Strawberry Small RNA miRNA Abundances

The data below are based on the microRNAs listed in the miRBase registry. Adjust libraries/reads to display on the control panel.

        

        miRNA         miRNA sequence Len Sum (norm) Average Max Min (>0)  SY_FLSY_YSSY_YLSY_RESY_UNSY_CW_4SY_WG_4SY_CW_10SY_WG_10StrAnt6_rep1StrAnt7_rep1StrAnt8_rep1StrAnt9_rep1
fve-miR11283 AGGCUUUGUAGAGGAUGGAAU 21 5,207 401 1,934 3    981 149 1,934 64 1,331 33 26 72 3 21 155 215 223
fve-miR11284 UUCGUGAUCUGCGAAAGGCUC 21 21,315 1,640 3,006 196    2,466 280 2,383 357 3,006 944 196 2,039 792 2,113 2,063 2,408 2,268
fve-miR11285 UCUAUUCAAAGAGAUGACUGUU 22 139,442 10,726 29,463 116    8,997 3,829 27,270 1,036 16,815 1,582 116 5,255 1,095 29,463 17,501 13,530 12,953
fve-miR11286 UUGGAGAGAGAGUAGACAAUG 21 133,375 10,260 44,110 431    12,443 431 8,050 44,110 14,333 7,562 9,230 19,535 4,535 4,088 3,973 2,650 2,435
fve-miR11287 UCAGGGAUUGUUUCAUAGACC 21 77,217 5,940 11,181 2,009    5,710 2,009 8,906 8,069 8,808 2,965 6,913 11,181 8,488 4,940 3,436 2,286 3,506
fve-miR11288a UGGGAUUUGGCGAAUUGUGGU 21 12,879 991 2,893 127    609 399 924 2,409 736 664 2,893 2,022 1,389 243 303 161 127
fve-miR11288b UGGGAUUGGGCGAAUUUUGGU 21 4,692 361 1,008 43    181 74 300 644 216 336 1,008 981 679 43 100 69 61
fve-miR11288c-3p UGAAUUGGGAUUUGUCGAAUU 21 18,660 1,435 6,807 79    792 516 1,422 6,807 1,116 79 204 741 2,749 1,832 1,327 496 579
fve-miR11288c-5p UUCGUUCGGAUUCCAAUUCAAA 22 74,989 5,768 30,174 237    3,557 2,702 6,022 30,174 4,623 237 1,087 3,279 12,217 6,054 3,170 800 1,067
fve-miR11288d UCCAUCGUUUUGAGACACAGG 21 22,999 1,769 16,996 49    741 384 549 807 1,005 49 593 1,178 16,996 234 167 112 184
fve-miR11288e UGAAGUGGGAUUUGGCGAAUU 21 64,093 4,930 11,027 635    4,792 4,144 9,495 11,027 5,287 635 5,133 4,577 7,668 4,987 3,549 1,264 1,535
fve-miR11289 UGCUUCAAGUCUGGCCAAUACU 22 27,485 2,114 17,595 3    325 9 3 95 198 58 8,023 302 17,595 40 50 234 553
fve-miR11290 UCGUCGACAUCAAAGGGCACC 21 12,296 946 4,233 98    1,537 427 506 608 1,119 440 4,233 1,278 1,559 98 188 146 157
fve-miR11291 UUGCGGUCUUGUCUCUUCCAAU 22 4,980 383 820 35    321 719 687 820 298 36 656 35 799 185 129 150 145
fve-miR11292 UUGUAGUUCAGCGCCUCCGCC 21 3,729 287 1,415 9    161 9 20 600 116 53 866 326 1,415 34 29 35 65
fve-miR11293 UUCUUCCUCAGGAACCUCCACC 22 3,244 250 1,128 7    213 352 281 404 110 28 545 137 1,128 19 12 7 8
fve-miR11294 UUCACCUGGACCAUAACUGACC 22 2,930 225 704 35    469 112 216 51 531 35 704 149 484 40 54 42 43
fve-miR11295 CUCAUUCAAUUUCGGUAUUCAG 22 2,639 203 669 61    288 61 144 135 297 105 108 669 222 247 137 110 116
fve-miR11296 UUUUUGAUGGCUGGAAUCCAGU 22 1,964 151 562 25    122 90 235 25 212 45 37 239 562 70 55 115 157
fve-miR11297 CAGACAAGAUCGAUCUCGCCU 21 1,205 93 447 1    447 1 399 29 128 0 11 14 11 69 66 12 18
fve-miR11298 UUGAGGGGCUUAACGAUUACC 21 1,480 114 701 3    47 19 24 51 56 48 349 158 701 3 8 5 11
fve-miR11299 CAAAUAGGGUUGGCUGAUACU 21 3,399 261 858 5    170 0 203 235 327 5 9 17 8 858 735 414 418
fve-miR11300 CAACAUCACUGUUCUCUUCCU 21 711 55 85 19    79 19 85 79 83 0 48 53 73 54 52 46 40
fve-miR11301 UCAGAGUUGUAAUAUAUUGAU 21 660 51 149 3    60 5 99 11 127 53 14 149 3 43 21 32 43
fve-miR11302 AGGACCGCCAUCACGUUUUGG 21 571 44 93 1    68 26 91 1 57 12 79 93 46 9 50 19 20
fve-miR11303 UCAAACAUCACUGCAGCUGUA 21 993 76 251 8    66 45 71 37 127 8 54 51 251 36 49 88 110
fve-miR11304 UAGUGUUUCAGCUUGACAAG 20 1,965 151 319 37    258 37 209 73 319 148 37 228 77 116 97 162 204
fve-miR11305 UUUUGGUCCGAAUCCGAGCUCC 22 338 26 84 1    23 1 2 21 20 35 57 78 84 1 3 5 8
fve-miR11306 CUACCGAAGAACUUUGCAAAAG 22 355 27 126 10    10 23 13 12 22 35 26 126 33 11 17 16 11
fve-miR11307 UAAGCGACGGACUCCAAUCGC 21 212 16 184 1    0 1 1 0 2 0 0 23 184 0 0 1 0
fve-miR11308 UAAGUUAGGAUUCUAGUUACC 21 2,892 222 930 1    24 2 58 1 71 7 0 30 3 234 930 698 834
fve-miR11309 UUUGUUUGGCAUGCAGUUGGC 21 232 18 74 3    11 5 9 4 12 5 74 51 39 4 6 3 9
fve-miR11310 AGGGAUCACAACUCCAGUGCU 21 190 15 36 1    36 9 31 3 26 0 17 8 32 5 1 10 12
fve-miR11311 UGAGAAUGAUGUGGAUCUCAGC 22 136 10 121 1    3 2 1 6 0 0 0 3 121 0 0 0 0
fve-miR11312 UGGAGCUGUUGGGGAGAGUUA 21 160 12 112 1    17 112 1 2 1 0 11 5 8 0 1 2 0
fve-miR11313 GAAAAGAAUGGACUCUCCGGGG 22 169 13 74 1    9 1 4 17 6 5 26 74 9 6 7 2 3
fve-miR11314 AGAGUUGUGGAUGCUAUGAAU 21 53 4 30 23    23 0 0 0 30 0 0 0 0 0 0 0 0
fve-miR11315 CUAGUCAUUGGUCAUAGCAUC 21 39,042 3,003 11,500 479    1,764 2,008 1,954 4,610 749 2,352 4,829 5,667 11,500 1,414 954 479 762
fve-miR1511 ACCUAGCUCUGAUACCAUGUG 21 628,146 48,319 77,512 19,914    71,220 32,157 77,512 67,963 67,137 21,600 53,044 66,256 76,274 28,290 25,449 19,914 21,330
fve-miR156a UUGACAGAAGAGAGUGAGCAC 21 152,572 11,736 50,162 18    18,782 448 18 1,238 19,975 1,998 11,873 50,162 44,590 703 1,528 412 845
fve-miR156b UUGACAGAAGAGAGUGAGCAC 21 152,572 11,736 50,162 18    18,782 448 18 1,238 19,975 1,998 11,873 50,162 44,590 703 1,528 412 845
fve-miR156c UUGACAGAAGAGAGUGAGCAC 21 152,572 11,736 50,162 18    18,782 448 18 1,238 19,975 1,998 11,873 50,162 44,590 703 1,528 412 845
fve-miR156d UGACAGAAGAGAGUGAGCAC 20 123,672 9,513 110,897 78    715 110,897 723 78 554 127 494 2,007 7,238 310 314 111 104
fve-miR156e UUGACAGAAGAGAGUGAGCAC 21 152,572 11,736 50,162 18    18,782 448 18 1,238 19,975 1,998 11,873 50,162 44,590 703 1,528 412 845
fve-miR156f UUGACAGAAGAUAGAGAGCAC 21 59,252 4,558 41,225 41    1,194 41,225 8,666 105 898 326 531 2,674 3,245 41 111 104 132
fve-miR156g-3p GCUCUCUAUGCUUCUGUCAUC 21 8,592 661 6,597 3    222 6,597 1,292 7 159 20 77 117 69 3 12 6 11
fve-miR156g-5p UUGACAGAAGAUAGAGAGCAC 21 59,252 4,558 41,225 41    1,194 41,225 8,666 105 898 326 531 2,674 3,245 41 111 104 132
fve-miR156h UGACAGAAGAGAGUGAGCUC 20 69,551 5,350 15,822 1,194    12,175 3,807 11,708 1,194 8,016 2,494 2,595 15,822 4,432 2,086 2,413 1,232 1,577
fve-miR156i UGACAGAAGAUAGAGAGCAC 20 16,588 1,276 6,380 17    331 2,606 399 17 2,025 40 43 201 138 165 662 3,581 6,380
fve-miR156j UUGACGGAAGAGAGCGAGCAC 21 2,472 190 1,307 2    52 48 0 2 132 0 3 86 1,307 260 179 166 237
fve-miR159a-3p UUUGGAUUGAAGGGAGCUCUA 21 706,578 54,352 180,133 5,164    65,742 72,657 123,259 180,133 76,679 5,164 28,397 8,554 36,604 33,067 24,747 26,508 25,067
fve-miR159a-5p GAGCUCCUUGAAGUCCAAUAG 21 2,524 194 490 7    490 241 367 179 426 7 230 143 183 47 71 62 78
fve-miR159b AUUGGAUUGAAGGGAGCUCUC 21 64,068 4,928 16,910 897    3,679 6,890 16,910 8,159 5,000 897 1,340 1,792 9,114 3,947 2,571 1,831 1,938
fve-miR159c AUUGGAUUGAAGGGAGCUCCC 21 237,018 18,232 88,909 13    1,597 13 752 214 4,701 124 145 195 645 88,909 82,443 30,061 27,219
fve-miR160a UGCCUGGCUCCCUGUAUGCCA 21 3,696 284 581 8    506 259 581 412 406 8 85 36 163 376 353 278 233
fve-miR160b UGCCUGGCUCCCUGUAUGCCA 21 3,696 284 581 8    506 259 581 412 406 8 85 36 163 376 353 278 233
fve-miR162-3p UCGAUAAACCUCUGCAUCCAG 21 59,875 4,606 13,654 193    2,298 193 3,839 6,015 2,938 4,696 3,197 13,654 2,195 5,255 9,126 3,957 2,512
fve-miR162-5p GGAGGCAGCGGUUCAUCGAUC 21 174 13 75 2    13 0 36 75 13 3 6 2 9 3 8 0 6
fve-miR164a-3p CACGUGCUCCCCUUCUCCAAC 21 636 49 114 5    49 26 37 114 46 0 40 5 49 107 85 41 37
fve-miR164a-5p UGGAGAAGCAGGGCACGUGCA 21 6,929 533 2,128 49    524 49 147 2,128 436 534 1,422 784 556 55 90 118 86
fve-miR164b UGGAGAAGCAGGGCACGUGCA 21 6,929 533 2,128 49    524 49 147 2,128 436 534 1,422 784 556 55 90 118 86
fve-miR164c UGGAGAAGCAGGGCACAUGCU 21 498 38 343 1    7 1 1 0 4 112 14 343 15 0 0 0 1
fve-miR166a UCGGACCAGGCUUCAUUCCCC 21 7,688,916 591,455 1,237,629 89,370    1,076,693 319,667 755,911 721,044 766,181 89,370 1,237,629 353,297 902,816 704,904 395,504 144,210 221,690
fve-miR166b UCGGACCAGGCUUCAUUCCCC 21 7,688,916 591,455 1,237,629 89,370    1,076,693 319,667 755,911 721,044 766,181 89,370 1,237,629 353,297 902,816 704,904 395,504 144,210 221,690
fve-miR166c UCGGACCAGGCUUCAUUCCCC 21 7,688,916 591,455 1,237,629 89,370    1,076,693 319,667 755,911 721,044 766,181 89,370 1,237,629 353,297 902,816 704,904 395,504 144,210 221,690
fve-miR166d-3p UCGGACCAGGCUUCAUUCCCC 21 7,688,916 591,455 1,237,629 89,370    1,076,693 319,667 755,911 721,044 766,181 89,370 1,237,629 353,297 902,816 704,904 395,504 144,210 221,690
fve-miR166d-5p GGGAAUGUCGUCUGGUUCGA 20 355 27 123 1    123 6 22 3 60 25 43 59 6 0 4 3 1
fve-miR166e UCGGACCAGGCUUCAUUCCCC 21 7,688,916 591,455 1,237,629 89,370    1,076,693 319,667 755,911 721,044 766,181 89,370 1,237,629 353,297 902,816 704,904 395,504 144,210 221,690
fve-miR166f UCGGACCAGGCUUCAUUCCCC 21 7,688,916 591,455 1,237,629 89,370    1,076,693 319,667 755,911 721,044 766,181 89,370 1,237,629 353,297 902,816 704,904 395,504 144,210 221,690
fve-miR167a UGAAGCUGCCAGCAUGAUCU 20 10,926 840 4,732 34    437 188 235 34 288 73 4,599 152 4,732 50 37 40 61
fve-miR167b UGAAGCUGCCAGCAUGAUCU 20 10,926 840 4,732 34    437 188 235 34 288 73 4,599 152 4,732 50 37 40 61
fve-miR167c UGAAGCUGCCAGCAUGAUCU 20 10,926 840 4,732 34    437 188 235 34 288 73 4,599 152 4,732 50 37 40 61
fve-miR167d UGAAGCUGCCAGCAUGAUCUCA 22 72,814 5,601 38,327 44    2,618 799 703 120 2,555 305 26,487 323 38,327 44 72 167 294
fve-miR168-3p CCCGCCUUGCAUCAACUGAAU 21 24,416 1,878 8,240 62    2,582 968 1,625 648 1,469 458 5,358 8,240 2,711 62 93 73 129
fve-miR168-5p UCGCUUGGUGCAGGUCGGGAA 21 28,768 2,213 7,134 370    2,873 912 1,733 1,999 2,310 775 6,346 7,134 2,798 567 514 370 437
fve-miR169a UAGCCAAGGAUGACUUGCCU 20 570 44 261 5    261 32 16 64 110 0 28 6 8 5 5 20 15
fve-miR169b UAGCCAAGGAUGACUUGCCU 20 570 44 261 5    261 32 16 64 110 0 28 6 8 5 5 20 15
fve-miR169c UAGCCAAGGAUGACUUGCCU 20 570 44 261 5    261 32 16 64 110 0 28 6 8 5 5 20 15
fve-miR169d UAGCCAAGGAUGACUUGCCU 20 570 44 261 5    261 32 16 64 110 0 28 6 8 5 5 20 15
fve-miR169e UGAGCCAAGGAUGACUUGCCU 21 70 5 32 1    32 5 3 16 7 0 0 0 1 3 2 0 1
fve-miR169f UGAGCCAAGAAUGACUUGCUG 21 41 3 14 1    14 6 1 2 6 0 0 0 0 2 3 5 2
fve-miR171a UGAUUGAGCCGUGCCAAUAUC 21 2,444 188 491 32    339 93 257 32 491 208 102 134 179 107 123 203 176
fve-miR171b CGAGCCGAACCAAUAUCACUC 21 892 69 387 2    124 178 7 13 55 2 23 84 387 5 7 2 5
fve-miR171c-3p UGAUUGAGCCGUGCCAAUAUC 21 2,444 188 491 32    339 93 257 32 491 208 102 134 179 107 123 203 176
fve-miR171c-5p AGAUAUUGGUGCGGUUCAAUC 21 339 26 77 1    29 5 76 4 49 28 40 77 20 1 1 2 7
fve-miR171d UGAUUGAGCCGUGCCAAUAUC 21 2,444 188 491 32    339 93 257 32 491 208 102 134 179 107 123 203 176
fve-miR171e UGAUUGAGCCGUGCCAAUAUC 21 2,444 188 491 32    339 93 257 32 491 208 102 134 179 107 123 203 176
fve-miR171f-3p UUGAGCCGCGCCAAUAUCACU 21 351 27 110 1    16 110 82 71 20 0 9 0 25 10 4 1 3
fve-miR171f-5p CGAUGUUGGUGAGGUUCAAUC 21 26 2 10 1    0 10 6 2 1 2 0 3 0 0 1 0 1
fve-miR171g UGAUUGAGCCGUGCCAAUAUC 21 2,444 188 491 32    339 93 257 32 491 208 102 134 179 107 123 203 176
fve-miR171h UUGAGCCGCGUCAAUAUCUCC 21 1,695 130 700 8    53 211 171 34 65 8 20 105 700 92 58 77 101
fve-miR172a AGAAUCUUGAUGAUGCUGCAU 21 141 11 59 1    22 0 59 14 26 0 0 3 3 1 2 5 6
fve-miR172b AGAAUCUUGAUGAUGCUGCAU 21 141 11 59 1    22 0 59 14 26 0 0 3 3 1 2 5 6
fve-miR172c AGAAUCUUGAUGAUGCUGCAU 21 141 11 59 1    22 0 59 14 26 0 0 3 3 1 2 5 6
fve-miR2109 UGCGAGUGUCUUCACCUCUGAA 22 5,722 440 930 58    609 122 473 930 572 58 170 120 131 358 728 778 673
fve-miR2111a UAAUCUGCAUCCUGAGGUUU 20 1,204 93 296 1    128 87 296 169 172 5 57 18 267 0 0 1 4
fve-miR2111b-3p GCCCUUGGGAUGCGGAUUACC 21 1,277 98 287 10    139 88 145 22 90 10 287 126 47 13 68 116 126
fve-miR2111b-5p UAAUCUGCAUCCUGAGGUUU 20 1,204 93 296 1    128 87 296 169 172 5 57 18 267 0 0 1 4
fve-miR2111c UAAUCUGCAUCCUGAGGUUU 20 1,204 93 296 1    128 87 296 169 172 5 57 18 267 0 0 1 4
fve-miR319 UUUGGACUGAAGGGAGCUCCU 21 1,322 102 617 1    58 2 0 4 38 45 542 15 617 0 1 0 0
fve-miR3627a UCGCAGGAGAGAUGGCACUACC 22 5,693 438 1,961 20    508 20 1,961 32 217 23 145 41 52 1,189 1,152 178 175
fve-miR3627b UCGCAGGAGAGAUGGCACUACC 22 5,693 438 1,961 20    508 20 1,961 32 217 23 145 41 52 1,189 1,152 178 175
fve-miR390a AAGCUCAGGAGGGAUAGCGCC 21 4,717 363 2,061 10    1,013 98 199 10 2,061 10 170 14 178 190 263 212 299
fve-miR390b AAGCUCAGGAGGGAUAGCGCC 21 4,717 363 2,061 10    1,013 98 199 10 2,061 10 170 14 178 190 263 212 299
fve-miR393a UCCAAAGGGAUCGCAUUGAUC 21 685 53 200 9    26 9 41 21 21 82 74 200 71 56 29 18 37
fve-miR393b UCCAAAGGGAUCGCAUUGAUCU 22 3,046 234 728 13    536 274 244 19 728 13 45 126 105 103 55 226 572
fve-miR394 UUGGCAUUCUGUCCACCUCC 20 3,924 302 623 72    623 72 466 180 560 181 588 152 334 137 140 243 248
fve-miR396a-3p GUUCAAUAAAGCUGUGGGAAG 21 2,673 206 732 13    197 101 266 732 418 134 125 312 91 13 41 99 144
fve-miR396a-5p UUCCACAGCUUUCUUGAACUG 21 109,044 8,388 26,371 975    7,809 1,495 1,460 4,326 7,913 1,530 1,002 14,302 975 4,916 11,144 25,801 26,371
fve-miR396b-3p GCUCAAGAAAGCUGUGGGACA 21 1,748 134 472 1    42 22 430 28 145 0 3 8 1 20 172 472 405
fve-miR396b-5p UUCCACAGCUUUCUUGAACUU 21 69,664 5,359 12,550 954    9,506 1,177 10,948 5,660 12,550 954 1,877 8,153 1,939 2,705 4,009 4,545 5,641
fve-miR396c-3p GUUCAAUAAAGCUGUGGGAAG 21 2,673 206 732 13    197 101 266 732 418 134 125 312 91 13 41 99 144
fve-miR396c-5p UUCCACAGCUUUCUUGAACUG 21 109,044 8,388 26,371 975    7,809 1,495 1,460 4,326 7,913 1,530 1,002 14,302 975 4,916 11,144 25,801 26,371
fve-miR396d UUCCACAGCUUUCUUGAACUG 21 109,044 8,388 26,371 975    7,809 1,495 1,460 4,326 7,913 1,530 1,002 14,302 975 4,916 11,144 25,801 26,371
fve-miR396e UUCCACAGGCUUUCUUGAACU 21 14,463 1,113 6,711 3    8 3 0 12 89 0 9 77 1,519 883 1,728 3,424 6,711
fve-miR397 UCAUUGAGUGCAGCGUUGAUG 21 754 58 338 3    10 3 3 11 4 99 26 338 107 14 12 46 81
fve-miR399a UGCCAAAGGAGAGUUGCCCUG 21 1,095 84 172 10    137 37 91 30 76 10 48 72 42 93 129 172 158
fve-miR399b AGCCAAAGGAGAAUUGCCCUG 21 231 18 83 1    2 3 83 1 4 0 0 6 4 19 35 49 25
fve-miR408 UGCACUGCCUCUUCCCUGGCU 21 72,120 5,548 27,899 302    1,518 302 438 9,946 401 8,499 9,014 27,899 9,798 1,459 789 827 1,230
fve-miR477a ACUCUCCCUCAAGGGCUUCUC 21 467 36 172 2    172 159 10 17 28 0 3 2 4 6 11 30 25
fve-miR477b CGCGCACCCGUUCAUCUUCGC 21 263 20 51 1    3 10 1 3 4 0 37 11 26 35 43 39 51
fve-miR482a UCUUUCCAAUUCCUCCCAUGCC 22 70,720 5,440 22,444 248    2,510 2,231 3,350 6,690 1,489 3,979 22,444 9,663 16,115 999 701 301 248
fve-miR482b UCUUUCCUAGUCCUGCCAUUCC 22 29,519 2,271 7,158 249    1,478 707 2,445 6,044 1,255 546 7,158 1,517 6,811 548 457 304 249
fve-miR482c UCUUUCCUAUUCCUCCCAUCCC 22 23,235 1,787 7,234 209    1,626 2,518 3,205 2,348 1,544 429 7,234 622 2,473 438 337 252 209
fve-miR482d UUCCCUAUUCCACCUAUUCCCC 22 2,714 209 577 10    110 110 125 507 86 188 554 577 388 30 12 10 17
fve-miR5225 CUGUCGUAGGAGAGAUGGCGCC 22 4,459 343 1,605 4    1,012 4 1,605 218 735 46 77 320 12 68 199 64 99
fve-miR530 UGCAUUUGCACCUGCACCUCU 21 95 7 39 1    14 7 4 39 8 0 3 0 2 1 10 5 2
fve-miR535a UGACGAUGAGAGAGAGCACGC 21 10,878 837 2,105 50    809 205 1,199 1,439 798 1,144 1,235 1,686 2,105 79 68 50 61
fve-miR535b UGACGAUGAGAGAGAGCACGC 21 10,878 837 2,105 50    809 205 1,199 1,439 798 1,144 1,235 1,686 2,105 79 68 50 61
fve-miR827 UUAGAUGACCAUCAACAAACA 21 285 22 122 1    51 7 122 20 51 0 14 0 11 1 1 4 3
fve-miR845 AACCGGCUCUGAUACCAAUUG 21 4,855 373 877 77    822 119 300 458 754 77 332 427 877 129 203 176 181