Potato PARE miRNA Abundances

The data below are based on the microRNAs listed in the Sanger registry. Adjust libraries/reads to display on the control panel.


        miRNA         miRNA sequence Len Sum (norm) Average Max Min (>0)  Deg_Stu_c6_T20CDeg_Stu_c6_T4C
stu-miR156a UUGACAGAAGAUAGAGAGCAC 21 0 0 0 0    0 0
stu-miR156b UUGACAGAAGAUAGAGAGCAC 21 0 0 0 0    0 0
stu-miR156c UUGACAGAAGAUAGAGAGCAC 21 0 0 0 0    0 0
stu-miR156d-3p GCUCUCUAUGCUUCUGUCAUCA 22 0 0 0 0    0 0
stu-miR156d-5p UUGACAGAAGAUAGAGAGCAC 21 0 0 0 0    0 0
stu-miR156e UGACAGAAGAGAGUGAGCAC 20 0 0 0 0    0 0
stu-miR156f-3p CUCACUUCUCUUUCUGUCAAUC 22 0 0 0 0    0 0
stu-miR156f-5p CUGACAGAAGAGAGUGAGCA 20 0 0 0 0    0 0
stu-miR156g-3p GCUUACUCUCUAUCUGUCACC 21 0 0 0 0    0 0
stu-miR156g-5p UGACAGAAGAGAGUGAGCAC 20 0 0 0 0    0 0
stu-miR156h-3p GCUCACUGCUCUAUCUGUCACC 22 0 0 0 0    0 0
stu-miR156h-5p UGACAGAAGAGAGUGAGCAC 20 0 0 0 0    0 0
stu-miR156i-3p GCUCACUGCUCUAUCUGUCACC 22 0 0 0 0    0 0
stu-miR156i-5p UGACAGAAGAGAGUGAGCAC 20 0 0 0 0    0 0
stu-miR156j-3p GCUCACUGCUCUAUCUGUCACC 22 0 0 0 0    0 0
stu-miR156j-5p UGACAGAAGAGAGUGAGCAC 20 0 0 0 0    0 0
stu-miR156k-3p GCUCACUGCUCUAUCUGUCACC 22 0 0 0 0    0 0
stu-miR156k-5p UGACAGAAGAGAGUGAGCAC 20 0 0 0 0    0 0
stu-miR160a-3p GCGUAUGAGGAGCCAAGCAUA 21 0 0 0 0    0 0
stu-miR160a-5p UGCCUGGCUCCCUGUAUGCCA 21 0 0 0 0    0 0
stu-miR160b UGCCUGGCUCCCUGUAUGCCA 21 0 0 0 0    0 0
stu-miR162a-3p UCGAUAAACCUCUGCAUCCAG 21 0 0 0 0    0 0
stu-miR162a-5p GGAGGCAGCGGUUCAUCGAUC 21 0 0 0 0    0 0
stu-miR162b-3p UCGAUAAACCUCUGCAUCCAG 21 0 0 0 0    0 0
stu-miR162b-5p GGAGGCAGCGGUUCAUCGAUC 21 0 0 0 0    0 0
stu-miR164-3p CAUGUGCUCUAGCUCUCCAGC 21 0 0 0 0    0 0
stu-miR164-5p UGGAGAAGCAGGGCACAUGCU 21 0 0 0 0    0 0
stu-miR166a-3p UCGGACCAGGCUUCAUUCCCC 21 0 0 0 0    0 0
stu-miR166a-5p GGAAUGUUGUCUGGCUCGAGG 21 0 0 0 0    0 0
stu-miR166b UCGGACCAGGCUUCAUUCCUC 21 0 0 0 0    0 0
stu-miR166c-3p UCGGACCAGGCUUCAUUCCCC 21 0 0 0 0    0 0
stu-miR166c-5p GGAAUGUUGUUUGGCUCGAGG 21 0 0 0 0    0 0
stu-miR166d-3p UCGGACCAGGCUUCAUUCCCC 21 0 0 0 0    0 0
stu-miR166d-5p AGAAUGUCGUCUGGUUCGAGA 21 0 0 0 0    0 0
stu-miR167a-3p GAUCAUGUGGCAGCCUCACC 20 0 0 0 0    0 0
stu-miR167a-5p UGAAGCUGCCAGCAUGAUCUA 21 0 0 0 0    0 0
stu-miR167b-3p GAUCAUGUGGCAGCAUCACC 20 0 0 0 0    0 0
stu-miR167b-5p UGAAGCUGCCAGCAUGAUCUA 21 0 0 0 0    0 0
stu-miR167c-3p GGUCAUGCUCGGACAGCCUCACU 23 0 0 0 0    0 0
stu-miR167c-5p UGAAGCUGCCAGCAUGAUCUA 21 0 0 0 0    0 0
stu-miR167d-3p GAUCAUGUGGUUGCUUCACC 20 0 0 0 0    0 0
stu-miR167d-5p UGAAGCUGCCAGCAUGAUCUA 21 0 0 0 0    0 0
stu-miR169a-3p GCAGUCUCCUUGGCUACU 18 0 0 0 0    0 0
stu-miR169a-5p UAGCCAAGGAUGACUUGCCU 20 0 0 0 0    0 0
stu-miR169b-3p GCAGUCUCCUUGGCUACU 18 0 0 0 0    0 0
stu-miR169b-5p UAGCCAAGGAUGACUUGCCU 20 0 0 0 0    0 0
stu-miR169c-3p GCAGUCUCCUUGGCUACC 18 0 0 0 0    0 0
stu-miR169c-5p UAGCCAAGGAUGACUUGCCU 20 0 0 0 0    0 0
stu-miR169d-3p GCAGGUCAUCUUUAGCUAACU 21 0 0 0 0    0 0
stu-miR169d-5p UAGCCAAGGAUGACUUGCCU 20 0 0 0 0    0 0
stu-miR169e-3p GCAAGUUAUCCUGGCUAUC 19 0 0 0 0    0 0
stu-miR169e-5p UAGCCAAGGAUGACUUGCCU 20 0 0 0 0    0 0
stu-miR169f-3p GCAAGCAUCCUUGGCGACU 19 0 0 0 0    0 0
stu-miR169f-5p UAGCCAAGGAUGACUUGCCU 20 0 0 0 0    0 0
stu-miR169g UAGCCAAGGAUGACUUGCCU 20 0 0 0 0    0 0
stu-miR169h UAGCCAAGGAUGACUUGCCU 20 0 0 0 0    0 0
stu-miR171a-3p UGAUUGAGCCGUGCCAAUAUC 21 0 0 0 0    0 0
stu-miR171a-5p UAUUGGCCUGGUUCACUCAGA 21 0 0 0 0    0 0
stu-miR171b-3p UUGAGCCGCGUCAAUAUCUCU 21 0 0 0 0    0 0
stu-miR171b-5p AGAUAUUGAUGUGGCUCAAUC 21 0 0 0 0    0 0
stu-miR171c-3p UGAUUGAGCCGUGUCAAUAUC 21 0 0 0 0    0 0
stu-miR171c-5p UAUUGGCCUGGUUCACUCAGA 21 0 0 0 0    0 0
stu-miR171d-3p UUGAGCCGUGCCAAUAUCACG 21 0 0 0 0    0 0
stu-miR171d-5p AGAUAUUGGUGCGGUUCAAUU 21 0 0 0 0    0 0
stu-miR171e UGAUUGAGCCGUGCCAAUAUC 21 0 0 0 0    0 0
stu-miR172a-3p AGAAUCUUGAUGAUGCUGCAU 21 0 0 0 0    0 0
stu-miR172a-5p GUAGCAUAAUCAAGAUUCACA 21 0 0 0 0    0 0
stu-miR172b-3p AGAAUCUUGAUGAUGCUGCAU 21 0 0 0 0    0 0
stu-miR172b-5p GCAGCACCAUCAAGAUUCACA 21 0 0 0 0    0 0
stu-miR172c-3p AGAAUCUUGAUGAUGCUGC 19 0 0 0 0    0 0
stu-miR172c-5p AGCAUCUUCAAGAUUCACA 19 0 0 0 0    0 0
stu-miR172d-3p GGAAUCUUGAUGAUGCUGCAG 21 0 0 0 0    0 0
stu-miR172d-5p GGAGCAUCAUCAAGAUUCACA 21 0 0 0 0    0 0
stu-miR172e-3p AGAAUCUUGAUGAUGCUGCAU 21 0 0 0 0    0 0
stu-miR172e-5p GCAACAUCAUCAAGAUUCACA 21 0 0 0 0    0 0
stu-miR1886a AUGGUAUCGUGAGAUGAAAUCAGC 24 0 0 0 0    0 0
stu-miR1886b AUGGUAUCGUGAGAUGAAAUCAGC 24 0 0 0 0    0 0
stu-miR1886c AUGGUAUCGUGAGAUGAAAUCAGC 24 0 0 0 0    0 0
stu-miR1886d AUGGUAUCGUGAGAUGAAAUCAGC 24 0 0 0 0    0 0
stu-miR1886e AUGGUAUCGUGAGAUGAAAUCAGC 24 0 0 0 0    0 0
stu-miR1886f AUGGUAUCGUGAGAUGAAAUCAGC 24 0 0 0 0    0 0
stu-miR1886g-3p UUUCAUAUUGAUUUCAUCUCAU 22 0 0 0 0    0 0
stu-miR1886g-5p GAGAUGAGAUCAAUGUUUGGACAU 24 0 0 0 0    0 0
stu-miR1886h AUUUUACGUUGAUUUCAUCUCAUG 24 0 0 0 0    0 0
stu-miR1886i-3p UUUACGUUGAUUUCAUCUCAUGA 23 0 0 0 0    0 0
stu-miR1886i-5p AUGAGAUGAAAUUAGCGUUUGGAU 24 0 0 0 0    0 0
stu-miR1919-3p ACGAGAGUCAUCUGUGACAGG 21 0 0 0 0    0 0
stu-miR1919-5p UGUCGCAGAUGACUUUCGCCC 21 0 0 0 0    0 0
stu-miR319-3p UUGGACUGAAGGGUUCCCUUC 21 0 0 0 0    0 0
stu-miR319-5p AGGAAACUGUUUAGUCCAACC 21 0 0 0 0    0 0
stu-miR319a-3p UUGGACUGAAGGGAGCUCCCU 21 0 0 0 0    0 0
stu-miR319a-5p AGAGCUUUCUUCGGUCCACAC 21 0 0 0 0    0 0
stu-miR319b UUGGACUGAAGGGAGCUCCU 20 0 0 0 0    0 0
stu-miR3627-3p AAGUGCCUCUGUCUUUCGACA 21 0 0 0 0    0 0
stu-miR3627-5p UCGCAGGAGAGAUGGCACUUAG 22 0 0 0 0    0 0
stu-miR384-3p AGGGGGCCAAAGUGCCAAAC 20 0 0 0 0    0 0
stu-miR384-5p UUGGCAUUCUGUCCACCUCC 20 0 0 0 0    0 0
stu-miR390-3p CGCUAUCCAUCUUGAGUUUUA 21 0 0 0 0    0 0
stu-miR390-5p AAGCUCAGGAGGGAUAGCACC 21 0 0 0 0    0 0
stu-miR391-3p GCAUCAUACUCCUGCAUAUU 20 0 0 0 0    0 0
stu-miR391-5p UACGCAGGAGAGAUGAUGCUG 21 0 0 0 0    0 0
stu-miR393-3p AUCAUGCGAUCUCUUCGGAAU 21 0 0 0 0    0 0
stu-miR393-5p UCCAAAGGGAUCGCAUUGAUCC 22 0 0 0 0    0 0
stu-miR395a CUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0
stu-miR395b CUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0
stu-miR395c CUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0
stu-miR395d CUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0
stu-miR395e CUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0
stu-miR395f CUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0
stu-miR395g CUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0
stu-miR395h CUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0
stu-miR395i CUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0
stu-miR395j CUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0
stu-miR396-3p GUCCAAGAAAGCUGUGGGAAA 21 0 0 0 0    0 0
stu-miR396-5p UUCCACAGCUUUCUUGAACUU 21 0 0 0 0    0 0
stu-miR397-3p CAUCAACGCUACACUCAAUCA 21 0 0 0 0    0 0
stu-miR397-5p AUUGAGUGCAGCGUUGAUGAC 21 0 0 0 0    0 0
stu-miR398a-3p UAUGUUCUCAGGUCGCCCCUG 21 0 0 0 0    0 0
stu-miR398a-5p GGGUUGAUUUGAGAACAUAUG 21 0 0 0 0    0 0
stu-miR398b-3p UUGUGUUCUCAGGUCACCCCU 21 0 0 0 0    0 0
stu-miR398b-5p GAGUGUGCCUUAGAACACAGGU 22 0 0 0 0    0 0
stu-miR399a-3p UGCCAAAGGAGAGCUGCCCUG 21 0 0 0 0    0 0
stu-miR399a-5p GGGCUACUCUCUAUUGGCAUG 21 0 0 0 0    0 0
stu-miR399b-3p UGCCAAAGGAGAGCUGCCCUG 21 0 0 0 0    0 0
stu-miR399b-5p GGGCUACUCUCUAUUGGCAUG 21 0 0 0 0    0 0
stu-miR399c-3p UGCCAAAGGAGAGCUGCCCUG 21 0 0 0 0    0 0
stu-miR399c-5p GGGCUACUCUCUAUUGGCAUG 21 0 0 0 0    0 0
stu-miR399d-3p UGCCAAAGGAGAGCUGCCCUG 21 0 0 0 0    0 0
stu-miR399d-5p GGGCUACUCUCUAUUGGCAUG 21 0 0 0 0    0 0
stu-miR399e-3p UGCCAAAGGAGAGCUGCCCUG 21 0 0 0 0    0 0
stu-miR399e-5p GGGCUACUCUCUAUUGGCAUG 21 0 0 0 0    0 0
stu-miR399f-3p UGCCAAAGGAGAGCUGCCCUG 21 0 0 0 0    0 0
stu-miR399f-5p GGGCUACUCUCUAUUGGCAUG 21 0 0 0 0    0 0
stu-miR399g-3p CGCCAAAGGGGAGCUGCCCUA 21 0 0 0 0    0 0
stu-miR399g-5p GGGCUACUCUCUAUUGGCAUG 21 0 0 0 0    0 0
stu-miR399h GGGCUACUCUCUAUUGGCAUG 21 0 0 0 0    0 0
stu-miR399i-3p UGCCAAAGGAGAGUUGCCCUA 21 0 0 0 0    0 0
stu-miR399i-5p GGGCUACACUCUAUUGGCAUG 21 0 0 0 0    0 0
stu-miR399j-3p CGCCAAAGGAGAGCUGCCCUG 21 0 0 0 0    0 0
stu-miR399j-5p GGGCUACUCUCUAUUGGCAUA 21 0 0 0 0    0 0
stu-miR399k-3p CGCCAAAGGAGAGCUGCCCUG 21 0 0 0 0    0 0
stu-miR399k-5p GGGCUACUCUCUAUUGGCAUG 21 0 0 0 0    0 0
stu-miR399l-3p CGCCAAAGGAGAGCUGCCCUG 21 0 0 0 0    0 0
stu-miR399l-5p GGGCUACUCUCUAUUGGCAUG 21 0 0 0 0    0 0
stu-miR399m-3p CGCCAAAGGAGAGCUGCCCUG 21 0 0 0 0    0 0
stu-miR399m-5p GGGCUACUCUCUAUUGGCAUG 21 0 0 0 0    0 0
stu-miR399n-3p CGCCAAAGGAGAGCUGCCCUG 21 0 0 0 0    0 0
stu-miR399n-5p GGGCUACUCUCUAUUGGCAUG 21 0 0 0 0    0 0
stu-miR399o-3p CGCCAAAGGAGAGCUGCCCUG 21 0 0 0 0    0 0
stu-miR399o-5p GGGCUACUCUCUAUUGGCAUG 21 0 0 0 0    0 0
stu-miR408a-3p UGCACAGCCUCUUCCCUGGUU 21 0 0 0 0    0 0
stu-miR408a-5p ACAGGGACGAGGCAGCGCAUG 21 0 0 0 0    0 0
stu-miR408b-3p UGCACUGCCUCUUCCCUGGCU 21 0 0 0 0    0 0
stu-miR408b-5p ACGGGGACGAGACAGAGCAUG 21 0 0 0 0    0 0
stu-miR477a-3p GAAGCUCUAGCAGGGAGAGCCA 22 0 0 0 0    0 0
stu-miR477a-5p CCUCUCCCUCAAGGGCUUCUC 21 0 0 0 0    0 0
stu-miR477b-3p GAGGUCUUUCGAGUGAGAGUGA 22 0 0 0 0    0 0
stu-miR477b-5p ACUCUCCCUCAAAGGCUUCUG 21 0 0 0 0    0 0
stu-miR479 UGAGCCGAACCAAUAUCACUC 21 0 0 0 0    0 0
stu-miR482a-3p UUUCCAAUUCCACCCAUUCCUA 22 0 0 0 0    0 0
stu-miR482a-5p GGAAUUGGUGGAUUGGAAAGC 21 0 0 0 0    0 0
stu-miR482b-3p UUACCGAUUCCCCCCAUUCCAA 22 0 0 0 0    0 0
stu-miR482b-5p GGAGUGGGUGGCAUGGUAAGA 21 0 0 0 0    0 0
stu-miR482c UUUCCUAUUCCACCCAUGCCAA 22 0 0 0 0    0 0
stu-miR482d-3p UCUUGCCUACACCGCCCAUGCC 22 0 0 0 0    0 0
stu-miR482d-5p CGUGAGUGGUGGGGUAAGAUA 21 0 0 0 0    0 0
stu-miR482e-3p UCUUGCCAAUACCGCCCAUUCC 22 0 0 0 0    0 0
stu-miR482e-5p AGUGGGUGGUGUGGUAAGAUU 21 0 0 0 0    0 0
stu-miR530 UCUGCAUUUGCACCUGCACCU 21 0 0 0 0    0 0
stu-miR5303a UUUUGGAGAAUCCGACACGCACCC 24 0 0 0 0    0 0
stu-miR5303b UUUUGGAGAAUCCGACACGCACCC 24 0 0 0 0    0 0
stu-miR5303c UUUUGGAGAAUCCGACACGCACCC 24 0 0 0 0    0 0
stu-miR5303d UUUUGGAGAAUCCGACACGCACCC 24 0 0 0 0    0 0
stu-miR5303e UUUUGGAGAAUCUGACACGGGUGU 24 0 0 0 0    0 0
stu-miR5303f AUUUUUGGAGAAUCUGACACGGGU 24 0 0 0 0    0 0
stu-miR5303g AUAUUUUUGAAGAGUCUGAGCAAC 24 0 0 0 0    0 0
stu-miR5303h AACAUUUUUGAAGAGUCUGAGCAA 24 0 0 0 0    0 0
stu-miR5303i AUAUUUUUGAAGAGUCUGAGCAAC 24 0 0 0 0    0 0
stu-miR5303j AAUAUUUUUGAAGAGUCUGAGCAA 24 0 0 0 0    0 0
stu-miR5304-3p AGAUGAGUAUGGUGCAUUGGA 21 0 0 0 0    0 0
stu-miR5304-5p CAAUGCAACAUACUCAUCACC 21 0 0 0 0    0 0
stu-miR6022 UGGAAGGGAGAAUAUCCAGGA 21 0 0 0 0    0 0
stu-miR6023 UUCCAUGAAAGUGUUUUUGGAU 22 0 0 0 0    0 0
stu-miR6024-3p UUUUAGCAAGAGUUGUUUUCCC 22 0 0 0 0    0 0
stu-miR6024-5p AGAAACAACACUUGCUAAAAGA 22 0 0 0 0    0 0
stu-miR6025 UACCAACAAUUGAGAUAACAUC 22 0 0 0 0    0 0
stu-miR6026-3p UUCUUGGCUAGAGUUGUAUUGC 22 0 0 0 0    0 0
stu-miR6026-5p AAUACAACUAUUGCCAAGACAA 22 0 0 0 0    0 0
stu-miR6027 UGAAUCCUUCGGCUAUCCAUAA 22 0 0 0 0    0 0
stu-miR6149-3p UGAUUCAGGUUUGUAUGCAAAC 22 0 0 0 0    0 0
stu-miR6149-5p UUGCAACACACCUGAAUCGUC 21 0 0 0 0    0 0
stu-miR7122-3p ACAGCGUUUCUCUGUAUAACC 21 0 0 0 0    0 0
stu-miR7122-5p UUAUACAGAGAAACCGCUGUCG 22 0 0 0 0    0 0
stu-miR7979 AGGUACAUGAACUCUAACGAGGCA 24 0 0 0 0    0 0
stu-miR7980a AUGAGAUGAAGUCAAUGUUUGGAC 24 0 0 0 0    0 0
stu-miR7980b-3p GAGAUGGAAUCAGUGUUUGGACAU 24 0 0 0 0    0 0
stu-miR7980b-5p GUCCAAACACUGAUUCCAUCUCAU 24 0 0 0 0    0 0
stu-miR7981-3p AUAGGACUUUAGUUUAGUUAAGGU 24 0 0 0 0    0 0
stu-miR7981-5p GUUAAUUAAACUAUGGUCCUAUUA 24 0 0 0 0    0 0
stu-miR7982a AAGUUGGAUGAUAAUAAUAUAUAU 24 0 0 0 0    0 0
stu-miR7982b AAGUUGGAUGAUAAUAAUAUAUAU 24 0 0 0 0    0 0
stu-miR7983-3p ACUAAUGCCGGUAAAGACUUUAAC 24 0 0 0 0    0 0
stu-miR7983-5p UAAAGUCUUUAGCGACAUUGGUUC 24 0 0 0 0    0 0
stu-miR7984a AUACCGAACUUUGGAAAUGACCUU 24 0 0 0 0    0 0
stu-miR7984b-3p GGUCUUUCAUAAAAUUUGGUAUCG 24 0 0 0 0    0 0
stu-miR7984b-5p AUACCGAACUUUGGAAAUGACCUU 24 0 0 0 0    0 0
stu-miR7984c-3p CCUUCAUAAAGUUUGGUAUCGUAA 24 0 0 0 0    0 0
stu-miR7984c-5p ACGAUACCAAACUUUAUGAAGGAC 24 0 0 0 0    0 0
stu-miR7984d-3p CAAUUUCGGUCAAAGUUCGGAUAU 24 0 0 0 0    0 0
stu-miR7984d-5p AUCCGAACUUUGACCGAAAUUGCU 24 0 0 0 0    0 0
stu-miR7985 CGGGCUUGCCUAGAACGGGUUACC 24 0 0 0 0    0 0
stu-miR7986 AGUUUAAAACGUUACUGUCGGUAA 24 0 0 0 0    0 0
stu-miR7987 ACACUAGUUGAUCUUAUUGAUGAC 24 0 0 0 0    0 0
stu-miR7988 AACGGAAAAGGGCCAAAAAUACCC 24 0 0 0 0    0 0
stu-miR7989 ACAAAUAAGUCCAUUACCUGAACC 24 0 0 0 0    0 0
stu-miR7990a UUCAAAUGAUCGUAACUUUGGCCU 24 0 0 0 0    0 0
stu-miR7990b GAAUUUUCAAAUGAUCGUAACUUU 24 0 0 0 0    0 0
stu-miR7991a AGGAGGUCGGAAUUUUUAAUGAAU 24 0 0 0 0    0 0
stu-miR7991b AGGAGGUCGGAAUUUUUAAUGAAU 24 0 0 0 0    0 0
stu-miR7991c AGGAGGUCGGAAUUUUUAAUGAAU 24 0 0 0 0    0 0
stu-miR7992-3p UGUCUAGAUGUGCAUUUCAAAGU 23 0 0 0 0    0 0
stu-miR7992-5p UUUGACAAUGCACAUCUAGACACU 24 0 0 0 0    0 0
stu-miR7993a AUAUUUUAUGUGGUUAACUUAACU 24 0 0 0 0    0 0
stu-miR7993b-3p AUAUUUUAUGUGGUUAACUUAACU 24 0 0 0 0    0 0
stu-miR7993b-5p UUAAGUUAACCACAUAAAAUAUGU 24 0 0 0 0    0 0
stu-miR7993c AUAUUUUAUGUGGUUAACUUAACU 24 0 0 0 0    0 0
stu-miR7993d AUAUUUUAUGUGGUUAACUUAACU 24 0 0 0 0    0 0
stu-miR7994a AUAUUAUACUUGGGCAUAAACUCC 24 0 0 0 0    0 0
stu-miR7994b-3p AUAUUAUACUUGGGCAUAAACUCC 24 0 0 0 0    0 0
stu-miR7994b-5p AGUUUAUGCCCAAGUAUAUAAUAUAU 26 0 0 0 0    0 0
stu-miR7995 UUACACGUAGACAAGUUGACCAUU 24 0 0 0 0    0 0
stu-miR7996a AUGUGGUACAUAUGAAAUUUGAAA 24 0 0 0 0    0 0
stu-miR7996b AUGUGGUACAUAUGAAAUUUGAAA 24 0 0 0 0    0 0
stu-miR7996c AUGUGGUACAUAUGAAAUUUGAAA 24 0 0 0 0    0 0
stu-miR7997a AUGCUGCUCGGACUCUUCAAA 21 0 0 0 0    0 0
stu-miR7997b AUGCUGCUCGGACUCUUCAAA 21 0 0 0 0    0 0
stu-miR7997c AUAUUGCUCGGACUCUUCAAAAAU 24 0 0 0 0    0 0
stu-miR7998 ACGGACCGUAGAUCAAUCCACAGU 24 0 0 0 0    0 0
stu-miR7999-3p ACGACCCGUAGAACUGCCCACGAC 24 0 0 0 0    0 0
stu-miR7999-5p CUGGGUCACUUCUACGGGUCCUUC 24 0 0 0 0    0 0
stu-miR8000 ACACCGAAGAACUGACACCGAAGA 24 0 0 0 0    0 0
stu-miR8001a UCCUGGGGAUUAGUAUGAAAAUUC 24 0 0 0 0    0 0
stu-miR8001b-3p GGAUUUUCAUACUAAUUCCUAGAA 24 0 0 0 0    0 0
stu-miR8001b-5p AUGGGGAUUAGUAUGAAAAUUUGC 24 0 0 0 0    0 0
stu-miR8002-3p AUUCCAUUAUUAUCAAGAAAAAAG 24 0 0 0 0    0 0
stu-miR8002-5p UUUUUCGUGAUAAUAAUGGAAUCA 24 0 0 0 0    0 0
stu-miR8003 AUUUCGGUAUACAAAUGGGAUGAC 24 0 0 0 0    0 0
stu-miR8004 AGGGGUUGUGUAUGUGUUUGGCCU 24 0 0 0 0    0 0
stu-miR8005a UUUAGAGUUUAAGGUUUAGAGUUU 24 0 0 0 0    0 0
stu-miR8005b-3p UUUAGAGUUUAAGGUUUAGAGUUU 24 0 0 0 0    0 0
stu-miR8005b-5p ACUCUAAAUUUUAAAUUCUAAAUC 24 0 0 0 0    0 0
stu-miR8005c UUUAGAGUUUAAGGUUUAGAGUUU 24 0 0 0 0    0 0
stu-miR8006-3p UGCCCUGCCGUCCAAAAAAUAGA 23 0 0 0 0    0 0
stu-miR8006-5p UAGUUUUUGGACGACAGGGGCACC 24 0 0 0 0    0 0
stu-miR8007a-3p CGAAAAAUGAAAAGUGCCACAUAA 24 0 0 0 0    0 0
stu-miR8007a-5p AUGUGGCACUUUUCGGAUUUUGAG 24 0 0 0 0    0 0
stu-miR8007b-3p CGAAAAAUGAAAAGUACCACAUAA 24 0 0 0 0    0 0
stu-miR8007b-5p AUGUGACACUUUUUGAAUUUCGAG 24 0 0 0 0    0 0
stu-miR8008a AUUUCCAGAAAAGCGACGGACAGU 24 0 0 0 0    0 0
stu-miR8008b AAACCCAGAAAAGCGACGGACAGU 24 0 0 0 0    0 0
stu-miR8009 AUUUCCAGAAAAGCGACGGACAGU 24 0 0 0 0    0 0
stu-miR8010 AUAGGACCCUAGUUAAAUUUAGGU 24 0 0 0 0    0 0
stu-miR8011a-3p AAUAAAAAGAAGCCUCACACAACU 24 0 0 0 0    0 0
stu-miR8011a-5p UUGUGUGAGGUUUCUUUUUGUUUC 24 0 0 0 0    0 0
stu-miR8011b-3p UUCGUGAGACAAAAAGAAGCCU 22 0 0 0 0    0 0
stu-miR8011b-5p ACUCAUUUUUGUCUCACAAAAA 22 0 0 0 0    0 0
stu-miR8012 AUGACUUUAAGUCGCGUCUGGCCC 24 0 0 0 0    0 0
stu-miR8013 AGAAGAAAAUCGCUCCGUCAGAAG 24 0 0 0 0    0 0
stu-miR8014-3p AUGAAUACAAUGUUUGGAUAAAUU 24 0 0 0 0    0 0
stu-miR8014-5p AUUGUUUCAUAUUGUAUUGUAUUU 24 0 0 0 0    0 0
stu-miR8015-3p GUUUCAUUUUCAAGGUCCAAUAGC 24 0 0 0 0    0 0
stu-miR8015-5p UAUUGGAUAUUGAAAAUGAAACUU 24 0 0 0 0    0 0
stu-miR8016 AUUUUUGAAUGGAAGGCCCAUGUG 24 0 0 0 0    0 0
stu-miR8017 AUCCAAGUGAAGUGUAUCGUCUCA 24 0 0 0 0    0 0
stu-miR8018 ACGAACCGUAGAUCCCAUCCGUGG 24 0 0 0 0    0 0
stu-miR8019-3p AAAAGAAUGACCUGGUUUGACUUG 24 0 0 0 0    0 0
stu-miR8019-5p AGGGAAGCAGGUCAUUCUUUAUG 23 0 0 0 0    0 0
stu-miR8020 AAUUUCAUUGAGUAUGUUGUUGUU 24 0 0 0 0    0 0
stu-miR8021 AUUCAAGGCUCAAACUCGAGACCU 24 0 0 0 0    0 0
stu-miR8022 UUUAAAUGAGAAUUUUGGACUAUU 24 0 0 0 0    0 0
stu-miR8023 UUUGGCACAAUUUCAUUGGCAACC 24 0 0 0 0    0 0
stu-miR8024a-3p UUGGAGGAUUUGAAGAUUUCAACU 24 0 0 0 0    0 0
stu-miR8024a-5p UUGAAGAAUUUAAAGACUUCAACU 24 0 0 0 0    0 0
stu-miR8024b UUGGAGGAUUUGAAGAUUUCAACU 24 0 0 0 0    0 0
stu-miR8025-3p UUUAAUUGCAUGCCAAGUGUGUGG 24 0 0 0 0    0 0
stu-miR8025-5p ACAUACUCGACAUGCAAUUAAAUU 24 0 0 0 0    0 0
stu-miR8026 AUGUAGAGAAUAUGUGGUAACCCU 24 0 0 0 0    0 0
stu-miR8027 AUCUCGAGAUAAGUUAUUCUGGAC 24 0 0 0 0    0 0
stu-miR8028-3p GUUCAUAAUUAUAGUAUAAGGAUG 24 0 0 0 0    0 0
stu-miR8028-5p UCCUUAUGCUACAAUUGUGAACAA 24 0 0 0 0    0 0
stu-miR8029 AGCCAUUUUUCUUUGUUUUGGAGC 24 0 0 0 0    0 0
stu-miR8030-3p UUAAAACCAAAUCAACCCAAAU 22 0 0 0 0    0 0
stu-miR8030-5p UUGGGUUGGUUUGGUCUCGGGUU 23 0 0 0 0    0 0
stu-miR8031 UUAGACACCUCAACUAAGACUUG 23 0 0 0 0    0 0
stu-miR8032a-3p AGUGUGAGUCGGUGUGAUUAGG 22 0 0 0 0    0 0
stu-miR8032a-5p UGGUCGGCAUGACUCCCGAGGU 22 0 0 0 0    0 0
stu-miR8032b-3p AGUGUGAGUCGGUGCGAUUAGG 22 0 0 0 0    0 0
stu-miR8032b-5p UGGUCGGCAUGACUCCCGAGGU 22 0 0 0 0    0 0
stu-miR8032c UGGUCGGCAUGACUCCCGAGGU 22 0 0 0 0    0 0
stu-miR8032d-3p AGUGUGAGUUGGUGCGAUUAGG 22 0 0 0 0    0 0
stu-miR8032d-5p UGGUCGGCAUGACUCCCGAGGU 22 0 0 0 0    0 0
stu-miR8032e-3p AGUGUGAGUCGGUGUGAUUAGG 22 0 0 0 0    0 0
stu-miR8032e-5p UGGUCGGCAUGACUCCCGAGGU 22 0 0 0 0    0 0
stu-miR8032f-3p AGUGUGAGUCGGUGCGAUUAGG 22 0 0 0 0    0 0
stu-miR8032f-5p UGGUCGGCAUGACUCCCGAGGU 22 0 0 0 0    0 0
stu-miR8032g-3p AGUGUGAGUCGGUGCGAUUAGG 22 0 0 0 0    0 0
stu-miR8032g-5p UGGUCGGCAUGACUCCCGAGGU 22 0 0 0 0    0 0
stu-miR8033-3p UCAAUUCUGCAGCUUUAGGAGU 22 0 0 0 0    0 0
stu-miR8033-5p UUCCAAAGCUGCAGAAAUGAGU 22 0 0 0 0    0 0
stu-miR8034 UAUGACAAACACUGCAAAAACU 22 0 0 0 0    0 0
stu-miR8035 UCCAUCUUCAAUAUCACUUUCU 22 0 0 0 0    0 0
stu-miR8036-3p UAUGUCUUUCCGAUGCCUCCCA 22 0 0 0 0    0 0
stu-miR8036-5p GGAGGAAUCGAAAGAUAUAAG 21 0 0 0 0    0 0
stu-miR8037 AUAAUUUGGAGGAAUAGGAACC 22 0 0 0 0    0 0
stu-miR8038a-3p GUUCAACUUGCUCACUUGGAG 21 0 0 0 0    0 0
stu-miR8038a-5p CCUUGUGAGUAAGUUGAAUCUC 22 0 0 0 0    0 0
stu-miR8038b-3p GUUCAACUUGCUCACUUGGAG 21 0 0 0 0    0 0
stu-miR8038b-5p CCUUGUGAGUAAGUUGAAUCUC 22 0 0 0 0    0 0
stu-miR8039 UUUCCUAUCUGAACUAUCACC 21 0 0 0 0    0 0
stu-miR8040-3p CUUAUAAUUGUAAUUAUGAUC 21 0 0 0 0    0 0
stu-miR8040-5p UCAUAAUUACAAUUAUAAGCC 21 0 0 0 0    0 0
stu-miR8041a-3p AUGAUGUAUAGCAAAGAGCCU 21 0 0 0 0    0 0
stu-miR8041a-5p GUGCUUUGCUAUUUUCAUUG 20 0 0 0 0    0 0
stu-miR8041b-3p AUGAUGUAUAGCAAAGAGCCU 21 0 0 0 0    0 0
stu-miR8041b-5p GUGCUUUGCUAUUUUCAUUG 20 0 0 0 0    0 0
stu-miR8042 AUUAGACUGAAGUGCUGAUCU 21 0 0 0 0    0 0
stu-miR8043 UGAUAUAAUUGGACUUUGGCC 21 0 0 0 0    0 0
stu-miR8044-3p UCUCCAGCGAUAUUUGAAACU 21 0 0 0 0    0 0
stu-miR8044-5p UUUCAAAUAUGGUUGGAGAUG 21 0 0 0 0    0 0
stu-miR8045 AUUGAUAGUUGAGGUGUGUUU 21 0 0 0 0    0 0
stu-miR8046-3p CGCUGAAAUUUCGAUCAUAAU 21 0 0 0 0    0 0
stu-miR8046-5p UAUGAUCGAAGUUUCAAUGAC 21 0 0 0 0    0 0
stu-miR8047 CCAUUUUUUCGAAAUUAGACC 21 0 0 0 0    0 0
stu-miR8048-3p AGAUGGACAUGCUAAUGAACA 21 0 0 0 0    0 0
stu-miR8048-5p CUCAUUAGCAUCUCCAUCUUG 21 0 0 0 0    0 0
stu-miR8049-3p CAUGUCUACAUGAGCCUGAUA 21 0 0 0 0    0 0
stu-miR8049-5p CAAGGCUCAUGCAGACAUGCA 21 0 0 0 0    0 0
stu-miR8050-3p UGACUUGAGAUUCCUACUUGG 21 0 0 0 0    0 0
stu-miR8050-5p AAGUAGGAAUCAAGGUCAAU 20 0 0 0 0    0 0
stu-miR8051-3p UAUUUCUUCUACCAUACUAUU 21 0 0 0 0    0 0
stu-miR8051-5p UAGUAUGGUAGAAAGAUUCA 20 0 0 0 0    0 0
stu-miR827-3p UUAGAUGAACAUCAACAAACA 21 0 0 0 0    0 0
stu-miR827-5p UUUGUUGAUGGUCAUCUAUUC 21 0 0 0 0    0 0