Orange miRNA Abundances

The data below are based on the microRNAs listed in the Sanger registry. Adjust libraries/reads to display on the control panel.

        

        miRNA         miRNA sequence Len Sum (norm) Average Max Min (>0)  CSI1CSI2CSI3
csi-miR1515 UCAUUUUUGCGUGCAAUGAUCC 22 440 147 179 125    179 125 136
csi-miR156 UGACAGAAGAGAGUGAGCAC 20 9,504 3,168 3,714 2,735    2,735 3,714 3,055
csi-miR159 UUUGGAUUGAAGGGAGCUCUA 21 2,132 711 992 310    992 830 310
csi-miR160 GCCUGGCUCCCUGUAUGCCAU 21 3 2 2 1    2 1 0
csi-miR162-3p UCGAUAAACCUCUGCAUCCAG 21 965 322 446 233    446 286 233
csi-miR162-5p UGGAGGCAGCGGUUCAUCGAUC 22 10 5 7 3    3 7 0
csi-miR164 UGGAGAAGCAGGGCACGUGCA 21 12,694 4,231 9,477 1,225    1,225 1,992 9,477
csi-miR166a UCGGACCAGGCUUCAUUCCCCC 22 25 13 18 7    18 7 0
csi-miR166b UCGGACCAGGCUUCAUUCCCGU 22 19 6 9 2    9 8 2
csi-miR166c UCGGACCAGGCUUCAUUCCC 20 1,894 631 978 74    978 842 74
csi-miR166d UCGGACCAGGCUUCAUUCCCU 21 69,957 23,319 39,494 2,593    39,494 27,870 2,593
csi-miR166e-3p UCGGACCAGGCUUCAUUCCCC 21 90,129 30,043 61,070 2,516    61,070 26,543 2,516
csi-miR166e-5p GGAAUGUUGUCUGGCUCGAGG 21 1,010 337 610 74    610 326 74
csi-miR167a UGAAGCUGCCAGCAUGAUCUG 21 355 118 251 48    251 56 48
csi-miR167b UGAAGCUGCCAGCAUGAUCUU 21 319 106 235 40    40 235 44
csi-miR167c UGAAGCUGCCAGCAUGAUCUG 21 355 118 251 48    251 56 48
csi-miR169 GAGCCAAGAAUGACUUGCCGA 21 0 0 0 0    0 0 0
csi-miR171a UUGAGCCGCGCCAAUAUCAC 20 12 12 12 12    0 12 0
csi-miR171b CGAGCCGAAUCAAUAUCACUC 21 26 9 20 1    5 1 20
csi-miR172a-3p AGAAUCUUGAUGAUGCUGCA 20 311 104 220 40    220 40 51
csi-miR172a-5p GCAGCGUCCUCAAGAUUCACA 21 1,376 688 762 614    762 614 0
csi-miR172b AGAAUCUUGAUGAUGCGGCAA 21 6 3 3 3    3 3 0
csi-miR172c UGGAAUCUUGAUGAUGCUGCAG 22 87 29 78 3    6 78 3
csi-miR319 UUUGGACUGAAGGGAGCUCCU 21 23 12 12 11    0 12 11
csi-miR390 AAGCUCAGGAGGGAUAGCGCC 21 2,690 897 1,958 99    633 1,958 99
csi-miR393 AUCCAAAGGGAUCGCAUUGAUC 22 0 0 0 0    0 0 0
csi-miR394 UUGGCAUUCUGUCCACCUCC 20 599 200 328 27    244 328 27
csi-miR3946 UUGUAGAGAAAGAGAAGAGAGCAC 24 0 0 0 0    0 0 0
csi-miR3947-5p UUAUUUCAGUAGACGACGUCACA 23 10 3 5 2    5 3 2
csi-miR3948 UGGAGUGGGAGUGGGAGUAGGGUG 24 0 0 0 0    0 0 0
csi-miR3949 UGAUGUUGAGGCAAAAAUGUAG 22 0 0 0 0    0 0 0
csi-miR395 CUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0
csi-miR3950 UUUUUCGGCAACAUGAUUUCU 21 5 5 5 5    0 0 5
csi-miR3951 UAGAUAAAGAUGAGAGAAAAA 21 15,130 5,043 11,866 1,237    1,237 2,027 11,866
csi-miR3952 UGAAGGGCCUUUCUAGAGCAC 21 1,262 421 632 306    324 306 632
csi-miR3953 UUGAGUUCUGCAAGCCGUCGA 21 71 36 39 32    0 32 39
csi-miR3954 UGGACAGAGAAAUCACGGUCA 21 3,005 1,002 1,595 486    486 924 1,595
csi-miR396a UUCCACAGCUUUCUUGAACUG 21 2,860 953 1,942 301    301 1,942 617
csi-miR396b UUCCACAGCUUUCUUGAACUG 21 2,860 953 1,942 301    301 1,942 617
csi-miR396c UUCAAGAAAUCUGUGGGAAG 20 1,485 495 1,011 164    1,011 310 164
csi-miR397 UCAUUGAGUGCAGCGUUGAUG 21 548 183 474 35    39 474 35
csi-miR398 UGUGUUCUCAGGUCACCCCUU 21 5 5 5 5    0 5 0
csi-miR399a UGCCAAAGGAGAUUUGCCCGG 21 1 1 1 1    1 0 0
csi-miR399b UGCCAAAGGAGAGUUGCCCUA 21 12 6 11 1    0 1 11
csi-miR399c UGCCAAAGGAGAAUUGCCCUG 21 0 0 0 0    0 0 0
csi-miR399d UGCCAAAGGAGAGUUGCCCUG 21 3 2 2 1    1 0 2
csi-miR399e UGCCAAAGGAGAAUUGCCCUG 21 0 0 0 0    0 0 0
csi-miR403 UUAGAUUCACGCACAAACUCG 21 2,006 669 1,154 265    1,154 587 265
csi-miR408 AUGCACUGCCUCUUCCCUGGC 21 263 88 196 16    16 196 51
csi-miR472 UUUUCCCACACCUCCCAUCCC 21 37 12 26 3    8 26 3
csi-miR473 ACUCUCCCUCAAGGGCUUCGC 21 18 6 12 3    3 3 12
csi-miR477a ACCUCCCUCGAAGGCUUCCAA 21 432 144 373 29    30 373 29
csi-miR477b CUCUCCCUCAAGGGCUUCUCU 21 0 0 0 0    0 0 0
csi-miR477c UCCCUCGAAGGCUUCCAAUAUA 22 21 11 20 1    1 20 0
csi-miR479 UGUGAUAUUGGUUCGGCUCAUC 22 476 159 197 95    95 197 184
csi-miR482a-3p UCUUCCCUAUGCCUCCCAUUCC 22 321 107 140 78    103 78 140
csi-miR482a-5p AGUGGGAGCGUGGGGUAAGAAG 22 540 180 428 31    81 31 428
csi-miR482b UCUUGCCCACCCCUCCCAUUCC 22 44 15 23 8    23 13 8
csi-miR482c UUCCCUAGUCCCCCUAUUCCUA 22 798 266 430 169    199 430 169
csi-miR530a UGCAUUUGCACCUGCACCUUG 21 51 17 26 2    23 26 2
csi-miR530b UGCAUUUGCACCUGCAUCUUG 21 11 4 5 3    3 5 3
csi-miR535 UGACAAUGAGAGAGAGCACAC 21 4,824 1,608 2,855 548    1,421 2,855 548
csi-miR827 UUAGAUGACCAUCAACAAACA 21 528 176 486 3    3 39 486
csi-miR857 UUUUGAAUGUUGAAUGGUGGCUAU 24 0 0 0 0    0 0 0