Sorghum Small RNA miRNA Abundances

The data below are based on the microRNAs listed in the miRBase registry. Adjust libraries/reads to display on the control panel.

        

        miRNA         miRNA sequence Len Sum (norm) Average Max Min (>0)  Sc0h1_sRNASc0h2_sRNASc0h3_sRNASc48h1_sRNASc48h2_sRNASc48h3_sRNATam0h1_sRNATam0h2_sRNATam0h3_sRNATam48h2_sRNATam48h3_sRNATam48h4_sRNA
sbi-miR1432 CUCAGGAGAGAUGACACCGAC 21 1 0 1 1    0 1 0 0 0 0 0 0 0 0 0 0
sbi-miR1435a UUUCUUAAGUCAAACUUUUC 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR1435b UUUCUUAAGUCAAACCUUUU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR156a UGACAGAAGAGAGUGAGCAC 20 1,176 98 284 21    127 82 66 141 284 268 67 24 22 44 21 30
sbi-miR156b UGACAGAAGAGAGUGAGCAC 20 1,176 98 284 21    127 82 66 141 284 268 67 24 22 44 21 30
sbi-miR156c UGACAGAAGAGAGUGAGCAC 20 1,176 98 284 21    127 82 66 141 284 268 67 24 22 44 21 30
sbi-miR156d UGACAGAAGAGAGAGAGCACA 21 1 0 1 1    0 0 0 0 0 0 0 0 0 1 0 0
sbi-miR156e UGACAGAAGAGAGCGAGCAC 20 44 4 13 1    4 4 2 1 13 6 6 3 0 1 0 4
sbi-miR156f UGACAGAAGAGAGUGAGCAC 20 1,176 98 284 21    127 82 66 141 284 268 67 24 22 44 21 30
sbi-miR156g UGACAGAAGAGAGUGAGCAC 20 1,176 98 284 21    127 82 66 141 284 268 67 24 22 44 21 30
sbi-miR156h UGACAGAAGAGAGUGAGCAC 20 1,176 98 284 21    127 82 66 141 284 268 67 24 22 44 21 30
sbi-miR156i UGACAGAAGAGAGUGAGCAC 20 1,176 98 284 21    127 82 66 141 284 268 67 24 22 44 21 30
sbi-miR159a UUUGGAUUGAAGGGAGCUCUG 21 8,813 734 1,847 226    473 426 741 892 1,847 1,091 1,035 578 334 656 226 514
sbi-miR159b CUUGGAUUGAAGGGAGCUCCU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR160a UGCCUGGCUCCCUGUAUGCCA 21 4,784 399 980 57    406 403 501 615 980 331 379 461 420 154 57 77
sbi-miR160b UGCCUGGCUCCCUGUAUGCCA 21 4,784 399 980 57    406 403 501 615 980 331 379 461 420 154 57 77
sbi-miR160c UGCCUGGCUCCCUGUAUGCCA 21 4,784 399 980 57    406 403 501 615 980 331 379 461 420 154 57 77
sbi-miR160d UGCCUGGCUCCCUGUAUGCCA 21 4,784 399 980 57    406 403 501 615 980 331 379 461 420 154 57 77
sbi-miR160e UGCCUGGCUCCCUGUAUGCCA 21 4,784 399 980 57    406 403 501 615 980 331 379 461 420 154 57 77
sbi-miR160f UGCCUGGCUCCCUGAAUGCCA 21 9 1 2 1    1 1 1 0 0 1 0 2 1 0 0 2
sbi-miR162 UCGAUAAACCUCUGCAUCCAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR164a UGGAGAAGCAGGGCACGUGCA 21 74 6 22 1    3 3 11 22 0 4 6 13 3 1 4 4
sbi-miR164b UGGAGAAGCAGGGCACGUGCU 21 16 1 5 1    1 1 1 0 0 0 5 2 0 1 3 2
sbi-miR164c UGGAGAAGCAGGACACGUGAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR164d UGGAGAAGCAGGGCACGUGCA 21 74 6 22 1    3 3 11 22 0 4 6 13 3 1 4 4
sbi-miR164e UGGAGAAGCAGGGCACGUGCA 21 74 6 22 1    3 3 11 22 0 4 6 13 3 1 4 4
sbi-miR166a UCGGACCAGGCUUCAUUCCC 20 1,168 97 224 22    103 114 172 157 224 165 47 65 22 32 30 37
sbi-miR166b UCGGACCAGGCUUCAUUCCC 20 1,168 97 224 22    103 114 172 157 224 165 47 65 22 32 30 37
sbi-miR166c UCGGACCAGGCUUCAUUCCC 20 1,168 97 224 22    103 114 172 157 224 165 47 65 22 32 30 37
sbi-miR166d UCGGACCAGGCUUCAUUCCC 20 1,168 97 224 22    103 114 172 157 224 165 47 65 22 32 30 37
sbi-miR166e UCGGACCAGGCUUCAAUCCCU 21 3,759 313 693 88    213 200 524 593 693 630 181 256 88 111 100 170
sbi-miR166f UCGGACCAGGCUUCAUUCCUC 21 2,023 169 347 42    107 150 336 278 347 323 110 130 55 67 42 78
sbi-miR166g UCGGACCAGGCUUCAAUCCCU 21 3,759 313 693 88    213 200 524 593 693 630 181 256 88 111 100 170
sbi-miR166h UCGGACCAGGCUUCAUUCCC 20 1,168 97 224 22    103 114 172 157 224 165 47 65 22 32 30 37
sbi-miR166i UCGGACCAGGCUUCAUUCCC 20 1,168 97 224 22    103 114 172 157 224 165 47 65 22 32 30 37
sbi-miR166j UCGGACCAGGCUUCAUUCCC 20 1,168 97 224 22    103 114 172 157 224 165 47 65 22 32 30 37
sbi-miR166k UCGGACCAGGCUUCAUUCCU 20 114 10 22 2    5 6 13 22 14 21 8 2 5 9 0 9
sbi-miR167a UGAAGCUGCCAGCAUGAUCUA 21 21 2 7 1    1 2 1 2 7 1 2 1 4 0 0 0
sbi-miR167b UGAAGCUGCCAGCAUGAUCUA 21 21 2 7 1    1 2 1 2 7 1 2 1 4 0 0 0
sbi-miR167c UGAAGCUGCCAGCAUGAUCUG 21 6,651 554 1,360 147    512 456 752 720 1,017 1,360 600 418 147 285 184 200
sbi-miR167d UGAAGCUGCCAGCAUGAUCUG 21 6,651 554 1,360 147    512 456 752 720 1,017 1,360 600 418 147 285 184 200
sbi-miR167e UGAAGCUGCCAGCAUGAUCUG 21 6,651 554 1,360 147    512 456 752 720 1,017 1,360 600 418 147 285 184 200
sbi-miR167f UGAAGCUGCCAGCAUGAUCUG 21 6,651 554 1,360 147    512 456 752 720 1,017 1,360 600 418 147 285 184 200
sbi-miR167g UGAAGCUGCCAGCAUGAUCUG 21 6,651 554 1,360 147    512 456 752 720 1,017 1,360 600 418 147 285 184 200
sbi-miR167h UGAAGCUGCCAGCAUGAUCUG 21 6,651 554 1,360 147    512 456 752 720 1,017 1,360 600 418 147 285 184 200
sbi-miR167i UGAAGCUGCCAGCAUGAUCUA 21 21 2 7 1    1 2 1 2 7 1 2 1 4 0 0 0
sbi-miR168 UCGCUUGGUGCAGAUCGGGAC 21 19,365 1,614 3,083 876    976 1,218 1,566 2,514 3,083 1,909 1,970 1,199 876 1,547 1,138 1,369
sbi-miR169a CAGCCAAGGAUGACUUGCCGA 21 25 2 12 1    0 0 3 0 12 5 1 3 0 1 0 0
sbi-miR169b CAGCCAAGGAUGACUUGCCGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR169c UAGCCAAGGAUGACUUGCCUA 21 2 0 1 1    0 0 0 0 1 0 0 0 0 1 0 0
sbi-miR169d-3p GGGCGGUCACCUUGGCUAGC 20 594 50 138 14    16 14 32 41 138 33 79 64 21 91 30 35
sbi-miR169d-5p UAGCCAAGGAUGACUUGCCU 20 7 1 2 1    0 1 0 0 0 2 0 0 0 1 1 2
sbi-miR169e UAGCCAAGGAUGACUUGCCGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR169f UAGCCAAGGAUGACUUGCCUG 21 11 1 9 2    2 0 0 0 9 0 0 0 0 0 0 0
sbi-miR169g UAGCCAAGGAUGACUUGCCUG 21 11 1 9 2    2 0 0 0 9 0 0 0 0 0 0 0
sbi-miR169h UAGCCAAGGAUGACUUGCCUA 21 2 0 1 1    0 0 0 0 1 0 0 0 0 1 0 0
sbi-miR169i UAGCCAAGAAUGACUUGCCUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR169j UAGCCAAGGAUGACUUGCCGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR169k CAGCCAAGGAUGACUUGCCGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR169l UAGCCAAGGAUGACUUGCCUG 21 11 1 9 2    2 0 0 0 9 0 0 0 0 0 0 0
sbi-miR169m UAGCCAAGGAUGACUUGCCUA 21 2 0 1 1    0 0 0 0 1 0 0 0 0 1 0 0
sbi-miR169n UAGCCAAGGAUGACUUGCCUA 21 2 0 1 1    0 0 0 0 1 0 0 0 0 1 0 0
sbi-miR169o UAGCCAAGGAUGAUUUGCCUG 21 2 0 1 1    0 1 0 0 0 0 0 1 0 0 0 0
sbi-miR169p UAGCCAAGAAUGGCUUGCCUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR169q UAGCCAAGAAUGGCUUGCCUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR171a UGAUUGAGCCGUGCCAAUAUC 21 46 4 12 2    3 4 4 0 4 2 5 6 3 12 3 0
sbi-miR171b UGAUUGAGCCGUGCCAAUAUC 21 46 4 12 2    3 4 4 0 4 2 5 6 3 12 3 0
sbi-miR171c GAGGUGAGCCGAGCCAAUAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR171d UGAUUGAGCCGUGCCAAUAUC 21 46 4 12 2    3 4 4 0 4 2 5 6 3 12 3 0
sbi-miR171e GUGAGCCGAACCAAUAUCACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR171f AUGAGCCGAACCAAUAUCACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR171g UGAUUGAGCCGCGCCAAUAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR171h GGAUUGAGCCGCGUCAAUAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR171i UGAUUGAGCCGUGCCAAUAUC 21 46 4 12 2    3 4 4 0 4 2 5 6 3 12 3 0
sbi-miR171j UGAUUGAGCCGCGCCAAUAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR171k UGAUUGAGCCGUGCCAAUAUC 21 46 4 12 2    3 4 4 0 4 2 5 6 3 12 3 0
sbi-miR172a AGAAUCUUGAUGAUGCUGCA 20 2 0 2 2    0 0 0 0 0 0 0 0 2 0 0 0
sbi-miR172b GGAAUCUUGAUGAUGCUGCA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR172c AGAAUCUUGAUGAUGCUGCA 20 2 0 2 2    0 0 0 0 0 0 0 0 2 0 0 0
sbi-miR172d AGAAUCUUGAUGAUGCUGCA 20 2 0 2 2    0 0 0 0 0 0 0 0 2 0 0 0
sbi-miR172e UGAAUCUUGAUGAUGCUGCAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR172f AGAAUCCUGAUGAUGCUGCAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR2118-3p UUCCUGAUGCCUCCCAUGCCUA 22 13 1 7 2    0 0 0 2 0 7 0 0 2 0 0 2
sbi-miR2118-5p GGCAUGGGAACAUGUAGGAAGG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR319a UUGGACUGAAGGGUGCUCCC 20 6 1 3 1    2 0 0 0 0 3 0 0 1 0 0 0
sbi-miR319b UUGGACUGAAGGGUGCUCCC 20 6 1 3 1    2 0 0 0 0 3 0 0 1 0 0 0
sbi-miR390 AAGCUCAGGAGGGAUAGCGCC 21 23 2 9 1    1 1 0 0 9 3 1 2 2 3 1 0
sbi-miR393a UCCAAAGGGAUCGCAUUGAUC 21 25 2 9 1    4 2 0 9 0 0 4 2 3 1 0 0
sbi-miR393b UCCAAAGGGAUCGCAUUGAUC 21 25 2 9 1    4 2 0 9 0 0 4 2 3 1 0 0
sbi-miR394a UUGGCAUUCUGUCCACCUCC 20 111 9 20 3    8 10 15 13 20 16 7 3 3 7 3 6
sbi-miR394b UUGGCAUUCUGUCCACCUCC 20 111 9 20 3    8 10 15 13 20 16 7 3 3 7 3 6
sbi-miR395a GUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR395b GUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR395c GUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR395d GUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR395e GUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR395f AUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR395g GUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR395h GUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR395i GUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR395j GUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR395k GUGAAGUGUUUGGAGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR395l GUGAAGUGCUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR396a UUCCACAGCUUUCUUGAACUG 21 2 0 1 1    0 0 0 0 0 0 1 0 1 0 0 0
sbi-miR396b UUCCACAGCUUUCUUGAACUG 21 2 0 1 1    0 0 0 0 0 0 1 0 1 0 0 0
sbi-miR396c UUCCACAGCUUUCUUGAACUU 21 29 2 8 1    4 1 0 2 8 2 4 6 1 0 1 0
sbi-miR396d CUCCACAGGCUUUCUUGAACUG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR396e UUCCACAGGCUUUCUUGAACUG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR397-3p UCACCGGCGCUGCACUCAAUU 21 103 9 29 1    9 9 11 16 3 29 5 5 1 5 4 6
sbi-miR397-5p UCAUUGAGUGCAGCGUUGAUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR398 UGUGUUCUCAGGUCGCCCCCG 21 180 15 52 2    18 2 6 21 52 31 8 17 5 7 7 6
sbi-miR399a UGCCAAAGGAGAAUUGCCCUG 21 34 3 9 1    0 1 4 3 4 9 1 2 1 3 0 6
sbi-miR399b UGCCAAAGGAGAGCUGCCCUG 21 112 9 38 1    1 11 38 15 12 18 5 9 0 0 1 2
sbi-miR399c UGCCAAAGGAGAAUUGCCCUG 21 34 3 9 1    0 1 4 3 4 9 1 2 1 3 0 6
sbi-miR399d UGCCAAAGGAGAGUUGCCCUG 21 1,490 124 269 42    92 100 269 181 127 202 168 141 77 42 42 49
sbi-miR399e UGCCAAAGGAGAUUUGCCCAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR399f UGCCAAAGGAGAUUUGCCCAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR399g UGCCAAAGGAAAUUUGCCCCG 21 50 4 11 1    2 0 4 1 9 11 2 11 0 4 4 2
sbi-miR399h UGCCAAAGGAGAAUUGCCCUG 21 34 3 9 1    0 1 4 3 4 9 1 2 1 3 0 6
sbi-miR399i UGCCAAAGGAGAGUUGCCCUG 21 1,490 124 269 42    92 100 269 181 127 202 168 141 77 42 42 49
sbi-miR399j UGCCAAAGGAGAAUUGCCCUG 21 34 3 9 1    0 1 4 3 4 9 1 2 1 3 0 6
sbi-miR399k UGCCAAAGGGGAUUUGCCCGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR408 CUGCACUGCCUCUUCCCUGGC 21 161 13 39 2    8 8 2 22 22 39 23 10 13 3 4 7
sbi-miR437a AAAGUUAGAGAAGUUUGACUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR437b AAAGUUAGAGAAGUUUGACUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR437c AAAGUUAGAGAAGUUUGACUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR437d AAAGUUAGAGAAGUUUGACUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR437e AAAGUUAGAGAAGUUUGACUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR437f AAAGUUAGAGAAGUUUGACUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR437g AAAGUUAGAGAAGUUUGACUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR437i AAAGUUAGAGAAGUUUGACUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR437j AAAGUUAGAGAAGUUUGACUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR437k AAAGUUAGAGAAGUUUGACUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR437l AAAGUUAGAGAAGUUUGACUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR437m AAAGUUAGAGAAGUUUGACUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR437n AAAGUUAGAGAAGUUUGACUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR437o AAAGUUAGAGAAGUUUGACUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR437p AAAGUUAGAGAAGUUUGACUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR437q AAAGUUAGAGAAGUUUGACUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR437r AAAGUUAGAGAAGUUUGACUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR437s AAAGUUAGAGAAGUUUGACUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR437t AAAGUUAGAGAAGUUUGACUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR437u AAAGUUAGAGAAGUUUGACUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR437v AAAGUUAGAGAAGUUUGACUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR437w AAAGUUAGAGAAGUUUGACUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR437x-3p AUUUGACUGACACGGAUUCUAGGA 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR437x-5p UAGAGUUGUCCUAAGUCAAACUUU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR528 UGGAAGGGGCAUGCAGAGGAG 21 172 14 69 2    4 0 6 7 0 18 69 46 12 4 4 2
sbi-miR529 CUGUACCCUCUCUCUUCUUC 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR5381 AAGAUCUGUGGCGCCGAGC 19 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR5382 CCAAUCUAAACAGGCCCU 18 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR5383 AUGACAGAGCUCCGGCAGAGAUAU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR5384 CGCGCCGCCGUCCAGCGG 18 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR5385 ACCACCAACCCCACCGCUUCUC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR5386 CGUCGCUGUCGCGCGCGCUG 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR5387a UAACACGAACCGGUGCUAAAGGAUC 25 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR5387b CGUGGCUCUGACCGGUGCUAAAGG 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR5388 AUCUUUGCCGGGUGUCUCUGAC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR5389 GCUUGAGUUUAUCAGCCGAGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR5564a UGGGGAAGCAAUUCGUCGAACA 22 6 1 3 1    0 0 0 1 0 0 0 2 0 0 3 0
sbi-miR5564b GCAAUUCGUCGAACAGCUUGA 21 1 0 1 1    0 0 0 0 0 0 0 0 0 0 1 0
sbi-miR5564c-3p ACGCGAGCUGUUUGGCGAAUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR5564c-5p AAUUCGUCGAACAGCUGCAGC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR5565a AACACAUGUGGAUUGAGGCGAAUC 24 1 0 1 1    0 1 0 0 0 0 0 0 0 0 0 0
sbi-miR5565b AACACAUGUGGAUUGAGGCGAAUC 24 1 0 1 1    0 1 0 0 0 0 0 0 0 0 0 0
sbi-miR5565c UACACAUGUGGAUUGAGGUGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR5565d ACUUCAAUCCAUGUAUGUUGGUGU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR5565e UUGUUUGGAUGUUGUCGGA 19 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR5565f UAGUCGGAUUUAUAUCAAUC 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR5565g-3p ACACAUGUGGAUUGAGAUGAAUAC 24 1 0 1 1    0 0 0 0 0 0 1 0 0 0 0 0
sbi-miR5565g-5p UUCACAUCAAUCCACAUAUGUUGG 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR5566 UCAGCAUCACCUCCCUGUUGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR5567 UUAAUGAUUCAUGUAUGUGUCCAA 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR5568a CAGAGCGACUUACAAUUUGGA 21 1 0 1 1    0 1 0 0 0 0 0 0 0 0 0 0
sbi-miR5568b-3p ACUAUGUAUCUAGAAAAGCUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR5568b-5p UUUCUAGGUACAUAGCUUUUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR5568c-3p ACUUACAGUUUGGAACGGAGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR5568c-5p UCUGUUCCAAAUUGUAAGUCG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR5568d-3p AAAGUUGUGUAUCUAGAAAAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR5568d-5p UGGCUUUUCUAGAUACAUAGC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR5568e-3p UAUCUAGAAAAGCUAAAACGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR5568e-5p GAUGUUUUGGGUUUUCUAGAU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR5568f-3p GUCUUAUAAUUUGGAAUGGAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR5568f-5p UCCAUUCCAAAUUGUAAGAUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR5568g-3p AAAACGUCUUAUAAUUUGGAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR5568g-5p CAAAUUAUAAGAUGUUUUGGC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR5569 UAUUGCAUGCUUGAACUAUGGUAA 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR5570 AAAAGACAAAUCAGCAUGUCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR6217a-3p AAAAUUAUCGUAAAUAGAGGUGGC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR6217a-5p UAGCCACUUUGAGUUACGAUAAUU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR6217b-3p AAAAUUAUCGUAAAUAGAGGUGGC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR6217b-5p UAGCCACUUUGAGUUACGAUAAUU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR6218-3p ACAAGUUUCGUGAUUUUUGGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR6218-5p CGAAAAUCACGAAACUUGUCG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR6219-3p AGUCCCGAAACCUUAGUCCCGGCU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR6219-5p GAACCGGGACUAAAGGUGGGACAU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR6220-3p AUGCCUUAUAAUUUGGGAUGGAGA 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR6220-5p CUCCAUCCUAAAUUAUAAGACAUU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR6221-3p CCGGGGCCAGAUCUCAGAAGC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR6221-5p UUCUGACUUCUGGCCCCUGCU 21 1 0 1 1    0 0 0 0 0 0 0 0 1 0 0 0
sbi-miR6222-3p CUAGCUGAUCCAAACAGGCCC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR6222-5p CCUGUUUGGAUCAGCCAAGGC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR6223-3p CUAGCAUGUUCCUCCUAAGAG 21 2 0 1 1    0 0 0 0 0 0 0 1 0 1 0 0
sbi-miR6223-5p UUCUUGGGAGGAGCAUGCUAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR6224a-3p CUUAUAUACUAGGACGGAGGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR6224a-5p CUCCGUCCUAAUAUAUAAGGC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR6224b-3p CUUAUAUACUAGGACGGAGGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR6224b-5p CUCCGUCCUAAUAUAUAAGGC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR6224c-3p CUUAUAUACUAGGACGGAGGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR6224c-5p CUCCGUCCUAAUAUAUAAGGC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR6225-3p GAAACGAAUCUUUUAAGUCUAAUU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR6225-5p AACUAGACUCAAAAGAUUCAUCUC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR6226-3p GAUUAGUCACGAUUAGUCGUCCGA 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR6226-5p AGAUCGGACGACUAAUCGCGAUUA 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR6227-3p CUCACAACACUUGCUAUUUGGG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR6227-5p GGGCCCAAAUAGCAAGUGUUGUGA 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR6228-3p GUGGCAGUAGAAUUAAUGAAGGGA 24 60 5 16 1    0 9 0 1 16 1 6 8 8 3 4 4
sbi-miR6228-5p UUCUAUCUCUAUUAAUUGUGUUGC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR6229-3p GUUUUUCUCGCCGGGUGAGAAGGC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR6229-5p AUUCUCACUUGGGCGACGGAAAGG 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR6230-3p UAACAAGUUUAGGGAUCUAGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR6230-5p UUUUGGGUCCCUAAACUUGUU 21 11 1 5 1    0 0 5 0 0 0 1 5 0 0 0 0
sbi-miR6231-3p UAUUUGUGGACUCAUGGACAU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR6231-5p GUCCGUGAGUCCACAAAUAGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR6232a-3p UGGAUGUACCAAAAAAGUCAAAGC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR6232a-5p GUCGCUUUGACUUUUUUGGUACAU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR6232b-3p AAUUCGAUGUACCAAAAAAGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR6232b-5p UUUUUGGUACAUUGAAUUUGC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR6233-3p CAAGUUUGGUUUUGGUAAUUAAUG 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR6233-5p UGUUGAGGCUGGAGCGAAACUCGG 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR6234a-3p UUAGCGUCAAGAGACGAACACACU 24 1 0 1 1    0 0 0 0 0 0 0 1 0 0 0 0
sbi-miR6234a-5p AAGUGUGUUCCUCUAUUUGACGCU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR6234b-3p UUAGCGUCAAGAGACGAACACACU 24 1 0 1 1    0 0 0 0 0 0 0 1 0 0 0 0
sbi-miR6234b-5p AAGUGUGUUCCUCUAUUUGACGCU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR6235-3p AACGAACAGUAUUUUUCUCUUACA 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR6235-5p UUGUGAGAGAAAAAUACUGUUGGC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR821a AAGUCAUCAACAUAAAAGUUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR821b AAGUUAUGAACAUAAAAGUUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR821c AAGUCAUCAACAUAAAAGUUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR821d AAGUCAUCAACAACAAAGUUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR821e AAGUCAUCAAAAUAAAAGUUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0