Sorghum Small RNA miRNA Abundances

The data below are based on the microRNAs listed in the Sanger registry. Adjust libraries/reads to display on the control panel.

        

        miRNA         miRNA sequence Len Sum (norm) Average Max Min (>0)  leaf_Sb_r1leaf_Sb_r22mm_wp_r112cm_wp_r115cm_wp_r130cm_wp_r105_ant_spik_r105_ant_spik_r205_10_an_spik_r105_10_an_spik_r208_12_an_spik_r108_12_an_spik_r212_ant_spik_r112_ant_spik_r2
sbi-miR1432 CUCAGGAGAGAUGACACCGAC 21 149 11 78 71    78 71 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR1435a UUUCUUAAGUCAAACUUUUC 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR1435b UUUCUUAAGUCAAACCUUUU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR156a UGACAGAAGAGAGUGAGCAC 20 6,286 449 2,683 7    2,464 2,683 7 20 33 38 70 95 125 180 135 104 181 151
sbi-miR156b UGACAGAAGAGAGUGAGCAC 20 6,286 449 2,683 7    2,464 2,683 7 20 33 38 70 95 125 180 135 104 181 151
sbi-miR156c UGACAGAAGAGAGUGAGCAC 20 6,286 449 2,683 7    2,464 2,683 7 20 33 38 70 95 125 180 135 104 181 151
sbi-miR156d UGACAGAAGAGAGAGAGCACA 21 1 0 1 1    0 0 0 1 0 0 0 0 0 0 0 0 0 0
sbi-miR156e UGACAGAAGAGAGCGAGCAC 20 172 12 39 1    15 20 0 0 5 1 5 4 39 14 18 17 10 24
sbi-miR156f UGACAGAAGAGAGUGAGCAC 20 6,286 449 2,683 7    2,464 2,683 7 20 33 38 70 95 125 180 135 104 181 151
sbi-miR156g UGACAGAAGAGAGUGAGCAC 20 6,286 449 2,683 7    2,464 2,683 7 20 33 38 70 95 125 180 135 104 181 151
sbi-miR156h UGACAGAAGAGAGUGAGCAC 20 6,286 449 2,683 7    2,464 2,683 7 20 33 38 70 95 125 180 135 104 181 151
sbi-miR156i UGACAGAAGAGAGUGAGCAC 20 6,286 449 2,683 7    2,464 2,683 7 20 33 38 70 95 125 180 135 104 181 151
sbi-miR159a UUUGGAUUGAAGGGAGCUCUG 21 406,570 29,041 89,590 2,176    89,590 84,221 46,191 26,958 36,939 24,091 24,357 30,990 2,176 25,040 2,906 5,015 5,637 2,459
sbi-miR159b CUUGGAUUGAAGGGAGCUCCU 21 35 3 9 2    0 3 0 5 2 3 9 6 0 3 0 2 2 0
sbi-miR160a UGCCUGGCUCCCUGUAUGCCA 21 5,302 379 1,599 44    1,497 1,599 281 221 234 300 300 354 82 234 51 46 59 44
sbi-miR160b UGCCUGGCUCCCUGUAUGCCA 21 5,302 379 1,599 44    1,497 1,599 281 221 234 300 300 354 82 234 51 46 59 44
sbi-miR160c UGCCUGGCUCCCUGUAUGCCA 21 5,302 379 1,599 44    1,497 1,599 281 221 234 300 300 354 82 234 51 46 59 44
sbi-miR160d UGCCUGGCUCCCUGUAUGCCA 21 5,302 379 1,599 44    1,497 1,599 281 221 234 300 300 354 82 234 51 46 59 44
sbi-miR160e UGCCUGGCUCCCUGUAUGCCA 21 5,302 379 1,599 44    1,497 1,599 281 221 234 300 300 354 82 234 51 46 59 44
sbi-miR160f UGCCUGGCUCCCUGAAUGCCA 21 47 3 26 1    19 26 0 0 0 0 0 0 1 0 0 1 0 0
sbi-miR162 UCGAUAAACCUCUGCAUCCAG 21 182 13 103 1    103 71 0 1 1 0 0 3 1 1 1 0 0 0
sbi-miR164a UGGAGAAGCAGGGCACGUGCA 21 81 6 12 2    6 3 4 7 11 4 6 3 2 12 5 4 8 6
sbi-miR164b UGGAGAAGCAGGGCACGUGCU 21 1 0 1 1    0 0 0 0 0 0 0 0 0 1 0 0 0 0
sbi-miR164c UGGAGAAGCAGGACACGUGAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR164d UGGAGAAGCAGGGCACGUGCA 21 81 6 12 2    6 3 4 7 11 4 6 3 2 12 5 4 8 6
sbi-miR164e UGGAGAAGCAGGGCACGUGCA 21 81 6 12 2    6 3 4 7 11 4 6 3 2 12 5 4 8 6
sbi-miR166a UCGGACCAGGCUUCAUUCCC 20 267,643 19,117 46,247 6,698    36,312 46,247 12,484 12,579 11,795 15,875 22,986 26,244 6,698 29,638 9,731 15,335 11,691 10,028
sbi-miR166b UCGGACCAGGCUUCAUUCCC 20 267,643 19,117 46,247 6,698    36,312 46,247 12,484 12,579 11,795 15,875 22,986 26,244 6,698 29,638 9,731 15,335 11,691 10,028
sbi-miR166c UCGGACCAGGCUUCAUUCCC 20 267,643 19,117 46,247 6,698    36,312 46,247 12,484 12,579 11,795 15,875 22,986 26,244 6,698 29,638 9,731 15,335 11,691 10,028
sbi-miR166d UCGGACCAGGCUUCAUUCCC 20 267,643 19,117 46,247 6,698    36,312 46,247 12,484 12,579 11,795 15,875 22,986 26,244 6,698 29,638 9,731 15,335 11,691 10,028
sbi-miR166e UCGGACCAGGCUUCAAUCCCU 21 504,027 36,002 64,834 12,445    12,871 12,445 64,834 40,759 45,243 44,617 41,847 57,616 15,777 63,342 21,223 25,487 34,737 23,229
sbi-miR166f UCGGACCAGGCUUCAUUCCUC 21 389,611 27,829 55,380 13,223    14,923 14,322 55,380 29,738 34,099 32,517 32,908 44,331 13,223 48,808 14,346 17,172 23,273 14,571
sbi-miR166g UCGGACCAGGCUUCAAUCCCU 21 504,027 36,002 64,834 12,445    12,871 12,445 64,834 40,759 45,243 44,617 41,847 57,616 15,777 63,342 21,223 25,487 34,737 23,229
sbi-miR166h UCGGACCAGGCUUCAUUCCC 20 267,643 19,117 46,247 6,698    36,312 46,247 12,484 12,579 11,795 15,875 22,986 26,244 6,698 29,638 9,731 15,335 11,691 10,028
sbi-miR166i UCGGACCAGGCUUCAUUCCC 20 267,643 19,117 46,247 6,698    36,312 46,247 12,484 12,579 11,795 15,875 22,986 26,244 6,698 29,638 9,731 15,335 11,691 10,028
sbi-miR166j UCGGACCAGGCUUCAUUCCC 20 267,643 19,117 46,247 6,698    36,312 46,247 12,484 12,579 11,795 15,875 22,986 26,244 6,698 29,638 9,731 15,335 11,691 10,028
sbi-miR166k UCGGACCAGGCUUCAUUCCU 20 15,659 1,119 3,284 421    421 477 3,284 1,062 1,205 1,232 1,438 1,997 442 1,879 488 635 619 480
sbi-miR167a UGAAGCUGCCAGCAUGAUCUA 21 644 46 123 4    23 31 69 53 81 68 91 123 13 48 4 19 11 10
sbi-miR167b UGAAGCUGCCAGCAUGAUCUA 21 644 46 123 4    23 31 69 53 81 68 91 123 13 48 4 19 11 10
sbi-miR167c UGAAGCUGCCAGCAUGAUCUG 21 277,241 19,803 139,043 3    133,150 139,043 7 8 3 4 17 12 150 200 666 814 1,832 1,335
sbi-miR167d UGAAGCUGCCAGCAUGAUCUG 21 277,241 19,803 139,043 3    133,150 139,043 7 8 3 4 17 12 150 200 666 814 1,832 1,335
sbi-miR167e UGAAGCUGCCAGCAUGAUCUG 21 277,241 19,803 139,043 3    133,150 139,043 7 8 3 4 17 12 150 200 666 814 1,832 1,335
sbi-miR167f UGAAGCUGCCAGCAUGAUCUG 21 277,241 19,803 139,043 3    133,150 139,043 7 8 3 4 17 12 150 200 666 814 1,832 1,335
sbi-miR167g UGAAGCUGCCAGCAUGAUCUG 21 277,241 19,803 139,043 3    133,150 139,043 7 8 3 4 17 12 150 200 666 814 1,832 1,335
sbi-miR167h UGAAGCUGCCAGCAUGAUCUG 21 277,241 19,803 139,043 3    133,150 139,043 7 8 3 4 17 12 150 200 666 814 1,832 1,335
sbi-miR167i UGAAGCUGCCAGCAUGAUCUA 21 644 46 123 4    23 31 69 53 81 68 91 123 13 48 4 19 11 10
sbi-miR168 UCGCUUGGUGCAGAUCGGGAC 21 745,481 53,249 151,730 13,401    151,730 126,232 13,401 23,808 21,715 28,779 33,800 24,274 76,004 33,244 54,122 42,120 55,474 60,778
sbi-miR169a CAGCCAAGGAUGACUUGCCGA 21 62 4 31 1    2 31 0 1 1 8 1 3 1 1 2 2 6 3
sbi-miR169b CAGCCAAGGAUGACUUGCCGG 21 23 2 6 1    6 6 0 0 1 0 0 1 0 3 1 0 4 1
sbi-miR169c UAGCCAAGGAUGACUUGCCUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR169d-3p GGGCGGUCACCUUGGCUAGC 20 604 43 99 4    74 94 4 21 11 7 17 18 41 39 49 51 79 99
sbi-miR169d-5p UAGCCAAGGAUGACUUGCCU 20 81 6 23 1    23 17 0 5 7 6 6 1 2 3 6 1 3 1
sbi-miR169e UAGCCAAGGAUGACUUGCCGG 21 174 12 43 1    0 0 0 27 26 28 23 43 1 12 6 4 3 1
sbi-miR169f UAGCCAAGGAUGACUUGCCUG 21 71 5 14 1    4 14 2 8 1 7 2 4 3 1 5 3 9 8
sbi-miR169g UAGCCAAGGAUGACUUGCCUG 21 71 5 14 1    4 14 2 8 1 7 2 4 3 1 5 3 9 8
sbi-miR169h UAGCCAAGGAUGACUUGCCUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR169i UAGCCAAGAAUGACUUGCCUA 21 1 0 1 1    0 0 0 0 0 0 0 0 0 0 1 0 0 0
sbi-miR169j UAGCCAAGGAUGACUUGCCGG 21 174 12 43 1    0 0 0 27 26 28 23 43 1 12 6 4 3 1
sbi-miR169k CAGCCAAGGAUGACUUGCCGG 21 23 2 6 1    6 6 0 0 1 0 0 1 0 3 1 0 4 1
sbi-miR169l UAGCCAAGGAUGACUUGCCUG 21 71 5 14 1    4 14 2 8 1 7 2 4 3 1 5 3 9 8
sbi-miR169m UAGCCAAGGAUGACUUGCCUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR169n UAGCCAAGGAUGACUUGCCUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR169o UAGCCAAGGAUGAUUUGCCUG 21 4 0 2 1    2 0 0 0 1 0 0 1 0 0 0 0 0 0
sbi-miR169p UAGCCAAGAAUGGCUUGCCUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR169q UAGCCAAGAAUGGCUUGCCUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR171a UGAUUGAGCCGUGCCAAUAUC 21 1,168 83 329 16    263 329 51 28 45 60 77 92 23 85 30 20 49 16
sbi-miR171b UGAUUGAGCCGUGCCAAUAUC 21 1,168 83 329 16    263 329 51 28 45 60 77 92 23 85 30 20 49 16
sbi-miR171c GAGGUGAGCCGAGCCAAUAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR171d UGAUUGAGCCGUGCCAAUAUC 21 1,168 83 329 16    263 329 51 28 45 60 77 92 23 85 30 20 49 16
sbi-miR171e GUGAGCCGAACCAAUAUCACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR171f AUGAGCCGAACCAAUAUCACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR171g UGAUUGAGCCGCGCCAAUAUC 21 4 0 3 1    0 3 0 0 0 0 0 0 0 0 0 0 0 1
sbi-miR171h GGAUUGAGCCGCGUCAAUAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR171i UGAUUGAGCCGUGCCAAUAUC 21 1,168 83 329 16    263 329 51 28 45 60 77 92 23 85 30 20 49 16
sbi-miR171j UGAUUGAGCCGCGCCAAUAUC 21 4 0 3 1    0 3 0 0 0 0 0 0 0 0 0 0 0 1
sbi-miR171k UGAUUGAGCCGUGCCAAUAUC 21 1,168 83 329 16    263 329 51 28 45 60 77 92 23 85 30 20 49 16
sbi-miR172a AGAAUCUUGAUGAUGCUGCA 20 36 3 17 1    8 17 0 1 3 2 0 1 0 0 2 2 0 0
sbi-miR172b GGAAUCUUGAUGAUGCUGCA 20 15 1 4 1    0 0 2 4 2 1 2 1 0 0 0 2 0 1
sbi-miR172c AGAAUCUUGAUGAUGCUGCA 20 36 3 17 1    8 17 0 1 3 2 0 1 0 0 2 2 0 0
sbi-miR172d AGAAUCUUGAUGAUGCUGCA 20 36 3 17 1    8 17 0 1 3 2 0 1 0 0 2 2 0 0
sbi-miR172e UGAAUCUUGAUGAUGCUGCAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR172f AGAAUCCUGAUGAUGCUGCAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR2118-3p UUCCUGAUGCCUCCCAUGCCUA 22 1,537 110 555 5    11 14 0 5 8 6 35 103 217 555 135 212 131 105
sbi-miR2118-5p GGCAUGGGAACAUGUAGGAAGG 22 184 13 64 6    0 0 0 0 0 0 15 7 64 39 12 28 6 13
sbi-miR319a UUGGACUGAAGGGUGCUCCC 20 37,335 2,667 15,319 71    71 80 15,319 3,604 4,401 3,125 2,384 3,075 314 1,863 685 682 1,135 597
sbi-miR319b UUGGACUGAAGGGUGCUCCC 20 37,335 2,667 15,319 71    71 80 15,319 3,604 4,401 3,125 2,384 3,075 314 1,863 685 682 1,135 597
sbi-miR390 AAGCUCAGGAGGGAUAGCGCC 21 8,513 608 1,482 132    189 247 1,339 1,056 987 1,482 819 1,163 196 434 151 132 159 159
sbi-miR393a UCCAAAGGGAUCGCAUUGAUC 21 2,697 193 1,073 3    856 1,073 0 12 3 26 56 79 32 141 96 62 176 85
sbi-miR393b UCCAAAGGGAUCGCAUUGAUC 21 2,697 193 1,073 3    856 1,073 0 12 3 26 56 79 32 141 96 62 176 85
sbi-miR394a UUGGCAUUCUGUCCACCUCC 20 2,542 182 503 44    448 503 89 173 141 240 145 239 48 209 44 67 134 62
sbi-miR394b UUGGCAUUCUGUCCACCUCC 20 2,542 182 503 44    448 503 89 173 141 240 145 239 48 209 44 67 134 62
sbi-miR395a GUGAAGUGUUUGGGGGAACUC 21 2 0 1 1    0 0 0 0 0 1 0 0 0 0 0 0 0 1
sbi-miR395b GUGAAGUGUUUGGGGGAACUC 21 2 0 1 1    0 0 0 0 0 1 0 0 0 0 0 0 0 1
sbi-miR395c GUGAAGUGUUUGGGGGAACUC 21 2 0 1 1    0 0 0 0 0 1 0 0 0 0 0 0 0 1
sbi-miR395d GUGAAGUGUUUGGGGGAACUC 21 2 0 1 1    0 0 0 0 0 1 0 0 0 0 0 0 0 1
sbi-miR395e GUGAAGUGUUUGGGGGAACUC 21 2 0 1 1    0 0 0 0 0 1 0 0 0 0 0 0 0 1
sbi-miR395f AUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR395g GUGAAGUGUUUGGGGGAACUC 21 2 0 1 1    0 0 0 0 0 1 0 0 0 0 0 0 0 1
sbi-miR395h GUGAAGUGUUUGGGGGAACUC 21 2 0 1 1    0 0 0 0 0 1 0 0 0 0 0 0 0 1
sbi-miR395i GUGAAGUGUUUGGGGGAACUC 21 2 0 1 1    0 0 0 0 0 1 0 0 0 0 0 0 0 1
sbi-miR395j GUGAAGUGUUUGGGGGAACUC 21 2 0 1 1    0 0 0 0 0 1 0 0 0 0 0 0 0 1
sbi-miR395k GUGAAGUGUUUGGAGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR395l GUGAAGUGCUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR396a UUCCACAGCUUUCUUGAACUG 21 32,290 2,306 5,428 574    2,284 2,237 806 795 1,015 1,826 2,459 4,069 574 5,428 2,032 1,741 4,908 2,116
sbi-miR396b UUCCACAGCUUUCUUGAACUG 21 32,290 2,306 5,428 574    2,284 2,237 806 795 1,015 1,826 2,459 4,069 574 5,428 2,032 1,741 4,908 2,116
sbi-miR396c UUCCACAGCUUUCUUGAACUU 21 494,845 35,346 223,246 55    223,246 218,408 442 55 94 470 483 987 3,627 7,931 6,984 7,771 14,543 9,804
sbi-miR396d CUCCACAGGCUUUCUUGAACUG 22 116 8 46 3    46 43 0 0 0 0 0 0 0 0 3 5 13 6
sbi-miR396e UUCCACAGGCUUUCUUGAACUG 22 130 9 57 1    57 45 0 0 0 1 0 1 2 3 1 7 11 2
sbi-miR397-3p UCACCGGCGCUGCACUCAAUU 21 13,117 937 6,454 44    5,484 6,454 237 55 58 98 49 89 44 120 81 97 150 101
sbi-miR397-5p UCAUUGAGUGCAGCGUUGAUG 21 48 3 23 1    21 23 0 0 1 0 0 1 1 0 1 0 0 0
sbi-miR398 UGUGUUCUCAGGUCGCCCCCG 21 5,035 360 2,868 2    1,960 2,868 51 16 30 27 2 30 5 17 5 5 9 10
sbi-miR399a UGCCAAAGGAGAAUUGCCCUG 21 50 4 19 1    19 11 0 0 0 2 2 4 1 0 4 3 2 2
sbi-miR399b UGCCAAAGGAGAGCUGCCCUG 21 21 2 13 1    13 3 0 0 1 0 0 3 0 0 1 0 0 0
sbi-miR399c UGCCAAAGGAGAAUUGCCCUG 21 50 4 19 1    19 11 0 0 0 2 2 4 1 0 4 3 2 2
sbi-miR399d UGCCAAAGGAGAGUUGCCCUG 21 3,576 255 1,663 2    1,663 1,397 2 11 51 26 58 59 35 59 48 62 57 48
sbi-miR399e UGCCAAAGGAGAUUUGCCCAG 21 47 3 20 1    0 0 0 0 1 0 0 0 1 0 14 20 7 4
sbi-miR399f UGCCAAAGGAGAUUUGCCCAG 21 47 3 20 1    0 0 0 0 1 0 0 0 1 0 14 20 7 4
sbi-miR399g UGCCAAAGGAAAUUUGCCCCG 21 53 4 29 1    29 17 2 1 0 0 0 1 0 1 0 2 0 0
sbi-miR399h UGCCAAAGGAGAAUUGCCCUG 21 50 4 19 1    19 11 0 0 0 2 2 4 1 0 4 3 2 2
sbi-miR399i UGCCAAAGGAGAGUUGCCCUG 21 3,576 255 1,663 2    1,663 1,397 2 11 51 26 58 59 35 59 48 62 57 48
sbi-miR399j UGCCAAAGGAGAAUUGCCCUG 21 50 4 19 1    19 11 0 0 0 2 2 4 1 0 4 3 2 2
sbi-miR399k UGCCAAAGGGGAUUUGCCCGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR408 CUGCACUGCCUCUUCCCUGGC 21 38,279 2,734 21,392 17    16,380 21,392 56 24 89 103 34 61 17 35 18 19 19 32
sbi-miR437a AAAGUUAGAGAAGUUUGACUU 21 23 2 9 1    2 9 0 1 5 4 0 1 1 0 0 0 0 0
sbi-miR437b AAAGUUAGAGAAGUUUGACUU 21 23 2 9 1    2 9 0 1 5 4 0 1 1 0 0 0 0 0
sbi-miR437c AAAGUUAGAGAAGUUUGACUU 21 23 2 9 1    2 9 0 1 5 4 0 1 1 0 0 0 0 0
sbi-miR437d AAAGUUAGAGAAGUUUGACUU 21 23 2 9 1    2 9 0 1 5 4 0 1 1 0 0 0 0 0
sbi-miR437e AAAGUUAGAGAAGUUUGACUU 21 23 2 9 1    2 9 0 1 5 4 0 1 1 0 0 0 0 0
sbi-miR437f AAAGUUAGAGAAGUUUGACUU 21 23 2 9 1    2 9 0 1 5 4 0 1 1 0 0 0 0 0
sbi-miR437g AAAGUUAGAGAAGUUUGACUU 21 23 2 9 1    2 9 0 1 5 4 0 1 1 0 0 0 0 0
sbi-miR437i AAAGUUAGAGAAGUUUGACUU 21 23 2 9 1    2 9 0 1 5 4 0 1 1 0 0 0 0 0
sbi-miR437j AAAGUUAGAGAAGUUUGACUU 21 23 2 9 1    2 9 0 1 5 4 0 1 1 0 0 0 0 0
sbi-miR437k AAAGUUAGAGAAGUUUGACUU 21 23 2 9 1    2 9 0 1 5 4 0 1 1 0 0 0 0 0
sbi-miR437l AAAGUUAGAGAAGUUUGACUU 21 23 2 9 1    2 9 0 1 5 4 0 1 1 0 0 0 0 0
sbi-miR437m AAAGUUAGAGAAGUUUGACUU 21 23 2 9 1    2 9 0 1 5 4 0 1 1 0 0 0 0 0
sbi-miR437n AAAGUUAGAGAAGUUUGACUU 21 23 2 9 1    2 9 0 1 5 4 0 1 1 0 0 0 0 0
sbi-miR437o AAAGUUAGAGAAGUUUGACUU 21 23 2 9 1    2 9 0 1 5 4 0 1 1 0 0 0 0 0
sbi-miR437p AAAGUUAGAGAAGUUUGACUU 21 23 2 9 1    2 9 0 1 5 4 0 1 1 0 0 0 0 0
sbi-miR437q AAAGUUAGAGAAGUUUGACUU 21 23 2 9 1    2 9 0 1 5 4 0 1 1 0 0 0 0 0
sbi-miR437r AAAGUUAGAGAAGUUUGACUU 21 23 2 9 1    2 9 0 1 5 4 0 1 1 0 0 0 0 0
sbi-miR437s AAAGUUAGAGAAGUUUGACUU 21 23 2 9 1    2 9 0 1 5 4 0 1 1 0 0 0 0 0
sbi-miR437t AAAGUUAGAGAAGUUUGACUU 21 23 2 9 1    2 9 0 1 5 4 0 1 1 0 0 0 0 0
sbi-miR437u AAAGUUAGAGAAGUUUGACUU 21 23 2 9 1    2 9 0 1 5 4 0 1 1 0 0 0 0 0
sbi-miR437v AAAGUUAGAGAAGUUUGACUU 21 23 2 9 1    2 9 0 1 5 4 0 1 1 0 0 0 0 0
sbi-miR437w AAAGUUAGAGAAGUUUGACUU 21 23 2 9 1    2 9 0 1 5 4 0 1 1 0 0 0 0 0
sbi-miR437x-3p AUUUGACUGACACGGAUUCUAGGA 24 63 5 18 1    4 3 4 3 18 7 2 4 3 4 3 4 3 1
sbi-miR437x-5p UAGAGUUGUCCUAAGUCAAACUUU 24 3 0 1 1    0 0 0 0 0 1 1 0 0 0 0 0 0 1
sbi-miR528 UGGAAGGGGCAUGCAGAGGAG 21 2,426 173 1,212 12    919 1,212 29 12 30 37 16 21 24 26 14 30 21 35
sbi-miR529 CUGUACCCUCUCUCUUCUUC 20 90 6 21 3    0 0 0 3 3 6 16 10 21 10 5 6 7 3
sbi-miR5381 AAGAUCUGUGGCGCCGAGC 19 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR5382 CCAAUCUAAACAGGCCCU 18 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR5383 AUGACAGAGCUCCGGCAGAGAUAU 24 37 3 6 1    0 3 4 4 2 4 1 6 3 0 4 0 3 3
sbi-miR5384 CGCGCCGCCGUCCAGCGG 18 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR5385 ACCACCAACCCCACCGCUUCUC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR5386 CGUCGCUGUCGCGCGCGCUG 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR5387a UAACACGAACCGGUGCUAAAGGAUC 25 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR5387b CGUGGCUCUGACCGGUGCUAAAGG 24 3 0 1 1    0 0 0 0 0 1 0 0 1 0 0 0 1 0
sbi-miR5388 AUCUUUGCCGGGUGUCUCUGAC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR5389 GCUUGAGUUUAUCAGCCGAGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR5564a UGGGGAAGCAAUUCGUCGAACA 22 10 1 3 1    0 3 0 0 0 1 1 1 0 0 1 0 3 0
sbi-miR5564b GCAAUUCGUCGAACAGCUUGA 21 8 1 4 1    4 0 0 0 0 0 0 1 1 0 0 1 0 1
sbi-miR5564c-3p ACGCGAGCUGUUUGGCGAAUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR5564c-5p AAUUCGUCGAACAGCUGCAGC 21 1 0 1 1    0 0 0 0 0 0 0 0 0 1 0 0 0 0
sbi-miR5565a AACACAUGUGGAUUGAGGCGAAUC 24 36 3 11 1    11 0 2 1 3 5 2 6 0 4 0 1 1 0
sbi-miR5565b AACACAUGUGGAUUGAGGCGAAUC 24 36 3 11 1    11 0 2 1 3 5 2 6 0 4 0 1 1 0
sbi-miR5565c UACACAUGUGGAUUGAGGUGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR5565d ACUUCAAUCCAUGUAUGUUGGUGU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR5565e UUGUUUGGAUGUUGUCGGA 19 3 0 1 1    0 0 0 0 1 0 1 0 0 0 0 0 1 0
sbi-miR5565f UAGUCGGAUUUAUAUCAAUC 20 2 0 1 1    0 0 0 0 0 0 0 1 0 1 0 0 0 0
sbi-miR5565g-3p ACACAUGUGGAUUGAGAUGAAUAC 24 9 1 3 1    0 0 0 3 2 3 0 0 0 1 0 0 0 0
sbi-miR5565g-5p UUCACAUCAAUCCACAUAUGUUGG 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR5566 UCAGCAUCACCUCCCUGUUGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR5567 UUAAUGAUUCAUGUAUGUGUCCAA 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR5568a CAGAGCGACUUACAAUUUGGA 21 41 3 9 1    0 0 9 3 0 3 5 1 4 4 3 1 2 6
sbi-miR5568b-3p ACUAUGUAUCUAGAAAAGCUA 21 13 1 9 1    0 9 0 0 1 0 2 0 0 0 0 0 1 0
sbi-miR5568b-5p UUUCUAGGUACAUAGCUUUUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR5568c-3p ACUUACAGUUUGGAACGGAGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR5568c-5p UCUGUUCCAAAUUGUAAGUCG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR5568d-3p AAAGUUGUGUAUCUAGAAAAG 21 2 0 2 2    2 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR5568d-5p UGGCUUUUCUAGAUACAUAGC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR5568e-3p UAUCUAGAAAAGCUAAAACGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR5568e-5p GAUGUUUUGGGUUUUCUAGAU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR5568f-3p GUCUUAUAAUUUGGAAUGGAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR5568f-5p UCCAUUCCAAAUUGUAAGAUG 21 36 3 8 1    8 0 2 4 1 0 2 3 1 3 3 6 1 2
sbi-miR5568g-3p AAAACGUCUUAUAAUUUGGAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR5568g-5p CAAAUUAUAAGAUGUUUUGGC 21 221 16 41 4    0 6 4 21 8 17 18 9 41 19 20 16 20 22
sbi-miR5569 UAUUGCAUGCUUGAACUAUGGUAA 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR5570 AAAAGACAAAUCAGCAUGUCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR6217a-3p AAAAUUAUCGUAAAUAGAGGUGGC 24 47 3 10 1    0 0 0 3 2 4 2 7 10 1 2 7 4 5
sbi-miR6217a-5p UAGCCACUUUGAGUUACGAUAAUU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR6217b-3p AAAAUUAUCGUAAAUAGAGGUGGC 24 47 3 10 1    0 0 0 3 2 4 2 7 10 1 2 7 4 5
sbi-miR6217b-5p UAGCCACUUUGAGUUACGAUAAUU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR6218-3p ACAAGUUUCGUGAUUUUUGGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR6218-5p CGAAAAUCACGAAACUUGUCG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR6219-3p AGUCCCGAAACCUUAGUCCCGGCU 24 1 0 1 1    0 0 0 0 0 1 0 0 0 0 0 0 0 0
sbi-miR6219-5p GAACCGGGACUAAAGGUGGGACAU 24 5 0 3 1    0 0 0 1 1 3 0 0 0 0 0 0 0 0
sbi-miR6220-3p AUGCCUUAUAAUUUGGGAUGGAGA 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR6220-5p CUCCAUCCUAAAUUAUAAGACAUU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR6221-3p CCGGGGCCAGAUCUCAGAAGC 21 5 0 2 1    0 0 0 0 0 0 2 0 1 0 0 0 2 0
sbi-miR6221-5p UUCUGACUUCUGGCCCCUGCU 21 34 2 15 1    15 9 0 3 1 0 0 0 2 0 1 2 0 1
sbi-miR6222-3p CUAGCUGAUCCAAACAGGCCC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR6222-5p CCUGUUUGGAUCAGCCAAGGC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR6223-3p CUAGCAUGUUCCUCCUAAGAG 21 97 7 16 3    11 6 16 7 5 5 8 7 4 3 7 8 4 6
sbi-miR6223-5p UUCUUGGGAGGAGCAUGCUAG 21 12 1 3 1    0 3 0 1 1 1 0 1 0 1 2 0 1 1
sbi-miR6224a-3p CUUAUAUACUAGGACGGAGGG 21 2 0 1 1    0 0 0 0 0 0 0 0 0 0 1 0 0 1
sbi-miR6224a-5p CUCCGUCCUAAUAUAUAAGGC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR6224b-3p CUUAUAUACUAGGACGGAGGG 21 2 0 1 1    0 0 0 0 0 0 0 0 0 0 1 0 0 1
sbi-miR6224b-5p CUCCGUCCUAAUAUAUAAGGC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR6224c-3p CUUAUAUACUAGGACGGAGGG 21 2 0 1 1    0 0 0 0 0 0 0 0 0 0 1 0 0 1
sbi-miR6224c-5p CUCCGUCCUAAUAUAUAAGGC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR6225-3p GAAACGAAUCUUUUAAGUCUAAUU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR6225-5p AACUAGACUCAAAAGAUUCAUCUC 24 465 33 67 12    67 60 49 35 50 43 17 34 15 19 20 25 19 12
sbi-miR6226-3p GAUUAGUCACGAUUAGUCGUCCGA 24 4 0 4 4    4 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR6226-5p AGAUCGGACGACUAAUCGCGAUUA 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR6227-3p CUCACAACACUUGCUAUUUGGG 22 4 0 1 1    0 0 0 0 0 0 1 0 1 0 1 1 0 0
sbi-miR6227-5p GGGCCCAAAUAGCAAGUGUUGUGA 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR6228-3p GUGGCAGUAGAAUUAAUGAAGGGA 24 544 39 58 22    53 48 33 29 46 36 47 27 58 39 41 28 37 22
sbi-miR6228-5p UUCUAUCUCUAUUAAUUGUGUUGC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR6229-3p GUUUUUCUCGCCGGGUGAGAAGGC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR6229-5p AUUCUCACUUGGGCGACGGAAAGG 24 10 1 7 3    0 0 0 3 0 0 0 7 0 0 0 0 0 0
sbi-miR6230-3p UAACAAGUUUAGGGAUCUAGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR6230-5p UUUUGGGUCCCUAAACUUGUU 21 8 1 4 1    4 0 0 1 1 0 1 0 0 0 0 0 1 0
sbi-miR6231-3p UAUUUGUGGACUCAUGGACAU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR6231-5p GUCCGUGAGUCCACAAAUAGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR6232a-3p UGGAUGUACCAAAAAAGUCAAAGC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR6232a-5p GUCGCUUUGACUUUUUUGGUACAU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR6232b-3p AAUUCGAUGUACCAAAAAAGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR6232b-5p UUUUUGGUACAUUGAAUUUGC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR6233-3p CAAGUUUGGUUUUGGUAAUUAAUG 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR6233-5p UGUUGAGGCUGGAGCGAAACUCGG 24 3 0 1 1    0 0 0 1 0 0 0 1 0 0 1 0 0 0
sbi-miR6234a-3p UUAGCGUCAAGAGACGAACACACU 24 265 19 47 3    15 26 13 31 32 47 22 36 3 14 6 8 7 5
sbi-miR6234a-5p AAGUGUGUUCCUCUAUUUGACGCU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR6234b-3p UUAGCGUCAAGAGACGAACACACU 24 265 19 47 3    15 26 13 31 32 47 22 36 3 14 6 8 7 5
sbi-miR6234b-5p AAGUGUGUUCCUCUAUUUGACGCU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR6235-3p AACGAACAGUAUUUUUCUCUUACA 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR6235-5p UUGUGAGAGAAAAAUACUGUUGGC 24 5 0 1 1    0 0 0 0 0 1 1 0 0 0 0 1 1 1
sbi-miR821a AAGUCAUCAACAUAAAAGUUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR821b AAGUUAUGAACAUAAAAGUUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR821c AAGUCAUCAACAUAAAAGUUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR821d AAGUCAUCAACAACAAAGUUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
sbi-miR821e AAGUCAUCAAAAUAAAAGUUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0