Orange Small RNA miRNA Abundances

The data below are based on the microRNAs listed in the miRBase registry. Adjust libraries/reads to display on the control panel.


        miRNA         miRNA sequence Len Sum (norm) Average Max Min (>0)  CSI1CSI2CSI3
csi-miR12105-3p UUGUUUUGGGUGAAACGGGUGU 22 28 9 12 4    12 4 12
csi-miR12105-5p UUUCUUGAGACAAAACAUGCAUC 23 1,606 535 1,185 187    1,185 234 187
csi-miR12106-3p UGGGGCAGCUGUCCUAAACGG 21 1 0 1 1    0 1 0
csi-miR12106-5p GUUUAGGACAGCUGCUGCCAAA 22 16 5 9 3    4 3 9
csi-miR12107-3p UCAUUCGCGCUCUCAUCAUUA 21 42 14 40 2    40 0 2
csi-miR12107-5p CUGAUGAGAGAGCGAAUGAUA 21 4,413 1,471 3,410 458    3,410 458 545
csi-miR12108-3p AUUUUAAAACGUGCGGAUGUCUGC 24 83 28 53 9    53 21 9
csi-miR12108-5p AGACGUUCGCACUUUUUAAAAUGC 24 16 5 9 2    5 9 2
csi-miR12109-3p CUGCAGAUUUGUGCAUUAAGCUGC 24 4 1 2 1    1 1 2
csi-miR12109-5p UGCUUGGUGCAUAAAACUACAGAA 24 0 0 0 0    0 0 0
csi-miR12110-3p CCCGAGUCACAGCUCCCUGGAC 22 89 30 89 89    0 89 0
csi-miR12110-5p CUGGGGAGUUGCACCCGGAGU 21 8 3 8 8    0 8 0
csi-miR12111-3p GACUGUCCCAUCUAAGUUUUUCUC 24 2 1 2 2    2 0 0
csi-miR12111-5p GAAAAACUUAGGUGGGAUAGUGUG 24 9 3 6 1    6 1 2
csi-miR1515a UCAUUUUUGCGUGCAAUGAUCC 22 440 147 179 125    179 125 136
csi-miR1515b-3p AUCAUUCACGCAAAAAUGAUU 21 2 1 2 2    0 0 2
csi-miR1515b-5p UCAUUUUUGCGUGCAAUGAUCC 22 440 147 179 125    179 125 136
csi-miR156a-3p UGCUCGCUCCUCUUCUGUCAGC 22 2 1 1 1    1 1 0
csi-miR156a-5p UGACAGAAGAGAGUGAGCAC 20 9,504 3,168 3,714 2,735    2,735 3,714 3,055
csi-miR156b-3p GCUCACUGCUCUUUCUGUCAGCU 23 1 0 1 1    0 1 0
csi-miR156b-5p UGACAGAAGAGAGUGAGCAC 20 9,504 3,168 3,714 2,735    2,735 3,714 3,055
csi-miR156c-3p GCUCACUCUCUAUCUGUCACC 21 1 0 1 1    0 1 0
csi-miR156c-5p UGACAGAAGAGAGUGAGCAC 20 9,504 3,168 3,714 2,735    2,735 3,714 3,055
csi-miR156d-5p UGACAGAAGAUAGAGAGCGC 20 235 78 166 6    6 63 166
csi-miR156e-3p GCUCUCUGUGCUUCUGUCAUCA 22 5 2 5 5    0 5 0
csi-miR156e-5p GUGACAGAAGAUAGAGAGCGC 21 7,847 2,616 4,572 176    176 4,572 3,099
csi-miR156f-3p GCUCUCUCUUCUCCUGUCAUUG 22 0 0 0 0    0 0 0
csi-miR156f-5p AUGACAGAAGAGAGAGAGUAC 21 65 22 50 3    3 50 12
csi-miR156g-3p GCUCUCUAUUCUUCUGUCAUC 21 10 3 6 4    6 4 0
csi-miR156g-5p UUGACGGAAGAUAGAGAGCAC 21 165,909 55,303 105,855 7,175    52,879 105,855 7,175
csi-miR156h-5p ACAGAAGAUAGAGAACACAUA 21 0 0 0 0    0 0 0
csi-miR156i-5p UUGACAGAAGAUAGAUAGCAC 21 0 0 0 0    0 0 0
csi-miR156j-3p AUCCAACGAAGCAGGAGCUGC 21 89 30 47 42    47 42 0
csi-miR156j-5p AGCUGCUGACUCGUUGGUUCA 21 1,537 512 922 615    922 615 0
csi-miR159a-3p UUUGGAUUGAAGGGAGCUCUA 21 2,132 711 992 310    992 830 310
csi-miR159a-5p GAGCUCCUUGAAGUCCAAAAG 21 21 7 11 10    10 11 0
csi-miR159b-5p AGCUGCCGACUCAUUCAUUCA 21 88 29 44 2    44 42 2
csi-miR159c-3p CUUGGACUGAAGGGAGCUCCC 21 1 0 1 1    0 1 0
csi-miR159c-5p GAGCUUUCUUCGGUCCACUU 20 56 19 56 56    0 56 0
csi-miR159d UUUGGACUGAAGGGAGCUCCU 21 23 8 12 11    0 12 11
csi-miR160a-3p GCGUAUGAGGAGCCAUGCAUA 21 845 282 573 11    573 261 11
csi-miR160a-5p GCCUGGCUCCCUGUAUGCCAU 21 3 1 2 1    2 1 0
csi-miR160b-3p GCGUACGAGGAGCCAAGCAUA 21 1,744 581 1,453 5    1,453 286 5
csi-miR160b-5p UGCCUGGCUCCCUGUAUGCCG 21 143 48 104 39    104 39 0
csi-miR160c-3p GCGUGCGAGGAGCCAUGCAUG 21 2 1 2 2    2 0 0
csi-miR160c-5p UGCCUGGCUCCCUGUAUGCUU 21 19 6 15 4    15 4 0
csi-miR162-3p UCGAUAAACCUCUGCAUCCAG 21 965 322 446 233    446 286 233
csi-miR162-5p UGGAGGCAGCGGUUCAUCGAUC 22 10 3 7 3    3 7 0
csi-miR164a-3p CAUGUGCCCUUCUUCCCCAUC 21 5 2 4 1    4 1 0
csi-miR164a-5p UGGAGAAGCAGGGCACGUGCA 21 12,694 4,231 9,477 1,225    1,225 1,992 9,477
csi-miR164b-3p CACGCGCUCCCCUUCUCCAAC 21 340 113 313 8    8 19 313
csi-miR164b-5p UGGAGAAGCAGGGCACGUGCA 21 12,694 4,231 9,477 1,225    1,225 1,992 9,477
csi-miR164c-3p CACGCGCUCCCCUUCUCCAAC 21 340 113 313 8    8 19 313
csi-miR164c-5p UGGAGAAGCAGGGCACGUGCA 21 12,694 4,231 9,477 1,225    1,225 1,992 9,477
csi-miR164d-3p CACGCGCUCCCCUUCUCCAAC 21 340 113 313 8    8 19 313
csi-miR164d-5p UGGAGAAGCAGGGCACGUGCA 21 12,694 4,231 9,477 1,225    1,225 1,992 9,477
csi-miR166a-3p UCGGACCAGGCUUCAUUCCCCC 22 25 8 18 7    18 7 0
csi-miR166a-5p GGAAUGUUGUCUGGCUCGAGG 21 1,010 337 610 74    610 326 74
csi-miR166b-3p UCUCGGACCAGGCUUCAUUCC 21 61,771 20,590 30,896 14,843    16,032 30,896 14,843
csi-miR166b-5p GGAAUGUUGUUUGGCUCGAGGG 22 79 26 54 3    22 54 3
csi-miR166c-3p UCGGACCAGGCUUCAUUCCC 20 1,894 631 978 74    978 842 74
csi-miR166c-5p GGGAAUGUUGUCUGGUUCGAG 21 0 0 0 0    0 0 0
csi-miR166d-3p UCUCGGACCAGGCUUCAUUCC 21 61,771 20,590 30,896 14,843    16,032 30,896 14,843
csi-miR166d-5p CUGUUGUCUGGUUCAAGG 18 0 0 0 0    0 0 0
csi-miR166e-3p UCGGACCAGGCUUCAUUCCCC 21 90,129 30,043 61,070 2,516    61,070 26,543 2,516
csi-miR166e-5p GGAAUGUUGUCUGGCUCGAGG 21 1,010 337 610 74    610 326 74
csi-miR166f-3p UCGGACCAGGCUUCAUUCCCU 21 69,957 23,319 39,494 2,593    39,494 27,870 2,593
csi-miR166f-5p GGACUGUUGUCUGGCUCGAUG 21 11 4 6 5    6 5 0
csi-miR166g-3p UCUCGGACCAGGCUUCAUUCC 21 61,771 20,590 30,896 14,843    16,032 30,896 14,843
csi-miR166g-5p GAAUGCUGUCUGGUUCGAGAC 21 5 2 4 1    4 1 0
csi-miR166h-3p UUUGGACCAGGCUUCCUUCCUC 22 9 3 5 4    4 5 0
csi-miR166i-3p UCUUGGACCAGGCUUCAUUCC 21 43 14 34 3    6 34 3
csi-miR166j-3p UUGGACCAGGCUUCAUUCCUC 21 10,704 3,568 8,041 5    8,041 2,658 5
csi-miR166k-3p UCUUGGACCAGGCUUCAUUCC 21 43 14 34 3    6 34 3
csi-miR167a-3p AGAUCAUCUGGCAGUUUCACC 21 111 37 95 7    95 7 9
csi-miR167a-5p UGAAGCUGCCAGCAUGAUCUG 21 355 118 251 48    251 56 48
csi-miR167b-3p AGAUCAUGCGGCAGUUUCACC 21 162 54 83 17    17 62 83
csi-miR167b-5p UGAAGCUGCCAGCAUGAUCUU 21 319 106 235 40    40 235 44
csi-miR167c-3p AGGUCAUCUUGCAGCUUCAAU 21 83 28 53 7    23 7 53
csi-miR167c-5p UGAAGCUGCCAGCAUGAUCUG 21 355 118 251 48    251 56 48
csi-miR167d-3p AUCGGAUCAUGUGGUAGCUUCACC 24 1 0 1 1    1 0 0
csi-miR167d-5p UGAAGCUGCCAGCAUGAUCUA 21 5,290 1,763 2,225 1,170    1,895 2,225 1,170
csi-miR167e-3p GGUCAUGCUCUGACAGCCUCACU 23 1 0 1 1    0 1 0
csi-miR167e-5p UGAAGCUGCCAGCAUGAUCUA 21 5,290 1,763 2,225 1,170    1,895 2,225 1,170
csi-miR168-3p CCCGCCUUGCAUCAACUGAAU 21 305 102 129 56    129 120 56
csi-miR168-5p UCGCUUGGUGCAGGUCGGGAA 21 25,609 8,536 9,244 7,842    8,523 7,842 9,244
csi-miR169a GAGCCAAGAAUGACUUGCCGA 21 0 0 0 0    0 0 0
csi-miR169b-5p UAGCCAAGGAUGACUUGCCU 20 3 1 3 3    0 3 0
csi-miR169c-3p CAGGCAGUCUCCUUGGCUAAG 21 4 1 3 1    1 3 0
csi-miR169c-5p UAGCCAAGGAUGACUUGCCU 20 3 1 3 3    0 3 0
csi-miR169d-3p CAGGCAGUCUCCUUGGCUAAG 21 4 1 3 1    1 3 0
csi-miR169d-5p UAGCCAAGGAUGACUUGCCU 20 3 1 3 3    0 3 0
csi-miR169e-3p CAGGCAGUCUCCUUGGCUAAG 21 4 1 3 1    1 3 0
csi-miR169e-5p UAGCCAAGGAUGACUUGCCU 20 3 1 3 3    0 3 0
csi-miR169f-5p UAGCCAAGGAUGACUUGCCU 20 3 1 3 3    0 3 0
csi-miR169g-5p CAGCCAAGGAUGACUUGCCGG 21 525 175 381 3    141 381 3
csi-miR169h-5p UAGCCAAGGAUGACUUGCCU 20 3 1 3 3    0 3 0
csi-miR169i-5p UAGCCAAGGAUGACUUGCCU 20 3 1 3 3    0 3 0
csi-miR169j-5p UAGCCAAGGAUGACUUGCCU 20 3 1 3 3    0 3 0
csi-miR169k-5p CAGCCAAGGAUGACUUGCCGG 21 525 175 381 3    141 381 3
csi-miR169l-3p AGGCAGUCUCCUUGGCUAAC 20 39 13 23 16    23 16 0
csi-miR169l-5p UAGCCAAGGAUGACUUGCCU 20 3 1 3 3    0 3 0
csi-miR169m-5p CAGCCAAGGAUGACUUGCCGG 21 525 175 381 3    141 381 3
csi-miR169n-3p GGCAAGUUGCCCUUGGCUACA 21 23 8 13 10    10 13 0
csi-miR169n-5p CAGCCAAGGAUGACUUGCCGG 21 525 175 381 3    141 381 3
csi-miR169o-5p CAGCCAAGGAUGACUUGCCGG 21 525 175 381 3    141 381 3
csi-miR169p-5p UAGCCAAGGAUGACUUGCCU 20 3 1 3 3    0 3 0
csi-miR169q-5p UAGCCAAGGAUGACUUGCCU 20 3 1 3 3    0 3 0
csi-miR169r-5p CAGCCAAGGAUGACUUGCCGG 21 525 175 381 3    141 381 3
csi-miR171a UUGAGCCGUGCCAAUAUCAC 20 12 4 8 4    4 8 0
csi-miR171b-3p CGAGCCGAAUCAAUAUCACUC 21 26 9 20 1    5 1 20
csi-miR171b-5p UGUGAUAUUGGUUCGGCUCAUC 22 476 159 197 95    95 197 184
csi-miR171c-3p UGAUUGAGCCGUGCCAAUAUC 21 1,439 480 837 2    837 600 2
csi-miR171c-5p UGUUGGAACGGCUCAAUCAAA 21 125 42 54 26    45 54 26
csi-miR171d-3p UGAUUGAGCCGUGCCAAUAUC 21 1,439 480 837 2    837 600 2
csi-miR171e-3p UUGAGCCGCGUCAAUAUCUCC 21 117 39 60 14    60 43 14
csi-miR171f-3p UGAUUGAGCCGUGCCAAUAUC 21 1,439 480 837 2    837 600 2
csi-miR171f-5p UAUUGGCCUGGUUCACUCAGA 21 29 10 17 12    17 12 0
csi-miR171g-3p UUGAGCCGCGUCAAUAUCUCC 21 117 39 60 14    60 43 14
csi-miR171h-3p UGAUUGAGCCGUGCCAAUAUC 21 1,439 480 837 2    837 600 2
csi-miR171i-3p UGAUUGAGCCGUGCCAAUAUC 21 1,439 480 837 2    837 600 2
csi-miR172a-3p AGAAUCUUGAUGAUGCUGCA 20 311 104 220 40    220 40 51
csi-miR172a-5p GCAGCGUCCUCAAGAUUCACA 21 1,376 459 762 614    762 614 0
csi-miR172b-3p AGAAUCUUGAUGAUGCUGCAU 21 32,478 10,826 23,577 3,050    23,577 3,050 5,851
csi-miR172b-5p GCAGCAUCAUCAAGAUUCACA 21 77 26 35 8    34 35 8
csi-miR172c-3p UGGAAUCUUGAUGAUGCUGCAG 22 87 29 78 3    6 78 3
csi-miR172c-5p GGAGCACCAUCAAGAUUCACA 21 22 7 17 2    3 17 2
csi-miR172d-5p GCGGCAUCAUCAAGAUUCACA 21 14 5 8 2    4 8 2
csi-miR2111-5p UAAUCUGCAUCCUGAGGUUUG 21 5 2 4 1    1 4 0
csi-miR2275a-3p UUUAGUUUCCUCCAAUAUCUUA 22 1 0 1 1    0 1 0
csi-miR2275a-5p AGAAUUGGAUGGAACUAAACA 21 4 1 4 4    4 0 0
csi-miR2275b-3p UUUAGUUUCCUCCAAUAUCUUA 22 1 0 1 1    0 1 0
csi-miR2275b-5p AGAAUUGGAUGGAACUAAACA 21 4 1 4 4    4 0 0
csi-miR3627a-5p UUGUCGCCGGAGAGAUAGCACC 22 6 2 3 3    3 3 0
csi-miR3627b-3p UUGUCGCAGGAGCGUUGGCACC 22 19 6 17 2    2 17 0
csi-miR3627c-5p UCGCAGGGGAGAUGGGACCAAC 22 30 10 18 4    4 8 18
csi-miR390a-3p CGCUAUCCAUCCUGAGUUUCA 21 186 62 161 3    22 161 3
csi-miR390a-5p AAGCUCAGGAGGGAUAGCGCC 21 2,690 897 1,958 99    633 1,958 99
csi-miR390b-5p AGCUCAGGAGGGAUAGCGCC 20 145 48 77 18    18 50 77
csi-miR391-3p CCGGAAUCAUUUCUCCCGCGUG 22 1 0 1 1    0 1 0
csi-miR391-5p UGCAGGUGAGAUGAUACCGUCA 22 96 32 77 19    77 19 0
csi-miR393a AUCCAAAGGGAUCGCAUUGAUC 22 0 0 0 0    0 0 0
csi-miR393b-3p UCAUGCGAUCCCUUCGGAAUU 21 1,236 412 652 52    52 532 652
csi-miR393b-5p UUCCAAAGGGAUCGCAUUGAUC 22 982 327 561 79    79 561 342
csi-miR393c-3p AUCAUGCUAUCCCUUUGGAUU 21 57 19 41 4    4 12 41
csi-miR393c-5p UCCAAAGGGAUCGCAUUGAUC 21 42 14 19 6    6 19 17
csi-miR3946 UUGUAGAGAAAGAGAAGAGAGCAC 24 0 0 0 0    0 0 0
csi-miR3947-5p UUAUUUCAGUAGACGACGUCACA 23 10 3 5 2    5 3 2
csi-miR3948 UGGAGUGGGAGUGGGAGUAGGGUG 24 0 0 0 0    0 0 0
csi-miR3949 UGAUGUUGAGGCAAAAAUGUAG 22 0 0 0 0    0 0 0
csi-miR394a UUGGCAUUCUGUCCACCUCC 20 599 200 328 27    244 328 27
csi-miR394b-5p UUGGCAUUCUGUCCACCUCC 20 599 200 328 27    244 328 27
csi-miR3950 UUUUUCGGCAACAUGAUUUCU 21 5 2 5 5    0 0 5
csi-miR3951a-3p UUUCUCUUAUCGUUAUCUGU 20 10,250 3,417 9,092 481    677 481 9,092
csi-miR3951a-5p UAGAUAAAGAUGAGAGAAAAA 21 15,130 5,043 11,866 1,237    1,237 2,027 11,866
csi-miR3951b-3p UUUCUCUUAUCUUUUAUCUGUG 22 14 5 13 1    13 1 0
csi-miR3951b-5p CAGGUAAAGAUGAGAGAAAAA 21 21 7 15 3    3 3 15
csi-miR3952-3p UGAAGGGCCUUUCUAGAGCAC 21 1,262 421 632 306    324 306 632
csi-miR3952-5p GCUGUAGAUAGGCCCUUCAAC 21 193 64 102 29    102 62 29
csi-miR3952b-3p UGAAGGGCCUUUCUAGAGCAC 21 1,262 421 632 306    324 306 632
csi-miR3952b-5p GCUGUAGAAAGGCCCCUCAAC 21 657 219 251 163    251 243 163
csi-miR3953 UUGAGUUCUGCAAGCCGUCGA 21 71 24 39 32    0 32 39
csi-miR3954 UGGACAGAGAAAUCACGGUCA 21 3,005 1,002 1,595 486    486 924 1,595
csi-miR3954b-3p ACCGUGUUUCUCUGCCCAAUC 21 0 0 0 0    0 0 0
csi-miR3954b-5p UUGGACAGAGAAAUCACGGUCA 22 278,441 92,814 146,064 50,287    50,287 82,090 146,064
csi-miR395a CUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0
csi-miR395b-3p CUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0
csi-miR395b-5p GUUCCCCUGAACACUUCAUUG 21 0 0 0 0    0 0 0
csi-miR395c-3p CUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0
csi-miR396a-3p AUUCAAGAAAGCUGUGGAAAA 21 40 13 27 13    27 13 0
csi-miR396a-5p UUCCACAGCUUUCUUGAACUG 21 2,860 953 1,942 301    301 1,942 617
csi-miR396b-3p GUUCAAUAAAGCUGUGGGAAG 21 397 132 181 93    123 181 93
csi-miR396b-5p UUCCACAGCUUUCUUGAACUG 21 2,860 953 1,942 301    301 1,942 617
csi-miR396c UUCAAGAAAUCUGUGGGAAG 20 1,485 495 1,011 164    1,011 310 164
csi-miR396d-3p UUCAAGAAAUCUGUGGGAAG 20 1,485 495 1,011 164    1,011 310 164
csi-miR396e-3p GCUCAAGAAUGCCGUGGGAAA 21 82 27 68 3    68 11 3
csi-miR396e-5p UUCCACGGCUUUCUUGAACU 20 10 3 10 10    10 0 0
csi-miR396f-3p GCUCAAGAAAGCUGUGGGAGA 21 2,287 762 2,028 24    2,028 235 24
csi-miR396f-5p UUCCACAGCUUUCUUGAACUU 21 709 236 364 2    343 364 2
csi-miR397-3p ACCAGCGCUGCACUCGAUCAU 21 33 11 30 3    3 30 0
csi-miR397-5p UCAUUGAGUGCAGCGUUGAUG 21 548 183 474 35    39 474 35
csi-miR398a-3p UGUGUUCUCAGGUCACCCCUU 21 5 2 5 5    0 5 0
csi-miR398a-5p AGAACAGAGGGUGGCGUUGGCU 22 18 6 11 7    0 7 11
csi-miR398b-3p UGUGUUCUCAGGUCGCCCCUG 21 183 61 131 9    9 43 131
csi-miR399a-3p UGCCAAAGGAGAUUUGCCCGG 21 1 0 1 1    1 0 0
csi-miR399a-5p GGGCAACAUCUCCAUUGGCAGG 22 0 0 0 0    0 0 0
csi-miR399b-3p UGCCAAAGGAGAGUUGCCCUA 21 12 4 11 1    0 1 11
csi-miR399b-5p AGGGCUUCUCUCCUUUGGCAG 21 0 0 0 0    0 0 0
csi-miR399c-3p UGCCAAAGGAGAAUUGCCCUG 21 0 0 0 0    0 0 0
csi-miR399c-5p GUGCAGUCCUCCUUUGGCGUG 21 0 0 0 0    0 0 0
csi-miR399d-3p UGCCAAAGGAGAGUUGCCCUG 21 3 1 2 1    1 0 2
csi-miR399d-5p GGGCACCUCUUACUUGGCAUG 21 0 0 0 0    0 0 0
csi-miR399e-3p UGCCAAAGGAGAUUUGCCCGG 21 1 0 1 1    1 0 0
csi-miR399e-5p GGGCAAUUCUCUAUUGGCAGU 21 0 0 0 0    0 0 0
csi-miR399f-3p CGCCAAAGGAGAAUUGCCCUG 21 3 1 3 3    0 3 0
csi-miR399f-5p GGGCAAUUCUCCUUUGGCAGA 21 0 0 0 0    0 0 0
csi-miR403a-3p UUAGAUUCACGCACAAACUCG 21 2,006 669 1,154 265    1,154 587 265
csi-miR403a-5p CAUGUUUCGGGUUUGUGCGUG 21 412 137 203 75    134 75 203
csi-miR403b-3p UUAGAUUCACGCACAAACUCG 21 2,006 669 1,154 265    1,154 587 265
csi-miR403b-5p AGUUUGUGCGUGAAUCUAACC 21 4 1 2 1    1 1 2
csi-miR408-3p AUGCACUGCCUCUUCCCUGGC 21 263 88 196 16    16 196 51
csi-miR408-5p ACGGGGAACAGGCAGAGCAUG 21 450 150 349 21    21 349 80
csi-miR477a-3p GGAAACCCUAGGGGGAGGUCG 21 96 32 47 10    10 39 47
csi-miR477a-5p ACCUCCCUCGAAGGCUUCCAA 21 432 144 373 29    30 373 29
csi-miR477b-3p UGAAGCCCUUAGGGCAGAGUGA 22 0 0 0 0    0 0 0
csi-miR477b-5p CUCUCCCUCAAGGGCUUCUCU 21 0 0 0 0    0 0 0
csi-miR477c-3p GAAGUCCUUGGGGUUGAGUGA 21 0 0 0 0    0 0 0
csi-miR477c-5p ACUCUCCCUCAAGGGCUUCGC 21 18 6 12 3    3 3 12
csi-miR477d-3p UGAGGCCGUUGGGGAGAGUGG 21 15 5 15 15    0 0 15
csi-miR477d-5p ACUCUCCCUCAAGGGCUUCUGG 22 0 0 0 0    0 0 0
csi-miR477e-3p UGAGGUUCUUGGGGAGAGUAG 21 12 4 12 12    0 0 12
csi-miR477e-5p ACUCUCCCUCAAGGGCUUCUGA 22 6 2 4 2    0 4 2
csi-miR482a-3p UCUUCCCUAUGCCUCCCAUUCC 22 321 107 140 78    103 78 140
csi-miR482a-5p AGUGGGAGCGUGGGGUAAGAAG 22 540 180 428 31    81 31 428
csi-miR482b-3p UCUUGCCCACCCCUCCCAUUCC 22 44 15 23 8    23 13 8
csi-miR482b-5p AAUGGGAGGCUUGGCAAGAAG 21 773 258 405 126    242 126 405
csi-miR482c-3p UUCCCUAGUCCCCCUAUUCCUA 22 798 266 430 169    199 430 169
csi-miR482c-5p GGAAUUGGGUGCUAGGGAAGG 21 21 7 9 4    8 4 9
csi-miR482d-3p UCCCUACUCCACCCAUGCCAUA 22 975 325 453 75    447 453 75
csi-miR482d-5p UGGUAUGGGUGAGUAGGGAAG 21 1,447 482 575 435    437 435 575
csi-miR482e-3p UUGCCAACUCCUCCCAUGCCGA 22 1,688 563 857 208    623 857 208
csi-miR482e-5p GGUCAUGGGAGGAUUGGCGA 20 1,162 387 882 66    214 66 882
csi-miR482f-3p UUUUCCCACACCUCCCAUCCC 21 37 12 26 3    8 26 3
csi-miR482f-5p GAUGGGUGAGUUGGGAAAAUA 21 94 31 65 13    13 16 65
csi-miR482g-3p UCUUCCCUAUGCCUCCCAUUCC 22 321 107 140 78    103 78 140
csi-miR482g-5p AGUGGGAGCGUGGGGUAAGAAG 22 540 180 428 31    81 31 428
csi-miR530a-3p AGGUGCAGCUGUAUAUGCAGG 21 9 3 6 1    6 1 2
csi-miR530a-5p UGCAUUUGCACCUGCACCUUG 21 51 17 26 2    23 26 2
csi-miR530b-3p AGGUGCAGUUGCAAGUGCAGA 21 3 1 3 3    3 0 0
csi-miR530b-5p UGCAUUUGCACCUGCAUCUUG 21 11 4 5 3    3 5 3
csi-miR535a UGACAAUGAGAGAGAGCACAC 21 4,824 1,608 2,855 548    1,421 2,855 548
csi-miR535b-3p GUGCUCUCUACCAUUGUCAUA 21 50 17 27 2    21 27 2
csi-miR535b-5p UGACAAUGAGAGAGAGCACAC 21 4,824 1,608 2,855 548    1,421 2,855 548
csi-miR535c-3p GUGCUCUCUACCAUUGUCAUA 21 50 17 27 2    21 27 2
csi-miR535c-5p UGACAAUGAGAGAGAGCACAC 21 4,824 1,608 2,855 548    1,421 2,855 548
csi-miR535d-3p GUGCUCUCUACCAUUGUCAUA 21 50 17 27 2    21 27 2
csi-miR535d-5p UGACAAUGAGAGAGAGCACAC 21 4,824 1,608 2,855 548    1,421 2,855 548
csi-miR535e-5p UGACAAUGAGAGAGAGCACAC 21 4,824 1,608 2,855 548    1,421 2,855 548
csi-miR535f-5p UGACAAUGAGAGAGAGCACAC 21 4,824 1,608 2,855 548    1,421 2,855 548
csi-miR536-3p UGGUGCCACGCUGUGUGCGUC 21 18 6 15 1    2 1 15
csi-miR536-5p CGCACCCCAGCGUGGAACCAUC 22 3 1 2 1    1 0 2
csi-miR827 UUAGAUGACCAUCAACAAACA 21 528 176 486 3    3 39 486
csi-miR857 UUUUGAAUGUUGAAUGGUGGCUAU 24 0 0 0 0    0 0 0
csi-miR858-3p CUCGUUGUCUGUUCGACCUUG 21 16 5 7 3    6 7 3
csi-miR9560-3p UCAUAUUUGCUCCACCACCUGUGG 24 12 4 9 3    0 9 3
csi-miR9560-5p ACAGGAGGUGGAACAAAUAUGAAA 24 1,425 475 778 18    18 778 629