Potato miRNA Abundances

The data below are based on the microRNAs listed in the Sanger registry. Adjust libraries/reads to display on the control panel.

        

        miRNA         miRNA sequence Len Sum (norm) Average Max Min (>0)  RNA_Stu_c5_STS3aRNA_Stu_c5_STS3bRNA_Stu_c5_STS2aRNA_Stu_c5_STS2bRNA_Stu_c5_STS1aRNA_Stu_c5_STS1bRNA_Stu_c5_SS3aRNA_Stu_c5_SS3bRNA_Stu_c5_SS2aRNA_Stu_c5_SS2bRNA_Stu_c5_SS1aRNA_Stu_c5_SS1bRNA_Stu_c5_LL3aRNA_Stu_c5_LL3bRNA_Stu_c5_LL2aRNA_Stu_c5_LL1aRNA_Stu_c5_LS1aRNA_Stu_c5_LS1bRNA_Stu_c5_LS2aRNA_Stu_c5_LS2bRNA_Stu_c5_LS3aRNA_Stu_c5_LS3bRNA_Stu_c6_T20CRNA_Stu_c6_T4CSTU1STU2STU3sRNA_STub_c1_t2sRNA_STub_c1_t1sRNA_STub_c1_le2sRNA_STub_c1_l1sRNA_Stub_c3_PEGsRNA_STov_c1_cosRNA_STov_c1_6sRNA_STov_c1_12sRNA_STov_c1_18sRNA_GAF23sRNA_GAF46sRNA_GAF48sRNA_GAF49sRNA_GAF63sRNA_GAF64sRNA_GAF75sRNA_GAF40sRNA_GAF36sRNA_GAF66sRNA_GAF62sRNA_GAF35sRNA_GAF52sRNA_GAF50sRNA_GAF42sRNA_GAF57sRNA_GAF38sRNA_GAF74sRNA_GAF26sRNA_GAF72sRNA_GAF25sRNA_GAF41sRNA_GAF24sRNA_GAF47sRNA_GAF32sRNA_GAF51sRNA_GAF58sRNA_GAF37sRNA_GAF56sRNA_GAF61sRNA_GAF65sRNA_GAF120sRNA_GAF119sRNA_GAF117sRNA_GAF45sRNA_GAF127
stu-miR156a UUGACAGAAGAUAGAGAGCAC 21 299,353 4,158 89,214 147    304 370 499 486 801 1,063 3,060 3,431 2,432 2,709 1,073 1,037 953 1,384 147 391 755 717 1,291 1,643 1,150 1,205 299 205 89,214 5,284 2,909 365 252 350 339 7,332 14,501 5,688 5,564 5,792 6,938 631 1,261 992 733 2,927 1,856 1,469 2,505 2,005 397 3,244 429 1,502 517 2,004 5,170 9,251 4,974 2,509 10,511 4,295 29,166 2,496 880 1,510 4,261 2,818 1,836 3,350 940 5,546 4,038 3,921 1,556 5,920
stu-miR156b UUGACAGAAGAUAGAGAGCAC 21 299,353 4,158 89,214 147    304 370 499 486 801 1,063 3,060 3,431 2,432 2,709 1,073 1,037 953 1,384 147 391 755 717 1,291 1,643 1,150 1,205 299 205 89,214 5,284 2,909 365 252 350 339 7,332 14,501 5,688 5,564 5,792 6,938 631 1,261 992 733 2,927 1,856 1,469 2,505 2,005 397 3,244 429 1,502 517 2,004 5,170 9,251 4,974 2,509 10,511 4,295 29,166 2,496 880 1,510 4,261 2,818 1,836 3,350 940 5,546 4,038 3,921 1,556 5,920
stu-miR156c UUGACAGAAGAUAGAGAGCAC 21 299,353 4,158 89,214 147    304 370 499 486 801 1,063 3,060 3,431 2,432 2,709 1,073 1,037 953 1,384 147 391 755 717 1,291 1,643 1,150 1,205 299 205 89,214 5,284 2,909 365 252 350 339 7,332 14,501 5,688 5,564 5,792 6,938 631 1,261 992 733 2,927 1,856 1,469 2,505 2,005 397 3,244 429 1,502 517 2,004 5,170 9,251 4,974 2,509 10,511 4,295 29,166 2,496 880 1,510 4,261 2,818 1,836 3,350 940 5,546 4,038 3,921 1,556 5,920
stu-miR156d-3p GCUCUCUAUGCUUCUGUCAUCA 22 2,327 43 693 1    6 0 11 0 6 0 18 0 16 37 0 10 7 0 0 0 13 0 6 11 6 10 0 0 2 0 0 0 0 2 2 1 8 10 12 7 28 23 44 9 3 5 21 111 6 328 12 20 0 16 9 13 0 13 693 59 0 8 3 51 4 3 49 14 17 15 4 9 5 25 83 423
stu-miR156d-5p UUGACAGAAGAUAGAGAGCAC 21 299,353 4,158 89,214 147    304 370 499 486 801 1,063 3,060 3,431 2,432 2,709 1,073 1,037 953 1,384 147 391 755 717 1,291 1,643 1,150 1,205 299 205 89,214 5,284 2,909 365 252 350 339 7,332 14,501 5,688 5,564 5,792 6,938 631 1,261 992 733 2,927 1,856 1,469 2,505 2,005 397 3,244 429 1,502 517 2,004 5,170 9,251 4,974 2,509 10,511 4,295 29,166 2,496 880 1,510 4,261 2,818 1,836 3,350 940 5,546 4,038 3,921 1,556 5,920
stu-miR156e UGACAGAAGAGAGUGAGCAC 20 9,694 137 2,379 5    50 12 33 44 57 89 279 464 180 147 107 122 47 49 10 36 46 34 65 114 31 63 100 82 2,379 229 978 286 162 10 7 353 40 63 50 100 50 42 20 50 23 99 53 16 19 5 16 179 23 21 18 66 86 120 61 29 39 76 5 21 0 28 34 38 34 46 9 455 369 287 134 205
stu-miR156f-3p CUCACUUCUCUUUCUGUCAAUC 22 61 6 18 1    0 0 0 0 0 0 4 0 4 18 0 0 0 0 0 0 0 0 6 0 6 0 0 0 0 0 0 0 1 3 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 0 10 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4
stu-miR156f-5p CUGACAGAAGAGAGUGAGCA 20 5,531 84 956 1    22 0 11 66 34 44 35 139 51 92 67 92 20 29 5 5 26 25 41 11 6 10 50 123 956 141 562 5 2 7 6 717 0 0 1 0 33 35 104 125 151 114 37 51 3 68 116 56 68 74 9 109 36 25 86 18 37 72 9 221 27 20 44 14 73 15 176 13 40 0 0 51
stu-miR156g-3p GCUUACUCUCUAUCUGUCACC 21 724 20 93 1    6 12 33 29 11 9 35 93 55 55 6 20 0 0 0 0 7 8 12 23 6 0 0 0 2 1 2 31 18 1 1 1 0 0 0 0 1 0 2 0 0 0 11 0 0 0 0 0 0 0 0 0 0 6 0 0 0 0 0 4 0 0 0 0 6 5 0 52 50 40 40 30
stu-miR156g-5p UGACAGAAGAGAGUGAGCAC 20 9,694 137 2,379 5    50 12 33 44 57 89 279 464 180 147 107 122 47 49 10 36 46 34 65 114 31 63 100 82 2,379 229 978 286 162 10 7 353 40 63 50 100 50 42 20 50 23 99 53 16 19 5 16 179 23 21 18 66 86 120 61 29 39 76 5 21 0 28 34 38 34 46 9 455 369 287 134 205
stu-miR156h-3p GCUCACUGCUCUAUCUGUCACC 22 410 16 55 1    0 0 0 7 0 18 40 46 4 55 0 20 0 0 0 0 0 0 0 0 0 21 0 0 0 0 1 32 23 1 1 1 18 29 28 11 0 0 0 0 0 0 2 0 0 0 0 0 0 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 13 5 5 11 13
stu-miR156h-5p UGACAGAAGAGAGUGAGCAC 20 9,694 137 2,379 5    50 12 33 44 57 89 279 464 180 147 107 122 47 49 10 36 46 34 65 114 31 63 100 82 2,379 229 978 286 162 10 7 353 40 63 50 100 50 42 20 50 23 99 53 16 19 5 16 179 23 21 18 66 86 120 61 29 39 76 5 21 0 28 34 38 34 46 9 455 369 287 134 205
stu-miR156i-3p GCUCACUGCUCUAUCUGUCACC 22 410 16 55 1    0 0 0 7 0 18 40 46 4 55 0 20 0 0 0 0 0 0 0 0 0 21 0 0 0 0 1 32 23 1 1 1 18 29 28 11 0 0 0 0 0 0 2 0 0 0 0 0 0 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 13 5 5 11 13
stu-miR156i-5p UGACAGAAGAGAGUGAGCAC 20 9,694 137 2,379 5    50 12 33 44 57 89 279 464 180 147 107 122 47 49 10 36 46 34 65 114 31 63 100 82 2,379 229 978 286 162 10 7 353 40 63 50 100 50 42 20 50 23 99 53 16 19 5 16 179 23 21 18 66 86 120 61 29 39 76 5 21 0 28 34 38 34 46 9 455 369 287 134 205
stu-miR156j-3p GCUCACUGCUCUAUCUGUCACC 22 410 16 55 1    0 0 0 7 0 18 40 46 4 55 0 20 0 0 0 0 0 0 0 0 0 21 0 0 0 0 1 32 23 1 1 1 18 29 28 11 0 0 0 0 0 0 2 0 0 0 0 0 0 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 13 5 5 11 13
stu-miR156j-5p UGACAGAAGAGAGUGAGCAC 20 9,694 137 2,379 5    50 12 33 44 57 89 279 464 180 147 107 122 47 49 10 36 46 34 65 114 31 63 100 82 2,379 229 978 286 162 10 7 353 40 63 50 100 50 42 20 50 23 99 53 16 19 5 16 179 23 21 18 66 86 120 61 29 39 76 5 21 0 28 34 38 34 46 9 455 369 287 134 205
stu-miR156k-3p GCUCACUGCUCUAUCUGUCACC 22 410 16 55 1    0 0 0 7 0 18 40 46 4 55 0 20 0 0 0 0 0 0 0 0 0 21 0 0 0 0 1 32 23 1 1 1 18 29 28 11 0 0 0 0 0 0 2 0 0 0 0 0 0 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 13 5 5 11 13
stu-miR156k-5p UGACAGAAGAGAGUGAGCAC 20 9,694 137 2,379 5    50 12 33 44 57 89 279 464 180 147 107 122 47 49 10 36 46 34 65 114 31 63 100 82 2,379 229 978 286 162 10 7 353 40 63 50 100 50 42 20 50 23 99 53 16 19 5 16 179 23 21 18 66 86 120 61 29 39 76 5 21 0 28 34 38 34 46 9 455 369 287 134 205
stu-miR160a-3p GCGUAUGAGGAGCCAAGCAUA 21 1,646 46 675 1    0 0 11 22 29 53 84 162 78 184 39 71 7 0 0 10 0 17 6 11 12 10 0 0 8 2 4 0 1 4 5 675 8 6 2 1 0 0 0 0 0 0 0 39 0 5 0 12 0 0 0 0 0 0 10 0 0 0 0 0 0 0 0 0 0 0 0 4 0 5 2 47
stu-miR160a-5p UGCCUGGCUCCCUGUAUGCCA 21 4,573 90 582 1    11 72 11 15 6 9 124 162 113 258 135 132 423 324 162 198 150 211 359 582 336 283 0 0 10 59 42 0 0 2 1 1 135 115 22 2 0 4 2 3 2 0 7 4 6 5 8 4 0 5 3 4 0 0 0 6 0 0 0 0 8 0 0 0 11 10 0 0 10 0 6 0
stu-miR160b UGCCUGGCUCCCUGUAUGCCA 21 4,573 90 582 1    11 72 11 15 6 9 124 162 113 258 135 132 423 324 162 198 150 211 359 582 336 283 0 0 10 59 42 0 0 2 1 1 135 115 22 2 0 4 2 3 2 0 7 4 6 5 8 4 0 5 3 4 0 0 0 6 0 0 0 0 8 0 0 0 11 10 0 0 10 0 6 0
stu-miR162a-3p UCGAUAAACCUCUGCAUCCAG 21 162,021 2,348 17,228 5    3,501 4,135 6,745 7,180 15,869 17,228 11,294 12,682 11,304 13,216 5,274 6,466 2,952 2,915 710 1,400 2,045 1,932 3,966 3,742 3,168 3,247 0 0 589 185 383 393 302 509 416 151 1,640 1,872 1,060 343 159 204 175 135 240 176 505 529 539 606 88 610 68 311 234 210 223 585 233 283 0 676 5 47 175 270 225 90 281 204 378 967 235 396 164 2,981
stu-miR162a-5p GGAGGCAGCGGUUCAUCGAUC 21 5,435 89 2,285 1    55 84 33 74 114 177 102 46 86 147 62 61 34 29 10 30 0 25 24 46 18 31 0 0 2 1 10 2 1 108 84 91 6 12 9 3 0 4 4 0 23 21 5 190 3 504 136 12 8 5 28 9 0 0 157 112 0 8 0 17 0 8 152 38 28 5 26 4 15 0 11 2,285
stu-miR162b-3p UCGAUAAACCUCUGCAUCCAG 21 162,021 2,348 17,228 5    3,501 4,135 6,745 7,180 15,869 17,228 11,294 12,682 11,304 13,216 5,274 6,466 2,952 2,915 710 1,400 2,045 1,932 3,966 3,742 3,168 3,247 0 0 589 185 383 393 302 509 416 151 1,640 1,872 1,060 343 159 204 175 135 240 176 505 529 539 606 88 610 68 311 234 210 223 585 233 283 0 676 5 47 175 270 225 90 281 204 378 967 235 396 164 2,981
stu-miR162b-5p GGAGGCAGCGGUUCAUCGAUC 21 5,435 89 2,285 1    55 84 33 74 114 177 102 46 86 147 62 61 34 29 10 30 0 25 24 46 18 31 0 0 2 1 10 2 1 108 84 91 6 12 9 3 0 4 4 0 23 21 5 190 3 504 136 12 8 5 28 9 0 0 157 112 0 8 0 17 0 8 152 38 28 5 26 4 15 0 11 2,285
stu-miR164-3p CAUGUGCUCUAGCUCUCCAGC 21 88 11 34 1    6 0 0 22 34 18 0 0 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR164-5p UGGAGAAGCAGGGCACAUGCU 21 7 1 2 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 1 0 1 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0
stu-miR166a-3p UCGGACCAGGCUUCAUUCCCC 21 5,673,858 79,913 528,768 50    181,789 186,439 182,827 183,704 528,768 528,558 387,174 388,519 206,286 201,276 194,336 201,658 221,441 206,040 51,624 98,669 173,114 166,511 275,597 264,639 238,048 233,830 50 0 6,036 17,102 27,905 21,481 20,737 55,008 36,319 10,535 13,446 9,323 3,616 1,044 2,176 1,983 2,088 2,875 4,232 2,668 13,949 4,854 2,729 4,474 1,584 5,966 2,237 4,884 2,642 2,467 4,016 10,931 1,552 2,268 295 7,261 150 2,483 1,582 4,378 2,992 1,083 2,829 1,879 2,537 12,447 11,200 5,852 4,529 8,337
stu-miR166a-5p GGAAUGUUGUCUGGCUCGAGG 21 66,181 945 6,332 4    883 1,100 1,797 1,915 4,792 5,007 2,492 2,805 1,592 2,230 1,168 1,474 704 805 197 512 469 793 966 1,289 795 817 0 0 343 118 125 12 4 34 24 379 610 636 465 270 481 366 243 97 257 343 119 1,201 50 6,332 405 183 467 269 194 166 100 321 6,056 524 159 284 132 1,532 93 67 1,508 808 241 31 275 175 639 59 448 3,934
stu-miR166b UCGGACCAGGCUUCAUUCCUC 21 627,639 8,840 39,112 50    11,214 10,194 12,691 13,550 26,174 26,330 38,903 39,112 23,388 21,842 9,643 10,055 22,077 20,765 5,764 12,072 21,970 21,046 33,553 31,714 30,759 29,924 50 0 7,019 34,125 7,634 415 472 2,275 1,567 29,193 6,299 3,150 3,206 627 1,167 504 907 191 2,556 1,111 5,067 1,532 586 1,995 834 1,311 1,303 564 536 1,295 1,349 2,416 354 1,037 151 4,059 66 815 361 1,504 1,401 385 1,589 163 1,155 6,512 5,046 2,000 3,329 3,716
stu-miR166c-3p UCGGACCAGGCUUCAUUCCCC 21 5,673,858 79,913 528,768 50    181,789 186,439 182,827 183,704 528,768 528,558 387,174 388,519 206,286 201,276 194,336 201,658 221,441 206,040 51,624 98,669 173,114 166,511 275,597 264,639 238,048 233,830 50 0 6,036 17,102 27,905 21,481 20,737 55,008 36,319 10,535 13,446 9,323 3,616 1,044 2,176 1,983 2,088 2,875 4,232 2,668 13,949 4,854 2,729 4,474 1,584 5,966 2,237 4,884 2,642 2,467 4,016 10,931 1,552 2,268 295 7,261 150 2,483 1,582 4,378 2,992 1,083 2,829 1,879 2,537 12,447 11,200 5,852 4,529 8,337
stu-miR166c-5p GGAAUGUUGUUUGGCUCGAGG 21 270 11 76 1    11 0 0 7 34 44 4 0 4 0 6 10 0 0 0 0 0 0 0 0 0 0 0 0 1 2 2 0 0 0 0 1 1 9 5 3 0 0 0 0 0 0 5 8 0 5 0 0 0 0 3 0 0 0 76 0 2 0 0 0 0 0 0 14 0 0 0 0 0 0 0 13
stu-miR166d-3p UCGGACCAGGCUUCAUUCCCC 21 5,673,858 79,913 528,768 50    181,789 186,439 182,827 183,704 528,768 528,558 387,174 388,519 206,286 201,276 194,336 201,658 221,441 206,040 51,624 98,669 173,114 166,511 275,597 264,639 238,048 233,830 50 0 6,036 17,102 27,905 21,481 20,737 55,008 36,319 10,535 13,446 9,323 3,616 1,044 2,176 1,983 2,088 2,875 4,232 2,668 13,949 4,854 2,729 4,474 1,584 5,966 2,237 4,884 2,642 2,467 4,016 10,931 1,552 2,268 295 7,261 150 2,483 1,582 4,378 2,992 1,083 2,829 1,879 2,537 12,447 11,200 5,852 4,529 8,337
stu-miR166d-5p AGAAUGUCGUCUGGUUCGAGA 21 9,050 156 951 2    375 454 455 655 716 842 909 951 675 793 320 468 34 118 42 20 65 93 141 171 80 73 0 0 18 4 56 3 4 31 24 39 0 0 0 0 11 15 18 13 23 0 5 4 0 39 4 4 8 16 28 4 0 0 35 6 2 4 9 76 16 3 20 0 0 0 26 4 0 5 19 4
stu-miR167a-3p GAUCAUGUGGCAGCCUCACC 20 26 5 10 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 8 6 0 0 10 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR167a-5p UGAAGCUGCCAGCAUGAUCUA 21 109,160 1,559 26,085 1    0 0 11 37 46 35 111 139 121 92 39 81 335 363 120 167 287 549 530 707 349 398 100 82 13,586 26,085 617 1 1 8 7 2,560 267 115 48 28 1,872 916 776 1,502 1,481 1,578 3,639 2,113 3,271 1,897 726 4,284 1,416 1,291 979 1,321 1,358 5,154 2,811 1,107 147 4,858 153 1,834 1,547 2,022 872 385 1,089 2,133 1,206 2,029 1,193 896 667 615
stu-miR167b-3p GAUCAUGUGGCAGCAUCACC 20 611 17 80 1    6 0 0 7 0 9 22 0 43 0 11 10 20 29 2 20 20 17 18 80 55 42 0 0 3 0 1 0 1 2 1 2 49 38 9 37 0 0 2 0 0 0 0 4 3 20 0 0 0 0 3 0 0 6 10 0 0 0 0 4 0 0 0 0 0 5 0 0 0 0 0 0
stu-miR167b-5p UGAAGCUGCCAGCAUGAUCUA 21 109,160 1,559 26,085 1    0 0 11 37 46 35 111 139 121 92 39 81 335 363 120 167 287 549 530 707 349 398 100 82 13,586 26,085 617 1 1 8 7 2,560 267 115 48 28 1,872 916 776 1,502 1,481 1,578 3,639 2,113 3,271 1,897 726 4,284 1,416 1,291 979 1,321 1,358 5,154 2,811 1,107 147 4,858 153 1,834 1,547 2,022 872 385 1,089 2,133 1,206 2,029 1,193 896 667 615
stu-miR167c-3p GGUCAUGCUCGGACAGCCUCACU 23 2,636 71 333 1    55 48 89 66 229 230 333 325 199 147 185 203 27 10 10 0 0 0 65 57 49 10 0 0 0 1 1 2 2 43 30 14 79 47 19 2 0 0 0 3 0 0 0 12 0 0 4 0 0 0 6 0 0 0 0 0 0 0 0 4 0 0 0 0 0 0 0 0 0 0 4 26
stu-miR167c-5p UGAAGCUGCCAGCAUGAUCUA 21 109,160 1,559 26,085 1    0 0 11 37 46 35 111 139 121 92 39 81 335 363 120 167 287 549 530 707 349 398 100 82 13,586 26,085 617 1 1 8 7 2,560 267 115 48 28 1,872 916 776 1,502 1,481 1,578 3,639 2,113 3,271 1,897 726 4,284 1,416 1,291 979 1,321 1,358 5,154 2,811 1,107 147 4,858 153 1,834 1,547 2,022 872 385 1,089 2,133 1,206 2,029 1,193 896 667 615
stu-miR167d-3p GAUCAUGUGGUUGCUUCACC 20 721 18 80 1    0 0 0 0 0 0 18 0 0 0 0 10 80 59 10 46 13 42 65 80 24 52 0 0 2 0 0 0 0 3 3 1 39 8 4 13 0 8 7 16 6 0 0 0 16 5 4 4 0 0 0 9 0 13 20 6 0 0 0 8 0 0 5 5 0 0 4 0 5 0 4 4
stu-miR167d-5p UGAAGCUGCCAGCAUGAUCUA 21 109,160 1,559 26,085 1    0 0 11 37 46 35 111 139 121 92 39 81 335 363 120 167 287 549 530 707 349 398 100 82 13,586 26,085 617 1 1 8 7 2,560 267 115 48 28 1,872 916 776 1,502 1,481 1,578 3,639 2,113 3,271 1,897 726 4,284 1,416 1,291 979 1,321 1,358 5,154 2,811 1,107 147 4,858 153 1,834 1,547 2,022 872 385 1,089 2,133 1,206 2,029 1,193 896 667 615
stu-miR169a-3p GCAGUCUCCUUGGCUACU 18 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR169a-5p UAGCCAAGGAUGACUUGCCU 20 33,395 1,044 3,696 1    801 896 943 1,311 1,019 966 1,778 2,202 1,464 1,714 708 844 1,503 1,531 275 609 1,244 1,586 3,294 3,696 2,428 2,482 0 0 0 0 0 0 0 34 40 0 3 2 1 0 3 0 0 0 2 0 2 0 0 0 0 0 0 0 0 0 0 6 0 0 0 8 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR169b-3p GCAGUCUCCUUGGCUACU 18 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR169b-5p UAGCCAAGGAUGACUUGCCU 20 33,395 1,044 3,696 1    801 896 943 1,311 1,019 966 1,778 2,202 1,464 1,714 708 844 1,503 1,531 275 609 1,244 1,586 3,294 3,696 2,428 2,482 0 0 0 0 0 0 0 34 40 0 3 2 1 0 3 0 0 0 2 0 2 0 0 0 0 0 0 0 0 0 0 6 0 0 0 8 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR169c-3p GCAGUCUCCUUGGCUACC 18 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR169c-5p UAGCCAAGGAUGACUUGCCU 20 33,395 1,044 3,696 1    801 896 943 1,311 1,019 966 1,778 2,202 1,464 1,714 708 844 1,503 1,531 275 609 1,244 1,586 3,294 3,696 2,428 2,482 0 0 0 0 0 0 0 34 40 0 3 2 1 0 3 0 0 0 2 0 2 0 0 0 0 0 0 0 0 0 0 6 0 0 0 8 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR169d-3p GCAGGUCAUCUUUAGCUAACU 21 366 14 47 1    22 12 0 15 6 27 22 23 12 0 6 20 7 10 0 0 20 0 47 11 31 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 4 0 0 0 0 0 5 0 0 10 0 0 0 0 0 17 0 13 0 6 0 4 0 0 0 0 0 0 0 5 0 0 0 0 0 9
stu-miR169d-5p UAGCCAAGGAUGACUUGCCU 20 33,395 1,044 3,696 1    801 896 943 1,311 1,019 966 1,778 2,202 1,464 1,714 708 844 1,503 1,531 275 609 1,244 1,586 3,294 3,696 2,428 2,482 0 0 0 0 0 0 0 34 40 0 3 2 1 0 3 0 0 0 2 0 2 0 0 0 0 0 0 0 0 0 0 6 0 0 0 8 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR169e-3p GCAAGUUAUCCUGGCUAUC 19 95 8 16 1    0 0 11 0 6 9 9 0 16 0 0 0 7 10 0 5 0 0 0 11 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5 0 0 0 0 0 0
stu-miR169e-5p UAGCCAAGGAUGACUUGCCU 20 33,395 1,044 3,696 1    801 896 943 1,311 1,019 966 1,778 2,202 1,464 1,714 708 844 1,503 1,531 275 609 1,244 1,586 3,294 3,696 2,428 2,482 0 0 0 0 0 0 0 34 40 0 3 2 1 0 3 0 0 0 2 0 2 0 0 0 0 0 0 0 0 0 0 6 0 0 0 8 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR169f-3p GCAAGCAUCCUUGGCGACU 19 9 5 5 4    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5 0 0 0 0 0 0 0 0 0
stu-miR169f-5p UAGCCAAGGAUGACUUGCCU 20 33,395 1,044 3,696 1    801 896 943 1,311 1,019 966 1,778 2,202 1,464 1,714 708 844 1,503 1,531 275 609 1,244 1,586 3,294 3,696 2,428 2,482 0 0 0 0 0 0 0 34 40 0 3 2 1 0 3 0 0 0 2 0 2 0 0 0 0 0 0 0 0 0 0 6 0 0 0 8 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR169g UAGCCAAGGAUGACUUGCCU 20 33,395 1,044 3,696 1    801 896 943 1,311 1,019 966 1,778 2,202 1,464 1,714 708 844 1,503 1,531 275 609 1,244 1,586 3,294 3,696 2,428 2,482 0 0 0 0 0 0 0 34 40 0 3 2 1 0 3 0 0 0 2 0 2 0 0 0 0 0 0 0 0 0 0 6 0 0 0 8 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR169h UAGCCAAGGAUGACUUGCCU 20 33,395 1,044 3,696 1    801 896 943 1,311 1,019 966 1,778 2,202 1,464 1,714 708 844 1,503 1,531 275 609 1,244 1,586 3,294 3,696 2,428 2,482 0 0 0 0 0 0 0 34 40 0 3 2 1 0 3 0 0 0 2 0 2 0 0 0 0 0 0 0 0 0 0 6 0 0 0 8 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR171a-3p UGAUUGAGCCGUGCCAAUAUC 21 3,454 52 266 2    6 0 78 37 57 53 129 139 101 129 45 41 74 88 22 56 46 42 106 103 61 63 0 0 52 50 48 3 2 27 32 92 266 189 198 14 25 23 24 9 137 16 71 24 56 20 20 72 15 0 25 22 18 19 30 24 4 36 10 64 85 11 5 5 11 31 30 13 30 5 15 0
stu-miR171a-5p UAUUGGCCUGGUUCACUCAGA 21 19,422 286 4,160 1    33 0 44 44 57 89 310 464 180 240 62 81 275 314 40 86 91 110 265 148 202 178 0 0 1 5 1 1 1 429 421 6 1,227 646 340 26 68 62 100 13 148 21 1,108 1,643 165 1,433 217 163 98 26 80 122 95 264 217 542 4 284 0 38 81 65 186 81 56 51 64 389 280 208 473 4,160
stu-miR171b-3p UUGAGCCGCGUCAAUAUCUCU 21 1,036 19 135 1    0 24 44 15 17 35 67 23 27 18 34 41 7 10 5 10 20 8 12 11 12 0 0 0 6 1 135 4 2 6 4 15 0 1 1 1 1 8 2 22 0 10 34 28 3 24 0 28 0 5 3 4 0 0 25 0 0 4 2 30 0 0 0 0 0 5 0 52 40 30 13 47
stu-miR171b-5p AGAUAUUGAUGUGGCUCAAUC 21 209 15 70 2    0 0 0 7 11 9 13 70 20 37 0 0 0 0 2 0 0 0 6 0 12 0 0 0 0 0 6 0 0 5 7 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR171c-3p UGAUUGAGCCGUGUCAAUAUC 21 503 12 49 1    0 0 0 7 0 9 49 23 31 18 28 20 7 29 2 0 7 0 29 11 6 10 0 0 0 3 0 0 0 4 4 2 0 0 1 0 1 0 0 0 28 0 11 4 6 10 4 0 0 0 9 0 0 6 5 0 4 12 0 4 43 11 0 5 0 0 4 4 10 5 13 4
stu-miR171c-5p UAUUGGCCUGGUUCACUCAGA 21 19,422 286 4,160 1    33 0 44 44 57 89 310 464 180 240 62 81 275 314 40 86 91 110 265 148 202 178 0 0 1 5 1 1 1 429 421 6 1,227 646 340 26 68 62 100 13 148 21 1,108 1,643 165 1,433 217 163 98 26 80 122 95 264 217 542 4 284 0 38 81 65 186 81 56 51 64 389 280 208 473 4,160
stu-miR171d-3p UUGAGCCGUGCCAAUAUCACG 21 524 12 41 1    0 0 11 0 6 0 13 0 8 37 0 0 7 10 0 0 7 8 41 34 18 31 0 0 1 1 1 0 0 18 13 1 21 9 7 1 8 0 0 3 8 0 16 20 6 34 0 40 0 0 6 0 5 13 5 6 0 12 0 0 0 3 5 0 6 0 9 4 0 0 2 9
stu-miR171d-5p AGAUAUUGGUGCGGUUCAAUU 21 108 10 40 1    0 0 0 0 0 0 0 0 4 0 0 10 0 0 0 5 0 0 0 0 0 0 0 0 1 0 0 1 0 3 2 40 0 0 0 0 0 0 0 0 0 0 0 16 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5 0 0 0 0 0 0 0 0 21
stu-miR171e UGAUUGAGCCGUGCCAAUAUC 21 3,454 52 266 2    6 0 78 37 57 53 129 139 101 129 45 41 74 88 22 56 46 42 106 103 61 63 0 0 52 50 48 3 2 27 32 92 266 189 198 14 25 23 24 9 137 16 71 24 56 20 20 72 15 0 25 22 18 19 30 24 4 36 10 64 85 11 5 5 11 31 30 13 30 5 15 0
stu-miR172a-3p AGAAUCUUGAUGAUGCUGCAU 21 5,659 111 2,374 1    0 0 11 15 17 18 13 0 20 18 51 41 40 20 5 5 13 0 29 57 12 52 0 123 114 297 2,374 1 1 1 1 1,710 130 111 15 3 7 8 2 0 6 0 11 36 0 0 8 12 0 0 0 0 5 0 45 47 39 12 16 25 19 0 0 24 0 5 0 0 10 0 4 0
stu-miR172a-5p GUAGCAUAAUCAAGAUUCACA 21 656 21 147 1    0 0 0 0 0 9 9 0 4 0 6 10 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 1 2 1 0 0 0 0 6 4 18 3 6 0 18 115 0 20 0 147 0 5 3 4 18 44 25 18 0 12 0 72 8 37 5 19 0 5 0 0 0 0 0 0
stu-miR172b-3p AGAAUCUUGAUGAUGCUGCAU 21 5,659 111 2,374 1    0 0 11 15 17 18 13 0 20 18 51 41 40 20 5 5 13 0 29 57 12 52 0 123 114 297 2,374 1 1 1 1 1,710 130 111 15 3 7 8 2 0 6 0 11 36 0 0 8 12 0 0 0 0 5 0 45 47 39 12 16 25 19 0 0 24 0 5 0 0 10 0 4 0
stu-miR172b-5p GCAGCACCAUCAAGAUUCACA 21 301 14 130 1    0 0 0 0 0 9 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 7 0 5 1 1 2 1 10 0 0 0 0 0 0 0 0 0 0 0 130 0 5 16 32 0 0 0 0 14 0 35 6 0 4 0 0 4 3 0 5 0 0 9 0 0 0 0 0
stu-miR172c-3p AGAAUCUUGAUGAUGCUGC 19 671 96 348 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5 0 0 18 0 0 10 348 287 0 1 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR172c-5p AGCAUCUUCAAGAUUCACA 19 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR172d-3p GGAAUCUUGAUGAUGCUGCAG 21 679 20 129 1    6 24 33 22 17 9 35 46 78 129 28 41 13 0 2 0 7 0 12 11 6 0 0 0 0 20 33 0 1 1 0 1 18 8 4 0 0 0 0 0 9 0 2 0 0 0 0 0 0 0 0 0 0 0 0 12 0 0 0 0 8 0 0 0 0 0 4 0 25 10 4 0
stu-miR172d-5p GGAGCAUCAUCAAGAUUCACA 21 1,204 31 319 1    6 12 11 7 11 0 9 0 8 0 6 0 7 0 0 0 0 0 0 0 0 0 0 0 4 10 16 0 0 0 0 4 2 0 1 0 3 0 4 0 0 0 2 28 28 5 8 52 0 0 15 4 5 19 10 6 0 20 3 34 0 6 0 0 0 0 4 122 319 183 90 120
stu-miR172e-3p AGAAUCUUGAUGAUGCUGCAU 21 5,659 111 2,374 1    0 0 11 15 17 18 13 0 20 18 51 41 40 20 5 5 13 0 29 57 12 52 0 123 114 297 2,374 1 1 1 1 1,710 130 111 15 3 7 8 2 0 6 0 11 36 0 0 8 12 0 0 0 0 5 0 45 47 39 12 16 25 19 0 0 24 0 5 0 0 10 0 4 0
stu-miR172e-5p GCAACAUCAUCAAGAUUCACA 21 173 12 52 1    17 12 0 15 52 27 18 0 0 0 0 10 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5 1 1 0 0 0 1 0 0 1 0 0 0 0 0 0 0 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 5 0 0 0
stu-miR1886a AUGGUAUCGUGAGAUGAAAUCAGC 24 84 7 15 1    6 12 0 15 6 9 0 0 0 0 0 0 7 0 0 0 0 0 6 0 6 10 0 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5 0 0 0
stu-miR1886b AUGGUAUCGUGAGAUGAAAUCAGC 24 84 7 15 1    6 12 0 15 6 9 0 0 0 0 0 0 7 0 0 0 0 0 6 0 6 10 0 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5 0 0 0
stu-miR1886c AUGGUAUCGUGAGAUGAAAUCAGC 24 84 7 15 1    6 12 0 15 6 9 0 0 0 0 0 0 7 0 0 0 0 0 6 0 6 10 0 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5 0 0 0
stu-miR1886d AUGGUAUCGUGAGAUGAAAUCAGC 24 84 7 15 1    6 12 0 15 6 9 0 0 0 0 0 0 7 0 0 0 0 0 6 0 6 10 0 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5 0 0 0
stu-miR1886e AUGGUAUCGUGAGAUGAAAUCAGC 24 84 7 15 1    6 12 0 15 6 9 0 0 0 0 0 0 7 0 0 0 0 0 6 0 6 10 0 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5 0 0 0
stu-miR1886f AUGGUAUCGUGAGAUGAAAUCAGC 24 84 7 15 1    6 12 0 15 6 9 0 0 0 0 0 0 7 0 0 0 0 0 6 0 6 10 0 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5 0 0 0
stu-miR1886g-3p UUUCAUAUUGAUUUCAUCUCAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR1886g-5p GAGAUGAGAUCAAUGUUUGGACAU 24 245 12 55 1    0 0 33 15 6 9 4 0 35 55 0 10 13 0 5 5 0 0 18 0 12 10 0 0 0 0 0 1 1 1 1 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 0 0 0 0 0 0 0 0 5 0 0 0
stu-miR1886h AUUUUACGUUGAUUUCAUCUCAUG 24 65 8 12 1    0 12 0 0 11 0 9 0 12 0 0 0 7 0 0 0 0 0 12 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR1886i-3p UUUACGUUGAUUUCAUCUCAUGA 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR1886i-5p AUGAGAUGAAAUUAGCGUUUGGAU 24 424 18 49 1    17 12 22 29 6 18 49 0 31 37 45 20 13 49 2 0 0 8 41 0 18 0 0 0 0 1 0 0 0 1 1 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR1919-3p ACGAGAGUCAUCUGUGACAGG 21 6,574 108 585 3    50 36 89 140 447 585 395 487 301 332 112 193 67 167 30 51 52 177 118 251 92 199 0 0 21 9 40 68 31 163 157 19 0 0 0 0 28 31 22 13 34 0 9 118 3 342 36 28 0 37 15 9 5 19 339 59 17 28 30 221 4 0 34 10 6 5 0 9 90 0 38 56
stu-miR1919-5p UGUCGCAGAUGACUUUCGCCC 21 36,330 512 2,316 1    298 299 699 744 1,048 1,250 1,827 1,785 2,155 1,917 893 966 1,308 1,315 200 538 1,029 1,046 2,180 2,316 1,713 1,969 0 82 486 411 675 43 35 124 91 324 7 4 4 1 53 115 64 22 109 31 301 652 100 513 24 227 60 26 59 66 50 214 263 212 2 192 3 739 47 104 78 105 39 122 34 144 624 134 443 577
stu-miR319-3p UUGGACUGAAGGGUUCCCUUC 21 3,512 153 716 1    248 263 455 412 716 638 111 162 152 129 67 81 0 0 0 5 0 0 0 11 0 0 0 0 0 14 1 17 10 0 1 0 3 8 3 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR319-5p AGGAAACUGUUUAGUCCAACC 21 371 23 71 1    33 0 44 52 69 71 22 0 12 0 11 10 0 0 0 0 0 0 0 0 0 0 0 0 0 17 25 1 1 1 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR319a-3p UUGGACUGAAGGGAGCUCCCU 21 289,541 4,322 59,001 1    3,065 3,143 9,773 9,551 16,235 17,361 25,697 25,572 31,147 30,118 13,923 14,508 382 324 87 127 423 329 748 753 795 649 0 0 0 3 15 288 279 182 118 1 11,077 3,112 1,376 34 4 23 7 25 72 26 71 4 22 34 4 28 15 26 49 35 14 25 0 6 0 60 2 13 8 11 29 10 34 5 21 1,356 59,001 1,154 4,277 1,875
stu-miR319a-5p AGAGCUUUCUUCGGUCCACAC 21 889 42 168 1    28 0 33 15 109 71 84 93 74 74 34 41 0 0 0 0 0 0 0 11 0 0 0 0 0 2 168 2 2 0 1 10 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5 0 2 30
stu-miR319b UUGGACUGAAGGGAGCUCCU 20 4,544 73 1,311 1    33 12 33 44 132 115 115 70 191 203 67 92 7 20 5 15 13 42 29 46 18 42 0 0 0 0 0 12 7 12 6 0 1,311 649 230 12 1 19 13 16 91 10 67 8 19 44 20 32 8 11 9 22 14 0 10 6 4 24 10 110 0 6 5 14 17 5 0 13 275 20 38 0
stu-miR3627-3p AAGUGCCUCUGUCUUUCGACA 21 29 7 23 1    0 0 0 0 0 0 4 23 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR3627-5p UCGCAGGAGAGAUGGCACUUAG 22 250 14 105 1    0 0 0 0 6 0 18 0 4 18 0 0 13 0 0 10 7 0 6 0 0 0 0 0 105 18 17 0 1 7 5 1 0 0 0 0 0 0 0 0 5 0 0 0 0 0 0 0 0 0 0 0 5 0 0 0 0 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR384-3p AGGGGGCCAAAGUGCCAAAC 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR384-5p UUGGCAUUCUGUCCACCUCC 20 6,466 110 1,437 1    22 0 55 66 52 142 204 301 367 590 79 122 47 59 5 30 72 59 94 103 104 84 0 0 44 79 142 4 2 21 16 1 1,437 971 318 45 7 27 4 6 41 0 80 4 37 5 0 8 0 0 52 4 0 44 5 12 6 24 5 38 74 6 0 0 6 10 13 0 205 0 6 0
stu-miR390-3p CGCUAUCCAUCUUGAGUUUUA 21 1,317 33 217 1    0 0 0 0 0 0 0 0 8 0 0 0 0 0 0 0 7 0 6 0 6 0 0 0 5 1 1 0 0 2 3 29 0 0 0 0 17 27 69 31 18 0 18 217 19 108 76 20 8 5 18 17 18 38 157 29 0 24 0 0 19 14 20 0 34 20 13 4 0 20 4 167
stu-miR390-5p AAGCUCAGGAGGGAUAGCACC 21 6,043 97 708 1    6 24 22 7 11 9 133 93 98 129 90 51 268 393 70 137 176 203 466 525 263 377 0 0 708 27 14 1 0 404 334 183 59 126 53 20 4 8 20 0 9 5 25 67 9 39 32 44 15 0 6 13 0 6 76 12 0 36 3 4 27 8 10 10 0 25 9 0 0 5 2 34
stu-miR393-3p AUCAUGCGAUCUCUUCGGAAU 21 1,770 36 409 1    0 0 22 22 155 142 0 23 16 0 6 0 27 59 2 15 13 0 24 34 18 10 0 0 20 4 5 1 1 58 47 409 10 4 1 1 4 12 0 6 12 0 5 51 0 176 4 12 0 11 3 4 0 0 157 41 0 0 2 55 4 3 24 0 0 0 0 0 5 0 0 30
stu-miR393-5p UCCAAAGGGAUCGCAUUGAUCC 22 2,480 49 1,123 1    6 0 22 15 23 35 27 23 35 37 0 20 7 10 5 25 33 42 24 23 6 0 0 0 0 1 1 2 1 3 1 0 30 29 12 1 0 0 42 53 1,123 119 34 0 22 5 60 20 0 11 31 87 0 13 0 0 0 16 0 89 8 0 20 0 28 10 155 0 5 0 30 0
stu-miR395a CUGAAGUGUUUGGGGGAACUC 21 400 10 56 1    0 0 0 0 0 0 0 23 4 0 6 0 7 10 2 5 7 0 18 11 12 0 0 0 0 1 0 1 1 1 1 1 7 6 3 0 1 0 4 0 3 0 0 4 0 44 4 0 0 5 3 0 14 6 10 18 0 24 0 13 0 0 10 5 6 0 0 17 10 5 11 56
stu-miR395b CUGAAGUGUUUGGGGGAACUC 21 400 10 56 1    0 0 0 0 0 0 0 23 4 0 6 0 7 10 2 5 7 0 18 11 12 0 0 0 0 1 0 1 1 1 1 1 7 6 3 0 1 0 4 0 3 0 0 4 0 44 4 0 0 5 3 0 14 6 10 18 0 24 0 13 0 0 10 5 6 0 0 17 10 5 11 56
stu-miR395c CUGAAGUGUUUGGGGGAACUC 21 400 10 56 1    0 0 0 0 0 0 0 23 4 0 6 0 7 10 2 5 7 0 18 11 12 0 0 0 0 1 0 1 1 1 1 1 7 6 3 0 1 0 4 0 3 0 0 4 0 44 4 0 0 5 3 0 14 6 10 18 0 24 0 13 0 0 10 5 6 0 0 17 10 5 11 56
stu-miR395d CUGAAGUGUUUGGGGGAACUC 21 400 10 56 1    0 0 0 0 0 0 0 23 4 0 6 0 7 10 2 5 7 0 18 11 12 0 0 0 0 1 0 1 1 1 1 1 7 6 3 0 1 0 4 0 3 0 0 4 0 44 4 0 0 5 3 0 14 6 10 18 0 24 0 13 0 0 10 5 6 0 0 17 10 5 11 56
stu-miR395e CUGAAGUGUUUGGGGGAACUC 21 400 10 56 1    0 0 0 0 0 0 0 23 4 0 6 0 7 10 2 5 7 0 18 11 12 0 0 0 0 1 0 1 1 1 1 1 7 6 3 0 1 0 4 0 3 0 0 4 0 44 4 0 0 5 3 0 14 6 10 18 0 24 0 13 0 0 10 5 6 0 0 17 10 5 11 56
stu-miR395f CUGAAGUGUUUGGGGGAACUC 21 400 10 56 1    0 0 0 0 0 0 0 23 4 0 6 0 7 10 2 5 7 0 18 11 12 0 0 0 0 1 0 1 1 1 1 1 7 6 3 0 1 0 4 0 3 0 0 4 0 44 4 0 0 5 3 0 14 6 10 18 0 24 0 13 0 0 10 5 6 0 0 17 10 5 11 56
stu-miR395g CUGAAGUGUUUGGGGGAACUC 21 400 10 56 1    0 0 0 0 0 0 0 23 4 0 6 0 7 10 2 5 7 0 18 11 12 0 0 0 0 1 0 1 1 1 1 1 7 6 3 0 1 0 4 0 3 0 0 4 0 44 4 0 0 5 3 0 14 6 10 18 0 24 0 13 0 0 10 5 6 0 0 17 10 5 11 56
stu-miR395h CUGAAGUGUUUGGGGGAACUC 21 400 10 56 1    0 0 0 0 0 0 0 23 4 0 6 0 7 10 2 5 7 0 18 11 12 0 0 0 0 1 0 1 1 1 1 1 7 6 3 0 1 0 4 0 3 0 0 4 0 44 4 0 0 5 3 0 14 6 10 18 0 24 0 13 0 0 10 5 6 0 0 17 10 5 11 56
stu-miR395i CUGAAGUGUUUGGGGGAACUC 21 400 10 56 1    0 0 0 0 0 0 0 23 4 0 6 0 7 10 2 5 7 0 18 11 12 0 0 0 0 1 0 1 1 1 1 1 7 6 3 0 1 0 4 0 3 0 0 4 0 44 4 0 0 5 3 0 14 6 10 18 0 24 0 13 0 0 10 5 6 0 0 17 10 5 11 56
stu-miR395j CUGAAGUGUUUGGGGGAACUC 21 400 10 56 1    0 0 0 0 0 0 0 23 4 0 6 0 7 10 2 5 7 0 18 11 12 0 0 0 0 1 0 1 1 1 1 1 7 6 3 0 1 0 4 0 3 0 0 4 0 44 4 0 0 5 3 0 14 6 10 18 0 24 0 13 0 0 10 5 6 0 0 17 10 5 11 56
stu-miR396-3p GUCCAAGAAAGCUGUGGGAAA 21 40,222 774 12,780 1    0 0 11 0 6 18 4 0 4 18 0 10 7 0 0 0 0 0 0 11 6 0 0 0 15 0 6 1 0 130 85 130 0 0 0 0 223 146 157 9 40 31 145 8,206 324 4,626 140 239 30 21 222 92 591 547 12,780 1,272 804 388 937 611 143 110 774 1,292 73 102 52 232 394 193 115 3,699
stu-miR396-5p UUCCACAGCUUUCUUGAACUU 21 240,570 3,437 12,019 37    1,347 1,350 5,214 4,426 8,049 7,639 9,317 7,790 8,864 6,709 2,398 2,389 4,978 3,376 460 1,131 4,487 2,869 11,072 7,472 6,642 5,384 0 0 122 59 62 263 215 2,494 1,942 37 9,698 11,995 2,757 385 2,094 1,371 1,261 300 2,093 997 8,770 4,403 3,424 3,066 706 3,053 482 622 1,687 1,382 2,849 12,019 2,624 1,414 228 5,662 183 1,172 1,059 995 1,479 1,254 1,286 626 1,880 9,263 6,254 7,234 1,338 2,648
stu-miR397-3p CAUCAACGCUACACUCAAUCA 21 28 4 13 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 6 1 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 13
stu-miR397-5p AUUGAGUGCAGCGUUGAUGAC 21 1,629 34 224 1    11 0 11 15 52 62 84 93 43 111 124 224 20 69 5 5 7 51 29 11 18 31 0 0 4 6 49 196 95 9 5 1 14 7 5 3 8 23 0 0 3 0 2 4 3 5 0 8 0 0 0 0 0 0 10 0 0 0 0 8 0 0 5 0 0 0 0 9 40 5 26 0
stu-miR398a-3p UAUGUUCUCAGGUCGCCCCUG 21 4,704 94 1,172 1    22 12 11 15 34 27 58 23 59 74 79 51 60 59 2 20 20 8 6 11 0 52 0 0 4 6 50 1,172 426 833 460 1 0 0 0 0 19 158 0 3 11 0 5 75 12 24 0 52 0 0 37 31 0 6 86 0 0 0 0 13 105 0 5 0 0 0 0 87 25 20 177 98
stu-miR398a-5p GGGUUGAUUUGAGAACAUAUG 21 6,455 157 2,306 1    0 0 11 0 11 0 0 0 0 0 0 0 0 0 0 0 0 0 0 11 0 0 0 0 0 1 2 34 24 20 16 1 0 0 0 0 1 246 2 3 2 5 2 1,185 25 298 80 120 0 0 12 13 14 19 1,274 77 2 12 3 25 8 0 29 5 0 10 0 206 180 94 66 2,306
stu-miR398b-3p UUGUGUUCUCAGGUCACCCCU 21 1,571 46 168 1    17 12 0 15 34 27 35 116 35 111 22 41 101 79 25 61 85 76 124 137 147 168 0 0 6 1 0 1 0 11 5 0 0 0 0 0 0 0 0 0 0 0 30 0 9 5 4 8 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 0 15 5 0 0
stu-miR398b-5p GAGUGUGCCUUAGAACACAGGU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR399a-3p UGCCAAAGGAGAGCUGCCCUG 21 97 7 22 1    6 0 22 0 11 0 0 0 0 0 0 0 0 10 0 0 0 0 0 0 0 0 0 0 0 1 14 4 6 12 5 1 0 0 0 0 1 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR399a-5p GGGCUACUCUCUAUUGGCAUG 21 314 14 76 1    0 0 11 7 6 27 13 0 20 0 11 20 7 0 2 0 7 8 0 0 0 0 0 0 2 1 76 8 8 37 27 6 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5 0 0 0 0 0 0 0 4
stu-miR399b-3p UGCCAAAGGAGAGCUGCCCUG 21 97 7 22 1    6 0 22 0 11 0 0 0 0 0 0 0 0 10 0 0 0 0 0 0 0 0 0 0 0 1 14 4 6 12 5 1 0 0 0 0 1 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR399b-5p GGGCUACUCUCUAUUGGCAUG 21 314 14 76 1    0 0 11 7 6 27 13 0 20 0 11 20 7 0 2 0 7 8 0 0 0 0 0 0 2 1 76 8 8 37 27 6 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5 0 0 0 0 0 0 0 4
stu-miR399c-3p UGCCAAAGGAGAGCUGCCCUG 21 97 7 22 1    6 0 22 0 11 0 0 0 0 0 0 0 0 10 0 0 0 0 0 0 0 0 0 0 0 1 14 4 6 12 5 1 0 0 0 0 1 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR399c-5p GGGCUACUCUCUAUUGGCAUG 21 314 14 76 1    0 0 11 7 6 27 13 0 20 0 11 20 7 0 2 0 7 8 0 0 0 0 0 0 2 1 76 8 8 37 27 6 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5 0 0 0 0 0 0 0 4
stu-miR399d-3p UGCCAAAGGAGAGCUGCCCUG 21 97 7 22 1    6 0 22 0 11 0 0 0 0 0 0 0 0 10 0 0 0 0 0 0 0 0 0 0 0 1 14 4 6 12 5 1 0 0 0 0 1 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR399d-5p GGGCUACUCUCUAUUGGCAUG 21 314 14 76 1    0 0 11 7 6 27 13 0 20 0 11 20 7 0 2 0 7 8 0 0 0 0 0 0 2 1 76 8 8 37 27 6 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5 0 0 0 0 0 0 0 4
stu-miR399e-3p UGCCAAAGGAGAGCUGCCCUG 21 97 7 22 1    6 0 22 0 11 0 0 0 0 0 0 0 0 10 0 0 0 0 0 0 0 0 0 0 0 1 14 4 6 12 5 1 0 0 0 0 1 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR399e-5p GGGCUACUCUCUAUUGGCAUG 21 314 14 76 1    0 0 11 7 6 27 13 0 20 0 11 20 7 0 2 0 7 8 0 0 0 0 0 0 2 1 76 8 8 37 27 6 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5 0 0 0 0 0 0 0 4
stu-miR399f-3p UGCCAAAGGAGAGCUGCCCUG 21 97 7 22 1    6 0 22 0 11 0 0 0 0 0 0 0 0 10 0 0 0 0 0 0 0 0 0 0 0 1 14 4 6 12 5 1 0 0 0 0 1 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR399f-5p GGGCUACUCUCUAUUGGCAUG 21 314 14 76 1    0 0 11 7 6 27 13 0 20 0 11 20 7 0 2 0 7 8 0 0 0 0 0 0 2 1 76 8 8 37 27 6 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5 0 0 0 0 0 0 0 4
stu-miR399g-3p CGCCAAAGGGGAGCUGCCCUA 21 29 4 9 1    0 0 0 7 0 9 0 0 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 6 0 1 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR399g-5p GGGCUACUCUCUAUUGGCAUG 21 314 14 76 1    0 0 11 7 6 27 13 0 20 0 11 20 7 0 2 0 7 8 0 0 0 0 0 0 2 1 76 8 8 37 27 6 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5 0 0 0 0 0 0 0 4
stu-miR399h GGGCUACUCUCUAUUGGCAUG 21 314 14 76 1    0 0 11 7 6 27 13 0 20 0 11 20 7 0 2 0 7 8 0 0 0 0 0 0 2 1 76 8 8 37 27 6 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5 0 0 0 0 0 0 0 4
stu-miR399i-3p UGCCAAAGGAGAGUUGCCCUA 21 103 5 18 1    0 0 0 0 0 0 0 0 4 0 0 0 7 10 0 0 0 0 18 11 6 0 0 0 1 1 8 0 1 1 1 3 0 0 0 0 0 0 0 0 0 0 2 0 3 0 0 0 0 0 0 4 0 0 0 0 0 0 0 0 4 0 0 0 0 0 0 0 5 0 13 0
stu-miR399i-5p GGGCUACACUCUAUUGGCAUG 21 139 13 40 1    0 0 0 0 0 0 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 1 22 1 1 37 25 40 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR399j-3p CGCCAAAGGAGAGCUGCCCUG 21 322 18 71 1    50 12 22 15 34 71 0 23 0 18 17 10 7 0 0 0 0 0 0 0 0 10 0 0 0 2 8 5 14 3 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR399j-5p GGGCUACUCUCUAUUGGCAUA 21 97 10 27 1    0 12 22 15 11 27 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5 0 0 0
stu-miR399k-3p CGCCAAAGGAGAGCUGCCCUG 21 322 18 71 1    50 12 22 15 34 71 0 23 0 18 17 10 7 0 0 0 0 0 0 0 0 10 0 0 0 2 8 5 14 3 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR399k-5p GGGCUACUCUCUAUUGGCAUG 21 314 14 76 1    0 0 11 7 6 27 13 0 20 0 11 20 7 0 2 0 7 8 0 0 0 0 0 0 2 1 76 8 8 37 27 6 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5 0 0 0 0 0 0 0 4
stu-miR399l-3p CGCCAAAGGAGAGCUGCCCUG 21 322 18 71 1    50 12 22 15 34 71 0 23 0 18 17 10 7 0 0 0 0 0 0 0 0 10 0 0 0 2 8 5 14 3 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR399l-5p GGGCUACUCUCUAUUGGCAUG 21 314 14 76 1    0 0 11 7 6 27 13 0 20 0 11 20 7 0 2 0 7 8 0 0 0 0 0 0 2 1 76 8 8 37 27 6 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5 0 0 0 0 0 0 0 4
stu-miR399m-3p CGCCAAAGGAGAGCUGCCCUG 21 322 18 71 1    50 12 22 15 34 71 0 23 0 18 17 10 7 0 0 0 0 0 0 0 0 10 0 0 0 2 8 5 14 3 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR399m-5p GGGCUACUCUCUAUUGGCAUG 21 314 14 76 1    0 0 11 7 6 27 13 0 20 0 11 20 7 0 2 0 7 8 0 0 0 0 0 0 2 1 76 8 8 37 27 6 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5 0 0 0 0 0 0 0 4
stu-miR399n-3p CGCCAAAGGAGAGCUGCCCUG 21 322 18 71 1    50 12 22 15 34 71 0 23 0 18 17 10 7 0 0 0 0 0 0 0 0 10 0 0 0 2 8 5 14 3 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR399n-5p GGGCUACUCUCUAUUGGCAUG 21 314 14 76 1    0 0 11 7 6 27 13 0 20 0 11 20 7 0 2 0 7 8 0 0 0 0 0 0 2 1 76 8 8 37 27 6 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5 0 0 0 0 0 0 0 4
stu-miR399o-3p CGCCAAAGGAGAGCUGCCCUG 21 322 18 71 1    50 12 22 15 34 71 0 23 0 18 17 10 7 0 0 0 0 0 0 0 0 10 0 0 0 2 8 5 14 3 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR399o-5p GGGCUACUCUCUAUUGGCAUG 21 314 14 76 1    0 0 11 7 6 27 13 0 20 0 11 20 7 0 2 0 7 8 0 0 0 0 0 0 2 1 76 8 8 37 27 6 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5 0 0 0 0 0 0 0 4
stu-miR408a-3p UGCACAGCCUCUUCCCUGGUU 21 956 21 254 1    0 0 11 7 6 0 4 23 8 18 39 31 20 0 2 5 7 0 6 11 6 0 0 0 1 0 14 13 9 1 2 0 0 0 0 0 4 254 0 0 2 0 5 4 19 10 4 36 0 0 46 0 5 0 20 0 0 4 0 8 8 3 0 5 6 0 0 35 90 50 64 30
stu-miR408a-5p ACAGGGACGAGGCAGCGCAUG 21 61 6 26 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5 4 26 1 1 1 0 8 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 6 0 0 0 0 4 0 0 0 0 0 0 0 0 0 0 4
stu-miR408b-3p UGCACUGCCUCUUCCCUGGCU 21 931 22 126 2    0 24 22 15 46 27 35 0 43 92 90 102 20 20 2 10 0 8 12 0 0 10 0 0 2 2 27 126 83 5 4 0 4 6 7 7 0 15 0 0 2 0 0 8 3 5 4 8 0 0 3 0 0 0 5 0 2 0 0 0 4 0 0 0 0 0 0 0 15 0 2 4
stu-miR408b-5p ACGGGGACGAGACAGAGCAUG 21 2,936 82 1,764 2    6 0 0 0 6 0 0 0 0 0 0 0 20 0 0 0 0 0 0 0 0 0 0 0 34 24 211 5 6 7 7 60 2 2 3 3 6 8 0 0 0 5 0 162 6 98 0 0 8 0 6 4 0 0 329 24 4 0 0 0 0 3 15 5 11 0 0 31 20 20 11 1,764
stu-miR4376-3p GCAUCAUACUCCUGCAUAUU 20 11 4 5 2    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4
stu-miR4376-5p UACGCAGGAGAGAUGAUGCUG 21 15,130 322 2,282 3    39 36 89 66 86 142 106 116 86 111 11 51 1,207 1,609 292 715 1,055 1,418 1,892 2,282 1,205 1,718 0 0 191 13 12 8 10 153 148 107 0 0 0 0 3 31 4 3 6 0 32 4 0 0 0 4 0 11 0 4 5 0 25 0 0 4 0 8 0 3 5 0 0 0 0 0 0 0 0 4
stu-miR477a-3p GAAGCUCUAGCAGGGAGAGCCA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR477a-5p CCUCUCCCUCAAGGGCUUCUC 21 1,864 47 187 1    83 60 166 162 114 115 142 162 187 184 62 51 7 10 2 10 52 51 41 68 43 42 0 0 0 0 1 2 1 3 2 0 1 1 1 1 0 0 0 0 2 0 2 0 0 0 4 0 0 0 0 4 0 6 0 0 0 0 2 8 0 0 0 0 0 5 0 0 0 0 0 4
stu-miR477b-3p GAGGUCUUUCGAGUGAGAGUGA 22 631 19 64 1    22 24 33 7 34 27 0 23 4 0 0 0 0 0 0 5 13 8 0 0 0 0 0 0 0 0 2 1 0 1 0 1 0 0 0 0 44 0 0 0 0 5 11 0 0 59 0 0 0 0 0 13 5 0 20 18 2 24 64 0 0 3 10 0 0 0 0 17 55 20 13 43
stu-miR477b-5p ACUCUCCCUCAAAGGCUUCUG 21 842 28 86 1    33 24 55 74 80 44 35 46 86 37 28 20 13 0 0 0 26 17 41 46 24 31 50 0 0 1 13 4 3 3 2 1 0 0 0 1 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR479 UGAGCCGAACCAAUAUCACUC 21 1,673 76 325 1    61 36 67 110 172 266 200 325 62 37 135 142 0 0 0 0 0 0 0 0 0 0 0 0 0 1 14 12 18 0 0 1 0 3 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 0 5 0 0
stu-miR482a-3p UUUCCAAUUCCACCCAUUCCUA 22 28,748 405 1,846 4    839 729 1,187 1,259 1,099 1,037 1,361 1,252 1,557 1,272 404 529 1,087 922 210 350 938 776 1,520 1,392 1,199 838 100 82 31 79 163 13 6 5 5 64 1,846 572 545 187 33 554 29 13 12 16 50 265 90 284 164 36 68 16 191 4 36 57 45 77 6 16 0 34 35 6 78 14 449 66 30 79 60 45 45 290
stu-miR482a-5p GGAAUUGGUGGAUUGGAAAGC 21 3,410 63 730 1    22 12 55 44 69 53 106 116 51 37 28 31 13 0 2 0 0 8 18 11 6 0 0 0 4 1 3 1 1 5 7 132 0 0 0 0 18 19 0 13 2 16 0 363 6 411 213 4 0 5 3 4 18 6 217 177 2 0 0 13 12 6 137 10 67 0 73 0 25 0 4 730
stu-miR482b-3p UUACCGAUUCCCCCCAUUCCAA 22 117,552 1,808 9,575 6    4,605 4,541 3,805 3,999 5,599 5,752 9,556 9,575 8,681 8,460 9,458 9,465 4,367 3,592 857 1,588 2,566 2,312 5,533 4,757 3,021 2,943 0 0 258 287 221 53 41 240 125 105 0 0 0 0 12 31 33 22 29 10 46 83 53 59 12 40 38 11 43 13 18 76 106 12 6 32 0 21 16 28 15 24 62 31 9 17 15 35 34 98
stu-miR482b-5p GGAGUGGGUGGCAUGGUAAGA 21 3,423 80 850 1    0 0 0 7 6 18 0 0 0 0 0 10 0 0 2 0 0 0 0 0 0 10 0 0 3 1 1 0 1 13 9 144 0 0 0 0 10 8 4 3 11 10 5 553 0 494 84 8 15 11 12 4 23 0 849 59 6 8 14 38 0 6 78 5 6 0 9 0 10 5 0 850
stu-miR482c UUUCCUAUUCCACCCAUGCCAA 22 35,396 499 2,802 2    657 932 1,398 1,384 1,906 2,136 2,089 2,481 2,802 2,212 1,101 1,129 731 687 162 304 397 363 1,126 981 654 649 199 0 1,075 927 435 77 32 48 34 260 965 617 251 36 124 189 177 147 54 16 96 162 81 103 132 100 60 105 289 35 36 302 394 165 11 100 2 59 225 132 44 86 90 122 43 35 85 134 62 162
stu-miR482d-3p UCUUGCCUACACCGCCCAUGCC 22 121,243 1,757 12,497 1    4,213 5,127 4,271 4,838 6,847 8,215 8,399 10,363 8,735 12,497 6,846 7,950 3,294 4,308 1,177 2,070 1,875 2,143 3,930 4,609 2,483 2,975 0 41 84 266 64 279 199 486 297 65 2 2 1 1 88 19 88 347 37 0 60 71 12 54 225 20 98 53 126 9 32 31 217 147 28 12 3 21 206 65 0 19 39 10 39 4 20 59 2 30
stu-miR482d-5p CGUGAGUGGUGGGGUAAGAUA 21 1,718 49 1,136 1    11 24 11 22 23 9 13 0 12 0 0 10 0 29 0 15 0 0 0 11 6 10 0 0 15 2 4 0 1 12 10 1,136 0 0 0 0 0 0 0 0 2 5 2 79 0 29 24 0 0 0 3 4 0 0 81 18 0 0 0 0 4 0 20 5 0 0 0 0 0 0 0 56
stu-miR482e-3p UCUUGCCAAUACCGCCCAUUCC 22 75,804 1,083 7,397 2    657 490 976 1,053 1,431 1,267 2,027 2,110 2,123 2,507 944 824 1,905 1,825 412 730 1,335 1,443 2,351 2,647 1,896 2,357 0 0 70 142 98 131 103 858 532 50 24 14 35 8 506 2,306 984 341 432 820 773 1,959 1,464 592 6,497 371 2,425 295 7,397 363 368 1,605 940 565 45 284 2 989 1,105 453 372 185 2,886 249 391 258 220 604 448 935
stu-miR482e-5p AGUGGGUGGUGUGGUAAGAUU 21 3,713 83 1,665 1    22 0 0 7 6 9 4 23 27 0 6 10 20 10 2 15 26 0 12 68 24 0 0 0 106 5 17 1 1 23 21 1,665 0 0 0 0 1 0 0 6 0 5 7 383 0 73 12 4 8 5 0 0 0 19 248 18 0 0 2 0 0 3 10 14 0 0 0 4 5 0 0 756
stu-miR530 UCUGCAUUUGCACCUGCACCU 21 420 12 45 1    0 0 0 0 0 0 4 0 8 0 0 10 20 0 2 10 7 0 24 11 6 10 0 0 0 0 1 3 2 39 44 0 0 0 0 0 1 0 0 0 23 0 0 8 0 5 0 0 0 0 6 4 0 6 5 0 45 4 5 4 8 0 0 5 11 0 0 9 35 5 4 26
stu-miR5303a UUUUGGAGAAUCCGACACGCACCC 24 36 5 9 1    0 0 0 7 6 9 4 0 8 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR5303b UUUUGGAGAAUCCGACACGCACCC 24 36 5 9 1    0 0 0 7 6 9 4 0 8 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR5303c UUUUGGAGAAUCCGACACGCACCC 24 36 5 9 1    0 0 0 7 6 9 4 0 8 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR5303d UUUUGGAGAAUCCGACACGCACCC 24 36 5 9 1    0 0 0 7 6 9 4 0 8 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR5303e UUUUGGAGAAUCUGACACGGGUGU 24 186 10 46 1    6 0 11 7 29 0 13 46 8 0 6 0 7 10 2 0 13 0 6 0 12 0 0 0 0 0 0 1 1 2 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR5303f AUUUUUGGAGAAUCUGACACGGGU 24 314 12 62 1    11 12 11 7 40 62 27 0 20 18 6 0 34 10 0 5 0 0 6 11 6 10 0 0 1 1 0 1 1 4 2 1 0 0 0 0 0 0 0 0 0 0 2 0 0 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR5303g AUAUUUUUGAAGAGUCUGAGCAAC 24 72 5 18 1    0 0 0 7 0 18 4 0 0 0 6 0 0 0 0 0 0 0 6 0 0 0 0 0 0 1 0 0 0 1 1 0 1 1 2 0 0 0 0 0 0 5 0 0 0 0 0 0 0 0 0 0 0 0 0 6 0 0 0 4 4 0 5 0 0 0 0 0 0 0 0 0
stu-miR5303h AACAUUUUUGAAGAGUCUGAGCAA 24 83 6 18 1    0 0 0 0 6 0 0 0 12 18 0 0 0 0 0 5 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 1 0 0 0 0 0 8 0 0 2 0 0 0 0 5 0 0 0 0 0 0 0 0 0 0 0 0 2 4 0 0 10 0 0 0 4 0 0 0 4 0
stu-miR5303i AUAUUUUUGAAGAGUCUGAGCAAC 24 72 5 18 1    0 0 0 7 0 18 4 0 0 0 6 0 0 0 0 0 0 0 6 0 0 0 0 0 0 1 0 0 0 1 1 0 1 1 2 0 0 0 0 0 0 5 0 0 0 0 0 0 0 0 0 0 0 0 0 6 0 0 0 4 4 0 5 0 0 0 0 0 0 0 0 0
stu-miR5303j AAUAUUUUUGAAGAGUCUGAGCAA 24 135 8 22 1    0 0 0 0 0 0 22 0 16 18 17 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 0 1 8 7 3 2 0 0 0 0 0 0 0 8 0 6 0 5 0 0 0 0 0 0 8 0 0 0 0 0 5 0 0 0 0 6 0
stu-miR5304-3p AGAUGAGUAUGGUGCAUUGGA 21 325 15 142 1    0 0 0 0 6 0 0 0 0 0 6 0 0 0 0 0 0 8 0 0 0 0 0 0 1 0 0 0 0 0 0 11 0 0 0 0 22 0 0 0 6 5 2 8 0 0 0 12 0 0 0 0 0 0 142 6 4 4 0 21 12 0 0 0 0 5 9 0 5 0 4 26
stu-miR5304-5p CAAUGCAACAUACUCAUCACC 21 188 9 42 1    0 0 0 15 6 0 18 23 8 0 0 0 7 10 2 0 0 8 6 0 0 42 0 0 0 0 0 1 0 2 2 3 0 0 0 0 0 0 0 0 0 0 2 0 0 0 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 10 0 0 0 0 0 0 0 2 17
stu-miR6022 UGGAAGGGAGAAUAUCCAGGA 21 23,232 347 2,993 1    6 24 11 37 126 177 173 185 172 129 45 71 34 20 15 10 33 25 59 46 12 63 0 82 1,515 931 2,993 6 4 2 1 797 0 0 0 0 308 620 113 501 1,111 119 459 411 134 699 100 287 60 316 154 381 86 195 2,639 218 1,735 444 1,837 450 349 76 167 95 84 127 103 144 424 124 260 98
stu-miR6023 UUCCAUGAAAGUGUUUUUGGAU 22 7,321 141 625 1    22 24 200 177 212 213 612 533 605 387 135 102 288 137 22 71 352 169 625 376 502 209 0 0 1 1 15 43 70 343 347 10 0 0 0 0 39 0 2 9 43 0 11 12 0 10 0 8 0 0 0 0 5 6 96 6 0 16 14 153 0 0 10 10 0 0 4 13 15 10 26 0
stu-miR6024-3p UUUUAGCAAGAGUUGUUUUCCC 22 14,081 204 1,223 5    66 12 122 118 240 266 421 232 601 461 118 142 154 88 15 51 91 59 218 160 220 220 0 0 40 86 55 5 13 40 34 55 1,110 981 562 101 71 312 186 72 163 26 429 138 103 147 24 211 45 53 323 61 73 214 40 82 15 108 0 921 35 59 49 24 73 92 94 254 140 287 1,223 777
stu-miR6024-5p AGAAACAACACUUGCUAAAAGA 22 12,776 213 4,433 1    0 0 22 15 11 9 40 46 35 37 34 0 13 20 0 0 7 17 6 11 12 0 0 0 1 1 1 1 1 17 16 27 0 0 0 0 102 8 2 53 35 5 89 1,094 12 538 76 68 8 21 6 4 64 57 4,433 371 248 36 2 81 50 14 83 200 22 51 39 96 70 94 28 4,216
stu-miR6025 UACCAACAAUUGAGAUAACAUC 22 18,219 285 4,196 2    6 0 33 52 109 106 98 116 51 55 56 10 40 20 2 15 13 51 82 80 31 31 0 0 14 19 49 4 3 15 9 23 0 0 0 0 65 4,196 2,741 1,724 171 47 241 166 240 108 726 112 105 179 2,165 109 32 422 212 82 4 72 0 166 217 67 54 38 236 601 472 26 25 158 923 124
stu-miR6026-3p UUCUUGGCUAGAGUUGUAUUGC 22 2,165 37 230 2    50 48 89 177 183 230 129 139 180 166 107 61 13 59 2 15 13 17 53 125 31 10 0 0 8 8 8 16 12 7 8 10 11 13 15 2 3 4 2 6 2 5 7 0 12 10 0 4 0 0 3 0 5 13 20 0 0 4 0 4 8 8 0 0 6 0 4 4 10 0 2 4
stu-miR6026-5p AAUACAACUAUUGCCAAGACAA 22 167 9 31 1    0 0 0 15 17 9 0 23 12 0 6 31 0 10 2 0 0 0 6 11 0 0 0 0 1 1 2 0 0 1 1 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 10 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4
stu-miR6027 UGAAUCCUUCGGCUAUCCAUAA 22 28,541 408 4,251 1    199 227 222 272 309 372 306 278 301 332 174 275 161 128 35 81 46 42 189 183 183 94 348 246 1,893 3,239 2,938 16 29 333 270 4,251 1 0 1 0 235 166 126 19 91 187 342 703 131 337 160 422 83 79 228 109 286 459 303 124 2 384 3 106 62 127 191 81 225 112 292 1,443 135 574 168 2,072
stu-miR6149-3p