Papaya miRNA Abundances

The data below are based on the microRNAs listed in the Sanger registry. Adjust libraries/reads to display on the control panel.

        

        miRNA         miRNA sequence Len Sum (norm) Average Max Min (>0)  CPA1CPA2CPA3
cpa-miR156a UGACAGAAGAGAGUGAGCAC 20 17,089 5,696 10,874 636    10,874 636 5,579
cpa-miR156b UGACAGAAGAGAGUGAGCAC 20 17,089 5,696 10,874 636    10,874 636 5,579
cpa-miR156c UGACAGAAGAGAGUGAGCAC 20 17,089 5,696 10,874 636    10,874 636 5,579
cpa-miR156d UGACAGAAGAGAGUGAGCAC 20 17,089 5,696 10,874 636    10,874 636 5,579
cpa-miR156e UUGACAGAAGAUAGAGAGCAC 21 7,045 2,348 3,653 635    3,653 635 2,757
cpa-miR156f UUGACAGAAGAUAGAGAGCAC 21 7,045 2,348 3,653 635    3,653 635 2,757
cpa-miR159a UUUGGAUUGAAGGGAGCUCUA 21 6,611 2,204 3,610 883    3,610 2,118 883
cpa-miR159b CUUGGAUUGAAGGGAGCUCC 20 8 3 4 1    4 1 3
cpa-miR160a UGCCUGGCUCCCUGUAUGCCA 21 223 74 93 58    72 93 58
cpa-miR160b UGCCUGGCUCCCUGUAUGCCA 21 223 74 93 58    72 93 58
cpa-miR160c-3p GCGUAUGAGGAGCCAUGCAUA 21 1,108 369 975 60    60 73 975
cpa-miR160c-5p UGCCUGGCUCCCUGUAUGCCA 21 223 74 93 58    72 93 58
cpa-miR160d UGCCUGGCUCCCUGAAUGCCA 21 243 81 110 64    110 64 69
cpa-miR160e UGCCUGGCUCCCUGUAUGCCA 21 223 74 93 58    72 93 58
cpa-miR160f-3p GCGUAUGAGGAGCCAUGCAUA 21 1,108 369 975 60    60 73 975
cpa-miR160f-5p UGCCUGGCUCCCUGUAUGCCA 21 223 74 93 58    72 93 58
cpa-miR162a UCGAUAAACCUCUGCAUCCAG 21 2,150 717 843 583    724 843 583
cpa-miR164a UGGAGAAGCAGGGCACGUGCA 21 2,009 670 1,102 396    511 1,102 396
cpa-miR164b UGGAGAAGCAGGGCACGUGCA 21 2,009 670 1,102 396    511 1,102 396
cpa-miR164c UGGAGAAGCAGGGCACGUGCA 21 2,009 670 1,102 396    511 1,102 396
cpa-miR164d UGGAGAAGGGGAGCACGUGCA 21 61 20 49 1    11 49 1
cpa-miR164e UGGAGAAGGGGAGCACGUGCA 21 61 20 49 1    11 49 1
cpa-miR166a UCGGACCAGGCUUCAUUCCCC 21 321,925 107,308 133,504 80,520    133,504 80,520 107,901
cpa-miR166b UCGGACCAGGCUUCAUUCCCC 21 321,925 107,308 133,504 80,520    133,504 80,520 107,901
cpa-miR166c UCGGACCAGGCUUCAUUCCCC 21 321,925 107,308 133,504 80,520    133,504 80,520 107,901
cpa-miR166d UCGGACCAGGCUUCAUUCCCG 21 91,694 30,565 37,859 19,634    37,859 19,634 34,201
cpa-miR166e GGACCAGGCUUCAUUCCCC 19 1,770 590 725 435    725 435 610
cpa-miR167a UGAAGCUGCCAGCAUGAUCUA 21 1,701 567 822 182    697 822 182
cpa-miR167b UGAAGCUGCCAGCAUGAUCUA 21 1,701 567 822 182    697 822 182
cpa-miR167c UGAAGCUGCCAGCAUGAUCUU 21 4,106 1,369 2,917 288    2,917 288 901
cpa-miR167d UGAAGCUGCCAGCAUGAUCUGA 22 29,329 9,776 21,178 84    21,178 84 8,067
cpa-miR169 CAGCCAAGAAUGACUUGCCG 20 9 3 6 1    6 1 2
cpa-miR171a UGAUUGAGCCGUGCCAAUAUC 21 716 239 423 110    423 110 183
cpa-miR171b UGAUUGAGCCGUGCCAAUAUC 21 716 239 423 110    423 110 183
cpa-miR171c UGAUUGAGCCGUGCCAAUAUC 21 716 239 423 110    423 110 183
cpa-miR171d UGAUUGAGCCGUGCCAAUAUC 21 716 239 423 110    423 110 183
cpa-miR172a GGGAAUCUUGAUGAUGCUGCA 21 36 12 27 3    6 27 3
cpa-miR172b GGGAAUCUUGAUGAUGCUGCA 21 36 12 27 3    6 27 3
cpa-miR319 AUUGGACUGAAGGGAGCUCC 20 5 5 5 5    0 5 0
cpa-miR390a AAGCUCAGGAGGGAUAGCGCC 21 8,508 2,836 3,748 2,054    3,748 2,054 2,706
cpa-miR390b AAGCUCAGGAGGGAUAGCGCC 21 8,508 2,836 3,748 2,054    3,748 2,054 2,706
cpa-miR393 UCCAAAGGGAUCGCAUUGAUCC 22 10 5 7 3    3 7 0
cpa-miR394a UUGGCAUUCUGUCCACCUCC 20 2,306 769 909 593    909 804 593
cpa-miR394b UUGGCAUUCUGUCCACCUCC 20 2,306 769 909 593    909 804 593
cpa-miR395a UGAAGUGUUUGGGGGAACUC 20 12 6 7 5    7 0 5
cpa-miR395b UGAAGUGUUUGGGGGAACUC 20 12 6 7 5    7 0 5
cpa-miR395c UGAAGUGUUUGGGGGAACUC 20 12 6 7 5    7 0 5
cpa-miR395d UGAAGUGUUUGGGGGAACUC 20 12 6 7 5    7 0 5
cpa-miR395e UGAAGUGUUUGGGGGAACUC 20 12 6 7 5    7 0 5
cpa-miR396 UUCCACAGCUUUCUUGAACUG 21 744 248 369 125    250 125 369
cpa-miR398 GGGACGACAUGAGAUCACACG 21 19,735 6,578 18,342 311    311 1,082 18,342
cpa-miR408 CUGCACUGCCUCUUCCCUGGC 21 71 24 44 11    16 44 11
cpa-miR477 AUUGGAGGACUUUGGGGGAGC 21 60 20 29 14    29 14 17
cpa-miR5211 GUGCCGUCGCACUGUGACAAG 21 34 34 34 34    0 0 34
cpa-miR535 UGACAACGAGAGAGAGCACGC 21 6,258 2,086 3,078 1,402    3,078 1,402 1,778
cpa-miR8134 UGAGAAUUAUGCGGAGGAUGU 21 248 83 138 46    138 64 46
cpa-miR8135 AGGAUUUUGCAGGGUUGAU 19 176 59 99 37    37 40 99
cpa-miR8136 UAAAGUGGAAUUGGGAUAAUA 21 1,243 414 604 111    604 528 111
cpa-miR8137 UUCGCCAGCCAUUCACAAAAU 21 566 189 259 125    182 259 125
cpa-miR8138 UAAAGAUGGUAACAAAGGAUAA 22 26 9 16 2    2 16 8
cpa-miR8139a UCCUGGCUGAGGACGGGUGUUGAA 24 17 6 8 3    6 3 8
cpa-miR8139b UCCUGGCUGAGGACGGGUGUUGAA 24 17 6 8 3    6 3 8
cpa-miR8139c UCCUGGCUGAGGACGGGUGUUGAA 24 17 6 8 3    6 3 8
cpa-miR8139d UCCUGGCUGAGGACGGGUGUUGAA 24 17 6 8 3    6 3 8
cpa-miR8139e UCCUGGCUGAGGACGGGUGUUGAA 24 17 6 8 3    6 3 8
cpa-miR8140 CUUUUCAAGACUUCAGCUUCA 21 506 169 277 94    135 277 94
cpa-miR8141 UGGAUACUAGUAGGCUGGUU 20 264 88 179 26    59 179 26
cpa-miR8142 UGAGGUAAGUAGACAGUAAAGGUU 24 40 13 31 4    4 31 5
cpa-miR8143 GAGAGAUGGUGGACAGAUCAGGUA 24 52 17 26 9    17 26 9
cpa-miR8144 AACAGUAGAACGAGUUAGAAAGGA 24 26 9 14 2    10 14 2
cpa-miR8145 AUAAACAGAUAGAAUGACAGCCUU 24 24 12 12 12    12 12 0
cpa-miR8146 AGGAAGACGGUGAGUAGAAGCCAA 24 17 6 12 1    4 12 1
cpa-miR8147 ACUGAUACUUGAUGAAUUUGCAUG 24 16 5 12 1    3 12 1
cpa-miR8148 UGACUGGGUCUGCUGACGUGGCAU 24 19 6 10 3    6 10 3
cpa-miR8149 AGCGAAGGGGACGCCUGAAGACUC 24 17 6 10 2    5 10 2
cpa-miR8150 AAAACCUGAGUCAGAUGAUGAGCG 24 55 18 25 8    25 22 8
cpa-miR8151 UGGAUACCAGUAGACAGAUA 20 28 9 18 1    18 9 1
cpa-miR8152 UUGGACUGCUAGGUGGCCCAU 21 24 8 14 5    14 5 5
cpa-miR8153 UGCACUGUAGAGCCGUAUUCGGAC 24 31 10 15 6    10 15 6
cpa-miR8154 CAGAGGAGGAGAUGAAGAGGGA 22 50 17 34 6    6 10 34
cpa-miR8155 UAACCUGGCUCUGAUACCA 19 40 13 19 4    17 4 19