5p AGAGUUGGAGGAAAACAAACA 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR2275c-3p UUUGGUUUCCUCCAAUAUCUCA 22 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR2275c-5p AGUGUUGGAUGGGACCAAAUC 21 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR319-3p ACUGGAUGACGCGGGAGCUAA 21 2,036 339 575 49    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 49 0 0 0 0 473 458 0 0 0 0 0 0 575 0 0 0 0 0 0 0 229 0 0 0 252 0 0 0
ata-miR319-5p AGCUGCCGAUUCAUUCAUUCA 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR390-3p CGCUAUCUAUCCUGAGCUCC 20 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR390-5p AAGCUCAGGAGGGAUAGCGCC 21 46 3 6 1    1 2 1 1 1 1 2 3 1 4 6 2 2 3 5 0 5 6 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR393-3p CAGUGCAAUCCCUUUGGAAUU 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR393-5p UUCCAAAGGGAUCGCAUUGAU 21 443 23 47 3    42 41 47 23 30 12 25 21 10 19 3 7 30 44 40 12 5 14 0 0 0 0 18 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR394-3p AGGUGGGCAUACUGCCAAUGG 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR394-5p UUGGCAUUCUGUCCACCUCC 20 56 3 6 1    1 1 1 2 6 3 3 5 2 5 4 3 2 1 6 3 5 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR395a-3p UGAAGUGUUUGGGGGAACUC 20 6 1 1 1    1 0 0 0 1 0 1 0 0 0 0 0 1 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR395a-5p GUUCCCUUCAAGCACUUCAGG 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR395b-3p AAGUGUUUGGGGGAACUC 18 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR395b-5p GUUCCCUGCAAACACUUCACG 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR395c-3p UGAAGUGUUUGGGGGAACUC 20 6 1 1 1    1 0 0 0 1 0 1 0 0 0 0 0 1 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR395c-5p GUUCUCCUCAAAUCACUUCA 20 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR395d-3p UGAAGUGUUUGGGGGAACUC 20 6 1 1 1    1 0 0 0 1 0 1 0 0 0 0 0 1 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR395d-5p AGUUCCCUUCAAGCACUUUACG 22 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR395e-3p UGAAGUGUUUGGGGGAACUC 20 6 1 1 1    1 0 0 0 1 0 1 0 0 0 0 0 1 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR395e-5p GUUCCUUACAAGCACUUCACG 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR395f-3p UGAAGUGUUUGGGGGAACUC 20 6 1 1 1    1 0 0 0 1 0 1 0 0 0 0 0 1 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR395f-5p GUUCCCUUCAAGCACUUCAGG 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR396a-3p GUUCAAGAAAGUCCUUGGAAA 21 5 1 1 1    0 0 1 1 0 0 0 0 1 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR396a-5p UCCACAGGCUUUCUUGAACUG 21 27,663 1,257 4,259 171    1,256 1,152 1,861 705 1,556 966 1,714 2,172 947 1,246 611 1,106 927 1,526 1,567 4,259 1,087 1,815 0 0 0 0 0 0 0 0 0 0 0 0 0 171 575 0 0 0 0 0 0 0 229 0 0 0 0 215 0 0
ata-miR396b-3p GUUCAAGAAAGUCCUUGGAA 20 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR396b-5p UCCACAGGCUUUCUUGAACUG 21 27,663 1,257 4,259 171    1,256 1,152 1,861 705 1,556 966 1,714 2,172 947 1,246 611 1,106 927 1,526 1,567 4,259 1,087 1,815 0 0 0 0 0 0 0 0 0 0 0 0 0 171 575 0 0 0 0 0 0 0 229 0 0 0 0 215 0 0
ata-miR396c-3p GGUCAAGAAAGCUGUGGGAAG 21 54 4 27 1    1 1 1 1 0 0 2 2 2 6 3 1 2 1 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 27 0 0 0 0 0 0 0 0 0
ata-miR396c-5p UUCCACAGCUUUCUUGAACUU 21 3,582 199 382 70    171 121 249 70 128 79 369 382 189 344 174 127 243 232 368 117 96 123 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR396d-3p GUUCAAGAAAGCCCAUGGAAA 21 10 1 1 1    0 0 0 1 1 0 0 1 1 1 0 1 1 1 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR396d-5p UCCACAGGCUUUCUUGAACUG 21 27,663 1,257 4,259 171    1,256 1,152 1,861 705 1,556 966 1,714 2,172 947 1,246 611 1,106 927 1,526 1,567 4,259 1,087 1,815 0 0 0 0 0 0 0 0 0 0 0 0 0 171 575 0 0 0 0 0 0 0 229 0 0 0 0 215 0 0
ata-miR396e-3p GUUCAAUAAAGCUGUGGGAAA 21 40 2 4 1    1 1 3 1 2 1 4 3 3 4 1 1 2 4 4 3 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR396e-5p UUCCACAGCUUUCUUGAACUG 21 2,259 126 243 57    122 133 151 102 187 119 90 143 70 110 57 110 109 173 193 243 59 88 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR398f-3p UGUGUUCUCAGGUCGCCCCCG 21 846 53 819 1    0 1 2 2 3 1 1 2 1 1 0 0 1 1 4 3 3 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 819 0 0 0 0 0 0
ata-miR398f-5p GGGUCGAACUGAGAACACAUG 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR398g-3p UGUGUUCUCAGGUCGCCCCCG 21 846 53 819 1    0 1 2 2 3 1 1 2 1 1 0 0 1 1 4 3 3 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 819 0 0 0 0 0 0
ata-miR398g-5p GGGUCGAGCUGGGAACACAUG 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR399a-3p UGCCAAAGGAGAAUUGCCCUG 21 69 4 21 1    1 1 1 1 2 0 4 10 2 3 4 1 2 1 1 21 4 10 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR399a-5p GGGCGCUUCUCCAUUGGCACGG 22 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR399b-3p UGCCAAAGGAGAAUUGCCCUG 21 69 4 21 1    1 1 1 1 2 0 4 10 2 3 4 1 2 1 1 21 4 10 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR399b-5p CAGGGCGCUUCUCCUUUGGCA 21 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR408-3p UGCACUGCCUCUUCCCUGCC 20 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR408-5p CAGGGAUGGAGCAGAGCAAGG 21 6 1 1 1    1 0 0 1 1 0 0 0 0 0 0 0 1 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR5062a-3p GUGGAUUUUUCACCAAGAUUCAAG 24 3 1 1 1    0 0 0 0 1 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR5062a-5p UGAACCUUAGGGAAAAGCCGCAU 23 474 59 229 8    27 9 21 0 0 0 0 0 0 0 0 0 8 29 14 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 137 0 0 0 0 0 229 0 0 0 0 0 0 0
ata-miR5062b-3p UGAACCUUAGGGAAAAGCCGCAU 23 474 59 229 8    27 9 21 0 0 0 0 0 0 0 0 0 8 29 14 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 137 0 0 0 0 0 229 0 0 0 0 0 0 0
ata-miR5062b-5p GCGGAUUUUUCACCAAGAUUCAAG 24 17 1 3 1    1 2 3 0 1 0 1 1 1 1 1 1 1 1 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR5070-3p UUGAACUAAGUAGGGUCGGAG 21 18 18 18 18    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 18 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR5070-5p UCUGACCCUUCUUAGUUCAAC 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR5084-3p ACCAUACGGUACUGCAGAGGAUC 23 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR5084-5p AUCCUCUACAGUACUGUACGGUGC 24 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR5168-3p UCGGACCAGGCUUCAAUCCCU 21 17,213 717 2,312 18    502 461 912 748 758 398 859 881 387 2,312 601 578 783 1,277 1,853 519 332 818 36 0 0 57 18 0 0 0 0 0 0 0 235 0 0 0 0 0 0 0 0 1,430 458 0 0 0 0 0 0 0
ata-miR5168-5p GGGUUGUUGUCUGGUUCAAGG 21 37 2 7 1    1 2 1 3 1 1 2 0 1 7 2 1 2 3 7 0 2 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR5181-3p CACUUAUUUUGGACCGGAGGG 21 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR5181-5p UCCGAUCCAGAAUAAGUGUCG 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR5200-3p UGUAGAUACUCCCUAAGGCUU 21 111 16 71 1    0 0 1 0 0 0 0 0 0 0 0 0 1 1 1 0 0 1 71 0 0 0 35 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR5200-5p AAGCCUUAGUGAAUAUCUACA 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR528-3p CCUGUGCCUGCCUCUUCCAUU 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR528-5p UGGAAGGGGCAUGCAGAGGAG 21 2,647 378 1,430 1    0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 35 16 473 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1,430 0 0 0 0 252 0 0 440
ata-miR6201-3p GUACGAGUGUCUCAGGGCCAA 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR6201-5p UGACCCUGAGGCACUCAUACCG 22 28 3 6 1    1 0 2 0 0 0 2 3 1 6 5 5 1 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR9672-3p UACCACGACUGUCAUUAAGCA 21 14,942 712 6,329 1    263 126 331 0 1 1 0 1 1 0 0 0 117 173 206 0 1 0 0 0 0 0 18 0 0 0 0 0 0 0 1,408 1,197 6,329 0 137 0 0 0 0 0 0 2,458 0 0 252 430 1,272 220
ata-miR9672-5p CUUAAUGACAGUCGUGGUGUC 21 36 4 7 1    6 5 7 1 1 0 0 0 1 0 0 0 2 5 6 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR9674a-3p GUAAGAUGGCUGAUGCUAUGG 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR9674a-5p AUAGCAUCAUCCAUCCUACCC 21 19,097 955 4,435 218    336 266 273 378 488 218 1,314 1,823 694 4,435 1,588 2,032 265 409 725 1,100 484 1,087 0 0 0 0 0 0 947 0 0 0 0 0 235 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR9674b-3p UGAAUUUGUCCAUAGCAUCAG 21 1,852 103 220 41    42 71 48 56 85 41 125 160 103 220 128 176 66 74 129 153 72 103 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR9674b-5p GGUGCUAUGGAUAGCUUCAAC 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR9674c-3p GGUGCUAUGGAUAAAUUCAAC 21 169 9 33 1    3 1 3 13 9 4 17 21 8 33 7 5 7 8 5 9 7 9 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR9674c-5p UGAAUUUUUCCAUAGCAUCAG 21 21 2 3 1    2 1 2 1 1 1 2 3 0 2 1 1 1 1 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR9677-3p UGGCCGUUGGUAGAGUAGGAGA 22 28,103 1,653 5,089 15    18 17 30 0 0 0 0 0 0 0 0 0 15 19 24 0 0 0 0 0 0 0 0 0 473 3,206 4,558 0 0 0 0 1,710 1,151 0 0 0 2,058 0 0 0 2,289 2,458 0 0 1,764 3,224 5,089 0
ata-miR9677-5p UUCCACUCUACCAACAGCCACG 22 5 1 1 1    1 1 1 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR9772a-3p AGGGGGCAAUCUCACCUCAAC 21 14 1 2 1    0 1 1 1 0 0 0 1 1 2 1 1 1 0 2 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR9772a-5p UGAGAUGAGAUUACCCCAUAC 21 644 34 87 12    12 15 16 18 32 15 27 42 25 42 21 38 18 35 77 87 42 66 0 0 0 0 0 16 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR9772b-3p AGGGGGCAAUCUCACCUCAAC 21 14 1 2 1    0 1 1 1 0 0 0 1 1 2 1 1 1 0 2 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR9772b-5p UGAGAUGAGAUUACCCCAUAC 21 644 34 87 12    12 15 16 18 32 15 27 42 25 42 21 38 18 35 77 87 42 66 0 0 0 0 0 16 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR9776-3p GCACAUCCAUGUCCAAGCUCU 21 41 6 21 1    1 2 7 0 0 0 0 0 0 0 1 0 3 6 21 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR9776-5p AGCUUGGACGAGGAUGUGCAA 21 277 23 137 1    23 5 20 0 1 0 0 0 1 2 1 1 5 64 17 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 137 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR9783-3p AUAAGCACCGGUGCUUAAGGA 21 1 1 1 1    0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR9783-5p UUUGAAGCACUGACGCCUAUUUCU 24 0 nan 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR9863a-3p UGAGAAGGUAGAUCAUAAUAGC 22 69,997 1,707 7,279 1    4,528 5,963 7,279 4 5 1 276 507 273 571 211 372 3,745 5,330 5,464 3 2 3 285 1,121 0 685 35 78 947 2,290 0 0 455 423 5,633 3,762 5,178 128 5,076 0 1,764 0 54 0 916 819 0 837 1,512 1,505 636 1,321
ata-miR9863a-5p UGUUAUGAUCUGCUUCUCAUC 21 377 21 51 1    23 19 27 20 25 6 13 21 7 3 1 3 18 39 42 36 23 51 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ata-miR9863b-3p UGAGAAGGUAGAUCAUAAUAGC 22 69,997 1,707 7,279 1    4,528 5,963 7,279 4 5 1 276 507 273 571 211 372 3,745 5,330 5,464 3 2 3 285 1,121 0 685 35 78 947 2,290 0 0 455 423 5,633 3,762 5,178 128 5,076 0 1,764 0 54 0 916 819 0 837 1,512 1,505 636 1,321
ata-miR9863b-5p UGUUAUGAUCUGCUUCUCAUC 21 377 21 51 1    23 19 27 20 25 6 13 21 7 3 1 3 18 39 42 36 23 51 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0