Poplar Small RNA miRNA Abundances

The data below are based on the microRNAs listed in the miRBase registry. Adjust libraries/reads to display on the control panel.


        miRNA         miRNA sequence Len Sum (norm) Average Max Min (>0)  PTR1PTR2PTR3
ptc-miR1444a UCCACAUUCGGUCAAUGUUC 20 8 3 3 2    3 2 3
ptc-miR1444b UUCACAUUCGGUCAACGUUC 20 0 0 0 0    0 0 0
ptc-miR1444c UUCACAUUCGGUCAACGUUC 20 0 0 0 0    0 0 0
ptc-miR1444d CGAACGUUGACCGAAUGUGAA 21 0 0 0 0    0 0 0
ptc-miR1444e CGAACGUUGACCGAAUGUGAA 21 0 0 0 0    0 0 0
ptc-miR1445 UCCCUUGUAGACUAGAAAAA 20 0 0 0 0    0 0 0
ptc-miR1446a UUCUGAACUCUCUCCCUCAA 20 16 5 8 2    2 8 6
ptc-miR1446b UUCUGAACUCUCUCCCUCAA 20 16 5 8 2    2 8 6
ptc-miR1446c UUCUGAACUCUCUCCCUCAA 20 16 5 8 2    2 8 6
ptc-miR1446d UUCUGAACUCUCUCCCUCAA 20 16 5 8 2    2 8 6
ptc-miR1446e UUCUGAACUCUCUCCCUCAA 20 16 5 8 2    2 8 6
ptc-miR1447 CAGAAUUGCAGUGCCUUGAUU 21 1,058 353 436 257    436 257 365
ptc-miR1448 CUUUCCAACGCCUCCCAUAC 20 0 0 0 0    0 0 0
ptc-miR1449 UGAGGUGCACGUAAGAUAACUC 22 1 0 1 1    1 0 0
ptc-miR1450 UUCAAUGGCUCGGUCAGGUUAC 22 77 26 46 9    9 46 22
ptc-miR156a UGACAGAAGAGAGUGAGCAC 20 22,094 7,365 12,038 3,317    12,038 6,739 3,317
ptc-miR156b UGACAGAAGAGAGUGAGCAC 20 22,094 7,365 12,038 3,317    12,038 6,739 3,317
ptc-miR156c UGACAGAAGAGAGUGAGCAC 20 22,094 7,365 12,038 3,317    12,038 6,739 3,317
ptc-miR156d UGACAGAAGAGAGUGAGCAC 20 22,094 7,365 12,038 3,317    12,038 6,739 3,317
ptc-miR156e UGACAGAAGAGAGUGAGCAC 20 22,094 7,365 12,038 3,317    12,038 6,739 3,317
ptc-miR156f UGACAGAAGAGAGUGAGCAC 20 22,094 7,365 12,038 3,317    12,038 6,739 3,317
ptc-miR156g UUGACAGAAGAUAGAGAGCAC 21 130,604 43,535 54,686 32,388    32,388 43,530 54,686
ptc-miR156h UUGACAGAAGAUAGAGAGCAC 21 130,604 43,535 54,686 32,388    32,388 43,530 54,686
ptc-miR156i UUGACAGAAGAUAGAGAGCAC 21 130,604 43,535 54,686 32,388    32,388 43,530 54,686
ptc-miR156j UUGACAGAAGAUAGAGAGCAC 21 130,604 43,535 54,686 32,388    32,388 43,530 54,686
ptc-miR156k UGACAGAAGAGAGGGAGCAC 20 68 23 35 11    35 22 11
ptc-miR156l UUGACAGAAGAUGGAGAGCAC 21 65 22 26 18    18 21 26
ptc-miR159a UUUGGAUUGAAGGGAGCUCUA 21 1,048 349 408 296    296 408 344
ptc-miR159b UUUGGAUUGAAGGGAGCUCUA 21 1,048 349 408 296    296 408 344
ptc-miR159c AUUGGAGUGAAGGGAGCUCGA 21 0 0 0 0    0 0 0
ptc-miR159d CUUGGAUUGAAGGGAGCUCCU 21 0 0 0 0    0 0 0
ptc-miR159e CUUGGGGUGAAGGGAGCUCCU 21 0 0 0 0    0 0 0
ptc-miR160a UGCCUGGCUCCCUGUAUGCCA 21 65 22 44 7    7 44 14
ptc-miR160b-3p GCGUAUGAGGAGCCAUGCAUA 21 4 1 2 1    2 1 1
ptc-miR160b-5p UGCCUGGCUCCCUGUAUGCCA 21 65 22 44 7    7 44 14
ptc-miR160c-3p GCGUAUGAGGAGCCAUGCAUA 21 4 1 2 1    2 1 1
ptc-miR160c-5p UGCCUGGCUCCCUGUAUGCCA 21 65 22 44 7    7 44 14
ptc-miR160d UGCCUGGCUCCCUGUAUGCCA 21 65 22 44 7    7 44 14
ptc-miR160e-3p GCAUGAGGGGAGUCGAGCAGG 21 10 3 4 2    4 4 2
ptc-miR160e-5p UGCCUGGCUCCCUGAAUGCCA 21 7 2 4 1    2 4 1
ptc-miR160f UGCCUGGCUCCCUGAAUGCCA 21 7 2 4 1    2 4 1
ptc-miR160g UGCCUGGCUCCCUGGAUGCCA 21 0 0 0 0    0 0 0
ptc-miR160h UGCCUGGCUCCCUGCAUGCCA 21 0 0 0 0    0 0 0
ptc-miR162a UCGAUAAACCUCUGCAUCCAG 21 960 320 452 173    335 452 173
ptc-miR162b UCGAUAAACCUCUGCAUCCAG 21 960 320 452 173    335 452 173
ptc-miR164a UGGAGAAGCAGGGCACGUGCA 21 6,111 2,037 2,781 1,425    1,425 2,781 1,905
ptc-miR164b UGGAGAAGCAGGGCACGUGCA 21 6,111 2,037 2,781 1,425    1,425 2,781 1,905
ptc-miR164c UGGAGAAGCAGGGCACGUGCA 21 6,111 2,037 2,781 1,425    1,425 2,781 1,905
ptc-miR164d UGGAGAAGCAGGGCACGUGCA 21 6,111 2,037 2,781 1,425    1,425 2,781 1,905
ptc-miR164e UGGAGAAGCAGGGCACGUGCA 21 6,111 2,037 2,781 1,425    1,425 2,781 1,905
ptc-miR164f UGGAGAAGCAGGGCACAUGCU 21 8 3 6 1    1 6 1
ptc-miR166a UCGGACCAGGCUUCAUUCCCC 21 81,946 27,315 80,162 98    80,162 1,686 98
ptc-miR166b UCGGACCAGGCUUCAUUCCCC 21 81,946 27,315 80,162 98    80,162 1,686 98
ptc-miR166c UCGGACCAGGCUUCAUUCCCC 21 81,946 27,315 80,162 98    80,162 1,686 98
ptc-miR166d UCGGACCAGGCUUCAUUCCCC 21 81,946 27,315 80,162 98    80,162 1,686 98
ptc-miR166e UCGGACCAGGCUUCAUUCCCC 21 81,946 27,315 80,162 98    80,162 1,686 98
ptc-miR166f UCGGACCAGGCUUCAUUCCCC 21 81,946 27,315 80,162 98    80,162 1,686 98
ptc-miR166g UCGGACCAGGCUUCAUUCCCC 21 81,946 27,315 80,162 98    80,162 1,686 98
ptc-miR166h UCGGACCAGGCUUCAUUCCCC 21 81,946 27,315 80,162 98    80,162 1,686 98
ptc-miR166i UCGGACCAGGCUUCAUUCCCC 21 81,946 27,315 80,162 98    80,162 1,686 98
ptc-miR166j UCGGACCAGGCUUCAUUCCCC 21 81,946 27,315 80,162 98    80,162 1,686 98
ptc-miR166k UCGGACCAGGCUUCAUUCCCC 21 81,946 27,315 80,162 98    80,162 1,686 98
ptc-miR166l UCGGACCAGGCUUCAUUCCCC 21 81,946 27,315 80,162 98    80,162 1,686 98
ptc-miR166m UCGGACCAGGCUUCAUUCCCC 21 81,946 27,315 80,162 98    80,162 1,686 98
ptc-miR166n UCGGACCAGGCUUCAUUCCUU 21 7,488 2,496 7,481 2    7,481 2 5
ptc-miR166o UCGGACCAGGCUUCAUUCCUU 21 7,488 2,496 7,481 2    7,481 2 5
ptc-miR166p UCGGACCAGGCUCCAUUCCUU 21 6 2 6 6    6 0 0
ptc-miR166q UCGGACCAGGCUUCAUUCCUU 21 7,488 2,496 7,481 2    7,481 2 5
ptc-miR167a UGAAGCUGCCAGCAUGAUCUA 21 297 99 238 24    238 24 35
ptc-miR167b UGAAGCUGCCAGCAUGAUCUA 21 297 99 238 24    238 24 35
ptc-miR167c UGAAGCUGCCAGCAUGAUCUA 21 297 99 238 24    238 24 35
ptc-miR167d UGAAGCUGCCAGCAUGAUCUA 21 297 99 238 24    238 24 35
ptc-miR167e UGAAGCUGCCAGCAUGAUCUG 21 477 159 422 21    422 21 34
ptc-miR167f-3p AGAUCAUGUGGCAGUUUCACC 21 22 7 22 22    22 0 0
ptc-miR167f-5p UGAAGCUGCCAGCAUGAUCUU 21 126 42 117 4    117 5 4
ptc-miR167g-3p AGAUCAUGUGGCAGUUUCACC 21 22 7 22 22    22 0 0
ptc-miR167g-5p UGAAGCUGCCAGCAUGAUCUU 21 126 42 117 4    117 5 4
ptc-miR167h-3p AGAUCAUGUGGCAGUUUCACC 21 22 7 22 22    22 0 0
ptc-miR167h-5p UGAAGCUGCCAACAUGAUCUG 21 1 0 1 1    1 0 0
ptc-miR168a-3p CCCGCCUUGCAUCAACUGAAU 21 219 73 158 22    39 22 158
ptc-miR168a-5p UCGCUUGGUGCAGGUCGGGAA 21 4,350 1,450 1,533 1,367    1,533 1,367 1,450
ptc-miR168b-3p CCCGCCUUGCAUCAACUGAAU 21 219 73 158 22    39 22 158
ptc-miR168b-5p UCGCUUGGUGCAGGUCGGGAA 21 4,350 1,450 1,533 1,367    1,533 1,367 1,450
ptc-miR169a CAGCCAAGGAUGACUUGCCGA 21 83 28 45 3    45 3 35
ptc-miR169aa GAGCCAAGAAUGACUUGUCGG 21 0 0 0 0    0 0 0
ptc-miR169ab CAGCCAAGGAAGACUUGCCC 20 0 0 0 0    0 0 0
ptc-miR169ac UAGCCAAGGACGACUUGCCCA 21 31 10 20 4    4 7 20
ptc-miR169ad UAGCCAAGGACGACUUGCCCA 21 31 10 20 4    4 7 20
ptc-miR169ae UAGCCAAGGACGACUUGCCCA 21 31 10 20 4    4 7 20
ptc-miR169af UAGCCAAGGACGACUUGCCCA 21 31 10 20 4    4 7 20
ptc-miR169ag AAGCCAAGGGUGACUUGCCUGA 22 5 2 3 1    1 1 3
ptc-miR169b-3p GGCAGGUUGUUCUUGGCUAC 20 131 44 96 35    35 0 96
ptc-miR169b-5p CAGCCAAGGAUGACUUGCCGA 21 83 28 45 3    45 3 35
ptc-miR169c CAGCCAAGGAUGACUUGCCGA 21 83 28 45 3    45 3 35
ptc-miR169d CAGCCAAGGAUGACUUGCCGG 21 44 15 32 5    5 7 32
ptc-miR169e CAGCCAAGGAUGACUUGCCGG 21 44 15 32 5    5 7 32
ptc-miR169f CAGCCAAGGAUGACUUGCCGG 21 44 15 32 5    5 7 32
ptc-miR169g CAGCCAAGGAUGACUUGCCGG 21 44 15 32 5    5 7 32
ptc-miR169h CAGCCAAGGAUGACUUGCCGG 21 44 15 32 5    5 7 32
ptc-miR169i UAGCCAAGGAUGACUUGCCUG 21 31 10 14 7    10 7 14
ptc-miR169j UAGCCAAGGAUGACUUGCCUG 21 31 10 14 7    10 7 14
ptc-miR169k UAGCCAAGGAUGACUUGCCUG 21 31 10 14 7    10 7 14
ptc-miR169l UAGCCAAGGAUGACUUGCCUG 21 31 10 14 7    10 7 14
ptc-miR169m UAGCCAAGGAUGACUUGCCUG 21 31 10 14 7    10 7 14
ptc-miR169n-3p GCAAGCAUCCUUGGUUCUCC 20 57 19 46 3    3 8 46
ptc-miR169n-5p UGAGCCAAGGAUGACUUGCCG 21 290 97 183 42    42 65 183
ptc-miR169o AAGCCAAGGAUGACUUGCCUG 21 0 0 0 0    0 0 0
ptc-miR169p CAGCCAAGGAUGACUUGCCGG 21 44 15 32 5    5 7 32
ptc-miR169q UAGCCAAGGACGACUUGCCUG 21 11 4 7 1    7 1 3
ptc-miR169r UAGCCAAGGAUGACUUGCCUA 21 0 0 0 0    0 0 0
ptc-miR169s UCAGCCAAGGAUGACUUGCCG 21 1 0 1 1    0 1 0
ptc-miR169t GAGCCAAGAAUGACUUGCCGG 21 0 0 0 0    0 0 0
ptc-miR169u-3p GGCAGUCUCCUUUGGCUAUCC 21 0 0 0 0    0 0 0
ptc-miR169u-5p UAGCCAAGGACGACUUGCCUA 21 24 8 17 2    17 2 5
ptc-miR169v UAGCCAAGGAUGACUUGCCCA 21 0 0 0 0    0 0 0
ptc-miR169w UAGCCAAGGAUGACUUGCCCA 21 0 0 0 0    0 0 0
ptc-miR169x UAGCCAAGGAUGACUUGCUCG 21 1 0 1 1    0 1 0
ptc-miR169y UAGCCAUGGAUGAAUUGCCUG 21 0 0 0 0    0 0 0
ptc-miR169z CAGCCAAGAAUGAUUUGCCGG 21 3 1 1 1    1 1 1
ptc-miR171a-3p UUGAGCCGUGCCAAUAUCACG 21 5 2 3 2    0 2 3
ptc-miR171a-5p GGAUAUUGGUACGGUUCAAUC 21 24 8 10 6    10 8 6
ptc-miR171b UUGAGCCGUGCCAAUAUCACG 21 5 2 3 2    0 2 3
ptc-miR171c AGAUUGAGCCGCGCCAAUAUC 21 1 0 1 1    0 0 1
ptc-miR171d AGAUUGAGCCGCGCCAAUAUC 21 1 0 1 1    0 0 1
ptc-miR171e UGAUUGAGCCGUGCCAAUAUC 21 47 16 34 5    34 5 8
ptc-miR171f UGAUUGAGCCGUGCCAAUAUC 21 47 16 34 5    34 5 8
ptc-miR171g-3p UGAUUGAGCCGUGCCAAUAUC 21 47 16 34 5    34 5 8
ptc-miR171g-5p UGUUGGGAUGGCUCAAUCAUG 21 17 6 11 1    1 11 5
ptc-miR171h-3p UGAUUGAGCCGUGCCAAUAUC 21 47 16 34 5    34 5 8
ptc-miR171h-5p UGUUGGGAUGGCUCAAUCAUA 21 9 3 9 9    0 0 9
ptc-miR171i UGAUUGAGCCGUGCCAAUAUC 21 47 16 34 5    34 5 8
ptc-miR171j CGAGCCGAAUCAAUAUCACU 20 0 0 0 0    0 0 0
ptc-miR171k GGAUUGAGCCGCGCCAAUAUC 21 0 0 0 0    0 0 0
ptc-miR171l-3p CGAGCCGAAUCAAUAUCACU 20 0 0 0 0    0 0 0
ptc-miR171l-5p UGUGAUAUUGGUCCGGCUCAUC 22 178 59 142 12    12 24 142
ptc-miR171m CGAGCCGAAUCAAUAUCACU 20 0 0 0 0    0 0 0
ptc-miR172a AGAAUCUUGAUGAUGCUGCAU 21 8,607 2,869 5,301 1,647    5,301 1,647 1,659
ptc-miR172b-3p AGAAUCUUGAUGAUGCUGCAU 21 8,607 2,869 5,301 1,647    5,301 1,647 1,659
ptc-miR172b-5p GGAGCAUCAUCAAGAUUCACA 21 14 5 9 1    1 4 9
ptc-miR172c AGAAUCUUGAUGAUGCUGCAU 21 8,607 2,869 5,301 1,647    5,301 1,647 1,659
ptc-miR172d GGAAUCUUGAUGAUGCUGCAU 21 51 17 26 2    2 23 26
ptc-miR172e GGAAUCUUGAUGAUGCUGCAU 21 51 17 26 2    2 23 26
ptc-miR172f AGAAUCUUGAUGAUGCUGCAU 21 8,607 2,869 5,301 1,647    5,301 1,647 1,659
ptc-miR172g-3p GGAAUCUUGAUGAUGCUGCAG 21 38 13 20 1    1 17 20
ptc-miR172g-5p GGAGCAUCAUCAAGAUUCACA 21 14 5 9 1    1 4 9
ptc-miR172h-3p GGAAUCUUGAUGAUGCUGCAG 21 38 13 20 1    1 17 20
ptc-miR172h-5p GGAGCACCAUCAAGAUUCACA 21 1 0 1 1    0 0 1
ptc-miR172i AGAAUCCUGAUGAUGCUGCAA 21 0 0 0 0    0 0 0
ptc-miR2111a UAAUCUGCAUCCUGAGGUUUG 21 17 6 8 1    1 8 8
ptc-miR2111b UAAUCUGCAUCCUGAGGUUUG 21 17 6 8 1    1 8 8
ptc-miR319a UUGGACUGAAGGGAGCUCCC 20 147 49 88 59    0 88 59
ptc-miR319b UUGGACUGAAGGGAGCUCCC 20 147 49 88 59    0 88 59
ptc-miR319c UUGGACUGAAGGGAGCUCCC 20 147 49 88 59    0 88 59
ptc-miR319d UUGGACUGAAGGGAGCUCCC 20 147 49 88 59    0 88 59
ptc-miR319e UUGGACUGAAGGGAGCUCCU 20 0 0 0 0    0 0 0
ptc-miR319f UUGGACUGAAGGGAGCUCCU 20 0 0 0 0    0 0 0
ptc-miR319g UUGGACUGAAGGGAGCUCCU 20 0 0 0 0    0 0 0
ptc-miR319h UUGGACUGAAGGGAGCUCCU 20 0 0 0 0    0 0 0
ptc-miR319i UUGGGCUGAAGGGAGCUCCC 20 0 0 0 0    0 0 0
ptc-miR3627a UCUGUCGCUGGAAAGAUGGUAC 22 147 49 80 24    24 80 43
ptc-miR3627b UGUCGCAGGAGAGAUGGCGCUA 22 1 0 1 1    0 1 0
ptc-miR390a AAGCUCAGGAGGGAUAGCGCC 21 419 140 344 35    40 35 344
ptc-miR390b AAGCUCAGGAGGGAUAGCGCC 21 419 140 344 35    40 35 344
ptc-miR390c AAGCUCAGGAGGGAUAGCGCC 21 419 140 344 35    40 35 344
ptc-miR390d-3p CGCUAUCCAUCCUGAGUUUUA 21 0 0 0 0    0 0 0
ptc-miR390d-5p AAGCUCAGGAGGGAUAGCGCC 21 419 140 344 35    40 35 344
ptc-miR393a-3p AUCAUGCUAUCCCUUUGGAUU 21 74 25 53 4    4 17 53
ptc-miR393a-5p UCCAAAGGGAUCGCAUUGAUC 21 49 16 27 1    1 21 27
ptc-miR393b-3p AUCAUGCUAUCCCUUUGGAUU 21 74 25 53 4    4 17 53
ptc-miR393b-5p UCCAAAGGGAUCGCAUUGAUC 21 49 16 27 1    1 21 27
ptc-miR393c UCCAAAGGGAUCGCAUUGAUC 21 49 16 27 1    1 21 27
ptc-miR394a-3p CUGUUGGUCUCUCUUUGUAA 20 0 0 0 0    0 0 0
ptc-miR394a-5p UUGGCAUUCUGUCCACCUCC 20 2,063 688 837 593    633 837 593
ptc-miR394b-3p CUGUUGGUCUCUCUUUGUAA 20 0 0 0 0    0 0 0
ptc-miR394b-5p UUGGCAUUCUGUCCACCUCC 20 2,063 688 837 593    633 837 593
ptc-miR395a CUGAAGGGUUUGGAGGAACUC 21 2 1 1 1    1 1 0
ptc-miR395b CUGAAGUGUUUGGGGGAACUC 21 64 21 46 4    46 4 14
ptc-miR395c CUGAAGUGUUUGGGGGAACUC 21 64 21 46 4    46 4 14
ptc-miR395d CUGAAGUGUUUGGGGGAACUC 21 64 21 46 4    46 4 14
ptc-miR395e CUGAAGUGUUUGGGGGAACUC 21 64 21 46 4    46 4 14
ptc-miR395f CUGAAGUGUUUGGGGGAACUC 21 64 21 46 4    46 4 14
ptc-miR395g CUGAAGUGUUUGGGGGAACUC 21 64 21 46 4    46 4 14
ptc-miR395h CUGAAGUGUUUGGGGGAACUC 21 64 21 46 4    46 4 14
ptc-miR395i CUGAAGUGUUUGGGGGAACUC 21 64 21 46 4    46 4 14
ptc-miR395j CUGAAGUGUUUGGGGGAACUC 21 64 21 46 4    46 4 14
ptc-miR395k CUGAAGUGUUUGGGGGAACUC 21 64 21 46 4    46 4 14
ptc-miR396a UUCCACAGCUUUCUUGAACUG 21 12,231 4,077 5,858 560    560 5,858 5,813
ptc-miR396b UUCCACAGCUUUCUUGAACUG 21 12,231 4,077 5,858 560    560 5,858 5,813
ptc-miR396c UUCCACAGCUUUCUUGAACUU 21 1,996 665 1,056 341    1,056 599 341
ptc-miR396d UUCCACAGCUUUCUUGAACUU 21 1,996 665 1,056 341    1,056 599 341
ptc-miR396e-3p CUCAAGAAAGCUGUGGGAGA 20 8,639 2,880 5,863 1,235    5,863 1,541 1,235
ptc-miR396e-5p UUCCACAGCUUUCUUGAACUU 21 1,996 665 1,056 341    1,056 599 341
ptc-miR396f UUCCACGGCUUUCUUGAACUG 21 9 3 6 1    2 1 6
ptc-miR396g-3p CUCAAGAAAGCCGUGGGAAAA 21 52 17 42 3    42 7 3
ptc-miR396g-5p UUCCACGGCUUUCUUGAACUU 21 630 210 319 75    319 236 75
ptc-miR397a UCAUUGAGUGCAGCGUUGAUG 21 930 310 588 156    156 588 186
ptc-miR397b CCAUUGAGUGCAGCGUUGAUG 21 0 0 0 0    0 0 0
ptc-miR397c UCAAUGAGUGGAGCUUUGAUG 21 0 0 0 0    0 0 0
ptc-miR398a UGUGUUCUCAGGUCACCCCUU 21 1 0 1 1    0 0 1
ptc-miR398b UGUGUUCUCAGGUCGCCCCUG 21 47 16 35 1    35 11 1
ptc-miR398c-3p UGUGUUCUCAGGUCGCCCCUG 21 47 16 35 1    35 11 1
ptc-miR398c-5p GGAGCGACCUGAAAUCACAUG 21 22 7 17 1    17 4 1
ptc-miR399a UGCCAAAGGAGAUUUGCCCCG 21 0 0 0 0    0 0 0
ptc-miR399b UGCCAAAGGAGAUUUGCCCGG 21 1 0 1 1    1 0 0
ptc-miR399c UGCCAAAGGAGAUUUGCUCAC 21 0 0 0 0    0 0 0
ptc-miR399d UGCCAAAGAAGAUUUGCCCCG 21 0 0 0 0    0 0 0
ptc-miR399e CGCCAAAGGAGAGUUGCCCUC 21 1 0 1 1    0 1 0
ptc-miR399f UGCCAAAGGAGAAUUGCCCUG 21 11 4 11 11    11 0 0
ptc-miR399g UGCCAAAGGAGAAUUGCCCUG 21 11 4 11 11    11 0 0
ptc-miR399h UGCCAAAGGAGAGUUUCCCUG 21 0 0 0 0    0 0 0
ptc-miR399i UGCCAAAGGAGAGUUGCCCUA 21 0 0 0 0    0 0 0
ptc-miR399j UGCCAAAGGAGAUUUGUCCGG 21 0 0 0 0    0 0 0
ptc-miR403a UUAGAUUCACGCACAAACUCG 21 231 77 91 53    87 53 91
ptc-miR403b UUAGAUUCACGCACAAACUCG 21 231 77 91 53    87 53 91
ptc-miR403c-3p UUAGAUUCACGCACAAACUCG 21 231 77 91 53    87 53 91
ptc-miR403c-5p UUUGUGCGUGGAUCUGAGGCC 21 845 282 358 235    358 252 235
ptc-miR403d UUAGAUUCACGCACAAACUCG 21 231 77 91 53    87 53 91
ptc-miR408-3p AUGCACUGCCUCUUCCCUGGC 21 845 282 436 99    436 310 99
ptc-miR408-5p CGGGGAACAGGCAGAGCAUGG 21 3,327 1,109 2,514 41    2,514 772 41
ptc-miR472a UUUUCCCUACUCCACCCAUCCC 22 119 40 80 12    80 27 12
ptc-miR472b UUUUCCCAACUCCACCCAUCCC 22 104 35 73 11    73 20 11
ptc-miR474a CAAAAGUUGCUGGGUUUGGCUGGG 24 0 0 0 0    0 0 0
ptc-miR474b CAAAAGUUGUUGGGUUUGGCUGGG 24 0 0 0 0    0 0 0
ptc-miR474c CAAAAGCUGUUGGGUUUGGCUGGG 24 0 0 0 0    0 0 0
ptc-miR475a-3p UUACAGUGCCCAUUGAUUAAG 21 229 76 88 53    88 88 53
ptc-miR475a-5p AAUGGCCAUUGUAAGAGUAGA 21 54 18 21 14    14 19 21
ptc-miR475b-3p UUACAGUGCCCAUUGAUUAAG 21 229 76 88 53    88 88 53
ptc-miR475b-5p AAUGGCCAUUGUAAGAGUAGA 21 54 18 21 14    14 19 21
ptc-miR475c UUACAAUGUCCAUUGAUUAAG 21 2 1 1 1    0 1 1
ptc-miR475d-3p UUACAGAGUCCAUUGAUUAAG 21 12 4 6 3    3 3 6
ptc-miR475d-5p AAUGGCCAUUGUAAGAGUAGA 21 54 18 21 14    14 19 21
ptc-miR476a UAGUAAUCCUUCUUUGCAAAG 21 48 16 22 13    22 13 13
ptc-miR476b UAGUAAUUCUUCUUUGCAAAA 21 3 1 1 1    1 1 1
ptc-miR477a-3p GGAUGCCUUUGGGGGAGAUUG 21 17 6 11 1    1 5 11
ptc-miR477a-5p AUCUCCCUCAGAGGCUUCCAA 21 96 32 66 8    8 22 66
ptc-miR477b AUCUCCCUCAGAGGCUUCCAA 21 96 32 66 8    8 22 66
ptc-miR477c GGAAACCUUUUGUGGGGGUUUG 22 147 49 100 5    5 42 100
ptc-miR477d-3p UGGACUCCUUUGGGGAGAUGG 21 158 53 130 3    3 25 130
ptc-miR477d-5p AUCUCCCUCAAAGGCUUCCUCU 22 0 0 0 0    0 0 0
ptc-miR477e-3p UGAGGCCUUUGGGGGAGAGUGG 22 2,027 676 994 439    439 994 594
ptc-miR477e-5p ACUCUCCCUCAAGGCUUCCA 20 29 10 12 7    7 12 10
ptc-miR477f GCUCUCCCUCAGGGCUUCCA 20 0 0 0 0    0 0 0
ptc-miR478a UGACGUGUCUUCUAUUUUUAGGGA 24 0 0 0 0    0 0 0
ptc-miR478b UGACGUGUCUUCUAUUUUUAGGGA 24 0 0 0 0    0 0 0
ptc-miR478c UGACGUGUCUUCUAUUUUUAGGGA 24 0 0 0 0    0 0 0
ptc-miR478d UGACAUGUCUUCUAUUUUUAGUAA 24 0 0 0 0    0 0 0
ptc-miR478e UGACGAGUCUUCUAUUUUUAGGGA 24 0 0 0 0    0 0 0
ptc-miR478f UGACAUGUCUUCUAUUUUUAGGGA 24 0 0 0 0    0 0 0
ptc-miR478h UAACGUGUCUCCUAUUUUUAGGGA 24 1 0 1 1    0 1 0
ptc-miR478i UAACGUGUCUCCUAUUUUUAGGGA 24 1 0 1 1    0 1 0
ptc-miR478j UAACGUGUCUCCUAUUUUUAGGGA 24 1 0 1 1    0 1 0
ptc-miR478k UAACGUGUCUCCUAUUUUUAGGGA 24 1 0 1 1    0 1 0
ptc-miR478l UAACGUGUCUCCUAUUUUUAGGGA 24 1 0 1 1    0 1 0
ptc-miR478m UAACGUGUCUCCUAUUUUUAGGGA 24 1 0 1 1    0 1 0
ptc-miR478n UAACGUGUCUCCUAUUUUUAGGGA 24 1 0 1 1    0 1 0
ptc-miR478o UAACGUGUCUCCUAUUUUUAGGGA 24 1 0 1 1    0 1 0
ptc-miR478p UAACGUGUCUUCUAUUUUUAGGGA 24 0 0 0 0    0 0 0
ptc-miR478q UAACGUGUCUCCUAUUUUUAGGGA 24 1 0 1 1    0 1 0
ptc-miR478r UAACGUGUCUCCUAUUUUUAGGGA 24 1 0 1 1    0 1 0
ptc-miR478s UAACGUGUCUCCUAUUUUUAGGGA 24 1 0 1 1    0 1 0
ptc-miR480 ACUACUACAUCAUUGACGUUGAAC 24 0 0 0 0    0 0 0
ptc-miR481a AGGACCUCACUUAACAGCUUAAGC 24 1 0 1 1    0 1 0
ptc-miR481b AGGACCUCACUUAACAGCUUAAGC 24 1 0 1 1    0 1 0
ptc-miR481c AGGACCUCACUUAACAGCUUAAGC 24 1 0 1 1    0 1 0
ptc-miR481d AGGACCUCACCUAACAGCUUAAGC 24 1 0 1 1    1 0 0
ptc-miR482a.1 CCUACUCCUCCCAUUCC 17 0 0 0 0    0 0 0
ptc-miR482a.2 UCUUGCCUACUCCUCCCAUU 20 1 0 1 1    1 0 0
ptc-miR482b-3p UUACCAAUACCUCUCAUGCCAA 22 43 14 26 7    26 10 7
ptc-miR482b-5p GGCAUGAGGUGUUUGGCAAGA 21 2 1 1 1    1 0 1
ptc-miR482c-3p UCUUUCCGAGUCCUCCCAUACC 22 8 3 7 1    7 1 0
ptc-miR482c-5p UAUGGGAGAGGCGGGAAUGACU 22 12 4 10 2    10 2 0
ptc-miR482d-3p UUGCCGACCCCACCCAUGCCAA 22 15 5 15 15    15 0 0
ptc-miR482d-5p GGACAUGGGUUGGUUUGCAAGA 22 3 1 3 3    3 0 0
ptc-miR530a UGCAUUUGCACCUGCACCUU 20 0 0 0 0    0 0 0
ptc-miR530b UGCAUUUGCACCUGCAUCUU 20 0 0 0 0    0 0 0
ptc-miR536 CGCUCGCCAGCGUUGCACCACC 22 1 0 1 1    1 0 0
ptc-miR6421-3p UAGAGCAGAUUGUAAGGGAAG 21 29,558 9,853 23,806 2,250    23,806 3,502 2,250
ptc-miR6421-5p UCCCUUACAAUCUACUCUUUC 21 3 1 2 1    2 1 0
ptc-miR6422 UGUGAUAAUGAAGGCUAUGGU 21 19 6 10 3    10 3 6
ptc-miR6423 CCGCUGUCGCCACUAUCUUCCU 22 0 0 0 0    0 0 0
ptc-miR6425a-3p UCCAUGGAAGAUAAUGACUCG 21 79 26 37 14    14 37 28
ptc-miR6425a-5p UUGUCUUCCAUGGAAUAGGCAG 22 52 17 33 8    11 33 8
ptc-miR6425b-3p UCCAUGGAAGAUAAUGACUCG 21 79 26 37 14    14 37 28
ptc-miR6425b-5p UUGUCUUCCAUGGAAUAGGCAG 22 52 17 33 8    11 33 8
ptc-miR6425c-3p UCCAUGGAAGAUAAUGACUCG 21 79 26 37 14    14 37 28
ptc-miR6425c-5p UUGUCUUCCAUGGAAUAGGCAG 22 52 17 33 8    11 33 8
ptc-miR6425d-3p UCCAUGGAAGAUAAUGACUCG 21 79 26 37 14    14 37 28
ptc-miR6425d-5p UUGUCUUCCAUGGAAUAGGCAG 22 52 17 33 8    11 33 8
ptc-miR6425e UUGUCUUCCAUGGAAUAGGCAG 22 52 17 33 8    11 33 8
ptc-miR6426a GUGGAGACAUGGAAGUGAAGA 21 19 6 8 5    5 6 8
ptc-miR6426b GUGGAGACAUGGAAGUGAAGA 21 19 6 8 5    5 6 8
ptc-miR6427-3p GUGGGAAUGAACAUUAUGAGA 21 44 15 27 5    12 5 27
ptc-miR6427-5p UCGUAAUGCUUCAUUCUCACAA 22 74 25 37 15    37 22 15
ptc-miR6428 UCUGGCAACUCAUUAGACUCAU 22 5 2 4 1    1 4 0
ptc-miR6429 UAGUAGAAAUGCAUUGACUAG 21 4 1 3 1    3 0 1
ptc-miR6430 UGAUGAUUAAUUGACUGCAAA 21 11 4 7 1    7 1 3
ptc-miR6431 UUAUGUGGCAUAAAAGAAUCAA 22 8 3 4 1    3 4 1
ptc-miR6432 CGGCUCUAGAGAAAAAGAUGG 21 6 2 3 1    3 2 1
ptc-miR6434 CUAUGUAUGCUUGACCAAUCA 21 7 2 3 2    3 2 2
ptc-miR6435 UGAAUAAUGGAGACACUCUAG 21 6 2 4 2    2 4 0
ptc-miR6436 CCAGACUCAAUAGCAGGACCCA 22 4 1 3 1    0 3 1
ptc-miR6437a UCACGGACGGCGGCUCCAAGCA 22 12 4 5 3    5 4 3
ptc-miR6437b UCACGGACGGCGGCUCCAAGCA 22 12 4 5 3    5 4 3
ptc-miR6438a UUGUACACAGAAUAGGUGAAAU 22 374 125 159 72    159 143 72
ptc-miR6438b UUGUACACAGAAUAGGUGAAAU 22 374 125 159 72    159 143 72
ptc-miR6439a CCAAAUGAAGAAGCAGAAGCC 21 3 1 1 1    1 1 1
ptc-miR6439b AGCAGAAGCCAUCACUAGCGC 21 0 0 0 0    0 0 0
ptc-miR6440a GAGUUUGAUCGAUUUCGAGUU 21 0 0 0 0    0 0 0
ptc-miR6440b GAGUUUGAUCGAUUUCGAGUU 21 0 0 0 0    0 0 0
ptc-miR6440c GAGUUUGAUCGAUUUCGAGUU 21 0 0 0 0    0 0 0
ptc-miR6440d GAGUUUGAUCGAUUUCGAGUU 21 0 0 0 0    0 0 0
ptc-miR6441 AAGUUGACGGAAGGACUACAU 21 201 67 79 57    65 57 79
ptc-miR6442 CUGAACGGCUUGAAGGGCACG 21 16 5 7 2    7 2 7
ptc-miR6443 GUAUGAUCAUAGAUGAUGGAG 21 8 3 4 2    2 4 2
ptc-miR6444 UAGGAAAAUUAGAGAUUAUGU 21 14 5 7 2    7 5 2
ptc-miR6445a UUCAUUCCUCUUCCUAAAAUGG 22 236 79 109 59    109 68 59
ptc-miR6445b UUCAUUCCUCUUCCUAAAAUGG 22 236 79 109 59    109 68 59
ptc-miR6446 UUGCUGGGUCCUGAUGAUGGA 21 52 17 32 6    6 14 32
ptc-miR6447 UUGACGAAAUGUGACGACUAC 21 4 1 3 1    3 1 0
ptc-miR6448 UAGGCACAGAAUUAACAAGGC 21 207 69 92 37    92 78 37
ptc-miR6449 CAUGAUUCUGAAUAACGGUUU 21 9 3 4 2    4 2 3
ptc-miR6450a CUUUGUCAGGACUCAAGGCUA 21 5 2 4 1    0 4 1
ptc-miR6450b CGAACACAGGACUCAAGGCUA 21 6 2 4 1    1 4 1
ptc-miR6451 AUGUCAGAUCAUGUUAGGUAU 21 5 2 5 5    0 5 0
ptc-miR6452 UGCAAAGGUAACUGAGACAAU 21 8 3 4 2    2 2 4
ptc-miR6454 CUUGUAACCUGAGUAGAGGCA 21 16 5 8 2    2 8 6
ptc-miR6455 UCAAAUAGCAUCCUCAACAUU 21 1 0 1 1    1 0 0
ptc-miR6456 UUGAGUCCUUCCAUUAGAUCC 21 0 0 0 0    0 0 0
ptc-miR6457a UAAUCUCUCUGCAGAAUGCUG 21 5 2 4 1    4 1 0
ptc-miR6457b UUAGUUUGGCAGCCUCUUCUC 21 35 12 34 1    34 1 0
ptc-miR6458 ACGCUCAAAUAUAUAAGGUGUU 22 0 0 0 0    0 0 0
ptc-miR6459a-3p UCGAAUUUGGGCUUGAGAUUG 21 1,527 509 555 419    553 555 419
ptc-miR6459a-5p AGCUCAAGCACAAAUUCGAUC 21 39 13 24 5    10 5 24
ptc-miR6459b UCUCAAGCCCAAAUUCGAUC 20 0 0 0 0    0 0 0
ptc-miR6460 UGAUAUGUGGCAUUCAAUCGA 21 98 33 54 22    54 22 22
ptc-miR6461 UAGCUAGCAAGUUCAUGGAUC 21 9 3 6 3    0 6 3
ptc-miR6462a UCUCUUAUGCAUUUUUGUCCC 21 0 0 0 0    0 0 0
ptc-miR6462b UCUCUUAUGCAUUUUUGUCCC 21 0 0 0 0    0 0 0
ptc-miR6462c-3p UCUCUUAUGCAUUUUUGUCCC 21 0 0 0 0    0 0 0
ptc-miR6462c-5p AAGGGACAAAAAUGGCAUAAGA 22 5 2 5 5    5 0 0
ptc-miR6462d UCUCUUAUGCAUUUUUGUCCC 21 0 0 0 0    0 0 0
ptc-miR6462e UCUUAUGCGUUUUUGUCUCU 20 1 0 1 1    0 0 1
ptc-miR6462f UCUUAUGCGUUUUUGUCUCU 20 1 0 1 1    0 0 1
ptc-miR6463 UGGAUGAUCAUGUUGGCAACC 21 25 8 13 4    13 4 8
ptc-miR6464 UGAUUGCUUGUUGGAUAUUAU 21 4 1 4 4    4 0 0
ptc-miR6465 UUAAAGCAGGGGGUCUAGUAGU 22 11 4 5 2    5 4 2
ptc-miR6466-3p UAUCAAUCAUCAAAUGUUCGU 21 1 0 1 1    0 0 1
ptc-miR6466-5p UCUGGUAUGAGCAUUUGAUGA 21 231 77 101 53    77 53 101
ptc-miR6467 AUAAGCUGUCGAGCGUUUUGU 21 16 5 8 2    8 6 2
ptc-miR6468-3p GGAGUGAUUCAGGGAACCCAU 21 0 0 0 0    0 0 0
ptc-miR6468-5p GUUUUCCCUGAAUCACUCCCA 21 0 0 0 0    0 0 0
ptc-miR6469 UGGCAGAAAAGGAUUCGUUUA 21 19 6 16 3    16 3 0
ptc-miR6470 CUCUGAUAUCAUAUUAAAAAA 21 4 1 3 1    3 1 0
ptc-miR6471 UUUGGGAUCAUCAGGACAGCC 21 47 16 20 10    17 10 20
ptc-miR6472 UAGUGAAUUCUAGGUCUCAAUC 22 9 3 6 1    6 2 1
ptc-miR6473 UCCACAAUCCCAUCAAGACUU 21 0 0 0 0    0 0 0
ptc-miR6474 UGUUCAGAUCAGUAGAUAGCA 21 275 92 188 22    188 22 65
ptc-miR6475 UCUUGAGAAGUAAAGAACGAC 21 7 2 7 7    7 0 0
ptc-miR6476a UCAGUGGAGAUGAAACAUGA 20 7 2 5 2    0 2 5
ptc-miR6476b UCAGUGGAGAUGAAACAUGA 20 7 2 5 2    0 2 5
ptc-miR6476c UCAGUGGAGAUGAAACAUGA 20 7 2 5 2    0 2 5
ptc-miR6477 UGAACAGUAGACGUGAAUUAU 21 41 14 26 7    26 8 7
ptc-miR6478 CCGACCUUAGCUCAGUUGGUG 21 0 0 0 0    0 0 0
ptc-miR6479 AUCAAUGAGAAUACUACUGCA 21 16 5 11 5    0 11 5
ptc-miR6480 UUGCUGAAACGAUUGAACUAU 21 141 47 136 2    136 2 3
ptc-miR7812 CUGUUAUGAAUUGAUGGAGUG 21 1 0 1 1    0 1 0
ptc-miR7813 UGGUAAUGCAAGUGUUGCUAA 21 0 0 0 0    0 0 0
ptc-miR7814 UAGAUUGUUUUUAUGCUUUGA 21 2 1 2 2    2 0 0
ptc-miR7815 CUCUUCAAAUAAAUCGUGGGA 21 9 3 5 1    5 1 3
ptc-miR7816 AAUGUUGUUAUUAACACUGUA 21 1 0 1 1    1 0 0
ptc-miR7817a UUUGGUUAUUGUCUCGAGACA 21 51 17 27 9    15 9 27
ptc-miR7817b UCUCUUCUGUUCCUGAACGGU 21 0 0 0 0    0 0 0
ptc-miR7818 UUUCUUAUCGAUCACUAGACG 21 4 1 3 1    3 0 1
ptc-miR7819 UCUUGAGAACAUGAUGAAUCG 21 1 0 1 1    1 0 0
ptc-miR7820 AUCAUAUAGGUUGAUCCUCGU 21 0 0 0 0    0 0 0
ptc-miR7821 AGAUGGGCAUCGGCAUUGUGA 21 2 1 1 1    1 0 1
ptc-miR7822 UUUGAAAUUGAACAAAUGGUA 21 2 1 1 1    1 0 1
ptc-miR7823 UUGCAUGCAUGAACUUGAAAU 21 26 9 14 5    7 5 14
ptc-miR7824 UUGAGAAAAGUCAAUCGGACC 21 0 0 0 0    0 0 0
ptc-miR7825 UUGAAGAAAGGUAGACAGAUAG 22 1 0 1 1    0 1 0
ptc-miR7826 UUACCAAGUUUCAAAUUCUCA 21 1 0 1 1    1 0 0
ptc-miR7827 GCUAGGACCAAGUUUUUUGGA 21 0 0 0 0    0 0 0
ptc-miR7828 GAUGACAUGGACACCAAAAUC 21 0 0 0 0    0 0 0
ptc-miR7829 ACACAGAAACUCCAAGCCCAC 21 1 0 1 1    1 0 0
ptc-miR7830 UGAUCUAGAGAACCGUUGCU 20 4 1 2 1    1 2 1
ptc-miR7831 UACAUGUAGAGACCACCAAAC 21 3 1 2 1    2 0 1
ptc-miR7832 UAGUUCCCAACCUACACCACA 21 0 0 0 0    0 0 0
ptc-miR7833 UAAUUAGAACUCAUACUAGAC 21 2 1 1 1    0 1 1
ptc-miR7834 UAAUAAAAUCUCGACUAUUAU 21 2 1 2 2    2 0 0
ptc-miR7835 GAUGGGAUUUUUCGGGAAGUG 21 0 0 0 0    0 0 0
ptc-miR7836 UGGGUGGGAGGUGUGGUAGCU 21 0 0 0 0    0 0 0
ptc-miR7837 UGGGUGGGAGGUGUGGUAGCU 21 0 0 0 0    0 0 0
ptc-miR7838 ACAUGUGCUGGGUAGGAGGAA 21 0 0 0 0    0 0 0
ptc-miR7839 AGUGGCAUUGGAGGUAUCCC 20 3 1 2 1    2 0 1
ptc-miR7840 CAAGGAGUAAUUAGUGACAUC 21 40 13 15 12    13 15 12
ptc-miR7841 GGGGGUUGCUGUCAAGCAUAA 21 1 0 1 1    0 0 1
ptc-miR7842 UAAAUCAAGCCCGGUACUUUU 21 0 0 0 0    0 0 0
ptc-miR827 UUAGAUGACCAUCAACGAAAA 21 71 24 70 1    70 1 0
ptc-miR828a UCUUGCUCAAAUGAGUAUUCCA 22 2 1 1 1    1 1 0
ptc-miR828b-3p UCAUUCGAGCAAGAAAUAUUA 21 6 2 6 6    6 0 0
ptc-miR828b-5p UCUUGCUCAAAUGAGUAUUCCA 22 2 1 1 1    1 1 0