Strawberry PARE miRNA Abundances

The data below are based on the microRNAs listed in the miRBase registry. Adjust libraries/reads to display on the control panel.

        

        miRNA         miRNA sequence Len Sum (norm) Average Max Min (>0)  SY_ARSY_OF_FBSY_LS
fve-miR11283 AGGCUUUGUAGAGGAUGGAAU 21 0 0 0 0    0 0 0
fve-miR11284 UUCGUGAUCUGCGAAAGGCUC 21 0 0 0 0    0 0 0
fve-miR11285 UCUAUUCAAAGAGAUGACUGUU 22 0 0 0 0    0 0 0
fve-miR11286 UUGGAGAGAGAGUAGACAAUG 21 0 0 0 0    0 0 0
fve-miR11287 UCAGGGAUUGUUUCAUAGACC 21 0 0 0 0    0 0 0
fve-miR11288a UGGGAUUUGGCGAAUUGUGGU 21 0 0 0 0    0 0 0
fve-miR11288b UGGGAUUGGGCGAAUUUUGGU 21 0 0 0 0    0 0 0
fve-miR11288c-3p UGAAUUGGGAUUUGUCGAAUU 21 0 0 0 0    0 0 0
fve-miR11288c-5p UUCGUUCGGAUUCCAAUUCAAA 22 0 0 0 0    0 0 0
fve-miR11288d UCCAUCGUUUUGAGACACAGG 21 0 0 0 0    0 0 0
fve-miR11288e UGAAGUGGGAUUUGGCGAAUU 21 0 0 0 0    0 0 0
fve-miR11289 UGCUUCAAGUCUGGCCAAUACU 22 0 0 0 0    0 0 0
fve-miR11290 UCGUCGACAUCAAAGGGCACC 21 0 0 0 0    0 0 0
fve-miR11291 UUGCGGUCUUGUCUCUUCCAAU 22 0 0 0 0    0 0 0
fve-miR11292 UUGUAGUUCAGCGCCUCCGCC 21 0 0 0 0    0 0 0
fve-miR11293 UUCUUCCUCAGGAACCUCCACC 22 0 0 0 0    0 0 0
fve-miR11294 UUCACCUGGACCAUAACUGACC 22 0 0 0 0    0 0 0
fve-miR11295 CUCAUUCAAUUUCGGUAUUCAG 22 0 0 0 0    0 0 0
fve-miR11296 UUUUUGAUGGCUGGAAUCCAGU 22 0 0 0 0    0 0 0
fve-miR11297 CAGACAAGAUCGAUCUCGCCU 21 0 0 0 0    0 0 0
fve-miR11298 UUGAGGGGCUUAACGAUUACC 21 0 0 0 0    0 0 0
fve-miR11299 CAAAUAGGGUUGGCUGAUACU 21 0 0 0 0    0 0 0
fve-miR11300 CAACAUCACUGUUCUCUUCCU 21 0 0 0 0    0 0 0
fve-miR11301 UCAGAGUUGUAAUAUAUUGAU 21 0 0 0 0    0 0 0
fve-miR11302 AGGACCGCCAUCACGUUUUGG 21 0 0 0 0    0 0 0
fve-miR11303 UCAAACAUCACUGCAGCUGUA 21 0 0 0 0    0 0 0
fve-miR11304 UAGUGUUUCAGCUUGACAAG 20 0 0 0 0    0 0 0
fve-miR11305 UUUUGGUCCGAAUCCGAGCUCC 22 0 0 0 0    0 0 0
fve-miR11306 CUACCGAAGAACUUUGCAAAAG 22 0 0 0 0    0 0 0
fve-miR11307 UAAGCGACGGACUCCAAUCGC 21 0 0 0 0    0 0 0
fve-miR11308 UAAGUUAGGAUUCUAGUUACC 21 0 0 0 0    0 0 0
fve-miR11309 UUUGUUUGGCAUGCAGUUGGC 21 0 0 0 0    0 0 0
fve-miR11310 AGGGAUCACAACUCCAGUGCU 21 0 0 0 0    0 0 0
fve-miR11311 UGAGAAUGAUGUGGAUCUCAGC 22 0 0 0 0    0 0 0
fve-miR11312 UGGAGCUGUUGGGGAGAGUUA 21 0 0 0 0    0 0 0
fve-miR11313 GAAAAGAAUGGACUCUCCGGGG 22 0 0 0 0    0 0 0
fve-miR11314 AGAGUUGUGGAUGCUAUGAAU 21 0 0 0 0    0 0 0
fve-miR11315 CUAGUCAUUGGUCAUAGCAUC 21 0 0 0 0    0 0 0
fve-miR1511 ACCUAGCUCUGAUACCAUGUG 21 0 0 0 0    0 0 0
fve-miR156a UUGACAGAAGAGAGUGAGCAC 21 0 0 0 0    0 0 0
fve-miR156b UUGACAGAAGAGAGUGAGCAC 21 0 0 0 0    0 0 0
fve-miR156c UUGACAGAAGAGAGUGAGCAC 21 0 0 0 0    0 0 0
fve-miR156d UGACAGAAGAGAGUGAGCAC 20 1,835 612 1,367 93    375 93 1,367
fve-miR156e UUGACAGAAGAGAGUGAGCAC 21 0 0 0 0    0 0 0
fve-miR156f UUGACAGAAGAUAGAGAGCAC 21 0 0 0 0    0 0 0
fve-miR156g-3p GCUCUCUAUGCUUCUGUCAUC 21 0 0 0 0    0 0 0
fve-miR156g-5p UUGACAGAAGAUAGAGAGCAC 21 0 0 0 0    0 0 0
fve-miR156h UGACAGAAGAGAGUGAGCUC 20 226 75 96 55    55 96 75
fve-miR156i UGACAGAAGAUAGAGAGCAC 20 639 213 419 3    3 419 217
fve-miR156j UUGACGGAAGAGAGCGAGCAC 21 0 0 0 0    0 0 0
fve-miR159a-3p UUUGGAUUGAAGGGAGCUCUA 21 0 0 0 0    0 0 0
fve-miR159a-5p GAGCUCCUUGAAGUCCAAUAG 21 0 0 0 0    0 0 0
fve-miR159b AUUGGAUUGAAGGGAGCUCUC 21 0 0 0 0    0 0 0
fve-miR159c AUUGGAUUGAAGGGAGCUCCC 21 0 0 0 0    0 0 0
fve-miR160a UGCCUGGCUCCCUGUAUGCCA 21 0 0 0 0    0 0 0
fve-miR160b UGCCUGGCUCCCUGUAUGCCA 21 0 0 0 0    0 0 0
fve-miR162-3p UCGAUAAACCUCUGCAUCCAG 21 0 0 0 0    0 0 0
fve-miR162-5p GGAGGCAGCGGUUCAUCGAUC 21 0 0 0 0    0 0 0
fve-miR164a-3p CACGUGCUCCCCUUCUCCAAC 21 0 0 0 0    0 0 0
fve-miR164a-5p UGGAGAAGCAGGGCACGUGCA 21 0 0 0 0    0 0 0
fve-miR164b UGGAGAAGCAGGGCACGUGCA 21 0 0 0 0    0 0 0
fve-miR164c UGGAGAAGCAGGGCACAUGCU 21 0 0 0 0    0 0 0
fve-miR166a UCGGACCAGGCUUCAUUCCCC 21 0 0 0 0    0 0 0
fve-miR166b UCGGACCAGGCUUCAUUCCCC 21 0 0 0 0    0 0 0
fve-miR166c UCGGACCAGGCUUCAUUCCCC 21 0 0 0 0    0 0 0
fve-miR166d-3p UCGGACCAGGCUUCAUUCCCC 21 0 0 0 0    0 0 0
fve-miR166d-5p GGGAAUGUCGUCUGGUUCGA 20 0 0 0 0    0 0 0
fve-miR166e UCGGACCAGGCUUCAUUCCCC 21 0 0 0 0    0 0 0
fve-miR166f UCGGACCAGGCUUCAUUCCCC 21 0 0 0 0    0 0 0
fve-miR167a UGAAGCUGCCAGCAUGAUCU 20 269 90 118 42    109 118 42
fve-miR167b UGAAGCUGCCAGCAUGAUCU 20 269 90 118 42    109 118 42
fve-miR167c UGAAGCUGCCAGCAUGAUCU 20 269 90 118 42    109 118 42
fve-miR167d UGAAGCUGCCAGCAUGAUCUCA 22 0 0 0 0    0 0 0
fve-miR168-3p CCCGCCUUGCAUCAACUGAAU 21 0 0 0 0    0 0 0
fve-miR168-5p UCGCUUGGUGCAGGUCGGGAA 21 0 0 0 0    0 0 0
fve-miR169a UAGCCAAGGAUGACUUGCCU 20 0 0 0 0    0 0 0
fve-miR169b UAGCCAAGGAUGACUUGCCU 20 0 0 0 0    0 0 0
fve-miR169c UAGCCAAGGAUGACUUGCCU 20 0 0 0 0    0 0 0
fve-miR169d UAGCCAAGGAUGACUUGCCU 20 0 0 0 0    0 0 0
fve-miR169e UGAGCCAAGGAUGACUUGCCU 21 0 0 0 0    0 0 0
fve-miR169f UGAGCCAAGAAUGACUUGCUG 21 0 0 0 0    0 0 0
fve-miR171a UGAUUGAGCCGUGCCAAUAUC 21 0 0 0 0    0 0 0
fve-miR171b CGAGCCGAACCAAUAUCACUC 21 0 0 0 0    0 0 0
fve-miR171c-3p UGAUUGAGCCGUGCCAAUAUC 21 0 0 0 0    0 0 0
fve-miR171c-5p AGAUAUUGGUGCGGUUCAAUC 21 0 0 0 0    0 0 0
fve-miR171d UGAUUGAGCCGUGCCAAUAUC 21 0 0 0 0    0 0 0
fve-miR171e UGAUUGAGCCGUGCCAAUAUC 21 0 0 0 0    0 0 0
fve-miR171f-3p UUGAGCCGCGCCAAUAUCACU 21 0 0 0 0    0 0 0
fve-miR171f-5p CGAUGUUGGUGAGGUUCAAUC 21 0 0 0 0    0 0 0
fve-miR171g UGAUUGAGCCGUGCCAAUAUC 21 0 0 0 0    0 0 0
fve-miR171h UUGAGCCGCGUCAAUAUCUCC 21 0 0 0 0    0 0 0
fve-miR172a AGAAUCUUGAUGAUGCUGCAU 21 0 0 0 0    0 0 0
fve-miR172b AGAAUCUUGAUGAUGCUGCAU 21 0 0 0 0    0 0 0
fve-miR172c AGAAUCUUGAUGAUGCUGCAU 21 0 0 0 0    0 0 0
fve-miR2109 UGCGAGUGUCUUCACCUCUGAA 22 0 0 0 0    0 0 0
fve-miR2111a UAAUCUGCAUCCUGAGGUUU 20 0 0 0 0    0 0 0
fve-miR2111b-3p GCCCUUGGGAUGCGGAUUACC 21 0 0 0 0    0 0 0
fve-miR2111b-5p UAAUCUGCAUCCUGAGGUUU 20 0 0 0 0    0 0 0
fve-miR2111c UAAUCUGCAUCCUGAGGUUU 20 0 0 0 0    0 0 0
fve-miR319 UUUGGACUGAAGGGAGCUCCU 21 0 0 0 0    0 0 0
fve-miR3627a UCGCAGGAGAGAUGGCACUACC 22 0 0 0 0    0 0 0
fve-miR3627b UCGCAGGAGAGAUGGCACUACC 22 0 0 0 0    0 0 0
fve-miR390a AAGCUCAGGAGGGAUAGCGCC 21 0 0 0 0    0 0 0
fve-miR390b AAGCUCAGGAGGGAUAGCGCC 21 0 0 0 0    0 0 0
fve-miR393a UCCAAAGGGAUCGCAUUGAUC 21 0 0 0 0    0 0 0
fve-miR393b UCCAAAGGGAUCGCAUUGAUCU 22 0 0 0 0    0 0 0
fve-miR394 UUGGCAUUCUGUCCACCUCC 20 10 3 10 10    0 0 10
fve-miR396a-3p GUUCAAUAAAGCUGUGGGAAG 21 0 0 0 0    0 0 0
fve-miR396a-5p UUCCACAGCUUUCUUGAACUG 21 0 0 0 0    0 0 0
fve-miR396b-3p GCUCAAGAAAGCUGUGGGACA 21 0 0 0 0    0 0 0
fve-miR396b-5p UUCCACAGCUUUCUUGAACUU 21 0 0 0 0    0 0 0
fve-miR396c-3p GUUCAAUAAAGCUGUGGGAAG 21 0 0 0 0    0 0 0
fve-miR396c-5p UUCCACAGCUUUCUUGAACUG 21 0 0 0 0    0 0 0
fve-miR396d UUCCACAGCUUUCUUGAACUG 21 0 0 0 0    0 0 0
fve-miR396e UUCCACAGGCUUUCUUGAACU 21 0 0 0 0    0 0 0
fve-miR397 UCAUUGAGUGCAGCGUUGAUG 21 0 0 0 0    0 0 0
fve-miR399a UGCCAAAGGAGAGUUGCCCUG 21 0 0 0 0    0 0 0
fve-miR399b AGCCAAAGGAGAAUUGCCCUG 21 0 0 0 0    0 0 0
fve-miR408 UGCACUGCCUCUUCCCUGGCU 21 0 0 0 0    0 0 0
fve-miR477a ACUCUCCCUCAAGGGCUUCUC 21 0 0 0 0    0 0 0
fve-miR477b CGCGCACCCGUUCAUCUUCGC 21 0 0 0 0    0 0 0
fve-miR482a UCUUUCCAAUUCCUCCCAUGCC 22 0 0 0 0    0 0 0
fve-miR482b UCUUUCCUAGUCCUGCCAUUCC 22 0 0 0 0    0 0 0
fve-miR482c UCUUUCCUAUUCCUCCCAUCCC 22 0 0 0 0    0 0 0
fve-miR482d UUCCCUAUUCCACCUAUUCCCC 22 0 0 0 0    0 0 0
fve-miR5225 CUGUCGUAGGAGAGAUGGCGCC 22 0 0 0 0    0 0 0
fve-miR530 UGCAUUUGCACCUGCACCUCU 21 0 0 0 0    0 0 0
fve-miR535a UGACGAUGAGAGAGAGCACGC 21 0 0 0 0    0 0 0
fve-miR535b UGACGAUGAGAGAGAGCACGC 21 0 0 0 0    0 0 0
fve-miR827 UUAGAUGACCAUCAACAAACA 21 0 0 0 0    0 0 0
fve-miR845 AACCGGCUCUGAUACCAAUUG 21 0 0 0 0    0 0 0