Grape miRNA Abundances

The data below are based on the microRNAs listed in the Sanger registry. Adjust libraries/reads to display on the control panel.

        

        miRNA         miRNA sequence Len Sum (norm) Average Max Min (>0)  Leaf_Y_1Leaf_Y_2Leaf_M_1Leaf_M_2Leaf_S_1Leaf_S_2Bud_AB_1Bud_AB_2Bud_W_1Bud_W_2Bud_L_1Bud_L_2Bud_B_1Bud_B_2Stem_G_1Stem_G_2Stem_W_1Stem_W_2Tendril_Y_1Tendril_Y_2Tendril_WD_1Tendril_WD_2Inf_Y_1Inf_Y_2Inf_WD_1Inf_WD_2Flower_FB_1Flower_FB_2Flower_F_1Flower_F_2Carpel_1Carpel_2Stamen_1Stamen_2Pollen_1Pollen_2Berry_FS_1Berry_FS_2Berry_PFS_1Berry_PFS_2Berry_PV_1Berry_PV_2Berry_V_1Berry_V_2Berry_MR_1Berry_MR_2Berry_R_1Berry_R_2Berry_PHWI_1Berry_PHWI_2Berry_PHWII_1Berry_PHWII_2Berry_PHWIII_1Berry_PHWIII_2Rachis_FS_1Rachis_FS_2Rachis_PFS_1Rachis_PFS_2Rachis_V_1Rachis_V_2Rachis_MR_1Rachis_MR_2Rachis_R_1Rachis_R_2Root_1Root_2Seed_GSeed_MLeaf_PNRoot_PN
vvi-miR156a UGACAGAAGAGAGGGAGCAC 20 36 9 31 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 31 0
vvi-miR156b UGACAGAAGAGAGUGAGCAC 20 69,726 1,025 20,981 2    0 11 150 88 68 78 195 101 188 228 0 12 11 25 55 55 127 1,241 37 17 262 108 45 149 397 371 252 213 85 66 352 898 1,523 914 202 683 64 55 319 78 2,819 1,228 215 206 112 51 245 270 42 30 30 41 42 2 70 791 219 1,610 451 832 214 202 153 278 10,432 12,084 816 147 20,981 5,390
vvi-miR156c UGACAGAAGAGAGUGAGCAC 20 69,726 1,025 20,981 2    0 11 150 88 68 78 195 101 188 228 0 12 11 25 55 55 127 1,241 37 17 262 108 45 149 397 371 252 213 85 66 352 898 1,523 914 202 683 64 55 319 78 2,819 1,228 215 206 112 51 245 270 42 30 30 41 42 2 70 791 219 1,610 451 832 214 202 153 278 10,432 12,084 816 147 20,981 5,390
vvi-miR156d UGACAGAAGAGAGUGAGCAC 20 69,726 1,025 20,981 2    0 11 150 88 68 78 195 101 188 228 0 12 11 25 55 55 127 1,241 37 17 262 108 45 149 397 371 252 213 85 66 352 898 1,523 914 202 683 64 55 319 78 2,819 1,228 215 206 112 51 245 270 42 30 30 41 42 2 70 791 219 1,610 451 832 214 202 153 278 10,432 12,084 816 147 20,981 5,390
vvi-miR156e UGACAGAGGAGAGUGAGCAC 20 320 9 71 1    0 0 0 0 0 0 0 0 1 5 0 0 0 0 28 9 0 0 4 0 1 0 8 5 2 1 0 1 0 0 0 0 0 0 0 0 0 0 11 3 28 13 6 2 11 0 1 6 1 2 0 1 0 2 6 9 1 10 1 0 0 0 0 0 71 43 9 0 14 4
vvi-miR156f UUGACAGAAGAUAGAGAGCAC 21 846,114 12,263 752,641 14    0 35 294 226 1,835 1,829 533 155 360 268 53 124 43 120 207 96 127 1,325 44 14 331 176 759 1,037 3,222 1,758 305 340 124 77 1,388 3,891 6,673 4,578 59 157 34 41 129 44 1,015 479 359 376 968 183 3,280 1,835 183 470 109 292 166 63 51 897 190 570 1,443 537 468 465 473 228 4,868 10,932 57 20 752,641 29,685
vvi-miR156g UUGACAGAAGAUAGAGAGCAC 21 846,114 12,263 752,641 14    0 35 294 226 1,835 1,829 533 155 360 268 53 124 43 120 207 96 127 1,325 44 14 331 176 759 1,037 3,222 1,758 305 340 124 77 1,388 3,891 6,673 4,578 59 157 34 41 129 44 1,015 479 359 376 968 183 3,280 1,835 183 470 109 292 166 63 51 897 190 570 1,443 537 468 465 473 228 4,868 10,932 57 20 752,641 29,685
vvi-miR156h UGACAGAAGAGAGAGAGCAU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR156i UUGACAGAAGAUAGAGAGCAC 21 846,114 12,263 752,641 14    0 35 294 226 1,835 1,829 533 155 360 268 53 124 43 120 207 96 127 1,325 44 14 331 176 759 1,037 3,222 1,758 305 340 124 77 1,388 3,891 6,673 4,578 59 157 34 41 129 44 1,015 479 359 376 968 183 3,280 1,835 183 470 109 292 166 63 51 897 190 570 1,443 537 468 465 473 228 4,868 10,932 57 20 752,641 29,685
vvi-miR159a CUUGGAGUGAAGGGAGCUCUC 21 962 51 307 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 26 51 58 32 185 307 145 127 0 2 0 0 0 0 0 0 0 0 0 0 1 0 2 0 5 2 1 0 0 0 0 0 2 0 0 0 0 0 0 0 4 9 0 0
vvi-miR159b CUUGGAGUGAAGGGAGCUCUC 21 962 51 307 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 26 51 58 32 185 307 145 127 0 2 0 0 0 0 0 0 0 0 0 0 1 0 2 0 5 2 1 0 0 0 0 0 2 0 0 0 0 0 0 0 4 9 0 0
vvi-miR159c UUUGGAUUGAAGGGAGCUCUA 21 3,389,219 48,417 1,052,770 57    582 10,461 7,243 3,833 281 293 42,179 13,224 93,071 68,771 805 3,048 26,452 11,839 50,419 10,322 11,276 45,091 34,986 13,561 67,920 53,124 32,170 47,839 17,640 16,263 4,483 15,496 9,023 13,177 1,052,770 327,580 371,996 248,445 457 955 11,128 28,022 6,589 2,960 29,660 16,836 6,843 3,388 11,968 507 14,939 12,783 2,752 1,118 937 685 464 57 20,307 164,376 21,598 13,284 52,993 62,261 12,584 8,385 4,986 2,478 1,658 1,174 959 14,790 111,344 17,331
vvi-miR160a UGCCUGGCUCCCUGAAUGCCAUC 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR160b UGCCUGGCUCCCUGAAUGCCAUC 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR160c UGCCUGGCUCCCUGUAUGCCA 21 516 15 145 1    0 0 2 1 0 0 47 19 6 0 0 0 4 0 5 1 10 13 6 0 9 9 8 5 12 22 9 7 5 0 9 0 0 0 0 7 12 3 0 0 0 0 0 0 2 0 2 0 0 0 0 0 0 0 2 7 3 2 1 0 1 0 0 0 0 0 0 0 145 120
vvi-miR160d UGCCUGGCUCCCUGUAUGCCA 21 516 15 145 1    0 0 2 1 0 0 47 19 6 0 0 0 4 0 5 1 10 13 6 0 9 9 8 5 12 22 9 7 5 0 9 0 0 0 0 7 12 3 0 0 0 0 0 0 2 0 2 0 0 0 0 0 0 0 2 7 3 2 1 0 1 0 0 0 0 0 0 0 145 120
vvi-miR160e UGCCUGGCUCCCUGUAUGCCA 21 516 15 145 1    0 0 2 1 0 0 47 19 6 0 0 0 4 0 5 1 10 13 6 0 9 9 8 5 12 22 9 7 5 0 9 0 0 0 0 7 12 3 0 0 0 0 0 0 2 0 2 0 0 0 0 0 0 0 2 7 3 2 1 0 1 0 0 0 0 0 0 0 145 120
vvi-miR162 UCGAUAAACCUCUGCAUCCAG 21 469,826 6,712 61,395 93    127 142 9,035 6,589 322 628 2,976 2,255 23,982 12,494 6,497 4,481 1,787 4,375 4,386 6,006 645 6,784 5,876 20,950 9,373 10,088 1,928 13,233 5,747 10,345 49,602 37,293 61,395 22,701 403 910 435 719 404 682 735 3,203 2,124 535 4,426 4,524 1,879 10,113 1,670 7,547 8,352 10,130 424 448 452 850 614 578 178 1,173 2,390 6,855 2,074 4,664 4,706 6,827 11,597 8,629 3,031 8,802 208 93 1,504 2,896
vvi-miR164a UGGAGAAGCAGGGCACGUGCA 21 4,716 94 1,980 2    3 34 41 6 0 0 13 8 114 115 2 4 23 13 23 9 49 213 28 29 23 15 33 65 71 70 31 63 32 61 131 190 290 127 0 0 76 175 30 6 85 27 0 3 0 0 4 0 0 0 0 0 0 0 0 6 90 80 27 37 17 19 56 0 0 0 0 0 1,980 69
vvi-miR164b UGGAGAAGCAGGGCACAUGCU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR164c UGGAGAAGCAGGGCACGUGCA 21 4,716 94 1,980 2    3 34 41 6 0 0 13 8 114 115 2 4 23 13 23 9 49 213 28 29 23 15 33 65 71 70 31 63 32 61 131 190 290 127 0 0 76 175 30 6 85 27 0 3 0 0 4 0 0 0 0 0 0 0 0 6 90 80 27 37 17 19 56 0 0 0 0 0 1,980 69
vvi-miR164d UGGAGAAGCAGGGCACGUGCA 21 4,716 94 1,980 2    3 34 41 6 0 0 13 8 114 115 2 4 23 13 23 9 49 213 28 29 23 15 33 65 71 70 31 63 32 61 131 190 290 127 0 0 76 175 30 6 85 27 0 3 0 0 4 0 0 0 0 0 0 0 0 6 90 80 27 37 17 19 56 0 0 0 0 0 1,980 69
vvi-miR166a UCGGACCAGGCUUCAUUCC 19 48,779 697 5,890 9    447 88 1,221 2,103 775 855 709 441 266 196 556 507 211 556 222 203 108 207 486 780 160 200 882 651 1,543 4,566 4,756 1,580 2,072 550 34 22 73 9 210 224 504 2,950 391 108 507 214 375 588 70 464 233 178 23 28 37 69 69 70 106 160 60 135 434 1,067 716 760 803 448 2,657 5,890 104 48 30 14
vvi-miR166b UCGGACCAGGCUUCAUUCC 19 48,779 697 5,890 9    447 88 1,221 2,103 775 855 709 441 266 196 556 507 211 556 222 203 108 207 486 780 160 200 882 651 1,543 4,566 4,756 1,580 2,072 550 34 22 73 9 210 224 504 2,950 391 108 507 214 375 588 70 464 233 178 23 28 37 69 69 70 106 160 60 135 434 1,067 716 760 803 448 2,657 5,890 104 48 30 14
vvi-miR166c UCGGACCAGGCUUCAUUCCCC 21 24,315,860 347,369 1,887,582 5,257    30,038 109,011 1,486,439 1,337,252 135,612 93,053 1,887,582 804,475 700,449 411,533 62,880 123,094 80,215 214,758 174,283 134,339 251,822 484,826 108,441 111,604 286,453 183,526 940,023 477,653 1,348,520 1,263,373 511,675 515,245 172,532 71,513 33,962 29,571 27,270 24,113 12,134 57,259 531,694 1,285,719 336,212 359,707 1,179,924 814,822 565,910 860,327 252,493 79,543 636,608 276,985 92,101 97,911 50,755 65,422 46,027 6,566 83,596 322,421 37,709 238,484 186,033 567,387 107,155 45,079 42,231 23,604 117,103 272,801 13,739 6,084 11,923 5,257
vvi-miR166d UCGGACCAGGCUUCAUUCCCC 21 24,315,860 347,369 1,887,582 5,257    30,038 109,011 1,486,439 1,337,252 135,612 93,053 1,887,582 804,475 700,449 411,533 62,880 123,094 80,215 214,758 174,283 134,339 251,822 484,826 108,441 111,604 286,453 183,526 940,023 477,653 1,348,520 1,263,373 511,675 515,245 172,532 71,513 33,962 29,571 27,270 24,113 12,134 57,259 531,694 1,285,719 336,212 359,707 1,179,924 814,822 565,910 860,327 252,493 79,543 636,608 276,985 92,101 97,911 50,755 65,422 46,027 6,566 83,596 322,421 37,709 238,484 186,033 567,387 107,155 45,079 42,231 23,604 117,103 272,801 13,739 6,084 11,923 5,257
vvi-miR166e UCGGACCAGGCUUCAUUCCCC 21 24,315,860 347,369 1,887,582 5,257    30,038 109,011 1,486,439 1,337,252 135,612 93,053 1,887,582 804,475 700,449 411,533 62,880 123,094 80,215 214,758 174,283 134,339 251,822 484,826 108,441 111,604 286,453 183,526 940,023 477,653 1,348,520 1,263,373 511,675 515,245 172,532 71,513 33,962 29,571 27,270 24,113 12,134 57,259 531,694 1,285,719 336,212 359,707 1,179,924 814,822 565,910 860,327 252,493 79,543 636,608 276,985 92,101 97,911 50,755 65,422 46,027 6,566 83,596 322,421 37,709 238,484 186,033 567,387 107,155 45,079 42,231 23,604 117,103 272,801 13,739 6,084 11,923 5,257
vvi-miR166f UCGGACCAGGCUUCAUUCCCC 21 24,315,860 347,369 1,887,582 5,257    30,038 109,011 1,486,439 1,337,252 135,612 93,053 1,887,582 804,475 700,449 411,533 62,880 123,094 80,215 214,758 174,283 134,339 251,822 484,826 108,441 111,604 286,453 183,526 940,023 477,653 1,348,520 1,263,373 511,675 515,245 172,532 71,513 33,962 29,571 27,270 24,113 12,134 57,259 531,694 1,285,719 336,212 359,707 1,179,924 814,822 565,910 860,327 252,493 79,543 636,608 276,985 92,101 97,911 50,755 65,422 46,027 6,566 83,596 322,421 37,709 238,484 186,033 567,387 107,155 45,079 42,231 23,604 117,103 272,801 13,739 6,084 11,923 5,257
vvi-miR166g UCGGACCAGGCUUCAUUCCCC 21 24,315,860 347,369 1,887,582 5,257    30,038 109,011 1,486,439 1,337,252 135,612 93,053 1,887,582 804,475 700,449 411,533 62,880 123,094 80,215 214,758 174,283 134,339 251,822 484,826 108,441 111,604 286,453 183,526 940,023 477,653 1,348,520 1,263,373 511,675 515,245 172,532 71,513 33,962 29,571 27,270 24,113 12,134 57,259 531,694 1,285,719 336,212 359,707 1,179,924 814,822 565,910 860,327 252,493 79,543 636,608 276,985 92,101 97,911 50,755 65,422 46,027 6,566 83,596 322,421 37,709 238,484 186,033 567,387 107,155 45,079 42,231 23,604 117,103 272,801 13,739 6,084 11,923 5,257
vvi-miR166h UCGGACCAGGCUUCAUUCCCC 21 24,315,860 347,369 1,887,582 5,257    30,038 109,011 1,486,439 1,337,252 135,612 93,053 1,887,582 804,475 700,449 411,533 62,880 123,094 80,215 214,758 174,283 134,339 251,822 484,826 108,441 111,604 286,453 183,526 940,023 477,653 1,348,520 1,263,373 511,675 515,245 172,532 71,513 33,962 29,571 27,270 24,113 12,134 57,259 531,694 1,285,719 336,212 359,707 1,179,924 814,822 565,910 860,327 252,493 79,543 636,608 276,985 92,101 97,911 50,755 65,422 46,027 6,566 83,596 322,421 37,709 238,484 186,033 567,387 107,155 45,079 42,231 23,604 117,103 272,801 13,739 6,084 11,923 5,257
vvi-miR167a UGAAGCUGCCAGCAUGAUCUG 21 2,865 49 782 1    0 6 23 28 16 6 4 0 4 0 21 24 2 16 52 37 0 39 2 70 76 36 1 0 10 25 52 43 74 34 6 9 0 0 0 0 49 101 74 41 85 32 35 57 52 4 56 45 16 11 21 22 13 32 2 40 18 34 22 24 19 26 22 21 374 782 5 0 14 0
vvi-miR167b UGAAGCUGCCAGCAUGAUCUA 21 7,719 148 6,318 1    0 5 40 11 5 0 19 21 81 29 42 17 46 25 0 3 0 0 0 7 2 1 11 23 24 29 24 45 32 36 18 12 0 32 0 6 5 14 17 0 0 4 0 2 4 0 6 3 0 1 1 6 4 0 0 0 11 3 2 0 1 9 20 0 53 22 13 6 6,318 548
vvi-miR167c UGAAGCUGCCAGCAUGAUCUC 21 17,570 288 2,093 1    0 9 92 31 21 6 501 209 98 45 18 55 108 122 3 2 0 13 0 0 27 9 59 46 1,618 1,491 1,143 1,522 826 842 415 640 580 344 2 16 1,246 2,093 794 204 423 196 92 89 33 38 165 46 4 13 3 5 1 0 0 28 0 8 60 77 18 2 0 0 178 239 218 10 188 186
vvi-miR167d UGAAGCUGCCAGCAUGAUCUA 21 7,719 148 6,318 1    0 5 40 11 5 0 19 21 81 29 42 17 46 25 0 3 0 0 0 7 2 1 11 23 24 29 24 45 32 36 18 12 0 32 0 6 5 14 17 0 0 4 0 2 4 0 6 3 0 1 1 6 4 0 0 0 11 3 2 0 1 9 20 0 53 22 13 6 6,318 548
vvi-miR167e UGAAGCUGCCAGCAUGAUCUA 21 7,719 148 6,318 1    0 5 40 11 5 0 19 21 81 29 42 17 46 25 0 3 0 0 0 7 2 1 11 23 24 29 24 45 32 36 18 12 0 32 0 6 5 14 17 0 0 4 0 2 4 0 6 3 0 1 1 6 4 0 0 0 11 3 2 0 1 9 20 0 53 22 13 6 6,318 548
vvi-miR168 UCGCUUGGUGCAGGUCGGGAA 21 98,181 1,403 6,763 5    100 187 1,226 791 130 173 2,832 2,612 6,134 4,373 563 491 408 2,085 3,428 2,294 137 4,038 1,859 1,428 867 856 2,174 4,984 1,576 1,661 5,239 4,693 6,763 5,673 402 916 1,958 1,124 14 33 1,411 1,856 378 80 3,158 1,793 238 302 221 60 506 488 54 54 34 76 46 14 25 365 2,720 2,988 286 814 652 731 1,869 1,561 517 522 34 5 93 8
vvi-miR169a CAGCCAAGGAUGACUUGCCGG 21 114 7 28 1    0 0 0 0 0 0 5 18 1 0 0 0 25 0 5 0 0 0 0 0 4 1 5 0 1 0 0 2 0 0 0 0 0 0 0 0 5 2 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 28 9
vvi-miR169b UGAGCCAAGGAUGGCUUGCCG 21 3 3 3 3    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0
vvi-miR169c CAGCCAAGGAUGACUUGCCGG 21 114 7 28 1    0 0 0 0 0 0 5 18 1 0 0 0 25 0 5 0 0 0 0 0 4 1 5 0 1 0 0 2 0 0 0 0 0 0 0 0 5 2 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 28 9
vvi-miR169d CAGCCAAGAAUGAUUUGCCGG 21 48 3 6 1    0 0 2 0 0 0 0 0 0 0 0 0 0 0 5 0 0 0 6 0 1 0 0 0 2 3 0 6 1 0 0 0 0 0 0 0 0 6 0 0 0 0 3 0 0 0 1 3 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 3
vvi-miR169e UAGCCAAGGAUGACUUGCCUGC 22 18 6 10 3    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 10 3
vvi-miR169f CAGCCAAGGAUGACUUGCCGA 21 108 12 87 1    0 0 2 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 2 1 0 0 0 0 0 1 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 87 10
vvi-miR169g CAGCCAAGGAUGACUUGCCGA 21 108 12 87 1    0 0 2 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 2 1 0 0 0 0 0 1 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 87 10
vvi-miR169h UGAGCCAAGGAUGGCUUGCCG 21 3 3 3 3    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0
vvi-miR169i GAGCCAAGGAUGACUGGCCGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR169j CAGCCAAGGAUGACUUGCCGG 21 114 7 28 1    0 0 0 0 0 0 5 18 1 0 0 0 25 0 5 0 0 0 0 0 4 1 5 0 1 0 0 2 0 0 0 0 0 0 0 0 5 2 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 28 9
vvi-miR169k CAGCCAAGGAUGACUUGCCGG 21 114 7 28 1    0 0 0 0 0 0 5 18 1 0 0 0 25 0 5 0 0 0 0 0 4 1 5 0 1 0 0 2 0 0 0 0 0 0 0 0 5 2 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 28 9
vvi-miR169l GAGCCAAGGAUGACUUGCCGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR169m GAGCCAAGGAUGACUUGCCGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR169n GAGCCAAGGAUGACUUGCCGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR169o GAGCCAAGGAUGACUUGCCGC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR169p GAGCCAAGGAUGACUUGCCGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR169q GAGCCAAGGAUGACUUGCCGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR169r UGAGUCAAGGAUGACUUGCCG 21 7 2 3 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0
vvi-miR169s CAGCCAAGGAUGACUUGCCGG 21 114 7 28 1    0 0 0 0 0 0 5 18 1 0 0 0 25 0 5 0 0 0 0 0 4 1 5 0 1 0 0 2 0 0 0 0 0 0 0 0 5 2 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 28 9
vvi-miR169t CGAGUCAAGGAUGACUUGCCG 21 4 1 2 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0
vvi-miR169u UGAGUCAAGGAUGACUUGCCG 21 7 2 3 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0
vvi-miR169v AAGCCAAGGAUGAAUUGCCGG 21 253 25 236 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5 0 0 0 0 3 2 1 0 1 0 0 1 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 236 2
vvi-miR169w CAGCCAAGGAUGACUUGCCGG 21 114 7 28 1    0 0 0 0 0 0 5 18 1 0 0 0 25 0 5 0 0 0 0 0 4 1 5 0 1 0 0 2 0 0 0 0 0 0 0 0 5 2 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 28 9
vvi-miR169x UAGCCAAGGAUGACUUGCCUA 21 5 2 2 1    0 0 1 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR169y UAGCGAAGGAUGACUUGCCUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR171a UGAUUGAGCCGUGCCAAUAUC 21 3,574 62 1,296 1    0 1 11 14 0 0 119 141 31 29 21 18 51 43 23 13 0 39 0 17 23 8 8 23 40 52 57 54 48 43 14 50 73 51 5 33 7 11 0 5 28 11 0 10 4 0 11 17 1 3 0 2 1 7 0 3 4 7 12 9 11 5 0 0 18 43 5 2 1,296 888
vvi-miR171b UGAUUGAGCCGCGUCAAUAUC 21 6 3 5 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 5 0 0 0 0 0 0 0 0
vvi-miR171c UGAUUGAGCCGUGCCAAUAUC 21 3,574 62 1,296 1    0 1 11 14 0 0 119 141 31 29 21 18 51 43 23 13 0 39 0 17 23 8 8 23 40 52 57 54 48 43 14 50 73 51 5 33 7 11 0 5 28 11 0 10 4 0 11 17 1 3 0 2 1 7 0 3 4 7 12 9 11 5 0 0 18 43 5 2 1,296 888
vvi-miR171d UGAUUGAGCCGUGCCAAUAUC 21 3,574 62 1,296 1    0 1 11 14 0 0 119 141 31 29 21 18 51 43 23 13 0 39 0 17 23 8 8 23 40 52 57 54 48 43 14 50 73 51 5 33 7 11 0 5 28 11 0 10 4 0 11 17 1 3 0 2 1 7 0 3 4 7 12 9 11 5 0 0 18 43 5 2 1,296 888
vvi-miR171e UGAUUGAGCCGCGCCAAUAUC 21 13 7 10 3    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 10 3
vvi-miR171f UUGAGCCGCGCCAAUAUCACU 21 908 28 201 1    0 0 0 0 0 0 46 54 9 9 0 0 9 5 31 20 0 32 0 2 31 20 6 46 201 191 3 9 8 2 19 35 0 51 0 10 0 3 0 0 0 3 0 0 2 0 0 0 0 0 1 0 0 0 0 15 10 20 0 0 0 0 0 0 0 0 0 0 2 3
vvi-miR171g UUGAGCCGAACCAAUAUCACC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR171h UGGUUGAGCCGCGCCAAUAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR171i UGAUUGAGCCGUGCCAAUAUC 21 3,574 62 1,296 1    0 1 11 14 0 0 119 141 31 29 21 18 51 43 23 13 0 39 0 17 23 8 8 23 40 52 57 54 48 43 14 50 73 51 5 33 7 11 0 5 28 11 0 10 4 0 11 17 1 3 0 2 1 7 0 3 4 7 12 9 11 5 0 0 18 43 5 2 1,296 888
vvi-miR171j UGAUUGAGCCGUGCCAAUAUC 21 3,574 62 1,296 1    0 1 11 14 0 0 119 141 31 29 21 18 51 43 23 13 0 39 0 17 23 8 8 23 40 52 57 54 48 43 14 50 73 51 5 33 7 11 0 5 28 11 0 10 4 0 11 17 1 3 0 2 1 7 0 3 4 7 12 9 11 5 0 0 18 43 5 2 1,296 888
vvi-miR172a UGAAUCUUGAUGAUGCUACAU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR172b UGAAUCUUGAUGAUGCUACAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR172c GGAAUCUUGAUGAUGCUGCAG 21 1,079 36 218 1    0 0 0 0 0 0 0 2 1 0 0 0 7 0 11 18 0 13 0 0 1 0 0 0 5 9 102 102 58 54 58 92 218 98 63 62 20 9 0 0 0 0 0 0 0 0 2 10 1 0 1 3 0 0 0 0 6 3 0 0 0 0 0 0 0 0 48 0 2 0
vvi-miR172d UGAGAAUCUUGAUGAUGCUGCAU 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR2111-3p GUCCUCUGGUUGCAGAUUACU 21 44 6 28 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 28 1 0 0 4 0 1 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5 0
vvi-miR2111-5p UAAUCUGCAUCCUGAGGUCUA 21 1,099 26 148 1    0 0 2 0 0 0 2 0 4 0 0 0 0 5 5 22 0 0 22 17 26 30 24 9 12 16 5 22 21 20 0 20 0 0 0 0 15 49 40 0 141 87 57 44 22 0 23 12 1 7 0 2 2 2 0 9 44 9 25 0 29 0 23 12 0 0 0 0 148 12
vvi-miR2950-3p UGGUGUGCACGGGAUGGAAUA 21 874 20 127 1    0 0 0 0 0 0 0 4 1 0 0 6 0 27 7 5 0 0 4 10 8 6 2 9 9 14 127 53 73 29 16 44 73 17 3 0 5 1 8 0 0 3 5 6 11 34 48 37 0 0 0 0 0 0 2 4 60 41 5 0 12 19 8 0 0 0 10 0 7 1
vvi-miR2950-5p UUCCAUCUCUUGCACACUGGA 21 6,112 99 910 2    0 0 17 17 5 6 87 99 388 211 0 0 9 5 130 46 29 207 31 0 28 11 72 28 123 163 648 910 423 165 155 175 435 189 4 46 81 133 167 55 56 65 25 40 31 0 97 25 6 5 2 7 3 2 0 21 20 10 57 70 44 26 6 33 36 43 10 0 17 57
vvi-miR319b UUGGACUGAAGGGAGCUCCCU 21 230,126 3,712 46,418 1    114 26 7 2 0 0 2,970 994 567 172 1,135 1,499 1,454 5,849 20,667 5,121 127 833 2,587 1,157 906 930 3,919 5,793 2,049 3,677 845 2,217 2,355 3,632 27,561 26,003 46,418 29,944 24 97 803 640 65 61 226 122 2 1 6 9 17 17 0 1 0 0 0 0 3,832 6,514 4,271 10,042 307 614 161 133 205 170 71 0 6 39 22 118
vvi-miR319c UUGGACUGAAGGGAGCUCCCU 21 230,126 3,712 46,418 1    114 26 7 2 0 0 2,970 994 567 172 1,135 1,499 1,454 5,849 20,667 5,121 127 833 2,587 1,157 906 930 3,919 5,793 2,049 3,677 845 2,217 2,355 3,632 27,561 26,003 46,418 29,944 24 97 803 640 65 61 226 122 2 1 6 9 17 17 0 1 0 0 0 0 3,832 6,514 4,271 10,042 307 614 161 133 205 170 71 0 6 39 22 118
vvi-miR319e UUUGGACUGAAGGGAGCUCCU 21 74,129 1,348 14,767 1    0 0 0 0 0 0 3 1 16 0 0 0 2 0 5 7 10 0 0 0 6 5 19 14 101 84 64 222 199 190 14,767 3,998 5,875 4,162 3 13 669 810 653 1,295 9,191 4,960 2,100 880 5,391 51 5,831 2,054 744 145 100 67 20 0 33 138 61 28 1,840 4,529 725 242 324 116 18 0 108 1,203 4 33
vvi-miR319f UUGGACUGAAGGGAGCUCCCU 21 230,126 3,712 46,418 1    114 26 7 2 0 0 2,970 994 567 172 1,135 1,499 1,454 5,849 20,667 5,121 127 833 2,587 1,157 906 930 3,919 5,793 2,049 3,677 845 2,217 2,355 3,632 27,561 26,003 46,418 29,944 24 97 803 640 65 61 226 122 2 1 6 9 17 17 0 1 0 0 0 0 3,832 6,514 4,271 10,042 307 614 161 133 205 170 71 0 6 39 22 118
vvi-miR319g UUGGACUGAAGGGAGCUCCCA 21 1,388 35 232 1    0 0 1 0 0 0 29 11 2 1 2 9 7 34 64 10 0 0 7 12 8 4 5 9 20 88 36 51 22 36 138 232 218 79 0 5 12 10 0 0 0 1 0 0 0 0 0 0 0 1 0 0 0 0 31 99 10 67 6 0 4 0 6 0 0 0 0 0 0 1
vvi-miR3623-3p UGGUGCUUGGACGAAUUUGCUA 22 4,733 79 479 1    0 16 81 31 0 6 43 8 44 55 48 38 21 50 301 133 0 32 50 149 51 69 106 479 60 35 61 38 69 32 5 3 0 0 0 0 56 155 163 17 113 140 155 191 28 77 57 78 5 3 2 4 1 0 0 60 45 30 91 128 113 150 156 87 0 22 8 2 460 22
vvi-miR3623-5p UCACAAGUUCAUCCAAGCACCA 22 128,487 1,836 19,437 2    27 25 1,028 319 68 96 2,064 1,517 19,437 14,335 794 788 2,167 2,746 807 1,370 1,134 7,650 335 1,411 3,024 3,007 267 772 342 454 383 799 1,527 1,306 195 259 508 482 22 2 309 1,088 327 245 11,362 9,682 580 2,795 1,204 1,013 5,664 3,622 663 451 555 734 295 149 27 73 1,113 432 543 422 1,336 1,830 1,299 764 1,248 2,152 79 19 3,294 1,651
vvi-miR3624-3p UCAGGGCAGCAGCAUACUACU 21 12,382 206 2,935 1    0 1 1,767 2,935 650 771 7 11 128 108 14 10 5 0 5 23 10 452 0 7 234 122 1 9 9 1 26 30 8 14 8 0 0 0 0 43 2 4 2 0 56 63 14 31 48 0 72 94 45 25 18 17 37 2 0 43 13 72 296 176 266 133 94 21 1,016 1,521 8 8 542 234
vvi-miR3624-5p UAGUAUGCUGCUGUCUUUAGA 21 57 5 24 1    0 0 0 3 0 0 0 0 1 0 0 2 0 5 0 0 0 0 0 0 3 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 2 24 0 0 0 0 0 0 3 11
vvi-miR3625-3p CGGGAGAUGACUACUGGAAGC 21 1,648 27 312 1    49 83 15 16 16 0 146 30 8 6 16 35 66 312 44 54 0 32 50 67 13 6 66 33 21 24 11 13 3 14 7 16 0 9 0 8 15 34 4 5 0 15 23 6 9 0 13 9 4 4 5 12 10 5 6 27 1 26 12 11 13 17 5 0 0 0 44 4 18 2
vvi-miR3625-5p UUCCAGCAGUCAUCUCCAAGG 21 85 4 20 1    0 0 1 0 5 0 9 20 4 3 0 0 7 9 4 8 0 0 2 2 0 0 0 0 2 1 0 2 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 2 0 0 0 0 0 1 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0
vvi-miR3626-3p CUUCAAUUUCACAGCGACCAC 21 62 3 12 1    0 0 1 0 0 0 1 5 2 2 0 0 0 0 4 5 0 0 0 12 2 4 0 0 0 0 1 2 3 2 0 0 0 0 0 5 0 0 0 0 0 6 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 0 1 0 1 0
vvi-miR3626-5p GGUAGUCGCUGUGAAAUUGAA 21 737 15 85 1    11 11 5 0 0 0 20 0 2 0 0 7 11 23 35 11 0 19 9 22 19 16 41 28 7 4 13 7 4 5 32 12 0 0 0 0 12 3 0 0 85 13 2 0 41 4 30 14 11 1 3 1 0 0 4 18 1 11 16 31 12 7 13 0 0 0 25 4 1 0
vvi-miR3627-3p UCGCCGCUCUCCUGUGACAAG 21 5,708 100 918 2    0 3 513 918 218 227 21 87 221 224 0 45 4 16 11 14 10 168 2 14 357 249 16 0 13 16 37 39 98 231 0 0 0 0 7 4 27 69 23 30 113 83 31 69 11 0 40 28 7 13 5 11 55 7 0 162 55 367 144 163 245 36 27 0 36 65 0 0 3 0
vvi-miR3627-5p UUGUCGCAGGAGAGACGGCACU 22 2,132 44 470 1    0 9 329 470 146 90 13 0 28 9 0 5 0 2 5 3 0 58 0 0 84 25 2 9 3 6 2 7 16 48 5 0 0 0 0 0 51 38 25 22 0 0 26 7 11 0 19 4 2 4 0 1 1 0 6 84 7 131 57 79 82 28 38 0 0 22 0 0 9 4
vvi-miR3628-3p CUAAGCACAGCUCUCGCAUCC 21 799 67 393 1    0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 6 0 0 0 0 0 0 0 1 393 170 118 52 0 12 0 0 23 14 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 8 0 0 0 0 0 0 0
vvi-miR3628-5p AUGCGAGAGCCGUGCUUAGUA 21 125 25 67 5    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 67 29 11 5 0 0 0 13 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR3629a-3p GGCUGCUGAGAAAAUGUAGGA 21 109 4 13 1    0 0 0 0 0 0 7 3 1 0 0 0 0 0 5 2 0 13 0 0 2 1 1 5 1 1 0 0 0 0 0 0 0 2 0 0 7 5 6 5 0 1 0 0 2 0 10 2 0 0 0 0 0 0 0 3 0 1 1 9 0 0 9 0 0 0 0 0 2 2
vvi-miR3629a-5p CGCAUUUUCUCAGCAGCCAAG 21 41 3 8 1    0 0 1 0 0 0 1 1 1 0 0 0 0 0 2 0 0 0 2 0 1 0 2 5 0 2 0 0 0 0 0 0 0 0 0 0 0 0 6 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 6 8
vvi-miR3629b GGCUGCUGAGAAAAUGUAGGA 21 109 4 13 1    0 0 0 0 0 0 7 3 1 0 0 0 0 0 5 2 0 13 0 0 2 1 1 5 1 1 0 0 0 0 0 0 0 2 0 0 7 5 6 5 0 1 0 0 2 0 10 2 0 0 0 0 0 0 0 3 0 1 1 9 0 0 9 0 0 0 0 0 2 2
vvi-miR3629c GGCUGCUGAGAAAAUGUAGGA 21 109 4 13 1    0 0 0 0 0 0 7 3 1 0 0 0 0 0 5 2 0 13 0 0 2 1 1 5 1 1 0 0 0 0 0 0 0 2 0 0 7 5 6 5 0 1 0 0 2 0 10 2 0 0 0 0 0 0 0 3 0 1 1 9 0 0 9 0 0 0 0 0 2 2
vvi-miR3630-3p UUUGGGAAUCUCUCUGAUGCAC 22 2,091 34 284 1    0 11 1 0 0 0 26 224 48 54 32 52 25 7 8 3 59 65 13 7 21 9 16 0 6 3 12 10 4 7 87 76 0 0 11 3 5 4 11 150 28 35 75 15 284 21 21 14 51 28 1 6 3 5 39 78 20 10 57 44 13 19 5 0 18 65 49 11 3 3
vvi-miR3630-5p UGCAAGUGACGAUAUCAGACA 21 399 9 43 1    0 0 1 0 0 0 4 1 3 0 5 19 4 4 2 5 0 6 13 0 9 1 0 0 1 3 16 10 8 20 1 0 0 0 16 4 0 4 0 0 0 4 14 6 0 13 1 16 0 1 1 3 3 2 0 6 9 9 10 7 35 17 17 0 0 43 22 0 0 0
vvi-miR3631a-3p UAUAUUGGAUGAUGUCAACAA 21 16 4 9 1    0 0 0 0 0 0 0 2 0 0 0 0 0 0 4 0 0 0 9 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR3631a-5p CAUGUUGACAUCAUCCAAUAUA 22 38 3 9 1    0 0 0 0 0 0 0 3 5 5 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 1 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 2 1 0 0 0 0 0 0 0 0 0 9 4
vvi-miR3631b-3p UGUUGGAUGAUGUCAAUAAGU 21 85 4 10 1    0 0 10 8 5 6 4 0 1 0 0 0 0 0 0 0 0 6 0 0 0 2 1 0 2 3 3 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 9 0 0 0 1 0 0 0 0 0 0 0 0 1 4 0 3 4 1 0 0 0 0 0 0 0 9 0
vvi-miR3631b-5p CAUGUUGACAUCAUCCAAUAUA 22 38 3 9 1    0 0 0 0 0 0 0 3 5 5 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 1 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 2 1 0 0 0 0 0 0 0 0 0 9 4
vvi-miR3631c CAUGUUGACAUCAUCCAAUAUA 22 38 3 9 1    0 0 0 0 0 0 0 3 5 5 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 1 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 2 1 0 0 0 0 0 0 0 0 0 9 4
vvi-miR3631d CAUGUUGACAUCAUCCAAUAUA 22 38 3 9 1    0 0 0 0 0 0 0 3 5 5 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 1 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 2 1 0 0 0 0 0 0 0 0 0 9 4
vvi-miR3632-3p UUUCCCAGACCCCCAAUACCAA 22 4,209 74 238 2    0 0 32 6 0 0 81 238 152 213 44 61 213 169 161 197 10 84 107 168 225 155 69 139 70 93 34 103 93 68 13 3 0 0 0 2 61 48 91 17 113 173 45 40 11 0 29 41 4 2 4 9 5 5 0 34 115 140 24 13 23 17 13 8 0 0 0 0 73 48
vvi-miR3632-5p GGAUUGGGGGCCGAUGGAAAGG 22 5,566 90 651 1    24 30 4 3 5 0 75 59 2 3 25 168 225 404 231 311 0 19 199 72 191 37 102 167 30 47 11 34 19 84 12 51 0 53 3 2 120 81 23 25 113 38 15 0 0 0 23 26 7 2 1 1 2 0 65 148 601 651 71 106 190 209 69 12 36 43 19 0 13 154
vvi-miR3633a-3p UUCCUAUACCACCCAUUCCCUA 22 6,247 106 1,190 2    0 3 68 26 0 0 128 472 722 1,190 7 24 121 111 66 80 49 278 17 134 149 151 51 177 93 94 82 125 137 36 24 40 0 91 17 2 17 59 65 0 254 168 12 70 46 0 127 71 10 5 8 11 6 0 0 15 40 47 17 9 37 43 11 29 0 0 10 0 167 128
vvi-miR3633a-5p GGAAUGGAUGGUUAGGAGAG 20 102,967 1,471 13,365 17    1,521 2,443 176 68 31 131 1,471 2,263 259 675 976 1,374 1,676 5,303 5,056 2,450 861 969 4,650 2,076 684 198 2,285 5,751 646 509 803 756 399 964 533 744 943 887 48 55 1,384 649 1,123 329 3,637 2,670 795 166 77 336 92 119 30 17 18 96 51 52 675 4,228 3,547 13,365 1,412 1,432 2,572 2,785 4,617 2,055 820 935 2,055 75 93 26
vvi-miR3633b-3p GUUCCCAUGCCAUCCAUUCCUA 22 3,527 61 300 2    0 2 5 0 0 0 300 105 62 87 2 14 5 29 82 54 10 84 22 60 48 61 75 265 179 156 51 70 54 34 47 59 0 53 0 0 91 143 129 44 141 162 48 99 50 26 75 89 14 13 5 16 9 2 6 25 41 94 10 18 18 0 0 37 0 0 19 0 22 6
vvi-miR3633b-5p GGAAUGGGUGGCUGGGAUCUA 21 7,300 128 1,668 1    0 7 3 7 0 0 121 120 3 3 9 28 5 32 199 54 0 6 77 0 33 17 124 186 106 150 8 22 0 63 458 565 1,668 1,610 1 6 264 64 40 78 226 179 41 2 18 0 14 8 3 0 1 0 0 0 20 118 144 169 23 53 8 2 10 0 18 22 61 0 14 9
vvi-miR3634-3p UUUCCGACUCGCACUCAUGCCGU 23 7,059,597 100,851 1,279,250 251    2,823 4,473 468,315 1,279,250 6,098 6,460 136,370 167,256 142,095 165,326 9,655 20,519 102,123 230,989 305,051 367,712 3,843 36,614 198,770 312,584 116,601 300,958 167,014 443,316 295,303 273,771 92,862 250,463 173,192 107,712 1,801 2,611 3,409 3,814 1,019 2,641 17,522 122,893 16,024 1,707 30,365 24,348 16,161 59,000 3,073 35,187 20,573 25,019 1,572 1,657 4,147 7,498 6,063 2,689 2,173 14,804 45,462 64,214 24,419 81,655 52,286 46,868 55,337 25,763 14,373 32,253 638 251 418 372
vvi-miR3634-5p GGCAUAUGUGUGACGGAAAGA 21 1,771 35 127 1    0 3 5 0 0 0 58 50 6 0 78 38 30 127 97 30 10 0 87 29 46 30 8 56 24 24 48 42 30 45 0 32 0 0 0 0 2 14 11 0 28 14 5 0 4 0 15 7 0 1 1 2 0 0 0 30 61 102 14 9 70 66 26 8 107 43 22 0 53 23
vvi-miR3635-3p AUUAUGUCCCACACAUGCCUC 21 2,155 48 308 1    11 0 2 0 0 0 2 18 42 66 0 5 7 20 3 1 0 0 0 2 8 5 14 33 65 56 171 308 209 296 35 90 218 78 0 0 32 73 32 5 56 3 0 7 6 0 0 0 0 0 0 1 0 0 0 13 6 4 6 0 6 0 5 0 0 65 14 0 6 50
vvi-miR3635-5p GGCAUGUGUGGGGCAUAAUAG 21 1,232 33 179 1    0 8 0 0 0 0 16 16 0 0 0 9 4 2 2 0 0 0 0 2 0 0 23 79 37 14 66 36 38 20 87 86 145 138 0 0 179 70 25 20 0 0 5 0 4 0 3 3 2 1 0 0 0 0 0 12 0 9 5 4 1 0 0 0 0 0 60 0 1 0
vvi-miR3636-3p GUCUGUCGGAGAAGCAAGUCGGAG 24 19,384 1,615 12,376 1    0 0 0 0 0 0 0 0 1 0 0 0 0 0 3 0 0 0 0 0 1 1 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 127 2 2 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 12,376 6,867
vvi-miR3636-5p UCGGUUUGCUUCUUUGAUAGAUUC 24 857 16 56 1    0 0 5 11 5 0 13 0 6 0 16 51 0 34 7 10 0 13 9 2 27 20 4 0 15 20 12 15 30 9 4 12 0 0 0 3 5 15 13 3 56 8 9 6 2 17 9 13 0 0 1 1 1 0 10 21 20 41 23 33 18 19 38 21 0 43 10 0 46 2
vvi-miR3637-3p UUUCGACAAGACACAAUGCAUAAA 24 119 4 17 1    0 0 0 0 0 0 1 2 8 8 12 17 0 7 7 1 0 0 6 0 4 2 1 0 2 0 2 0 1 0 5 6 0 0 0 0 0 1 0 0 0 1 0 1 0 0 5 1 1 0 0 1 0 0 0 0 0 2 1 0 1 0 0 0 0 0 4 0 7 1
vvi-miR3637-5p AUUUAUGUAUUGUGUUUUGUCGGA 24 542 20 254 1    0 1 2 3 0 0 5 0 4 0 0 0 0 0 0 0 0 0 0 0 0 2 5 5 5 0 0 0 0 0 254 12 73 40 0 0 5 13 11 0 0 8 0 0 6 0 3 1 1 0 0 0 0 0 2 12 0 1 7 0 0 0 0 0 0 0 0 7 54 0
vvi-miR3638-3p GCAACAAGCAUGAAAAGGCACACC 24 12 2 4 1    0 0 0 0 0 0 1 0 1 4 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 3
vvi-miR3638-5p UGUGCCUUUUCGCGCUUGUUGCUA 24 4 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 0
vvi-miR3639-3p GAGCUUUUGGCUUCUCAGAAGUCA 24 61 15 58 1    0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 58 0
vvi-miR3639-5p AUUGACUUCUGAAAGGCUAAAAGC 24 50,529 10,106 40,544 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 6 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 40,544 9,977
vvi-miR3640-3p AUCGAAAAGGCAUCAUCAAUCAGG 24 1,929 34 201 1    0 1 6 0 0 0 28 8 20 19 0 61 201 72 62 72 0 6 42 70 77 21 25 74 22 39 42 54 54 36 9 44 0 19 3 0 15 34 44 8 28 42 11 14 6 0 46 39 2 2 5 12 3 2 0 10 40 43 10 0 18 12 11 0 18 22 0 0 177 68
vvi-miR3640-5p ACCUGAUUGGUGAUGCUUUUUUGG 24 4,241 71 483 1    3 22 32 8 0 0 190 65 23 11 168 291 124 483 119 169 0 13 109 67 64 30 31 56 55 90 214 116 114 91 16 135 73 123 0 12 22 26 21 25 0 15 51 97 28 30 56 59 6 3 1 2 0 0 0 9 67 168 6 13 16 14 8 8 0 22 35 0 250 66
vvi-miR390 AAGCUCAGGAGGGAUAGCGCC 21 38,378 564 2,945 1    8 57 23 33 5 24 2,684 2,665 1,018 919 840 908 1,113 1,647 1,208 812 284 2,164 1,835 766 2,945 1,775 389 776 408 474 2,286 2,579 1,490 1,279 535 906 798 783 34 97 93 100 2 11 28 6 0 1 13 13 52 42 5 3 1 1 3 0 29 407 178 454 39 46 11 24 4 33 89 65 8 11 8 31
vvi-miR393a UCCAAAGGGAUCGCAUUGAUC 21 13,575 215 1,505 2    0 0 15 13 16 60 0 13 59 85 78 31 16 36 36 44 0 13 41 41 29 28 6 14 106 136 687 680 1,137 919 0 32 73 40 216 148 5 4 8 0 28 95 32 19 4 238 51 130 7 7 49 182 115 374 0 13 723 705 174 290 757 1,177 1,505 560 517 478 455 5 2 18
vvi-miR393b UCCAAAGGGAUCGCAUUGAUC 21 13,575 215 1,505 2    0 0 15 13 16 60 0 13 59 85 78 31 16 36 36 44 0 13 41 41 29 28 6 14 106 136 687 680 1,137 919 0 32 73 40 216 148 5 4 8 0 28 95 32 19 4 238 51 130 7 7 49 182 115 374 0 13 723 705 174 290 757 1,177 1,505 560 517 478 455 5 2 18
vvi-miR394a UUGGCAUUCUGUCCACCUCCAU 22 6 3 5 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR394b UUGGCAUUCUGUCCACCUCC 20 6,465 122 1,028 1    0 0 24 12 0 12 39 919 800 1,028 81 46 75 70 253 72 39 853 70 106 190 173 16 130 70 123 224 215 136 192 9 18 0 13 0 10 5 5 2 0 28 6 0 2 0 0 5 10 0 1 0 1 0 0 16 27 53 94 16 31 22 38 10 21 0 0 6 0 48 0
vvi-miR394c UUGGCAUUCUGUCCACCUCCAU 22 6 3 5 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR395a CUGAAGUGUUUGGGGGAACUC 21 11,401 211 2,002 1    0 137 685 1,252 5 0 7 4 0 0 0 0 0 0 16 4 10 6 17 14 36 29 53 84 34 9 1 15 5 20 1,157 160 508 231 0 0 245 214 34 165 2,002 1,140 447 64 525 21 159 14 29 27 1 2 0 0 86 395 26 22 154 154 51 19 0 0 0 0 15 819 68 4
vvi-miR395b CUGAAGUGUUUGGGGGAACUC 21 11,401 211 2,002 1    0 137 685 1,252 5 0 7 4 0 0 0 0 0 0 16 4 10 6 17 14 36 29 53 84 34 9 1 15 5 20 1,157 160 508 231 0 0 245 214 34 165 2,002 1,140 447 64 525 21 159 14 29 27 1 2 0 0 86 395 26 22 154 154 51 19 0 0 0 0 15 819 68 4
vvi-miR395c CUGAAGUGUUUGGGGGAACUC 21 11,401 211 2,002 1    0 137 685 1,252 5 0 7 4 0 0 0 0 0 0 16 4 10 6 17 14 36 29 53 84 34 9 1 15 5 20 1,157 160 508 231 0 0 245 214 34 165 2,002 1,140 447 64 525 21 159 14 29 27 1 2 0 0 86 395 26 22 154 154 51 19 0 0 0 0 15 819 68 4
vvi-miR395d CUGAAGUGUUUGGGGGAACUC 21 11,401 211 2,002 1    0 137 685 1,252 5 0 7 4 0 0 0 0 0 0 16 4 10 6 17 14 36 29 53 84 34 9 1 15 5 20 1,157 160 508 231 0 0 245 214 34 165 2,002 1,140 447 64 525 21 159 14 29 27 1 2 0 0 86 395 26 22 154 154 51 19 0 0 0 0 15 819 68 4
vvi-miR395e CUGAAGUGUUUGGGGGAACUC 21 11,401 211 2,002 1    0 137 685 1,252 5 0 7 4 0 0 0 0 0 0 16 4 10 6 17 14 36 29 53 84 34 9 1 15 5 20 1,157 160 508 231 0 0 245 214 34 165 2,002 1,140 447 64 525 21 159 14 29 27 1 2 0 0 86 395 26 22 154 154 51 19 0 0 0 0 15 819 68 4
vvi-miR395f CUGAAGUGUUUGGGGGAACUC 21 11,401 211 2,002 1    0 137 685 1,252 5 0 7 4 0 0 0 0 0 0 16 4 10 6 17 14 36 29 53 84 34 9 1 15 5 20 1,157 160 508 231 0 0 245 214 34 165 2,002 1,140 447 64 525 21 159 14 29 27 1 2 0 0 86 395 26 22 154 154 51 19 0 0 0 0 15 819 68 4
vvi-miR395g CUGAAGUGUUUGGGGGAACUC 21 11,401 211 2,002 1    0 137 685 1,252 5 0 7 4 0 0 0 0 0 0 16 4 10 6 17 14 36 29 53 84 34 9 1 15 5 20 1,157 160 508 231 0 0 245 214 34 165 2,002 1,140 447 64 525 21 159 14 29 27 1 2 0 0 86 395 26 22 154 154 51 19 0 0 0 0 15 819 68 4
vvi-miR395h CUGAAGUGUUUGGGGGAACUC 21 11,401 211 2,002 1    0 137 685 1,252 5 0 7 4 0 0 0 0 0 0 16 4 10 6 17 14 36 29 53 84 34 9 1 15 5 20 1,157 160 508 231 0 0 245 214 34 165 2,002 1,140 447 64 525 21 159 14 29 27 1 2 0 0 86 395 26 22 154 154 51 19 0 0 0 0 15 819 68 4
vvi-miR395i CUGAAGUGUUUGGGGGAACUC 21 11,401 211 2,002 1    0 137 685 1,252 5 0 7 4 0 0 0 0 0 0 16 4 10 6 17 14 36 29 53 84 34 9 1 15 5 20 1,157 160 508 231 0 0 245 214 34 165 2,002 1,140 447 64 525 21 159 14 29 27 1 2 0 0 86 395 26 22 154 154 51 19 0 0 0 0 15 819 68 4
vvi-miR395j CUGAAGUGUUUGGGGGAACUC 21 11,401 211 2,002 1    0 137 685 1,252 5 0 7 4 0 0 0 0 0 0 16 4 10 6 17 14 36 29 53 84 34 9 1 15 5 20 1,157 160 508 231 0 0 245 214 34 165 2,002 1,140 447 64 525 21 159 14 29 27 1 2 0 0 86 395 26 22 154 154 51 19 0 0 0 0 15 819 68 4
vvi-miR395k CUGAAGUGUUUGGGGGAACUC 21 11,401 211 2,002 1    0 137 685 1,252 5 0 7 4 0 0 0 0 0 0 16 4 10 6 17 14 36 29 53 84 34 9 1 15 5 20 1,157 160 508 231 0 0 245 214 34 165 2,002 1,140 447 64 525 21 159 14 29 27 1 2 0 0 86 395 26 22 154 154 51 19 0 0 0 0 15 819 68 4
vvi-miR395l CUGAAGUGUUUGGGGGAACUC 21 11,401 211 2,002 1    0 137 685 1,252 5 0 7 4 0 0 0 0 0 0 16 4 10 6 17 14 36 29 53 84 34 9 1 15 5 20 1,157 160 508 231 0 0 245 214 34 165 2,002 1,140 447 64 525 21 159 14 29 27 1 2 0 0 86 395 26 22 154 154 51 19 0 0 0 0 15 819 68 4
vvi-miR395m CUGAAGUGUUUGGGGGAACUC 21 11,401 211 2,002 1    0 137 685 1,252 5 0 7 4 0 0 0 0 0 0 16 4 10 6 17 14 36 29 53 84 34 9 1 15 5 20 1,157 160 508 231 0 0 245 214 34 165 2,002 1,140 447 64 525 21 159 14 29 27 1 2 0 0 86 395 26 22 154 154 51 19 0 0 0 0 15 819 68 4
vvi-miR395n CUGAAGAGUCUGGAGGAACUC 21 5 5 5 5    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR396a UUCCACAGCUUUCUUGAACUA 21 30,008 455 2,723 1    0 8 236 173 5 6 1,992 2,723 1,524 871 155 108 30 95 519 161 20 342 168 259 453 289 577 2,362 2,262 2,581 495 829 342 88 125 103 145 165 0 12 193 474 454 233 987 791 462 1,830 411 72 874 310 32 29 18 36 15 2 4 205 47 391 505 755 254 131 107 66 0 87 1 0 8 1
vvi-miR396b UUCCACAGCUUUCUUGAACU 20 35,954 521 4,889 3    103 52 996 489 36 24 123 147 135 96 191 235 32 88 736 403 49 401 1,265 2,788 443 595 155 321 612 1,724 4,889 2,539 2,549 991 11 38 73 42 40 59 137 363 403 87 648 247 206 748 79 289 213 100 8 11 14 30 25 43 86 247 117 569 361 493 364 415 394 311 1,355 4,064 3 42 0 12
vvi-miR396c UUCCACAGCUUUCUUGAACUG 21 106,631 1,568 28,159 2    211 142 12,726 28,159 88 30 55 141 841 1,029 53 45 34 18 8,643 2,943 792 2,681 2,951 4,487 4,560 14,546 456 1,437 1,006 781 836 2,128 1,620 896 11 2 0 15 0 35 235 631 336 137 367 270 121 475 70 140 239 144 6 12 13 32 10 14 100 552 1,298 1,636 260 561 298 399 448 274 410 956 74 2 40 1,673
vvi-miR396d UUCCACAGCUUUCUUGAACUG 21 106,631 1,568 28,159 2    211 142 12,726 28,159 88 30 55 141 841 1,029 53 45 34 18 8,643 2,943 792 2,681 2,951 4,487 4,560 14,546 456 1,437 1,006 781 836 2,128 1,620 896 11 2 0 15 0 35 235 631 336 137 367 270 121 475 70 140 239 144 6 12 13 32 10 14 100 552 1,298 1,636 260 561 298 399 448 274 410 956 74 2 40 1,673
vvi-miR397a UCAUUGAGUGCAGCGUUGAUG 21 17,730 467 7,585 1    0 0 1 0 10 6 3 0 1 3 0 0 4 0 4 0 0 0 0 0 1 3 0 0 11 5 18 8 11 2 6 20 0 38 8 22 0 2 13 0 0 4 0 0 2 0 0 0 1 0 0 0 0 0 0 6 67 82 13 4 13 19 8 0 5,813 7,585 0 0 851 3,062
vvi-miR398a UGUGUUCUCAGGUCACCCCUU 21 63 6 26 1    0 0 26 4 0 0 0 0 1 0 0 0 0 5 0 0 0 0 0 0 4 4 0 5 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 5 0 0 0 0 0 0 5 0
vvi-miR398b UGUGUUCUCAGGUCGCCCCUG 21 289,538 4,196 160,568 5    0 76 947 1,324 239 131 82 29 23 20 21 21 23 50 51 37 39 129 26 5 77 101 175 172 382 313 167 160 201 462 2,690 3,624 10,226 8,992 61 99 49 201 95 92 2,537 1,368 58 18 33 9 199 35 12 17 39 16 9 5 90 286 459 327 187 640 119 33 77 46 85,326 160,568 84 270 761 4,298
vvi-miR398c UGUGUUCUCAGGUCGCCCCUG 21 289,538 4,196 160,568 5    0 76 947 1,324 239 131 82 29 23 20 21 21 23 50 51 37 39 129 26 5 77 101 175 172 382 313 167 160 201 462 2,690 3,624 10,226 8,992 61 99 49 201 95 92 2,537 1,368 58 18 33 9 199 35 12 17 39 16 9 5 90 286 459 327 187 640 119 33 77 46 85,326 160,568 84 270 761 4,298
vvi-miR399a UGCCAAAGGAGAAUUGCCCUG 21 354 17 155 1    0 0 2 0 0 0 5 3 0 0 0 0 2 0 0 0 0 0 0 0 5 3 13 5 2 1 1 0 0 0 0 0 0 0 0 0 0 6 0 3 0 0 0 6 0 0 0 7 1 1 0 0 0 0 0 0 0 2 0 0 0 0 0 0 125 0 0 0 155 6
vvi-miR399b UGCCAAAGGAGAGUUGCCCUG 21 961 46 285 1    0 0 0 0 0 0 2 5 0 0 0 2 0 4 0 0 0 0 0 0 1 0 2 0 33 15 0 1 0 0 18 39 73 106 0 0 0 1 0 0 0 6 0 0 0 0 0 0 0 6 0 0 0 0 0 3 0 0 0 0 0 0 0 0 285 217 0 0 118 24
vvi-miR399c UGCCAAAGGAGAGUUGCCCUG 21 961 46 285 1    0 0 0 0 0 0 2 5 0 0 0 2 0 4 0 0 0 0 0 0 1 0 2 0 33 15 0 1 0 0 18 39 73 106 0 0 0 1 0 0 0 6 0 0 0 0 0 0 0 6 0 0 0 0 0 3 0 0 0 0 0 0 0 0 285 217 0 0 118 24
vvi-miR399d UGCCAAAGGAGAUUUGCUCGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR399e UGCCAAAGGAGAUUUGCCCGG 21 13 4 9 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 9 3
vvi-miR399f UGCCGAAGGAGAUUUGUCCUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR399g UGCCAAAGGAGAUUUGCCCCU 21 31 16 30 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 30 0
vvi-miR399h UGCCAAAGGAGAAUUGCCCUG 21 354 17 155 1    0 0 2 0 0 0 5 3 0 0 0 0 2 0 0 0 0 0 0 0 5 3 13 5 2 1 1 0 0 0 0 0 0 0 0 0 0 6 0 3 0 0 0 6 0 0 0 7 1 1 0 0 0 0 0 0 0 2 0 0 0 0 0 0 125 0 0 0 155 6
vvi-miR399i CGCCAAAGGAGAGUUGCCCUG 21 7,116 111 1,160 2    0 6 6 18 10 6 67 29 17 38 0 11 7 5 80 35 49 239 39 5 69 66 16 14 40 18 47 40 8 16 304 254 1,160 882 0 0 96 98 95 276 141 143 25 133 142 0 177 116 143 205 7 39 44 5 49 165 88 120 11 33 2 14 8 29 464 65 24 0 463 95
vvi-miR403a UUAGAUUCACGCACAAACUCG 21 203,823 2,912 16,715 19    219 119 2,117 2,661 328 382 2,517 1,789 16,715 8,746 3,987 3,182 2,304 6,719 3,293 4,612 381 8,361 1,795 4,557 7,282 8,142 870 3,032 2,668 1,714 9,631 8,335 7,497 4,723 178 519 290 373 366 1,129 539 2,255 1,375 334 1,494 2,280 2,069 5,792 1,322 3,073 7,842 10,107 500 368 432 921 648 772 49 739 1,778 4,530 1,216 1,417 2,217 2,151 2,515 2,079 2,354 5,672 451 19 995 1,985
vvi-miR403b UUAGAUUCACGCACAAACUCG 21 203,823 2,912 16,715 19    219 119 2,117 2,661 328 382 2,517 1,789 16,715 8,746 3,987 3,182 2,304 6,719 3,293 4,612 381 8,361 1,795 4,557 7,282 8,142 870 3,032 2,668 1,714 9,631 8,335 7,497 4,723 178 519 290 373 366 1,129 539 2,255 1,375 334 1,494 2,280 2,069 5,792 1,322 3,073 7,842 10,107 500 368 432 921 648 772 49 739 1,778 4,530 1,216 1,417 2,217 2,151 2,515 2,079 2,354 5,672 451 19 995 1,985
vvi-miR403c UUAGAUUCACGCACAAACUCG 21 203,823 2,912 16,715 19    219 119 2,117 2,661 328 382 2,517 1,789 16,715 8,746 3,987 3,182 2,304 6,719 3,293 4,612 381 8,361 1,795 4,557 7,282 8,142 870 3,032 2,668 1,714 9,631 8,335 7,497 4,723 178 519 290 373 366 1,129 539 2,255 1,375 334 1,494 2,280 2,069 5,792 1,322 3,073 7,842 10,107 500 368 432 921 648 772 49 739 1,778 4,530 1,216 1,417 2,217 2,151 2,515 2,079 2,354 5,672 451 19 995 1,985
vvi-miR403d UUAGAUUCACGCACAAACUCG 21 203,823 2,912 16,715 19    219 119 2,117 2,661 328 382 2,517 1,789 16,715 8,746 3,987 3,182 2,304 6,719 3,293 4,612 381 8,361 1,795 4,557 7,282 8,142 870 3,032 2,668 1,714 9,631 8,335 7,497 4,723 178 519 290 373 366 1,129 539 2,255 1,375 334 1,494 2,280 2,069 5,792 1,322 3,073 7,842 10,107 500 368 432 921 648 772 49 739 1,778 4,530 1,216 1,417 2,217 2,151 2,515 2,079 2,354 5,672 451 19 995 1,985
vvi-miR403e UUAGAUUCACGCACAAACUCG 21 203,823 2,912 16,715 19    219 119 2,117 2,661 328 382 2,517 1,789 16,715 8,746 3,987 3,182 2,304 6,719 3,293 4,612 381 8,361 1,795 4,557 7,282 8,142 870 3,032 2,668 1,714 9,631 8,335 7,497 4,723 178 519 290 373 366 1,129 539 2,255 1,375 334 1,494 2,280 2,069 5,792 1,322 3,073 7,842 10,107 500 368 432 921 648 772 49 739 1,778 4,530 1,216 1,417 2,217 2,151 2,515 2,079 2,354 5,672 451 19 995 1,985
vvi-miR403f UUAGAUUCACGCACAAACUCG 21 203,823 2,912 16,715 19    219 119 2,117 2,661 328 382 2,517 1,789 16,715 8,746 3,987 3,182 2,304 6,719 3,293 4,612 381 8,361 1,795 4,557 7,282 8,142 870 3,032 2,668 1,714 9,631 8,335 7,497 4,723 178 519 290 373 366 1,129 539 2,255 1,375 334 1,494 2,280 2,069 5,792 1,322 3,073 7,842 10,107 500 368 432 921 648 772 49 739 1,778 4,530 1,216 1,417 2,217 2,151 2,515 2,079 2,354 5,672 451 19 995 1,985
vvi-miR408 AUGCACUGCCUCUUCCCUGGC 21 72,724 1,212 41,120 1    0 1 286 199 21 84 2 27 11 0 18 11 2 59 54 40 0 0 6 48 40 40 11 112 105 249 480 673 407 199 2 46 73 30 7 0 2 8 51 0 874 365 28 34 13 119 67 54 0 3 1 6 14 0 0 12 205 398 41 209 233 109 125 116 15,639 41,120 71 0 4,581 4,883
vvi-miR477a AUCUCCCUCAAAGGCUUCCAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR477b-3p CGAAGUCUUUGGGGAGAGUGG 21 1,521 36 398 1    0 6 242 398 0 0 8 1 0 0 0 4 0 0 14 4 0 0 6 0 7 14 2 5 11 11 6 5 4 0 0 7 0 0 0 0 20 16 21 0 28 13 146 125 114 0 55 95 1 1 1 1 0 0 0 10 10 16 26 20 13 14 0 0 0 0 11 0 9 0
vvi-miR477b-5p ACUCUUUCUCAAGGGCUUCUAG 22 18 2 4 1    0 0 1 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 2 0 0 0 4 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 2
vvi-miR479 UGUGGUAUUGGUUCGGCUCAUC 22 8,503 135 530 1    0 20 1 1 0 0 62 28 242 199 194 347 37 165 530 285 10 6 399 466 406 250 249 139 90 105 74 111 120 131 299 309 218 289 0 9 323 303 65 28 28 39 46 38 35 30 42 180 18 26 2 6 2 0 37 363 131 209 178 37 75 57 125 0 89 43 39 0 61 57
vvi-miR482 UCUUUCCUACUCCUCCCAUUCC 22 324,188 4,631 35,034 39    149 39 1,684 1,232 104 233 1,461 3,080 10,480 23,958 5,286 7,274 3,839 10,335 3,252 5,836 1,310 9,058 5,838 18,336 9,145 12,325 3,600 8,230 5,739 7,391 8,066 22,113 35,034 17,976 633 1,398 2,393 2,168 282 651 713 3,490 2,952 609 3,130 3,433 441 1,641 811 455 1,815 2,155 157 150 295 368 331 251 51 842 7,035 4,725 3,478 3,907 4,259 7,003 6,064 3,873 1,302 5,672 698 252 314 1,588
vvi-miR535a UGACAACGAGAGAGAGCACGC 21 86,747 1,257 44,206 4    0 11 589 490 1,118 1,387 236 63 166 152 48 52 12 32 83 90 20 349 63 36 78 36 87 219 123 111 891 427 286 131 44 88 73 42 177 302 5 20 275 34 395 155 414 855 376 94 1,141 1,005 155 35 180 272 304 43 4 144 67 892 469 539 261 228 168 66 2,532 4,847 300 38 44,206 18,116
vvi-miR535b UGACAACGAGAGAGAGCACGC 21 86,747 1,257 44,206 4    0 11 589 490 1,118 1,387 236 63 166 152 48 52 12 32 83 90 20 349 63 36 78 36 87 219 123 111 891 427 286 131 44 88 73 42 177 302 5 20 275 34 395 155 414 855 376 94 1,141 1,005 155 35 180 272 304 43 4 144 67 892 469 539 261 228 168 66 2,532 4,847 300 38 44,206 18,116
vvi-miR535c UGACAACGAGAGAGAGCACGC 21 86,747 1,257 44,206 4    0 11 589 490 1,118 1,387 236 63 166 152 48 52 12 32 83 90 20 349 63 36 78 36 87 219 123 111 891 427 286 131 44 88 73 42 177 302 5 20 275 34 395 155 414 855 376 94 1,141 1,005 155 35 180 272 304 43 4 144 67 892 469 539 261 228 168 66 2,532 4,847 300 38 44,206 18,116
vvi-miR828a UCUUGCUCAAAUGAGUAUUCCA 22 33 3 7 1    0 0 2 0 0 0 0 4 3 4 0 0 0 0 0 1 0 0 0 7 1 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 6 0
vvi-miR845a UAGCUCUGAUACCAAUUGAUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR845b UAGCUCUGAUACCAAUUGAUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR845c AGGCUCUGAUACCAAUUGAUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR845d UGGCUCUGAUACCAAUUGAUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR845e UGGCUCUGAUACCAAUUGAUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0