Potato Small RNA miRNA Abundances

The data below are based on the microRNAs listed in the Sanger registry. Adjust libraries/reads to display on the control panel.


        miRNA         miRNA sequence Len Sum (norm) Average Max Min (>0)  RNA_Stu_c5_STS3aRNA_Stu_c5_STS3bRNA_Stu_c5_STS2aRNA_Stu_c5_STS2bRNA_Stu_c5_STS1aRNA_Stu_c5_STS1bRNA_Stu_c5_SS3aRNA_Stu_c5_SS3bRNA_Stu_c5_SS2aRNA_Stu_c5_SS2bRNA_Stu_c5_SS1aRNA_Stu_c5_SS1bRNA_Stu_c5_LL3aRNA_Stu_c5_LL3bRNA_Stu_c5_LL2aRNA_Stu_c5_LL1aRNA_Stu_c5_LS1aRNA_Stu_c5_LS1bRNA_Stu_c5_LS2aRNA_Stu_c5_LS2bRNA_Stu_c5_LS3aRNA_Stu_c5_LS3bRNA_Stu_c6_T20CRNA_Stu_c6_T4CSTU1STU2STU3sRNA_STub_c1_t2sRNA_STub_c1_t1sRNA_STub_c1_le2sRNA_STub_c1_l1sRNA_Stub_c3_PEGsRNA_STov_c1_cosRNA_STov_c1_6sRNA_STov_c1_12sRNA_STov_c1_18sRNA_GAF23sRNA_GAF46sRNA_GAF48sRNA_GAF49sRNA_GAF63sRNA_GAF64sRNA_GAF75sRNA_GAF40sRNA_GAF36sRNA_GAF66sRNA_GAF62sRNA_GAF35sRNA_GAF52sRNA_GAF50sRNA_GAF42sRNA_GAF57sRNA_GAF38sRNA_GAF74sRNA_GAF26sRNA_GAF72sRNA_GAF25sRNA_GAF41sRNA_GAF24sRNA_GAF47sRNA_GAF32sRNA_GAF51sRNA_GAF58sRNA_GAF37sRNA_GAF56sRNA_GAF61sRNA_GAF65sRNA_GAF120sRNA_GAF119sRNA_GAF117sRNA_GAF45sRNA_GAF127
stu-miR156a UUGACAGAAGAUAGAGAGCAC 21 2,746,887 38,151 892,143 147    304 370 499 486 801 1,063 3,060 3,431 2,432 2,709 1,073 1,037 953 1,384 147 391 755 717 1,291 1,643 1,150 1,205 299 205 892,143 52,840 29,087 3,650 2,522 3,499 3,386 73,321 145,013 56,883 55,640 57,918 69,385 6,314 12,609 9,917 7,330 29,273 18,564 14,691 25,049 20,048 3,970 32,441 4,293 15,015 5,173 20,037 51,701 92,505 49,743 25,092 105,105 42,945 291,663 24,959 8,803 15,098 42,610 28,177 18,358 33,502 9,402 55,458 40,379 39,213 15,558 59,200
stu-miR156b UUGACAGAAGAUAGAGAGCAC 21 2,746,887 38,151 892,143 147    304 370 499 486 801 1,063 3,060 3,431 2,432 2,709 1,073 1,037 953 1,384 147 391 755 717 1,291 1,643 1,150 1,205 299 205 892,143 52,840 29,087 3,650 2,522 3,499 3,386 73,321 145,013 56,883 55,640 57,918 69,385 6,314 12,609 9,917 7,330 29,273 18,564 14,691 25,049 20,048 3,970 32,441 4,293 15,015 5,173 20,037 51,701 92,505 49,743 25,092 105,105 42,945 291,663 24,959 8,803 15,098 42,610 28,177 18,358 33,502 9,402 55,458 40,379 39,213 15,558 59,200
stu-miR156c UUGACAGAAGAUAGAGAGCAC 21 2,746,887 38,151 892,143 147    304 370 499 486 801 1,063 3,060 3,431 2,432 2,709 1,073 1,037 953 1,384 147 391 755 717 1,291 1,643 1,150 1,205 299 205 892,143 52,840 29,087 3,650 2,522 3,499 3,386 73,321 145,013 56,883 55,640 57,918 69,385 6,314 12,609 9,917 7,330 29,273 18,564 14,691 25,049 20,048 3,970 32,441 4,293 15,015 5,173 20,037 51,701 92,505 49,743 25,092 105,105 42,945 291,663 24,959 8,803 15,098 42,610 28,177 18,358 33,502 9,402 55,458 40,379 39,213 15,558 59,200
stu-miR156d-3p GCUCUCUAUGCUUCUGUCAUCA 22 21,830 303 6,926 1    6 0 11 0 6 0 18 0 16 37 0 10 7 0 0 0 13 0 6 11 6 10 0 0 16 0 0 0 0 22 15 1 81 96 124 67 276 231 442 94 31 52 207 1,106 62 3,276 120 199 0 158 92 131 0 126 6,926 589 0 80 35 509 39 28 490 143 168 153 43 87 50 248 831 4,229
stu-miR156d-5p UUGACAGAAGAUAGAGAGCAC 21 2,746,887 38,151 892,143 147    304 370 499 486 801 1,063 3,060 3,431 2,432 2,709 1,073 1,037 953 1,384 147 391 755 717 1,291 1,643 1,150 1,205 299 205 892,143 52,840 29,087 3,650 2,522 3,499 3,386 73,321 145,013 56,883 55,640 57,918 69,385 6,314 12,609 9,917 7,330 29,273 18,564 14,691 25,049 20,048 3,970 32,441 4,293 15,015 5,173 20,037 51,701 92,505 49,743 25,092 105,105 42,945 291,663 24,959 8,803 15,098 42,610 28,177 18,358 33,502 9,402 55,458 40,379 39,213 15,558 59,200
stu-miR156e UGACAGAAGAGAGUGAGCAC 20 76,585 1,064 23,790 10    50 12 33 44 57 89 279 464 180 147 107 122 47 49 10 36 46 34 65 114 31 63 100 82 23,790 2,287 9,777 2,865 1,624 99 69 3,526 403 635 498 995 498 423 199 501 231 986 528 158 187 49 160 1,793 226 211 185 656 863 1,196 607 295 388 760 52 212 0 281 343 380 337 458 86 4,549 3,693 2,872 1,343 2,050
stu-miR156f-3p CUCACUUCUCUUUCUGUCAAUC 22 256 4 101 2    0 0 0 0 0 0 4 0 4 18 0 0 0 0 0 0 0 0 6 0 6 0 0 0 0 0 0 0 2 26 15 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 31 0 0 0 101 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 43
stu-miR156f-5p CUGACAGAAGAGAGUGAGCA 20 46,281 643 9,557 5    22 0 11 66 34 44 35 139 51 92 67 92 20 29 5 5 26 25 41 11 6 10 50 123 9,557 1,413 5,620 48 25 70 58 7,173 0 0 8 0 332 346 1,040 1,251 1,506 1,142 367 513 31 685 1,163 558 678 738 92 1,094 363 252 859 177 366 720 87 2,207 271 197 441 143 730 153 1,760 131 399 0 0 513
stu-miR156g-3p GCUUACUCUCUAUCUGUCACC 21 3,460 48 525 3    6 12 33 29 11 9 35 93 55 55 6 20 0 0 0 0 7 8 12 23 6 0 0 0 24 8 19 306 182 7 4 3 0 0 0 0 14 0 22 0 0 0 115 0 0 0 0 0 0 0 0 0 0 63 0 0 0 0 0 42 0 0 0 0 56 51 0 525 499 396 405 299
stu-miR156g-5p UGACAGAAGAGAGUGAGCAC 20 76,585 1,064 23,790 10    50 12 33 44 57 89 279 464 180 147 107 122 47 49 10 36 46 34 65 114 31 63 100 82 23,790 2,287 9,777 2,865 1,624 99 69 3,526 403 635 498 995 498 423 199 501 231 986 528 158 187 49 160 1,793 226 211 185 656 863 1,196 607 295 388 760 52 212 0 281 343 380 337 458 86 4,549 3,693 2,872 1,343 2,050
stu-miR156h-3p GCUCACUGCUCUAUCUGUCACC 22 2,178 30 321 1    0 0 0 7 0 18 40 46 4 55 0 20 0 0 0 0 0 0 0 0 0 21 0 0 0 0 8 321 231 7 12 1 177 285 276 107 0 0 0 0 0 0 23 0 0 0 0 0 0 53 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 131 50 50 107 128
stu-miR156h-5p UGACAGAAGAGAGUGAGCAC 20 76,585 1,064 23,790 10    50 12 33 44 57 89 279 464 180 147 107 122 47 49 10 36 46 34 65 114 31 63 100 82 23,790 2,287 9,777 2,865 1,624 99 69 3,526 403 635 498 995 498 423 199 501 231 986 528 158 187 49 160 1,793 226 211 185 656 863 1,196 607 295 388 760 52 212 0 281 343 380 337 458 86 4,549 3,693 2,872 1,343 2,050
stu-miR156i-3p GCUCACUGCUCUAUCUGUCACC 22 2,178 30 321 1    0 0 0 7 0 18 40 46 4 55 0 20 0 0 0 0 0 0 0 0 0 21 0 0 0 0 8 321 231 7 12 1 177 285 276 107 0 0 0 0 0 0 23 0 0 0 0 0 0 53 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 131 50 50 107 128
stu-miR156i-5p UGACAGAAGAGAGUGAGCAC 20 76,585 1,064 23,790 10    50 12 33 44 57 89 279 464 180 147 107 122 47 49 10 36 46 34 65 114 31 63 100 82 23,790 2,287 9,777 2,865 1,624 99 69 3,526 403 635 498 995 498 423 199 501 231 986 528 158 187 49 160 1,793 226 211 185 656 863 1,196 607 295 388 760 52 212 0 281 343 380 337 458 86 4,549 3,693 2,872 1,343 2,050
stu-miR156j-3p GCUCACUGCUCUAUCUGUCACC 22 2,178 30 321 1    0 0 0 7 0 18 40 46 4 55 0 20 0 0 0 0 0 0 0 0 0 21 0 0 0 0 8 321 231 7 12 1 177 285 276 107 0 0 0 0 0 0 23 0 0 0 0 0 0 53 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 131 50 50 107 128
stu-miR156j-5p UGACAGAAGAGAGUGAGCAC 20 76,585 1,064 23,790 10    50 12 33 44 57 89 279 464 180 147 107 122 47 49 10 36 46 34 65 114 31 63 100 82 23,790 2,287 9,777 2,865 1,624 99 69 3,526 403 635 498 995 498 423 199 501 231 986 528 158 187 49 160 1,793 226 211 185 656 863 1,196 607 295 388 760 52 212 0 281 343 380 337 458 86 4,549 3,693 2,872 1,343 2,050
stu-miR156k-3p GCUCACUGCUCUAUCUGUCACC 22 2,178 30 321 1    0 0 0 7 0 18 40 46 4 55 0 20 0 0 0 0 0 0 0 0 0 21 0 0 0 0 8 321 231 7 12 1 177 285 276 107 0 0 0 0 0 0 23 0 0 0 0 0 0 53 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 131 50 50 107 128
stu-miR156k-5p UGACAGAAGAGAGUGAGCAC 20 76,585 1,064 23,790 10    50 12 33 44 57 89 279 464 180 147 107 122 47 49 10 36 46 34 65 114 31 63 100 82 23,790 2,287 9,777 2,865 1,624 99 69 3,526 403 635 498 995 498 423 199 501 231 986 528 158 187 49 160 1,793 226 211 185 656 863 1,196 607 295 388 760 52 212 0 281 343 380 337 458 86 4,549 3,693 2,872 1,343 2,050
stu-miR160a-3p GCGUAUGAGGAGCCAAGCAUA 21 9,201 128 6,748 3    0 0 11 22 29 53 84 162 78 184 39 71 7 0 0 10 0 17 6 11 12 10 0 0 85 23 43 0 4 40 46 6,748 75 56 22 3 0 0 0 0 0 0 0 395 0 49 0 120 0 0 0 0 0 0 101 0 0 0 0 0 0 0 0 0 0 0 0 44 0 50 21 470
stu-miR160a-5p UGCCUGGCUCCCUGUAUGCCA 21 9,070 126 1,355 6    11 72 11 15 6 9 124 162 113 258 135 132 423 324 162 198 150 211 359 582 336 283 0 0 101 590 424 0 0 22 12 10 1,355 1,153 219 20 0 38 22 31 15 0 69 39 62 49 80 40 0 53 31 44 0 0 0 59 0 0 0 0 78 0 0 0 112 102 0 0 100 0 64 0
stu-miR160b UGCCUGGCUCCCUGUAUGCCA 21 9,070 126 1,355 6    11 72 11 15 6 9 124 162 113 258 135 132 423 324 162 198 150 211 359 582 336 283 0 0 101 590 424 0 0 22 12 10 1,355 1,153 219 20 0 38 22 31 15 0 69 39 62 49 80 40 0 53 31 44 0 0 0 59 0 0 0 0 78 0 0 0 112 102 0 0 100 0 64 0
stu-miR162a-3p UCGAUAAACCUCUGCAUCCAG 21 351,450 4,881 29,813 52    3,501 4,135 6,745 7,180 15,869 17,228 11,294 12,682 11,304 13,216 5,274 6,466 2,952 2,915 710 1,400 2,045 1,932 3,966 3,742 3,168 3,247 0 0 5,892 1,848 3,830 3,930 3,018 5,087 4,162 1,509 16,405 18,720 10,604 3,434 1,590 2,040 1,748 1,345 2,397 1,765 5,048 5,292 5,390 6,063 882 6,098 678 3,108 2,340 2,100 2,226 5,852 2,325 2,827 0 6,758 52 467 1,745 2,699 2,253 903 2,807 2,037 3,778 9,666 2,346 3,961 1,641 29,813
stu-miR162a-5p GGAGGCAGCGGUUCAUCGAUC 21 42,748 594 22,851 10    55 84 33 74 114 177 102 46 86 147 62 61 34 29 10 30 0 25 24 46 18 31 0 0 24 12 101 15 13 1,084 837 909 59 121 87 32 0 38 44 0 231 208 46 1,896 31 5,037 1,363 120 75 53 277 87 0 0 1,567 1,119 0 80 0 170 0 84 1,518 380 281 51 258 44 150 0 107 22,851
stu-miR162b-3p UCGAUAAACCUCUGCAUCCAG 21 351,450 4,881 29,813 52    3,501 4,135 6,745 7,180 15,869 17,228 11,294 12,682 11,304 13,216 5,274 6,466 2,952 2,915 710 1,400 2,045 1,932 3,966 3,742 3,168 3,247 0 0 5,892 1,848 3,830 3,930 3,018 5,087 4,162 1,509 16,405 18,720 10,604 3,434 1,590 2,040 1,748 1,345 2,397 1,765 5,048 5,292 5,390 6,063 882 6,098 678 3,108 2,340 2,100 2,226 5,852 2,325 2,827 0 6,758 52 467 1,745 2,699 2,253 903 2,807 2,037 3,778 9,666 2,346 3,961 1,641 29,813
stu-miR162b-5p GGAGGCAGCGGUUCAUCGAUC 21 42,748 594 22,851 10    55 84 33 74 114 177 102 46 86 147 62 61 34 29 10 30 0 25 24 46 18 31 0 0 24 12 101 15 13 1,084 837 909 59 121 87 32 0 38 44 0 231 208 46 1,896 31 5,037 1,363 120 75 53 277 87 0 0 1,567 1,119 0 80 0 170 0 84 1,518 380 281 51 258 44 150 0 107 22,851
stu-miR164-3p CAUGUGCUCUAGCUCUCCAGC 21 107 1 34 4    6 0 0 22 34 18 0 0 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 15 4 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR164-5p UGGAGAAGCAGGGCACAUGCU 21 44 1 21 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 8 0 0 0 0 1 0 8 3 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 21 0
stu-miR166a-3p UCGGACCAGGCUUCAUUCCCC 21 9,030,546 125,424 550,085 50    181,789 186,439 182,827 183,704 528,768 528,558 387,174 388,519 206,286 201,276 194,336 201,658 221,441 206,040 51,624 98,669 173,114 166,511 275,597 264,639 238,048 233,830 50 0 60,357 171,024 279,047 214,809 207,368 550,085 363,190 105,351 134,464 93,230 36,163 10,439 21,760 19,826 20,883 28,750 42,322 26,678 139,492 48,536 27,293 44,742 15,840 59,662 22,367 48,839 26,421 24,675 40,161 109,307 15,519 22,677 2,952 72,615 1,499 24,832 15,822 43,777 29,925 10,834 28,294 18,787 25,372 124,474 112,002 58,523 45,289 83,375
stu-miR166a-5p GGAAUGUUGUCUGGCUCGAGG 21 350,392 4,867 63,324 38    883 1,100 1,797 1,915 4,792 5,007 2,492 2,805 1,592 2,230 1,168 1,474 704 805 197 512 469 793 966 1,289 795 817 0 0 3,435 1,176 1,246 117 38 342 243 3,792 6,097 6,363 4,646 2,697 4,811 3,657 2,433 970 2,566 3,426 1,193 12,006 498 63,324 4,050 1,833 4,669 2,687 1,940 1,662 999 3,209 60,561 5,242 1,594 2,839 1,324 15,323 931 675 15,085 8,078 2,414 305 2,748 1,749 6,389 594 4,476 39,338
stu-miR166b UCGGACCAGGCUUCAUUCCUC 21 2,021,273 28,073 341,249 50    11,214 10,194 12,691 13,550 26,174 26,330 38,903 39,112 23,388 21,842 9,643 10,055 22,077 20,765 5,764 12,072 21,970 21,046 33,553 31,714 30,759 29,924 50 0 70,189 341,249 76,344 4,150 4,720 22,751 15,667 291,930 62,995 31,503 32,059 6,273 11,668 5,043 9,070 1,908 25,556 11,107 50,666 15,323 5,857 19,951 8,341 13,112 13,029 5,637 5,358 12,950 13,493 24,165 3,539 10,367 1,508 40,586 662 8,150 3,606 15,042 14,007 3,849 15,888 1,629 11,549 65,123 50,461 20,003 33,290 37,160
stu-miR166c-3p UCGGACCAGGCUUCAUUCCCC 21 9,030,546 125,424 550,085 50    181,789 186,439 182,827 183,704 528,768 528,558 387,174 388,519 206,286 201,276 194,336 201,658 221,441 206,040 51,624 98,669 173,114 166,511 275,597 264,639 238,048 233,830 50 0 60,357 171,024 279,047 214,809 207,368 550,085 363,190 105,351 134,464 93,230 36,163 10,439 21,760 19,826 20,883 28,750 42,322 26,678 139,492 48,536 27,293 44,742 15,840 59,662 22,367 48,839 26,421 24,675 40,161 109,307 15,519 22,677 2,952 72,615 1,499 24,832 15,822 43,777 29,925 10,834 28,294 18,787 25,372 124,474 112,002 58,523 45,289 83,375
stu-miR166c-5p GGAAUGUUGUUUGGCUCGAGG 21 1,608 22 758 3    11 0 0 7 34 44 4 0 4 0 6 10 0 0 0 0 0 0 0 0 0 0 0 0 12 16 16 0 0 0 0 3 11 88 54 32 0 0 0 0 0 0 46 79 0 49 0 0 0 0 31 0 0 0 758 0 22 0 0 0 0 0 0 143 0 0 0 0 0 0 0 128
stu-miR166d-3p UCGGACCAGGCUUCAUUCCCC 21 9,030,546 125,424 550,085 50    181,789 186,439 182,827 183,704 528,768 528,558 387,174 388,519 206,286 201,276 194,336 201,658 221,441 206,040 51,624 98,669 173,114 166,511 275,597 264,639 238,048 233,830 50 0 60,357 171,024 279,047 214,809 207,368 550,085 363,190 105,351 134,464 93,230 36,163 10,439 21,760 19,826 20,883 28,750 42,322 26,678 139,492 48,536 27,293 44,742 15,840 59,662 22,367 48,839 26,421 24,675 40,161 109,307 15,519 22,677 2,952 72,615 1,499 24,832 15,822 43,777 29,925 10,834 28,294 18,787 25,372 124,474 112,002 58,523 45,289 83,375
stu-miR166d-5p AGAAUGUCGUCUGGUUCGAGA 21 14,437 201 951 20    375 454 455 655 716 842 909 951 675 793 320 468 34 118 42 20 65 93 141 171 80 73 0 0 182 39 564 28 43 305 235 391 0 0 0 0 111 154 177 125 231 0 46 39 0 391 40 40 75 158 277 44 0 0 354 59 22 40 87 764 155 28 196 0 0 0 258 44 0 50 192 43
stu-miR167a-3p GAUCAUGUGGCAGCCUCACC 20 39 1 10 6    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 8 6 0 0 10 0 0 0 0 0 0 0 7 8 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR167a-5p UGAAGCUGCCAGCAUGAUCUA 21 1,049,343 14,574 260,852 10    0 0 11 37 46 35 111 139 121 92 39 81 335 363 120 167 287 549 530 707 349 398 100 82 135,856 260,852 6,169 10 13 85 69 25,596 2,672 1,153 482 281 18,718 9,162 7,765 15,016 14,814 15,779 36,393 21,128 32,714 18,973 7,258 42,843 14,158 12,908 9,792 13,212 13,584 51,539 28,107 11,074 1,465 48,583 1,533 18,337 15,473 20,216 8,718 3,849 10,891 21,333 12,064 20,294 11,929 8,962 6,671 6,151
stu-miR167b-3p GAUCAUGUGGCAGCAUCACC 20 2,404 33 495 2    6 0 0 7 0 9 22 0 43 0 11 10 20 29 2 20 20 17 18 80 55 42 0 0 28 0 4 0 4 18 4 20 495 382 89 373 0 0 22 0 0 0 0 39 31 196 0 0 0 0 31 0 0 63 101 0 0 0 0 42 0 0 0 0 0 51 0 0 0 0 0 0
stu-miR167b-5p UGAAGCUGCCAGCAUGAUCUA 21 1,049,343 14,574 260,852 10    0 0 11 37 46 35 111 139 121 92 39 81 335 363 120 167 287 549 530 707 349 398 100 82 135,856 260,852 6,169 10 13 85 69 25,596 2,672 1,153 482 281 18,718 9,162 7,765 15,016 14,814 15,779 36,393 21,128 32,714 18,973 7,258 42,843 14,158 12,908 9,792 13,212 13,584 51,539 28,107 11,074 1,465 48,583 1,533 18,337 15,473 20,216 8,718 3,849 10,891 21,333 12,064 20,294 11,929 8,962 6,671 6,151
stu-miR167c-3p GGUCAUGCUCGGACAGCCUCACU 23 5,302 74 790 4    55 48 89 66 229 230 333 325 199 147 185 203 27 10 10 0 0 0 65 57 49 10 0 0 0 4 4 20 20 426 297 138 790 470 187 17 0 0 0 31 0 0 0 118 0 0 40 0 0 0 62 0 0 0 0 0 0 0 0 42 0 0 0 0 0 0 0 0 0 0 43 256
stu-miR167c-5p UGAAGCUGCCAGCAUGAUCUA 21 1,049,343 14,574 260,852 10    0 0 11 37 46 35 111 139 121 92 39 81 335 363 120 167 287 549 530 707 349 398 100 82 135,856 260,852 6,169 10 13 85 69 25,596 2,672 1,153 482 281 18,718 9,162 7,765 15,016 14,814 15,779 36,393 21,128 32,714 18,973 7,258 42,843 14,158 12,908 9,792 13,212 13,584 51,539 28,107 11,074 1,465 48,583 1,533 18,337 15,473 20,216 8,718 3,849 10,891 21,333 12,064 20,294 11,929 8,962 6,671 6,151
stu-miR167d-3p GAUCAUGUGGUUGCUUCACC 20 2,704 38 387 10    0 0 0 0 0 0 18 0 0 0 0 10 80 59 10 46 13 42 65 80 24 52 0 0 16 0 0 0 0 29 31 12 387 80 43 127 0 77 66 156 61 0 0 0 156 49 40 40 0 0 0 87 0 126 202 59 0 0 0 85 0 0 49 48 0 0 43 0 50 0 43 43
stu-miR167d-5p UGAAGCUGCCAGCAUGAUCUA 21 1,049,343 14,574 260,852 10    0 0 11 37 46 35 111 139 121 92 39 81 335 363 120 167 287 549 530 707 349 398 100 82 135,856 260,852 6,169 10 13 85 69 25,596 2,672 1,153 482 281 18,718 9,162 7,765 15,016 14,814 15,779 36,393 21,128 32,714 18,973 7,258 42,843 14,158 12,908 9,792 13,212 13,584 51,539 28,107 11,074 1,465 48,583 1,533 18,337 15,473 20,216 8,718 3,849 10,891 21,333 12,064 20,294 11,929 8,962 6,671 6,151
stu-miR169a-3p GCAGUCUCCUUGGCUACU 18 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR169a-5p UAGCCAAGGAUGACUUGCCU 20 34,298 476 3,696 5    801 896 943 1,311 1,019 966 1,778 2,202 1,464 1,714 708 844 1,503 1,531 275 609 1,244 1,586 3,294 3,696 2,428 2,482 0 0 0 0 0 0 0 342 405 0 27 16 5 0 28 0 0 0 15 0 23 0 0 0 0 0 0 0 0 0 0 63 0 0 0 80 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR169b-3p GCAGUCUCCUUGGCUACU 18 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR169b-5p UAGCCAAGGAUGACUUGCCU 20 34,298 476 3,696 5    801 896 943 1,311 1,019 966 1,778 2,202 1,464 1,714 708 844 1,503 1,531 275 609 1,244 1,586 3,294 3,696 2,428 2,482 0 0 0 0 0 0 0 342 405 0 27 16 5 0 28 0 0 0 15 0 23 0 0 0 0 0 0 0 0 0 0 63 0 0 0 80 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR169c-3p GCAGUCUCCUUGGCUACC 18 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR169c-5p UAGCCAAGGAUGACUUGCCU 20 34,298 476 3,696 5    801 896 943 1,311 1,019 966 1,778 2,202 1,464 1,714 708 844 1,503 1,531 275 609 1,244 1,586 3,294 3,696 2,428 2,482 0 0 0 0 0 0 0 342 405 0 27 16 5 0 28 0 0 0 15 0 23 0 0 0 0 0 0 0 0 0 0 63 0 0 0 80 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR169d-3p GCAGGUCAUCUUUAGCUAACU 21 1,023 14 175 4    22 12 0 15 6 27 22 23 12 0 6 20 7 10 0 0 20 0 47 11 31 0 0 0 0 0 0 0 0 7 4 0 0 0 0 0 41 0 0 0 0 0 46 0 0 98 0 0 0 0 0 175 0 126 0 59 0 40 0 0 0 0 0 0 0 51 0 0 0 0 0 85
stu-miR169d-5p UAGCCAAGGAUGACUUGCCU 20 34,298 476 3,696 5    801 896 943 1,311 1,019 966 1,778 2,202 1,464 1,714 708 844 1,503 1,531 275 609 1,244 1,586 3,294 3,696 2,428 2,482 0 0 0 0 0 0 0 342 405 0 27 16 5 0 28 0 0 0 15 0 23 0 0 0 0 0 0 0 0 0 0 63 0 0 0 80 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR169e-3p GCAAGUUAUCCUGGCUAUC 19 191 3 52 4    0 0 11 0 6 9 9 0 16 0 0 0 7 10 0 5 0 0 0 11 0 0 0 0 0 0 0 0 0 0 4 0 0 0 0 0 0 0 0 0 0 52 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 51 0 0 0 0 0 0
stu-miR169e-5p UAGCCAAGGAUGACUUGCCU 20 34,298 476 3,696 5    801 896 943 1,311 1,019 966 1,778 2,202 1,464 1,714 708 844 1,503 1,531 275 609 1,244 1,586 3,294 3,696 2,428 2,482 0 0 0 0 0 0 0 342 405 0 27 16 5 0 28 0 0 0 15 0 23 0 0 0 0 0 0 0 0 0 0 63 0 0 0 80 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR169f-3p GCAAGCAUCCUUGGCGACU 19 89 1 49 40    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 40 0 0 0 0 0 0 0 0 0 0 0 0 0 0 49 0 0 0 0 0 0 0 0 0
stu-miR169f-5p UAGCCAAGGAUGACUUGCCU 20 34,298 476 3,696 5    801 896 943 1,311 1,019 966 1,778 2,202 1,464 1,714 708 844 1,503 1,531 275 609 1,244 1,586 3,294 3,696 2,428 2,482 0 0 0 0 0 0 0 342 405 0 27 16 5 0 28 0 0 0 15 0 23 0 0 0 0 0 0 0 0 0 0 63 0 0 0 80 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR169g UAGCCAAGGAUGACUUGCCU 20 34,298 476 3,696 5    801 896 943 1,311 1,019 966 1,778 2,202 1,464 1,714 708 844 1,503 1,531 275 609 1,244 1,586 3,294 3,696 2,428 2,482 0 0 0 0 0 0 0 342 405 0 27 16 5 0 28 0 0 0 15 0 23 0 0 0 0 0 0 0 0 0 0 63 0 0 0 80 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR169h UAGCCAAGGAUGACUUGCCU 20 34,298 476 3,696 5    801 896 943 1,311 1,019 966 1,778 2,202 1,464 1,714 708 844 1,503 1,531 275 609 1,244 1,586 3,294 3,696 2,428 2,482 0 0 0 0 0 0 0 342 405 0 27 16 5 0 28 0 0 0 15 0 23 0 0 0 0 0 0 0 0 0 0 63 0 0 0 80 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR171a-3p UGAUUGAGCCGUGCCAAUAUC 21 21,251 295 2,662 6    6 0 78 37 57 53 129 139 101 129 45 41 74 88 22 56 46 42 106 103 61 63 0 0 517 497 479 33 18 268 324 922 2,662 1,888 1,978 145 249 231 243 94 1,368 156 711 237 561 196 201 717 151 0 246 219 182 189 303 236 43 360 105 637 853 112 49 48 112 305 301 131 299 50 149 0
stu-miR171a-5p UAUUGGCCUGGUUCACUCAGA 21 164,403 2,283 41,602 4    33 0 44 44 57 89 310 464 180 240 62 81 275 314 40 86 91 110 265 148 202 178 0 0 12 54 4 8 7 4,289 4,212 64 12,270 6,456 3,399 263 677 616 995 125 1,475 208 11,083 16,429 1,651 14,327 2,166 1,634 979 263 801 1,225 954 2,643 2,174 5,419 43 2,839 0 382 814 647 1,861 808 561 509 644 3,893 2,795 2,079 4,731 41,602
stu-miR171b-3p UUGAGCCGCGUCAAUAUCUCU 21 6,398 89 1,355 3    0 24 44 15 17 35 67 23 27 18 34 41 7 10 5 10 20 8 12 11 12 0 0 0 57 8 1,355 41 20 55 42 151 0 8 3 3 14 77 22 219 0 104 344 276 31 244 0 279 0 53 31 44 0 0 253 0 0 40 17 297 0 0 0 0 0 51 0 525 399 297 128 470
stu-miR171b-5p AGAUAUUGAUGUGGCUCAAUC 21 407 6 70 2    0 0 0 7 11 9 13 70 20 37 0 0 0 0 2 0 0 0 6 0 12 0 0 0 0 0 58 0 0 51 69 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 42 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR171c-3p UGAUUGAGCCGUGUCAAUAUC 21 2,468 34 427 2    0 0 0 7 0 9 49 23 31 18 28 20 7 29 2 0 7 0 29 11 6 10 0 0 0 27 0 0 0 40 42 19 0 0 3 0 14 0 0 0 277 0 115 39 62 98 40 0 0 0 92 0 0 63 51 0 43 120 0 42 427 112 0 48 0 0 43 44 100 50 128 43
stu-miR171c-5p UAUUGGCCUGGUUCACUCAGA 21 164,403 2,283 41,602 4    33 0 44 44 57 89 310 464 180 240 62 81 275 314 40 86 91 110 265 148 202 178 0 0 12 54 4 8 7 4,289 4,212 64 12,270 6,456 3,399 263 677 616 995 125 1,475 208 11,083 16,429 1,651 14,327 2,166 1,634 979 263 801 1,225 954 2,643 2,174 5,419 43 2,839 0 382 814 647 1,861 808 561 509 644 3,893 2,795 2,079 4,731 41,602
stu-miR171d-3p UUGAGCCGUGCCAAUAUCACG 21 3,146 44 399 6    0 0 11 0 6 0 13 0 8 37 0 0 7 10 0 0 7 8 41 34 18 31 0 0 8 12 8 0 0 176 131 10 210 92 70 14 83 0 0 31 77 0 161 197 62 342 0 399 0 0 62 0 45 126 51 59 0 120 0 0 0 28 49 0 56 0 86 44 0 0 21 85
stu-miR171d-5p AGAUAUUGGUGCGGUUCAAUU 21 906 13 403 3    0 0 0 0 0 0 0 0 4 0 0 10 0 0 0 5 0 0 0 0 0 0 0 0 4 0 0 3 0 33 23 403 0 0 0 0 0 0 0 0 0 0 0 158 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 49 0 0 0 0 0 0 0 0 214
stu-miR171e UGAUUGAGCCGUGCCAAUAUC 21 21,251 295 2,662 6    6 0 78 37 57 53 129 139 101 129 45 41 74 88 22 56 46 42 106 103 61 63 0 0 517 497 479 33 18 268 324 922 2,662 1,888 1,978 145 249 231 243 94 1,368 156 711 237 561 196 201 717 151 0 246 219 182 189 303 236 43 360 105 637 853 112 49 48 112 305 301 131 299 50 149 0
stu-miR172a-3p AGAAUCUUGAUGAUGCUGCAU 21 51,537 716 23,739 2    0 0 11 15 17 18 13 0 20 18 51 41 40 20 5 5 13 0 29 57 12 52 0 123 1,136 2,970 23,739 13 2 7 8 17,103 1,296 1,109 152 26 69 77 22 0 61 0 115 355 0 0 80 120 0 0 0 0 45 0 455 471 388 120 157 255 194 0 0 238 0 51 0 0 100 0 43 0
stu-miR172a-5p GUAGCAUAAUCAAGAUUCACA 21 6,202 86 1,475 4    0 0 0 0 0 9 9 0 4 0 6 10 0 0 0 0 0 0 0 0 0 0 0 0 16 0 0 0 0 7 15 7 0 0 0 0 55 38 177 31 61 0 184 1,145 0 196 0 1,475 0 53 31 44 182 441 253 177 0 120 0 722 78 366 49 190 0 51 0 0 0 0 0 0
stu-miR172b-3p AGAAUCUUGAUGAUGCUGCAU 21 51,537 716 23,739 2    0 0 11 15 17 18 13 0 20 18 51 41 40 20 5 5 13 0 29 57 12 52 0 123 1,136 2,970 23,739 13 2 7 8 17,103 1,296 1,109 152 26 69 77 22 0 61 0 115 355 0 0 80 120 0 0 0 0 45 0 455 471 388 120 157 255 194 0 0 238 0 51 0 0 100 0 43 0
stu-miR172b-5p GCAGCACCAUCAAGAUUCACA 21 2,898 40 1,303 2    0 0 0 0 0 9 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 73 0 54 10 2 18 12 97 0 0 0 0 0 0 0 0 0 0 0 1,303 0 49 160 319 0 0 0 0 136 0 354 59 0 40 0 0 39 28 0 48 0 0 86 0 0 0 0 0
stu-miR172c-3p AGAAUCUUGAUGAUGCUGC 19 688 10 348 4    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5 0 0 18 0 0 10 348 287 0 4 16 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR172c-5p AGCAUCUUCAAGAUUCACA 19 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR172d-3p GGAAUCUUGAUGAUGCUGCAG 21 2,117 29 327 2    6 24 33 22 17 9 35 46 78 129 28 41 13 0 2 0 7 0 12 11 6 0 0 0 0 198 327 0 7 4 0 10 183 80 43 0 0 0 0 0 92 0 23 0 0 0 0 0 0 0 0 0 0 0 0 118 0 0 0 0 78 0 0 0 0 0 43 0 250 99 43 0
stu-miR172d-5p GGAGCAUCAUCAAGAUUCACA 21 11,364 158 3,194 6    6 12 11 7 11 0 9 0 8 0 6 0 7 0 0 0 0 0 0 0 0 0 0 0 44 105 160 0 0 0 0 42 22 0 8 0 28 0 44 0 0 0 23 276 280 49 80 518 0 0 154 44 45 189 101 59 0 200 35 340 0 56 0 0 0 0 43 1,225 3,194 1,832 895 1,196
stu-miR172e-3p AGAAUCUUGAUGAUGCUGCAU 21 51,537 716 23,739 2    0 0 11 15 17 18 13 0 20 18 51 41 40 20 5 5 13 0 29 57 12 52 0 123 1,136 2,970 23,739 13 2 7 8 17,103 1,296 1,109 152 26 69 77 22 0 61 0 115 355 0 0 80 120 0 0 0 0 45 0 455 471 388 120 157 255 194 0 0 238 0 51 0 0 100 0 43 0
stu-miR172e-5p GCAACAUCAUCAAGAUUCACA 21 351 5 54 2    17 12 0 15 52 27 18 0 0 0 0 10 0 0 0 0 0 0 0 0 0 0 0 0 0 0 54 3 2 0 0 0 5 0 0 3 0 0 0 0 0 0 0 39 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 44 50 0 0 0
stu-miR1886a AUGGUAUCGUGAGAUGAAAUCAGC 24 142 2 50 4    6 12 0 15 6 9 0 0 0 0 0 0 7 0 0 0 0 0 6 0 6 10 0 0 0 0 4 0 0 11 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 50 0 0 0
stu-miR1886b AUGGUAUCGUGAGAUGAAAUCAGC 24 142 2 50 4    6 12 0 15 6 9 0 0 0 0 0 0 7 0 0 0 0 0 6 0 6 10 0 0 0 0 4 0 0 11 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 50 0 0 0
stu-miR1886c AUGGUAUCGUGAGAUGAAAUCAGC 24 142 2 50 4    6 12 0 15 6 9 0 0 0 0 0 0 7 0 0 0 0 0 6 0 6 10 0 0 0 0 4 0 0 11 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 50 0 0 0
stu-miR1886d AUGGUAUCGUGAGAUGAAAUCAGC 24 142 2 50 4    6 12 0 15 6 9 0 0 0 0 0 0 7 0 0 0 0 0 6 0 6 10 0 0 0 0 4 0 0 11 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 50 0 0 0
stu-miR1886e AUGGUAUCGUGAGAUGAAAUCAGC 24 142 2 50 4    6 12 0 15 6 9 0 0 0 0 0 0 7 0 0 0 0 0 6 0 6 10 0 0 0 0 4 0 0 11 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 50 0 0 0
stu-miR1886f AUGGUAUCGUGAGAUGAAAUCAGC 24 142 2 50 4    6 12 0 15 6 9 0 0 0 0 0 0 7 0 0 0 0 0 6 0 6 10 0 0 0 0 4 0 0 11 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 50 0 0 0
stu-miR1886g-3p UUUCAUAUUGAUUUCAUCUCAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR1886g-5p GAGAUGAGAUCAAUGUUUGGACAU 24 363 5 55 4    0 0 33 15 6 9 4 0 35 55 0 10 13 0 5 5 0 0 18 0 12 10 0 0 0 0 0 8 7 7 4 0 0 0 0 0 0 0 0 0 15 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 42 0 0 0 0 0 0 0 0 50 0 0 0
stu-miR1886h AUUUUACGUUGAUUUCAUCUCAUG 24 70 1 12 3    0 12 0 0 11 0 9 0 12 0 0 0 7 0 0 0 0 0 12 0 0 0 0 0 0 0 0 3 0 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR1886i-3p UUUACGUUGAUUUCAUCUCAUGA 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR1886i-5p AUGAGAUGAAAUUAGCGUUUGGAU 24 461 6 49 1    17 12 22 29 6 18 49 0 31 37 45 20 13 49 2 0 0 8 41 0 18 0 0 0 0 4 0 0 0 4 4 1 0 0 0 0 14 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 17 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR1919-3p ACGAGAGUCAUCUGUGACAGG 21 26,379 366 3,423 30    50 36 89 140 447 585 395 487 301 332 112 193 67 167 30 51 52 177 118 251 92 199 0 0 206 93 401 683 310 1,632 1,566 195 0 0 0 0 276 308 221 125 338 0 92 1,185 31 3,423 361 279 0 369 154 87 45 189 3,387 589 172 280 296 2,207 39 0 343 95 56 51 0 87 898 0 384 555
stu-miR1919-5p UGUCGCAGAUGACUUUCGCCC 21 115,099 1,599 7,386 14    298 299 699 744 1,048 1,250 1,827 1,785 2,155 1,917 893 966 1,308 1,315 200 538 1,029 1,046 2,180 2,316 1,713 1,969 0 82 4,857 4,111 6,745 428 354 1,242 910 3,240 70 40 35 14 525 1,155 642 219 1,091 311 3,006 6,516 997 5,134 241 2,272 602 263 585 656 500 2,140 2,629 2,120 22 1,919 35 7,386 465 1,040 784 1,045 393 1,222 343 1,443 6,239 1,337 4,433 5,766
stu-miR319-3p UUGGACUGAAGGGUUCCCUUC 21 4,068 57 716 4    248 263 455 412 716 638 111 162 152 129 67 81 0 0 0 5 0 0 0 11 0 0 0 0 0 144 4 166 103 0 8 0 32 80 32 49 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR319-5p AGGAAACUGUUUAGUCCAACC 21 765 11 245 2    33 0 44 52 69 71 22 0 12 0 11 10 0 0 0 0 0 0 0 0 0 0 0 0 0 167 245 5 2 4 8 10 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR319a-3p UUGGACUGAAGGGAGCUCCCU 21 1,053,022 14,625 590,006 9    3,065 3,143 9,773 9,551 16,235 17,361 25,697 25,572 31,147 30,118 13,923 14,508 382 324 87 127 423 329 748 753 795 649 0 0 0 31 152 2,883 2,787 1,819 1,184 9 110,768 31,125 13,756 344 41 231 66 250 722 260 711 39 218 342 40 279 151 263 493 350 136 252 0 59 0 600 17 127 78 112 294 95 337 51 215 13,558 590,006 11,536 42,774 18,751
stu-miR319a-5p AGAGCUUUCUUCGGUCCACAC 21 2,875 40 1,681 4    28 0 33 15 109 71 84 93 74 74 34 41 0 0 0 0 0 0 0 11 0 0 0 0 0 23 1,681 15 16 0 4 99 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 50 0 21 299
stu-miR319b UUGGACUGAAGGGAGCUCCU 20 33,328 463 13,109 5    33 12 33 44 132 115 115 70 191 203 67 92 7 20 5 15 13 42 29 46 18 42 0 0 0 0 0 120 70 118 62 0 13,109 6,488 2,297 119 14 192 133 156 907 104 665 79 187 440 201 319 75 105 92 219 136 0 101 59 43 240 105 1,104 0 56 49 143 168 51 0 131 2,745 198 384 0
stu-miR3627-3p AAGUGCCUCUGUCUUUCGACA 21 35 0 23 4    0 0 0 0 0 0 4 23 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR3627-5p UCGCAGGAGAGAUGGCACUUAG 22 1,742 24 1,047 2    0 0 0 0 6 0 18 0 4 18 0 0 13 0 0 10 7 0 6 0 0 0 0 0 1,047 179 167 0 2 74 50 10 0 0 0 0 0 0 0 0 46 0 0 0 0 0 0 0 0 0 0 0 45 0 0 0 0 40 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR384-3p AGGGGGCCAAAGUGCCAAAC 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR384-5p UUGGCAUUCUGUCCACCUCC 20 40,757 566 14,372 5    22 0 55 66 52 142 204 301 367 590 79 122 47 59 5 30 72 59 94 103 104 84 0 0 436 788 1,421 38 22 213 158 6 14,372 9,705 3,179 451 69 269 44 63 415 0 803 39 374 49 0 80 0 0 523 44 0 441 51 118 65 240 52 382 737 56 0 0 56 102 129 0 2,046 0 64 0
stu-miR390-3p CGCUAUCCAUCUUGAGUUUUA 21 12,929 180 2,172 4    0 0 0 0 0 0 0 0 8 0 0 0 0 0 0 0 7 0 6 0 6 0 0 0 53 4 8 0 0 18 27 292 0 0 0 0 166 269 686 313 184 0 184 2,172 187 1,076 762 199 75 53 185 175 182 378 1,567 295 0 240 0 0 194 141 196 0 337 204 129 44 0 198 43 1,666
stu-miR390-5p AAGCUCAGGAGGGAUAGCACC 21 28,494 396 7,084 6    6 24 22 7 11 9 133 93 98 129 90 51 268 393 70 137 176 203 466 525 263 377 0 0 7,084 268 144 8 0 4,043 3,344 1,826 586 1,261 533 197 41 77 199 0 92 52 252 671 93 391 321 438 151 0 62 131 0 63 758 118 0 360 35 42 271 84 98 95 0 255 86 0 0 50 21 342
stu-miR391-3p GCAUCAUACUCCUGCAUAUU 20 114 2 49 22    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 22 0 0 0 0 0 0 0 0 0 0 0 0 0 49 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 43
stu-miR391-5p UACGCAGGAGAGAUGAUGCUG 21 22,324 310 2,282 11    39 36 89 66 86 142 106 116 86 111 11 51 1,207 1,609 292 715 1,055 1,418 1,892 2,282 1,205 1,718 0 0 1,911 128 121 82 96 1,533 1,485 1,072 0 0 0 0 28 308 44 31 61 0 321 39 0 0 0 40 0 105 0 44 45 0 253 0 0 40 0 85 0 28 49 0 0 0 0 0 0 0 0 43
stu-miR393-3p AUCAUGCGAUCUCUUCGGAAU 21 12,410 172 4,093 2    0 0 22 22 155 142 0 23 16 0 6 0 27 59 2 15 13 0 24 34 18 10 0 0 202 43 54 13 2 584 471 4,093 97 36 8 9 41 115 0 63 123 0 46 513 0 1,760 40 120 0 105 31 44 0 0 1,567 412 0 0 17 552 39 28 245 0 0 0 0 0 50 0 0 299
stu-miR393-5p UCCAAAGGGAUCGCAUUGAUCC 22 21,025 292 11,234 4    6 0 22 15 23 35 27 23 35 37 0 20 7 10 5 25 33 42 24 23 6 0 0 0 0 12 12 15 9 33 4 0 296 293 116 9 0 0 420 532 11,234 1,194 344 0 218 49 602 199 0 105 308 875 0 126 0 0 0 160 0 891 78 0 196 0 281 102 1,546 0 50 0 298 0
stu-miR395a CUGAAGUGUUUGGGGGAACUC 21 3,014 42 555 1    0 0 0 0 0 0 0 23 4 0 6 0 7 10 2 5 7 0 18 11 12 0 0 0 0 8 0 5 2 4 4 1 70 60 30 0 14 0 44 0 31 0 0 39 0 440 40 0 0 53 31 0 136 63 101 177 0 240 0 127 0 0 98 48 56 0 0 175 100 50 107 555
stu-miR395b CUGAAGUGUUUGGGGGAACUC 21 3,014 42 555 1    0 0 0 0 0 0 0 23 4 0 6 0 7 10 2 5 7 0 18 11 12 0 0 0 0 8 0 5 2 4 4 1 70 60 30 0 14 0 44 0 31 0 0 39 0 440 40 0 0 53 31 0 136 63 101 177 0 240 0 127 0 0 98 48 56 0 0 175 100 50 107 555
stu-miR395c CUGAAGUGUUUGGGGGAACUC 21 3,014 42 555 1    0 0 0 0 0 0 0 23 4 0 6 0 7 10 2 5 7 0 18 11 12 0 0 0 0 8 0 5 2 4 4 1 70 60 30 0 14 0 44 0 31 0 0 39 0 440 40 0 0 53 31 0 136 63 101 177 0 240 0 127 0 0 98 48 56 0 0 175 100 50 107 555
stu-miR395d CUGAAGUGUUUGGGGGAACUC 21 3,014 42 555 1    0 0 0 0 0 0 0 23 4 0 6 0 7 10 2 5 7 0 18 11 12 0 0 0 0 8 0 5 2 4 4 1 70 60 30 0 14 0 44 0 31 0 0 39 0 440 40 0 0 53 31 0 136 63 101 177 0 240 0 127 0 0 98 48 56 0 0 175 100 50 107 555
stu-miR395e CUGAAGUGUUUGGGGGAACUC 21 3,014 42 555 1    0 0 0 0 0 0 0 23 4 0 6 0 7 10 2 5 7 0 18 11 12 0 0 0 0 8 0 5 2 4 4 1 70 60 30 0 14 0 44 0 31 0 0 39 0 440 40 0 0 53 31 0 136 63 101 177 0 240 0 127 0 0 98 48 56 0 0 175 100 50 107 555
stu-miR395f CUGAAGUGUUUGGGGGAACUC 21 3,014 42 555 1    0 0 0 0 0 0 0 23 4 0 6 0 7 10 2 5 7 0 18 11 12 0 0 0 0 8 0 5 2 4 4 1 70 60 30 0 14 0 44 0 31 0 0 39 0 440 40 0 0 53 31 0 136 63 101 177 0 240 0 127 0 0 98 48 56 0 0 175 100 50 107 555
stu-miR395g CUGAAGUGUUUGGGGGAACUC 21 3,014 42 555 1    0 0 0 0 0 0 0 23 4 0 6 0 7 10 2 5 7 0 18 11 12 0 0 0 0 8 0 5 2 4 4 1 70 60 30 0 14 0 44 0 31 0 0 39 0 440 40 0 0 53 31 0 136 63 101 177 0 240 0 127 0 0 98 48 56 0 0 175 100 50 107 555
stu-miR395h CUGAAGUGUUUGGGGGAACUC 21 3,014 42 555 1    0 0 0 0 0 0 0 23 4 0 6 0 7 10 2 5 7 0 18 11 12 0 0 0 0 8 0 5 2 4 4 1 70 60 30 0 14 0 44 0 31 0 0 39 0 440 40 0 0 53 31 0 136 63 101 177 0 240 0 127 0 0 98 48 56 0 0 175 100 50 107 555
stu-miR395i CUGAAGUGUUUGGGGGAACUC 21 3,014 42 555 1    0 0 0 0 0 0 0 23 4 0 6 0 7 10 2 5 7 0 18 11 12 0 0 0 0 8 0 5 2 4 4 1 70 60 30 0 14 0 44 0 31 0 0 39 0 440 40 0 0 53 31 0 136 63 101 177 0 240 0 127 0 0 98 48 56 0 0 175 100 50 107 555
stu-miR395j CUGAAGUGUUUGGGGGAACUC 21 3,014 42 555 1    0 0 0 0 0 0 0 23 4 0 6 0 7 10 2 5 7 0 18 11 12 0 0 0 0 8 0 5 2 4 4 1 70 60 30 0 14 0 44 0 31 0 0 39 0 440 40 0 0 53 31 0 136 63 101 177 0 240 0 127 0 0 98 48 56 0 0 175 100 50 107 555
stu-miR396-3p GUCCAAGAAAGCUGUGGGAAA 21 401,366 5,575 127,796 3    0 0 11 0 6 18 4 0 4 18 0 10 7 0 0 0 0 0 0 11 6 0 0 0 145 0 58 3 0 1,301 852 1,304 0 0 0 0 2,226 1,463 1,571 94 400 311 1,446 82,064 3,240 46,258 1,404 2,391 301 211 2,217 919 5,906 5,475 127,796 12,723 8,037 3,879 9,375 6,112 1,435 1,097 7,738 12,924 730 1,018 515 2,318 3,943 1,931 1,151 36,989
stu-miR396-5p UUCCACAGCUUUCUUGAACUU 21 1,385,433 19,242 120,194 368    1,347 1,350 5,214 4,426 8,049 7,639 9,317 7,790 8,864 6,709 2,398 2,389 4,978 3,376 460 1,131 4,487 2,869 11,072 7,472 6,642 5,384 0 0 1,224 590 623 2,630 2,152 24,938 19,415 368 96,976 119,952 27,572 3,845 20,944 13,705 12,609 3,003 20,930 9,965 87,702 44,034 34,240 30,659 7,058 30,528 4,820 6,217 16,875 13,825 28,485 120,194 26,237 14,136 2,284 56,620 1,830 11,715 10,586 9,953 14,791 12,544 12,856 6,262 18,804 92,633 62,539 72,336 13,384 26,482
stu-miR397-3p CAUCAACGCUACACUCAAUCA 21 248 3 128 2    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 4 62 3 2 0 0 6 0 0 0 0 0 0 0 0 0 0 0 39 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 128
stu-miR397-5p AUUGAGUGCAGCGUUGAUGAC 21 6,623 92 1,963 5    11 0 11 15 52 62 84 93 43 111 124 224 20 69 5 5 7 51 29 11 18 31 0 0 40 58 494 1,963 947 92 54 10 140 72 51 32 83 231 0 0 31 0 23 39 31 49 0 80 0 0 0 0 0 0 101 0 0 0 0 85 0 0 49 0 0 0 0 87 399 50 256 0
stu-miR398a-3p UAUGUUCUCAGGUCGCCCCUG 21 40,698 565 11,720 1    22 12 11 15 34 27 58 23 59 74 79 51 60 59 2 20 20 8 6 11 0 52 0 0 36 62 498 11,720 4,263 8,329 4,597 1 0 0 0 0 194 1,578 0 31 108 0 46 750 125 244 0 518 0 0 370 306 0 63 859 0 0 0 0 127 1,047 0 49 0 0 0 0 875 250 198 1,769 982
stu-miR398a-5p GGGUUGAUUUGAGAACAUAUG 21 64,258 892 23,065 3    0 0 11 0 11 0 0 0 0 0 0 0 0 0 0 0 0 0 0 11 0 0 0 0 0 8 16 339 242 198 162 3 0 0 0 0 14 2,464 22 31 15 52 23 11,848 249 2,983 802 1,196 0 0 123 131 136 189 12,739 766 22 120 35 255 78 0 294 48 0 102 0 2,056 1,797 941 661 23,065
stu-miR398b-3p UUGUGUUCUCAGGUCACCCCU 21 2,480 34 298 3    17 12 0 15 34 27 35 116 35 111 22 41 101 79 25 61 85 76 124 137 147 168 0 0 57 8 0 3 0 110 46 0 0 0 0 0 0 0 0 0 0 0 298 0 93 49 40 80 0 0 0 0 0 0 0 0 0 0 0 0 0 28 0 0 0 0 0 0 150 50 0 0
stu-miR398b-5p GAGUGUGCCUUAGAACACAGGU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR399a-3p UGCCAAAGGAGAGCUGCCCUG 21 522 7 140 6    6 0 22 0 11 0 0 0 0 0 0 0 0 10 0 0 0 0 0 0 0 0 0 0 0 12 140 36 63 118 46 6 0 0 0 0 14 38 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR399a-5p GGGCUACUCUCUAUUGGCAUG 21 1,872 26 755 2    0 0 11 7 6 27 13 0 20 0 11 20 7 0 2 0 7 8 0 0 0 0 0 0 20 4 755 76 76 375 270 61 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 48 0 0 0 0 0 0 0 43
stu-miR399b-3p UGCCAAAGGAGAGCUGCCCUG 21 522 7 140 6    6 0 22 0 11 0 0 0 0 0 0 0 0 10 0 0 0 0 0 0 0 0 0 0 0 12 140 36 63 118 46 6 0 0 0 0 14 38 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR399b-5p GGGCUACUCUCUAUUGGCAUG 21 1,872 26 755 2    0 0 11 7 6 27 13 0 20 0 11 20 7 0 2 0 7 8 0 0 0 0 0 0 20 4 755 76 76 375 270 61 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 48 0 0 0 0 0 0 0 43
stu-miR399c-3p UGCCAAAGGAGAGCUGCCCUG 21 522 7 140 6    6 0 22 0 11 0 0 0 0 0 0 0 0 10 0 0 0 0 0 0 0 0 0 0 0 12 140 36 63 118 46 6 0 0 0 0 14 38 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR399c-5p GGGCUACUCUCUAUUGGCAUG 21 1,872 26 755 2    0 0 11 7 6 27 13 0 20 0 11 20 7 0 2 0 7 8 0 0 0 0 0 0 20 4 755 76 76 375 270 61 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 48 0 0 0 0 0 0 0 43
stu-miR399d-3p UGCCAAAGGAGAGCUGCCCUG 21 522 7 140 6    6 0 22 0 11 0 0 0 0 0 0 0 0 10 0 0 0 0 0 0 0 0 0 0 0 12 140 36 63 118 46 6 0 0 0 0 14 38 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR399d-5p GGGCUACUCUCUAUUGGCAUG 21 1,872 26 755 2    0 0 11 7 6 27 13 0 20 0 11 20 7 0 2 0 7 8 0 0 0 0 0 0 20 4 755 76 76 375 270 61 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 48 0 0 0 0 0 0 0 43
stu-miR399e-3p UGCCAAAGGAGAGCUGCCCUG 21 522 7 140 6    6 0 22 0 11 0 0 0 0 0 0 0 0 10 0 0 0 0 0 0 0 0 0 0 0 12 140 36 63 118 46 6 0 0 0 0 14 38 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR399e-5p GGGCUACUCUCUAUUGGCAUG 21 1,872 26 755 2    0 0 11 7 6 27 13 0 20 0 11 20 7 0 2 0 7 8 0 0 0 0 0 0 20 4 755 76 76 375 270 61 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 48 0 0 0 0 0 0 0 43
stu-miR399f-3p UGCCAAAGGAGAGCUGCCCUG 21 522 7 140 6    6 0 22 0 11 0 0 0 0 0 0 0 0 10 0 0 0 0 0 0 0 0 0 0 0 12 140 36 63 118 46 6 0 0 0 0 14 38 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR399f-5p GGGCUACUCUCUAUUGGCAUG 21 1,872 26 755 2    0 0 11 7 6 27 13 0 20 0 11 20 7 0 2 0 7 8 0 0 0 0 0 0 20 4 755 76 76 375 270 61 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 48 0 0 0 0 0 0 0 43
stu-miR399g-3p CGCCAAAGGGGAGCUGCCCUA 21 88 1 58 2    0 0 0 7 0 9 0 0 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 58 0 2 4 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR399g-5p GGGCUACUCUCUAUUGGCAUG 21 1,872 26 755 2    0 0 11 7 6 27 13 0 20 0 11 20 7 0 2 0 7 8 0 0 0 0 0 0 20 4 755 76 76 375 270 61 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 48 0 0 0 0 0 0 0 43
stu-miR399h GGGCUACUCUCUAUUGGCAUG 21 1,872 26 755 2    0 0 11 7 6 27 13 0 20 0 11 20 7 0 2 0 7 8 0 0 0 0 0 0 20 4 755 76 76 375 270 61 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 48 0 0 0 0 0 0 0 43
stu-miR399i-3p UGCCAAAGGAGAGUUGCCCUA 21 523 7 128 2    0 0 0 0 0 0 0 0 4 0 0 0 7 10 0 0 0 0 18 11 6 0 0 0 8 12 82 0 2 7 12 29 0 0 0 0 0 0 0 0 0 0 23 0 31 0 0 0 0 0 0 44 0 0 0 0 0 0 0 0 39 0 0 0 0 0 0 0 50 0 128 0
stu-miR399i-5p GGGCUACACUCUAUUGGCAUG 21 1,361 19 398 4    0 0 0 0 0 0 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 24 8 222 8 4 375 255 398 0 0 0 0 0 0 0 0 0 0 23 0 0 0 0 0 0 0 0 0 0 0 0 0 0 40 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR399j-3p CGCCAAAGGAGAGCUGCCCUG 21 605 8 137 7    50 12 22 15 34 71 0 23 0 18 17 10 7 0 0 0 0 0 0 0 0 10 0 0 0 19 78 48 137 26 8 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR399j-5p GGGCUACUCUCUAUUGGCAUA 21 171 2 50 3    0 12 22 15 11 27 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 23 4 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 50 0 0 0
stu-miR399k-3p CGCCAAAGGAGAGCUGCCCUG 21 605 8 137 7    50 12 22 15 34 71 0 23 0 18 17 10 7 0 0 0 0 0 0 0 0 10 0 0 0 19 78 48 137 26 8 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR399k-5p GGGCUACUCUCUAUUGGCAUG 21 1,872 26 755 2    0 0 11 7 6 27 13 0 20 0 11 20 7 0 2 0 7 8 0 0 0 0 0 0 20 4 755 76 76 375 270 61 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 48 0 0 0 0 0 0 0 43
stu-miR399l-3p CGCCAAAGGAGAGCUGCCCUG 21 605 8 137 7    50 12 22 15 34 71 0 23 0 18 17 10 7 0 0 0 0 0 0 0 0 10 0 0 0 19 78 48 137 26 8 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR399l-5p GGGCUACUCUCUAUUGGCAUG 21 1,872 26 755 2    0 0 11 7 6 27 13 0 20 0 11 20 7 0 2 0 7 8 0 0 0 0 0 0 20 4 755 76 76 375 270 61 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 48 0 0 0 0 0 0 0 43
stu-miR399m-3p CGCCAAAGGAGAGCUGCCCUG 21 605 8 137 7    50 12 22 15 34 71 0 23 0 18 17 10 7 0 0 0 0 0 0 0 0 10 0 0 0 19 78 48 137 26 8 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR399m-5p GGGCUACUCUCUAUUGGCAUG 21 1,872 26 755 2    0 0 11 7 6 27 13 0 20 0 11 20 7 0 2 0 7 8 0 0 0 0 0 0 20 4 755 76 76 375 270 61 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 48 0 0 0 0 0 0 0 43
stu-miR399n-3p CGCCAAAGGAGAGCUGCCCUG 21 605 8 137 7    50 12 22 15 34 71 0 23 0 18 17 10 7 0 0 0 0 0 0 0 0 10 0 0 0 19 78 48 137 26 8 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR399n-5p GGGCUACUCUCUAUUGGCAUG 21 1,872 26 755 2    0 0 11 7 6 27 13 0 20 0 11 20 7 0 2 0 7 8 0 0 0 0 0 0 20 4 755 76 76 375 270 61 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 48 0 0 0 0 0 0 0 43
stu-miR399o-3p CGCCAAAGGAGAGCUGCCCUG 21 605 8 137 7    50 12 22 15 34 71 0 23 0 18 17 10 7 0 0 0 0 0 0 0 0 10 0 0 0 19 78 48 137 26 8 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR399o-5p GGGCUACUCUCUAUUGGCAUG 21 1,872 26 755 2    0 0 11 7 6 27 13 0 20 0 11 20 7 0 2 0 7 8 0 0 0 0 0 0 20 4 755 76 76 375 270 61 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 48 0 0 0 0 0 0 0 43
stu-miR408a-3p UGCACAGCCUCUUCCCUGGUU 21 7,700 107 2,541 2    0 0 11 7 6 0 4 23 8 18 39 31 20 0 2 5 7 0 6 11 6 0 0 0 12 0 136 133 94 15 15 0 0 0 0 0 41 2,541 0 0 15 0 46 39 187 98 40 359 0 0 462 0 45 0 202 0 0 40 0 85 78 28 0 48 56 0 0 350 898 495 639 299
stu-miR408a-5p ACAGGGACGAGGCAGCGCAUG 21 598 8 265 3    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 48 39 265 8 4 7 0 83 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 59 0 0 0 0 39 0 0 0 0 0 0 0 0 0 0 43
stu-miR408b-3p UGCACUGCCUCUUCCCUGGCU 21 4,103 57 1,264 2    0 24 22 15 46 27 35 0 43 92 90 102 20 20 2 10 0 8 12 0 0 10 0 0 16 16 269 1,264 832 51 39 0 38 56 70 69 0 154 0 0 15 0 0 79 31 49 40 80 0 0 31 0 0 0 51 0 22 0 0 0 39 0 0 0 0 0 0 0 150 0 21 43
stu-miR408b-5p ACGGGGACGAGACAGAGCAUG 21 29,060 404 17,640 6    6 0 0 0 6 0 0 0 0 0 0 0 20 0 0 0 0 0 0 0 0 0 0 0 339 241 2,114 51 61 70 69 605 22 20 32 29 55 77 0 0 0 52 0 1,619 62 978 0 0 75 0 62 44 0 0 3,286 236 43 0 0 0 0 28 147 48 112 0 0 306 200 198 107 17,640
stu-miR477a-3p GAAGCUCUAGCAGGGAGAGCCA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR477a-5p CCUCUCCCUCAAGGGCUUCUC 21 2,311 32 187 2    83 60 166 162 114 115 142 162 187 184 62 51 7 10 2 10 52 51 41 68 43 42 0 0 0 0 12 20 9 29 15 0 5 12 5 9 0 0 0 0 15 0 23 0 0 0 40 0 0 0 0 44 0 63 0 0 0 0 17 85 0 0 0 0 0 51 0 0 0 0 0 43
stu-miR477b-3p GAGGUCUUUCGAGUGAGAGUGA 22 4,488 62 645 3    22 24 33 7 34 27 0 23 4 0 0 0 0 0 0 5 13 8 0 0 0 0 0 0 0 0 16 3 0 4 0 4 0 0 0 0 442 0 0 0 0 52 115 0 0 587 0 0 0 0 0 131 45 0 202 177 22 240 645 0 0 28 98 0 0 0 0 175 549 198 128 427
stu-miR477b-5p ACUCUCCCUCAAAGGCUUCUG 21 1,107 15 128 4    33 24 55 74 80 44 35 46 86 37 28 20 13 0 0 0 26 17 41 46 24 31 50 0 0 4 128 38 27 33 19 4 0 0 0 12 0 0 0 0 15 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 17 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR479 UGAGCCGAACCAAUAUCACUC 21 2,210 31 325 3    61 36 67 110 172 266 200 325 62 37 135 142 0 0 0 0 0 0 0 0 0 0 0 0 0 8 140 117 179 0 0 3 0 28 14 14 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 44 0 50 0 0
stu-miR482a-3p UUUCCAAUUCCACCCAUUCCUA 22 90,054 1,251 18,459 44    839 729 1,187 1,259 1,099 1,037 1,361 1,252 1,557 1,272 404 529 1,087 922 210 350 938 776 1,520 1,392 1,199 838 100 82 311 792 1,627 133 58 51 50 644 18,459 5,724 5,455 1,875 332 5,544 288 125 123 156 505 2,646 904 2,836 1,644 359 678 158 1,909 44 363 566 455 766 65 160 0 340 349 56 784 143 4,491 662 301 787 599 446 448 2,904
stu-miR482a-5p GGAAUUGGUGGAUUGGAAAGC 21 27,954 388 7,304 2    22 12 55 44 69 53 106 116 51 37 28 31 13 0 2 0 0 8 18 11 6 0 0 0 40 12 31 8 2 51 66 1,325 0 0 0 0 180 192 0 125 15 156 0 3,633 62 4,107 2,125 40 0 53 31 44 182 63 2,174 1,767 22 0 0 127 116 56 1,371 95 674 0 730 0 250 0 43 7,304
stu-miR482b-3p UUACCGAUUCCCCCCAUUCCAA 22 140,212 1,947 9,575 65    4,605 4,541 3,805 3,999 5,599 5,752 9,556 9,575 8,681 8,460 9,458 9,465 4,367 3,592 857 1,588 2,566 2,312 5,533 4,757 3,021 2,943 0 0 2,582 2,865 2,207 528 413 2,404 1,250 1,045 0 0 0 0 124 308 332 219 292 104 459 829 530 587 120 399 377 105 431 131 182 755 1,062 118 65 320 0 212 155 281 147 238 618 305 86 175 150 347 341 982
stu-miR482b-5p GGAGUGGGUGGCAUGGUAAGA 21 33,727 468 8,500 2    0 0 0 7 6 18 0 0 0 0 0 10 0 0 2 0 0 0 0 0 0 10 0 0 32 4 8 0 2 129 89 1,435 0 0 0 0 97 77 44 31 108 104 46 5,529 0 4,939 842 80 151 105 123 44 227 0 8,493 589 65 80 139 382 0 56 784 48 56 0 86 0 100 50 0 8,500
stu-miR482c UUUCCUAUUCCACCCAUGCCAA 22 115,634 1,606 10,745 17    657 932 1,398 1,384 1,906 2,136 2,089 2,481 2,802 2,212 1,101 1,129 731 687 162 304 397 363 1,126 981 654 649 199 0 10,745 9,267 4,352 767 321 481 343 2,604 9,646 6,170 2,506 362 1,244 1,886 1,770 1,470 538 156 964 1,619 810 1,027 1,323 996 602 1,054 2,895 350 363 3,021 3,943 1,649 108 1,000 17 594 2,249 1,321 441 855 898 1,222 429 350 848 1,337 618 1,623
stu-miR482d-3p UCUUGCCUACACCGCCCAUGCC 22 157,602 2,189 12,497 9    4,213 5,127 4,271 4,838 6,847 8,215 8,399 10,363 8,735 12,497 6,846 7,950 3,294 4,308 1,177 2,070 1,875 2,143 3,930 4,609 2,483 2,975 0 41 841 2,663 638 2,789 1,986 4,863 2,966 647 22 24 14 9 885 192 885 3,473 369 0 597 711 125 538 2,246 199 979 527 1,263 87 318 315 2,174 1,473 280 120 35 212 2,055 647 0 190 393 102 386 44 200 594 21 299
stu-miR482d-5p CGUGAGUGGUGGGGUAAGAUA 21 15,314 213 11,356 2    11 24 11 22 23 9 13 0 12 0 0 10 0 29 0 15 0 0 0 11 6 10 0 0 154 19 35 0 2 125 104 11,356 0 0 0 0 0 0 0 0 15 52 23 790 0 293 241 0 0 0 31 44 0 0 809 177 0 0 0 0 39 0 196 48 0 0 0 0 0 0 0 555
stu-miR482e-3p UCUUGCCAAUACCGCCCAUUCC 22 458,244 6,365 73,967 17    657 490 976 1,053 1,431 1,267 2,027 2,110 2,123 2,507 944 824 1,905 1,825 412 730 1,335 1,443 2,351 2,647 1,896 2,357 0 0 699 1,417 985 1,310 1,034 8,582 5,319 500 237 137 352 78 5,060 23,060 9,844 3,410 4,318 8,201 7,733 19,588 14,643 5,917 64,965 3,706 24,250 2,950 73,967 3,631 3,680 16,047 9,403 5,655 452 2,839 17 9,890 11,052 4,527 3,722 1,853 28,856 2,495 3,907 2,580 2,196 6,040 4,476 9,354
stu-miR482e-5p AGUGGGUGGUGUGGUAAGAUU 21 34,503 479 16,649 2    22 0 0 7 6 9 4 23 27 0 6 10 20 10 2 15 26 0 12 68 24 0 0 0 1,063 50 171 8 2 228 208 16,649 0 0 0 0 14 0 0 63 0 52 69 3,831 0 733 120 40 75 53 0 0 0 189 2,477 177 0 0 17 0 0 28 98 143 0 0 0 44 50 0 0 7,560
stu-miR530 UCUGCAUUUGCACCUGCACCU 21 3,193 44 452 2    0 0 0 0 0 0 4 0 8 0 0 10 20 0 2 10 7 0 24 11 6 10 0 0 0 0 4 31 18 386 440 0 0 0 0 0 14 0 0 0 231 0 0 79 0 49 0 0 0 0 62 44 0 63 51 0 452 40 52 42 78 0 0 48 112 0 0 87 349 50 43 256
stu-miR5303a UUUUGGAGAAUCCGACACGCACCC 24 49 1 11 4    0 0 0 7 6 9 4 0 8 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 0 0 11 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR5303b UUUUGGAGAAUCCGACACGCACCC 24 49 1 11 4    0 0 0 7 6 9 4 0 8 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 0 0 11 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR5303c UUUUGGAGAAUCCGACACGCACCC 24 49 1 11 4    0 0 0 7 6 9 4 0 8 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 0 0 11 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR5303d UUUUGGAGAAUCCGACACGCACCC 24 49 1 11 4    0 0 0 7 6 9 4 0 8 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 0 0 11 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR5303e UUUUGGAGAAUCUGACACGGGUGU 24 263 4 46 2    6 0 11 7 29 0 13 46 8 0 6 0 7 10 2 0 13 0 6 0 12 0 0 0 0 0 0 5 2 18 27 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 35 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR5303f AUUUUUGGAGAAUCUGACACGGGU 24 457 6 62 2    11 12 11 7 40 62 27 0 20 18 6 0 34 10 0 5 0 0 6 11 6 10 0 0 4 12 0 8 2 37 23 3 0 0 0 0 0 0 0 0 0 0 23 0 0 49 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
stu-miR5303g AUAUUUUUGAAGAGUCUGAGCAAC 24 330 5 59 4    0 0 0 7 0 18 4 0 0 0 6 0 0 0 0 0 0 0 6 0 0 0 0 0 0 4 0 0 0 4 4 0 5 12 19 0 0 0 0 0 0 52 0 0 0 0 0 0 0 0 0 0 0 0 0 59 0 0 0 42 39 0 49 0 0 0 0 0 0 0 0 0
stu-miR5303h AACAUUUUUGAAGAGUCUGAGCAA 24 441 6 98 3    0 0 0 0 6 0 0 0 12 18 0 0 0 0 0 5 0 0 0 0 0 0 0 0 0 8 0 5 0 0 0 3 0 0 0 0 0 77 0 0 15 0 0 0 0 49 0 0 0 0 0 0 0 0 0 0 0 0 17 42 0 0 98 0 0 0 43 0 0 0 43 0
stu-miR5303i AUAUUUUUGAAGAGUCUGAGCAAC 24 330 5 59 4    0 0 0 7 0 18 4 0 0 0 6 0 0 0 0 0 0 0 6 0 0 0 0 0 0 4 0 0 0 4 4 0 5 12 19 0 0 0 0 0 0 52 0 0 0 0 0 0 0 0 0 0 0 0 0 59 0 0 0 42 39 0 49 0 0 0 0 0 0 0 0 0
stu-miR5303j AAUAUUUUUGAAGAGUCUGAGCAA 24 675 9 85 4    0 0 0 0 0 0 22 0 16 18 17 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5 4 8 0 14 77 66 31 15 0 0 0 0 0 0 0 75 0 62 0 45 0 0 0 0 0 0 85 0 0 0 0 0 51 0 0 0 0 64 0
stu-miR5304-3p AGAUGAGUAUGGUGCAUUGGA 21 3,057 42 1,415 4    0 0 0 0 6 0 0 0 0 0 6 0 0 0 0 0 0 8 0 0 0 0 0 0 4 0 0 0 0 0 0 106 0 0 0 0 221 0 0 0 61 52 23 79 0 0 0 120 0 0 0 0 0 0 1,415 59 43 40 0 212 116 0 0 0 0 51 86 0 50 0 43 256
stu-miR5304-5p CAAUGCAACAUACUCAUCACC 21 581 8 171 2    0 0 0 15 6 0 18 23 8 0 0 0 7 10 2 0 0 8 6 0 0 42 0 0 0 0 0 3 0 22 23 35 0 0 0 0 0 0 0 0 0 0 23 0 0 0 40 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 98 0 0 0 0 0 0 0 21 171
stu-miR6022 UGGAAGGGAGAAUAUCCAGGA 21 218,325 3,032 29,932 6    6 24 11 37 126 177 173 185 172 129 45 71 34 20 15 10 33 25 59 46 12 63 0 82 15,154 9,314 29,932 59 36 18 12 7,973 0 0 0 0 3,083 6,198 1,128 5,005 11,111 1,194 4,589 4,107 1,340 6,992 1,003 2,870 602 3,161 1,540 3,806 863 1,951 26,388 2,179 17,345 4,438 18,366 4,499 3,490 759 1,665 950 842 1,273 1,030 1,443 4,242 1,238 2,600 982
stu-miR6023 UUCCAUGAAAGUGUUUUUGGAU 22 19,427 270 3,471 8    22 24 200 177 212 213 612 533 605 387 135 102 288 137 22 71 352 169 625 376 502 209 0 0 8 8 148 428 696 3,429 3,471 96 0 0 0 0 387 0 22 94 430 0 115 118 0 98 0 80 0 0 0 0 45 63 960 59 0 160 139 1,528 0 0 98 95 0 0 43 131 150 99 256 0
stu-miR6024-3p UUUUAGCAAGAGUUGUUUUCCC 22 104,132 1,446 12,233 12    66 12 122 118 240 266 421 232 601 461 118 142 154 88 15 51 91 59 218 160 220 220 0 0 404 858 549 51 128 401 336 545 11,103 9,814 5,617 1,007 705 3,118 1,858 720 1,629 260 4,291 1,382 1,028 1,467 241 2,112 452 527 3,233 612 727 2,140 404 825 151 1,080 0 9,211 349 590 490 238 730 916 944 2,537 1,398 2,872 12,233 7,774
stu-miR6024-5p AGAAACAACACUUGCUAAAAGA 22 124,740 1,733 44,334 2    0 0 22 15 11 9 40 46 35 37 34 0 13 20 0 0 7 17 6 11 12 0 0 0 12 4 12 5 2 173 162 268 0 0 0 0 1,023 77 22 532 353 52 895 10,939 125 5,379 762 678 75 211 62 44 636 566 44,334 3,711 2,478 360 17 806 504 141 833 1,996 225 509 386 962 699 941 277 42,157
stu-miR6025 UACCAACAAUUGAGAUAACAUC 22 172,678 2,398 41,962 2    6 0 33 52 109 106 98 116 51 55 56 10 40 20 2 15 13 51 82 80 31 31 0 0 137 190 494 38 34 154 89 234 0 0 0 0 650 41,962 27,408 17,237 1,706 467 2,409 1,659 2,399 1,076 7,258 1,116 1,054 1,791 21,648 1,094 318 4,216 2,123 825 43 720 0 1,655 2,172 675 539 380 2,358 6,008 4,722 262 250 1,584 9,228 1,239
stu-miR6026-3p UUCUUGGCUAGAGUUGUAUUGC 22 4,582 64 230 2    50 48 89 177 183 230 129 139 180 166 107 61 13 59 2 15 13 17 53 125 31 10 0 0 77 78 78 163 121 70 85 96 113 133 146 20 28 38 22 63 15 52 69 0 125 98 0 40 0 0 31 0 45 126 202 0 0 40 0 42 78 84 0 0 56 0 43 44 100 0 21 43
stu-miR6026-5p AAUACAACUAUUGCCAAGACAA 22 382 5 101 2    0 0 0 15 17 9 0 23 12 0 6 31 0 10 2 0 0 0 6 11 0 0 0 0 12 8 19 0 0 4 8 45 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 101 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 43
stu-miR6027 UGAAUCCUUCGGCUAUCCAUAA 22 240,363 3,338