Peach miRNA Abundances

The data below are based on the microRNAs listed in the Sanger registry. Adjust libraries/reads to display on the control panel.

        

        miRNA         miRNA sequence Len Sum (norm) Average Max Min (>0)  PCH_FrtPCH_LfPCH_Rt
ppe-miR1511-3p ACCUGGCUCUGAUACCAUAAC 21 139,774 46,591 107,294 11,914    107,294 11,914 20,566
ppe-miR1511-5p CGUGGUAUCAGAGUCAUGUUA 21 910 303 834 16    834 16 60
ppe-miR156a UGACAGAAGAAAGAGAGCAC 20 269 90 158 12    158 99 12
ppe-miR156b UGACAGAAGAAAGAGAGCAC 20 269 90 158 12    158 99 12
ppe-miR156c UGACAGAAGAGAGUGAGCAC 20 282,696 94,232 279,654 1,146    1,146 1,896 279,654
ppe-miR156d UGACAGAAGAGAGUGAGCAC 20 282,696 94,232 279,654 1,146    1,146 1,896 279,654
ppe-miR156e UGACAGAAGAGAGUGAGCAC 20 282,696 94,232 279,654 1,146    1,146 1,896 279,654
ppe-miR156f UGACAGAAGAUAGAGAGCAC 20 54,577 18,192 53,767 249    249 561 53,767
ppe-miR156g UUGACAGAAGAUAGAGAGCAC 21 596,282 198,761 524,882 1,059    1,059 70,341 524,882
ppe-miR156h UUGACAGAAGAUAGAGAGCAC 21 596,282 198,761 524,882 1,059    1,059 70,341 524,882
ppe-miR156i UUGACAGAAGAUAGAGAGCAC 21 596,282 198,761 524,882 1,059    1,059 70,341 524,882
ppe-miR159 UUUGGAUUGAAGGGAGCUCUA 21 163,683 54,561 136,990 10,904    136,990 10,904 15,789
ppe-miR160a UGCCUGGCUCCCUGUAUGCCA 21 893 298 609 110    609 110 174
ppe-miR160b UGCCUGGCUCCCUGUAUGCCA 21 893 298 609 110    609 110 174
ppe-miR162 UCGAUAAACCUCUGCAUCCAG 21 8,363 2,788 7,311 436    7,311 436 616
ppe-miR164a UGGAGAAGCAGGGCACGUGCA 21 36,099 12,033 25,701 344    10,054 344 25,701
ppe-miR164b UGGAGAAGCAGGGCACGUGCA 21 36,099 12,033 25,701 344    10,054 344 25,701
ppe-miR164c UGGAGAAGCAGGGCACGUGCA 21 36,099 12,033 25,701 344    10,054 344 25,701
ppe-miR164d UGGAGAAGCAGGGCACAUGCU 21 46 23 45 1    0 1 45
ppe-miR166a UCGGACCAGGCUUCAUUCCCC 21 334,306 111,435 217,984 25,842    25,842 90,480 217,984
ppe-miR166b UCGGACCAGGCUUCAUUCCCC 21 334,306 111,435 217,984 25,842    25,842 90,480 217,984
ppe-miR166c UCGGACCAGGCUUCAUUCCCC 21 334,306 111,435 217,984 25,842    25,842 90,480 217,984
ppe-miR166d UCGGACCAGGCUUCAUUCCCC 21 334,306 111,435 217,984 25,842    25,842 90,480 217,984
ppe-miR166e UCGGACCAGGCUUCAUUCCCC 21 334,306 111,435 217,984 25,842    25,842 90,480 217,984
ppe-miR167a UGAAGCUGCCAGCAUGAUCUA 21 6,780 2,260 2,980 1,372    2,980 1,372 2,428
ppe-miR167b UGAAGCUGCCAGCAUGAUCUA 21 6,780 2,260 2,980 1,372    2,980 1,372 2,428
ppe-miR167c UGAAGCUGCCAGCAUGAUCUGA 22 9,317 3,106 8,017 162    1,138 8,017 162
ppe-miR167d UGAAGCUGCCAGCAUGAUCUUA 22 17,678 5,893 9,947 2,346    9,947 5,385 2,346
ppe-miR168 UCGCUUGGUGCAGGUCGGGAA 21 38,868 12,956 20,661 1,597    1,597 16,610 20,661
ppe-miR169a CAGCCAAGGAUGACUUGCCGG 21 1,075 358 1,063 3    1,063 3 9
ppe-miR169b CAGCCAAGGAUGACUUGCCGG 21 1,075 358 1,063 3    1,063 3 9
ppe-miR169c CAGCCAAGGAUGACUUGCCGG 21 1,075 358 1,063 3    1,063 3 9
ppe-miR169d UGAGCCAAGGAUGACUUGCCA 21 255 85 141 35    79 35 141
ppe-miR169e-5p UGAGCCAAGGAUGACUUGCCA 21 255 85 141 35    79 35 141
ppe-miR169f UAGCCAAGGAUGACUUGCCUGC 22 618 309 617 1    617 0 1
ppe-miR169g UAGCCAAGGAUGACUUGCCUGC 22 618 309 617 1    617 0 1
ppe-miR169h UAGCCAAGGAUGACUUGCCUGC 22 618 309 617 1    617 0 1
ppe-miR169i UAGCCAAGGAUGACUUGCCUGC 22 618 309 617 1    617 0 1
ppe-miR169j UAGCCAAGGAUGACUUGCCUGC 22 618 309 617 1    617 0 1
ppe-miR169k GAGCCAAGGAUGAAUUGCCGG 21 506 169 268 1    237 1 268
ppe-miR169l GAGCCAAGGAUGAAUUGCCGG 21 506 169 268 1    237 1 268
ppe-miR171a UGAUUGAGCCGUGCCAAUAUC 21 3,004 1,001 2,782 83    2,782 83 139
ppe-miR171b UUGAGCCGCGCCAAUAUCACU 21 28 14 16 12    16 0 12
ppe-miR171c UGAUUGAGCCGUGCCAAUAUC 21 3,004 1,001 2,782 83    2,782 83 139
ppe-miR171d-3p CGAGCCGAAUCAAUAUCACUC 21 1,094 365 877 41    877 41 176
ppe-miR171d-5p UGUGAUAUUGGUUCGGUUCAUA 22 278 93 271 3    4 3 271
ppe-miR171e UUAUUGAACCGGACCAAUAUC 21 0 0 0 0    0 0 0
ppe-miR171f UGAUUGAGCCGUGCCAAUAUC 21 3,004 1,001 2,782 83    2,782 83 139
ppe-miR171g UGAUUGAGCCGUGCCAAUAUC 21 3,004 1,001 2,782 83    2,782 83 139
ppe-miR171h UUGAGCCGCGUCAAUAUCUCC 21 2,910 970 2,071 313    526 313 2,071
ppe-miR172a-3p AGAAUCUUGAUGAUGCUGCAU 21 6,987 2,329 4,196 526    2,265 4,196 526
ppe-miR172a-5p GUAGCAUCAUCAAGAUUCACG 21 10 3 5 1    4 5 1
ppe-miR172b AGAAUCUUGAUGAUGCUGCAU 21 6,987 2,329 4,196 526    2,265 4,196 526
ppe-miR172c GGAAUCUUGAUGAUGCUGCAU 21 447 149 364 12    364 12 71
ppe-miR172d GGAAUCUUGAUGAUGCUGCAG 21 1,210 403 1,194 2    1,194 2 14
ppe-miR2111a UAAUCUGCAUCCUGAGGUUUA 21 43 22 40 3    0 3 40
ppe-miR2111b UAAUCUGCAUCCUGAGGUUUA 21 43 22 40 3    0 3 40
ppe-miR2111c UAAUCUGCAUCCUGAGGUUUA 21 43 22 40 3    0 3 40
ppe-miR2111d UAAUCUGCAUCCUGAGGUUUA 21 43 22 40 3    0 3 40
ppe-miR319a UUGGACUGAAGGGAGCUCCC 20 176 88 139 37    0 37 139
ppe-miR319b UAGCUGCCGAGUCAUUCAUCCA 22 4 4 4 4    0 0 4
ppe-miR3627-3p UGGUGUCAUCCCUCCUGUGACC 22 7 4 5 2    0 2 5
ppe-miR3627-5p UCGCAGGAGAGAUGGCACUGUC 22 1,642 547 1,429 4    4 209 1,429
ppe-miR390 AAGCUCAGGAGGGAUAGCGCC 21 2,210 737 1,540 243    427 243 1,540
ppe-miR393a CAUCCAAAGGGAUCGCAUUGA 21 301 151 300 1    300 1 0
ppe-miR393b UCCAAAGGGAUCGCAUUGAUC 21 80 40 58 22    0 58 22
ppe-miR394a UUGGCAUUCUGUCCACCUCC 20 1,069 356 644 8    644 417 8
ppe-miR394b UUGGCAUUCUGUCCACCUCC 20 1,069 356 644 8    644 417 8
ppe-miR395a-3p CUGAAGUGUUUGGGGGGACCC 21 919 460 559 360    360 559 0
ppe-miR395a-5p GUUCCCUCAAACACUUCAUU 20 320 160 316 4    316 4 0
ppe-miR395b-3p CUGAAGUGUUUGGGGGGACCC 21 919 460 559 360    360 559 0
ppe-miR395b-5p GUUCCCUCAAACACUUCAUU 20 320 160 316 4    316 4 0
ppe-miR395c CUGAAGUGUUUGGGGGAACUC 21 6,437 2,146 5,237 30    1,170 5,237 30
ppe-miR395d CUGAAGUGUUUGGGGGAACUC 21 6,437 2,146 5,237 30    1,170 5,237 30
ppe-miR395e CUGAAGUGUUUGGGGGAACUC 21 6,437 2,146 5,237 30    1,170 5,237 30
ppe-miR395f CUGAAGUGUUUGGGGGAACUC 21 6,437 2,146 5,237 30    1,170 5,237 30
ppe-miR395g CUGAAGUGUUUGGGGGAACUC 21 6,437 2,146 5,237 30    1,170 5,237 30
ppe-miR395h CUGAAGUGUUUGGGGGAACUC 21 6,437 2,146 5,237 30    1,170 5,237 30
ppe-miR395i CUGAAGUGUUUGGGGGAACUC 21 6,437 2,146 5,237 30    1,170 5,237 30
ppe-miR395j CUGAAGUGUUUGGGGGAACUC 21 6,437 2,146 5,237 30    1,170 5,237 30
ppe-miR395k CUGAAGUGUUUGGGGGAACUC 21 6,437 2,146 5,237 30    1,170 5,237 30
ppe-miR395l CUGAAGUGUUUGGGGGAACUC 21 6,437 2,146 5,237 30    1,170 5,237 30
ppe-miR395m CUGAAGUGUUUGGGGGAACUC 21 6,437 2,146 5,237 30    1,170 5,237 30
ppe-miR395n CUGAAGUGUUUGGGGGAACUC 21 6,437 2,146 5,237 30    1,170 5,237 30
ppe-miR395o GUUCCCUCAAACACUUCAUU 20 320 160 316 4    316 4 0
ppe-miR396a UUCCACAGCUUUCUUGAACGU 21 1,442 481 1,261 82    1,261 99 82
ppe-miR396b UUCCACAGCUUUCUUGAACUU 21 23,874 7,958 22,938 407    22,938 407 529
ppe-miR397 UCAUUGAGUGCAGCGUUGAUG 21 8,054 2,685 7,364 332    332 358 7,364
ppe-miR398a-3p UGUGUUCUCAGGUCGCCCCUG 21 367 122 322 16    16 29 322
ppe-miR398a-5p GGAGCGACCUGGGAUCACAUG 21 639 213 304 151    304 184 151
ppe-miR398b CGUGUUCUCAGGUCGCCCCUG 21 304 101 239 8    8 57 239
ppe-miR399a CGCCAAAGGAGAGUUGCCCUU 21 130 130 130 130    0 130 0
ppe-miR399b UCUGCCAAAGGAGAAUUGCCC 21 399 399 399 399    0 399 0
ppe-miR399c UGCCAAAGAAGAGUUGCCCUA 21 89 30 59 6    59 24 6
ppe-miR399d UGCCAAAGAAGAGUUGCCCUA 21 89 30 59 6    59 24 6
ppe-miR399e UGCCAAAGAAGAGUUGCCCUA 21 89 30 59 6    59 24 6
ppe-miR399f UGCCAAAGAAGAGUUGCCCUA 21 89 30 59 6    59 24 6
ppe-miR399g UGCCAAAGAAGAGUUGCCCUA 21 89 30 59 6    59 24 6
ppe-miR399h UGCCAAAGAAGAGUUGCCCUA 21 89 30 59 6    59 24 6
ppe-miR399i UGCCAAAGAAGAGUUGCCCUA 21 89 30 59 6    59 24 6
ppe-miR399j UGCCAAAGAAGAGUUGCCCUA 21 89 30 59 6    59 24 6
ppe-miR399k UGCCAAAGAAGAGUUGCCCUA 21 89 30 59 6    59 24 6
ppe-miR399l UGCCAAAGAAGAGUUGCCCUA 21 89 30 59 6    59 24 6
ppe-miR399m UGCCAAAGGAGAUUUGCUCGG 21 180 90 177 3    0 177 3
ppe-miR399n UGCCAAAGGAGAUUUGCUCGG 21 180 90 177 3    0 177 3
ppe-miR403 UUAGAUUCACGCACAAACUCG 21 788 263 443 161    443 161 184
ppe-miR477-3p CGAAGCCUUUGGGGAGAGUAA 21 208 69 158 14    158 36 14
ppe-miR477-5p ACUCUCCCUCAAAGGCUUCUAG 22 429 143 180 87    162 180 87
ppe-miR477a-3p GUUGGGGGCUCUUUUGGGACG 21 359 180 350 9    0 9 350
ppe-miR477a-5p UCCCUCAAGGGCUCCCAAUAUU 22 144 48 115 1    115 1 28
ppe-miR477b-3p GUUGGGGGCUCUUUUGGGACG 21 359 180 350 9    0 9 350
ppe-miR477b-5p UCCCUCAAGGGCUCCCAAUAUU 22 144 48 115 1    115 1 28
ppe-miR482a-3p UUUCCGAAACCUCCCAUUCCAA 22 29,383 9,794 28,554 44    28,554 44 785
ppe-miR482a-5p GGGUGAGAGGUUGCCGGAAAGA 22 631 316 597 34    0 34 597
ppe-miR482b-3p CUUCCCAAACCUCCCAUUCCUA 22 39,443 13,148 38,489 430    38,489 430 524
ppe-miR482b-5p GGAAUGGGAGGAUUGGGAAAA 21 250 83 233 4    4 233 13
ppe-miR482c-3p UUCCCAAGCCCGCCCAUUCCAA 22 10,275 3,425 5,572 1,912    5,572 1,912 2,791
ppe-miR482c-5p GGAAUGGGCUGUUUGGGAUG 20 11,012 3,671 7,731 12    12 3,269 7,731
ppe-miR482d-3p CCUCCCAUGCCACGCAUUUCUA 22 85 28 83 1    83 1 1
ppe-miR482d-5p GAGAUGGGUGGCUGGGAAGGA 21 0 0 0 0    0 0 0
ppe-miR482e UUGCCUAUUCCUCCCAUGCCAA 22 2,361 787 1,794 98    1,794 98 469
ppe-miR482f UCUUUCCUACUCCACCCAUUCC 22 15,527 5,176 14,077 673    14,077 777 673
ppe-miR5225-3p UCAUCUCUCCUCGACUGAA 19 4 4 4 4    4 0 0
ppe-miR5225-5p UCUGUCGUAGGAGAGAUGGCGC 22 280 140 162 118    162 0 118
ppe-miR530 UCUGCAUUUGCACCUGCACCU 21 51 51 51 51    51 0 0
ppe-miR535a UGACAACGAGAGAGAGCACGC 21 19,937 6,646 18,042 603    1,292 603 18,042
ppe-miR535b UGACGACGAGAGAGAGCACGC 21 187,456 62,485 180,253 802    802 6,401 180,253
ppe-miR6257 UCUUAACUGUUGGAUUAGGCU 21 13 13 13 13    0 0 13
ppe-miR6258 UUCCAGCUGUAAAGAUCAAGA 21 5 3 4 1    0 4 1
ppe-miR6259 UAGAAAAAUACGGGCGAUAAA 21 0 0 0 0    0 0 0
ppe-miR6260 UGGAGUGAGAGAAUGGGAGGU 21 3 3 3 3    0 3 0
ppe-miR6261 AAGUGAUUAUAUGGAGAAGCAC 22 0 0 0 0    0 0 0
ppe-miR6262 UCUUUAGAAAGUUAGAAUUGU 21 1 1 1 1    0 1 0
ppe-miR6263 AAGUGGACAAAAGGGGAGUGG 21 1 1 1 1    0 0 1
ppe-miR6264 AUGCCUAUGGACACGUGUCAA 21 3 2 2 1    0 1 2
ppe-miR6265 UUGAACUUUGACCCGAUUCGCAU 23 2 1 1 1    0 1 1
ppe-miR6266a UAAAUGCAGGGGCAAAAUGAU 21 0 0 0 0    0 0 0
ppe-miR6266b UAAAUGCAGGGGCAAAAUGAU 21 0 0 0 0    0 0 0
ppe-miR6266c UAAAUGCAGGGGCAAAAUGAU 21 0 0 0 0    0 0 0
ppe-miR6267a UAGAGAGGUGGUACAAUUGUG 21 0 0 0 0    0 0 0
ppe-miR6267b AUUAGAGAGGCGGUAAACAAU 21 0 0 0 0    0 0 0
ppe-miR6267c-3p UAGAGAGAUGGUCAGCAAUGU 21 434 145 360 33    360 33 41
ppe-miR6267c-5p AUUGCUGAUCACCUCUCUAAU 21 29 15 28 1    28 0 1
ppe-miR6269 UGUGAAUAGUGAUUGCCAUGG 21 0 0 0 0    0 0 0
ppe-miR6270 UUCUGGUAUUGGAAUUUCAUU 21 33 11 26 3    4 3 26
ppe-miR6271 UCAAGAUUGAGAGAUAUAAUG 21 0 0 0 0    0 0 0
ppe-miR6272 UAGCUGUAAAUGAGUGUUUUU 21 0 0 0 0    0 0 0
ppe-miR6273 AAUGCAGCAUGAUUUUUUUUU 21 0 0 0 0    0 0 0
ppe-miR6274a UAUUUUGCUAUCUUCGGGCAAUA 23 1 1 1 1    0 0 1
ppe-miR6274b-3p UUGUGUUAUUGGCCGAAAAUAG 22 1 1 1 1    0 0 1
ppe-miR6274b-5p AUUUCGACUAAUAACACAAUG 21 191 64 146 4    146 4 41
ppe-miR6275 AGUGGAAGUAGCAAGGGGAAGC 22 1 1 1 1    0 0 1
ppe-miR6276 AAAGGCUCAUACAAAUAUUCC 21 0 0 0 0    0 0 0
ppe-miR6277 UGUGUGUGGAAAGAGCGAGAC 21 10 5 7 3    0 7 3
ppe-miR6278 UGAACCUUGUGUACAAAUUGGC 22 0 0 0 0    0 0 0
ppe-miR6279 UAGACAAGAAUUCCAGAGACC 21 0 0 0 0    0 0 0
ppe-miR6280 UUGGCAGUAAGAUUUUUGGUG 21 3 2 2 1    0 2 1
ppe-miR6281 GUUAGAGAUAGAGAGAGUGAG 21 83 28 59 10    59 10 14
ppe-miR6282 GUUGAUCGAUGUGGGAUGUUACA 23 7 4 5 2    0 5 2
ppe-miR6283 CAAAAGGGGAGUGGGAAAAUC 21 2 1 1 1    0 1 1
ppe-miR6284 UUUGGACCAUGGAUGAAGAUU 21 122 61 62 60    0 60 62
ppe-miR6285 UAGUGAAGUUUGAAUUAGGGCU 22 109 36 79 15    79 15 15
ppe-miR6286 UUUGAACCAUUGGAUCGUAGUUA 23 3 2 2 1    0 2 1
ppe-miR6287 CAAGAAGUGGAAGUUUUGGGC 21 4 2 3 1    0 3 1
ppe-miR6288a GAAAAUGACAAGUGGCUAGUU 21 0 0 0 0    0 0 0
ppe-miR6288b-3p UCAAUUAGAAAAUGAUAAGUG 21 25 13 24 1    24 1 0
ppe-miR6288b-5p CUUGUUAUUUUUUAAUUGAUU 21 8 8 8 8    8 0 0
ppe-miR6288c-3p AACCAAUUAGAAAAUAACAAGUGG 24 0 0 0 0    0 0 0
ppe-miR6288c-5p CUUGUUAUUUUUUAAUUGAUU 21 8 8 8 8    8 0 0
ppe-miR6289 UCCUUUGAAUGGUUAGGCUCA 21 1 1 1 1    0 0 1
ppe-miR6290 UGAAUGAGUUCAGAGAUCGUGUA 23 1 1 1 1    0 1 0
ppe-miR6291a CUUACCACAUUUUUAUACCAU 21 0 0 0 0    0 0 0
ppe-miR6291b CUUACCACAUUUUUAUACCAU 21 0 0 0 0    0 0 0
ppe-miR6291c-3p CAAGGUAGUUUAUAAAUGUGG 21 0 0 0 0    0 0 0
ppe-miR6291c-5p CCACAUUUAUAGAUUACCUUG 21 278 139 277 1    277 0 1
ppe-miR6292 UAUCUUUUAAUCGUUAGAUCA 21 1 1 1 1    0 0 1
ppe-miR6293 UAAGAGGCUGAUGACUAAAAC 21 56 28 39 17    0 39 17
ppe-miR6294 UGGUGUAGGCUAAUCACAAUC 21 6 3 3 3    0 3 3
ppe-miR6295 GAGGACAGAAGAUGAUUCAGC 21 67 34 53 14    0 14 53
ppe-miR6296 UAAGGCCCUUAGAUGAGACCC 21 0 0 0 0    0 0 0
ppe-miR6297a AAUAAUUUUUCGUCGCGCAAAAU 23 3 2 2 1    0 2 1
ppe-miR6297b GAUGUAUUGUCGUCGCGCAAAGU 23 7 7 7 7    0 7 0
ppe-miR7122a-3p GCCGUGUUUCUUUGUAUAAAG 21 6 3 4 2    4 0 2
ppe-miR7122a-5p UUAUACAAUGAAAUCACGGCCG 22 25,390 8,463 16,834 4,055    4,501 4,055 16,834
ppe-miR7122b-3p CCGUGUUUCCUUGUAUAAAG 20 0 0 0 0    0 0 0
ppe-miR7122b-5p UUAUACAAUGAAAUCACGGUCG 22 1,612 537 1,269 142    142 201 1,269
ppe-miR7125-3p CGAACUUAUUGCAACUAGCUU 21 1,058 353 763 41    763 254 41
ppe-miR7125-5p GCUAGGUGCAACAAGUUCAAU 21 55 28 31 24    0 31 24
ppe-miR8122-3p UGAAGGAAGAUUUGUGGAAAG 21 73,348 24,449 52,014 731    731 52,014 20,603
ppe-miR8122-5p UUCCACAGAUCUUUCCUCAUU 21 2,371 790 1,727 301    1,727 301 343
ppe-miR8123-3p UUGUGCCAUUGCUCAAGC 18 8 8 8 8    8 0 0
ppe-miR8123-5p UGAGCAAUGGCACACAGCCCU 21 25,218 25,218 25,218 25,218    25,218 0 0
ppe-miR8124-3p UGGCACCAAUGAUACCAAGUUU 22 5,541 5,541 5,541 5,541    5,541 0 0
ppe-miR8124-5p ACUUGGUAUCUUGGUGCCGGU 21 0 0 0 0    0 0 0
ppe-miR8125 CAGGAAAGAAUGUGAUGAGUA 21 6,471 2,157 6,157 4    4 6,157 310
ppe-miR8126-3p UUCAGUAUUUUGACUCAGAA 20 1 1 1 1    0 1 0
ppe-miR8126-5p UCUGAGUCAGAUUACUGAAUA 21 547 274 419 128    0 419 128
ppe-miR8127-3p UUCAAAGGGUACAUCCACAGU 21 193 97 126 67    126 67 0
ppe-miR8127-5p CAACUGUGGACAUACCCUUUG 21 193 193 193 193    0 193 0
ppe-miR8128-3p UCGUGGGGAGAGAUCUAAUCG 21 162 162 162 162    162 0 0
ppe-miR8128-5p AUUAGACCUCUCCCGACGAAA 21 0 0 0 0    0 0 0
ppe-miR8129-3p AUAAUAAUGUCCGGAUGUCAA 21 145 73 141 4    0 141 4
ppe-miR8129-5p GAUAUCCGCACAUUAUUAUUG 21 2 2 2 2    0 2 0
ppe-miR8130-3p CCCUUCCAGUAAGGCACCCCC 21 142 142 142 142    142 0 0
ppe-miR8130-5p GGGUUCCUUGUUGGAAGGACU 21 71 71 71 71    71 0 0
ppe-miR8131-3p AAUCAACUCAGCUUAGCUGAACUG 24 0 0 0 0    0 0 0
ppe-miR8131-5p AUUUCAGCUAAGUUGAGUUGU 21 22 11 12 10    12 10 0
ppe-miR8132 UCCAACGAUGGGUGACCACAA 21 63 63 63 63    63 0 0
ppe-miR8133-3p UAACUUCCGAACGUCCGCAUA 21 3 3 3 3    0 0 3
ppe-miR8133-5p UCCUGUGCGAACGUCCAGAAG 21 89 45 54 35    0 54 35
ppe-miR827 UUAGAUGACCAUCAACAAACA 21 5,370 1,790 3,436 77    1,857 3,436 77
ppe-miR828-3p UCAUUUCAGCAAGCAGCGUUA 21 40 13 27 5    8 5 27
ppe-miR828-5p UCUUGCUCAAAUGAGUAUUCCA 22 31 16 28 3    28 0 3
ppe-miR858 CUCGUUGUCUGUUCGACCUUG 21 2,786 929 2,426 4    356 4 2,426