Grape Small RNA miRNA Abundances

The data below are based on the microRNAs listed in the Sanger registry. Adjust libraries/reads to display on the control panel.


        miRNA         miRNA sequence Len Sum (norm) Average Max Min (>0)  Mont_CS_ps_1Mont_CS_ps_2Mont_CS_bc_1Mont_CS_bc_2Mont_CS_19_1Mont_CS_19_2Mont_CS_hv_1Mont_CS_hv_2Mont_SG_ps_1Mont_SG_ps_2Mont_SG_bc_1Mont_SG_bc_2Mont_SG_19_1Mont_SG_19_2Mont_SG_hv_1Mont_SG_hv_2Bol_CS_ps_1Bol_CS_ps_2Bol_CS_bc_1Bol_CS_bc_2Bol_CS_19_1Bol_CS_19_2Bol_CS_hv_1Bol_CS_hv_2Bol_SG_ps_1Bol_SG_ps_2Bol_SG_bc_1Bol_SG_bc_2Bol_SG_19_1Bol_SG_19_2Bol_SG_hv_1Bol_SG_hv_2Ric_CS_ps_1Ric_CS_ps_2Ric_CS_bc_1Ric_CS_bc_2Ric_CS_19_1Ric_CS_19_2Ric_CS_hv_1Ric_CS_hv_2Ric_SG_ps_1Ric_SG_ps_2Ric_SG_bc_1Ric_SG_bc_2Ric_SG_19_1Ric_SG_19_2Ric_SG_hv_1Ric_SG_hv_2
vvi-miR156a UGACAGAAGAGAGGGAGCAC 20 4 0 1 1    1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR156b UGACAGAAGAGAGUGAGCAC 20 10,561 220 738 31    214 67 236 546 128 348 106 53 116 82 42 99 168 162 73 108 382 153 204 567 334 468 182 303 251 249 207 0 31 45 83 42 528 355 738 227 178 114 273 179 332 111 336 326 464 160 73 118
vvi-miR156c UGACAGAAGAGAGUGAGCAC 20 10,561 220 738 31    214 67 236 546 128 348 106 53 116 82 42 99 168 162 73 108 382 153 204 567 334 468 182 303 251 249 207 0 31 45 83 42 528 355 738 227 178 114 273 179 332 111 336 326 464 160 73 118
vvi-miR156d UGACAGAAGAGAGUGAGCAC 20 10,561 220 738 31    214 67 236 546 128 348 106 53 116 82 42 99 168 162 73 108 382 153 204 567 334 468 182 303 251 249 207 0 31 45 83 42 528 355 738 227 178 114 273 179 332 111 336 326 464 160 73 118
vvi-miR156e UGACAGAGGAGAGUGAGCAC 20 234 5 43 1    13 0 0 3 2 0 0 0 4 0 0 0 14 8 0 1 0 0 4 11 4 1 2 1 2 5 2 0 0 9 22 5 4 0 7 0 0 1 4 2 2 1 5 0 43 5 31 16
vvi-miR156f UUGACAGAAGAUAGAGAGCAC 21 26,445 551 2,933 9    130 9 95 206 832 1,683 538 739 25 52 16 12 489 581 465 649 139 158 77 210 1,035 2,659 666 2,933 111 94 97 0 316 476 666 247 334 190 184 120 1,357 874 1,762 1,212 65 69 101 121 1,651 1,096 536 368
vvi-miR156g UUGACAGAAGAUAGAGAGCAC 21 26,445 551 2,933 9    130 9 95 206 832 1,683 538 739 25 52 16 12 489 581 465 649 139 158 77 210 1,035 2,659 666 2,933 111 94 97 0 316 476 666 247 334 190 184 120 1,357 874 1,762 1,212 65 69 101 121 1,651 1,096 536 368
vvi-miR156h UGACAGAAGAGAGAGAGCAU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR156i UUGACAGAAGAUAGAGAGCAC 21 26,445 551 2,933 9    130 9 95 206 832 1,683 538 739 25 52 16 12 489 581 465 649 139 158 77 210 1,035 2,659 666 2,933 111 94 97 0 316 476 666 247 334 190 184 120 1,357 874 1,762 1,212 65 69 101 121 1,651 1,096 536 368
vvi-miR159a CUUGGAGUGAAGGGAGCUCUC 21 18 0 8 1    4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 8 0 0 0 0 1 2 1 0 0 0 0 0 0 0 0
vvi-miR159b CUUGGAGUGAAGGGAGCUCUC 21 18 0 8 1    4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 8 0 0 0 0 1 2 1 0 0 0 0 0 0 0 0
vvi-miR159c UUUGGAUUGAAGGGAGCUCUA 21 198,072 4,127 13,021 30    10,410 1,902 1,826 7,591 4,265 9,819 2,369 2,319 1,552 1,180 299 1,352 2,839 8,882 4,558 3,411 3,168 4,994 2,243 13,021 7,168 3,816 2,280 4,322 2,666 2,979 4,824 30 738 3,188 4,638 3,191 3,531 2,537 2,105 693 10,966 6,301 3,669 6,307 5,200 5,287 3,846 3,895 5,089 5,831 2,406 2,569
vvi-miR160a UGCCUGGCUCCCUGAAUGCCAUC 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR160b UGCCUGGCUCCCUGAAUGCCAUC 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR160c UGCCUGGCUCCCUGUAUGCCA 21 87 2 9 1    1 0 2 0 0 2 1 0 0 4 0 4 4 4 0 4 0 1 0 4 0 3 5 9 0 1 1 0 0 0 0 0 8 0 0 0 7 1 4 2 6 1 0 0 6 0 2 0
vvi-miR160d UGCCUGGCUCCCUGUAUGCCA 21 87 2 9 1    1 0 2 0 0 2 1 0 0 4 0 4 4 4 0 4 0 1 0 4 0 3 5 9 0 1 1 0 0 0 0 0 8 0 0 0 7 1 4 2 6 1 0 0 6 0 2 0
vvi-miR160e UGCCUGGCUCCCUGUAUGCCA 21 87 2 9 1    1 0 2 0 0 2 1 0 0 4 0 4 4 4 0 4 0 1 0 4 0 3 5 9 0 1 1 0 0 0 0 0 8 0 0 0 7 1 4 2 6 1 0 0 6 0 2 0
vvi-miR162 UCGAUAAACCUCUGCAUCCAG 21 130,641 2,722 8,119 40    5,433 772 787 4,018 1,039 8,119 912 1,266 1,611 4,896 425 901 6,793 3,611 2,454 3,599 4,220 3,452 1,511 3,734 2,563 5,418 2,472 4,840 2,886 1,091 1,612 40 722 826 846 594 7,047 1,403 4,825 2,078 2,433 1,039 4,655 2,168 4,169 751 2,302 2,503 6,580 3,543 572 1,110
vvi-miR164a UGGAGAAGCAGGGCACGUGCA 21 198 4 32 1    32 3 6 11 0 0 0 0 1 13 0 0 0 0 0 0 10 12 7 11 0 0 1 0 18 6 5 0 0 0 0 0 12 7 0 0 0 1 0 0 24 10 0 4 2 0 2 0
vvi-miR164b UGGAGAAGCAGGGCACAUGCU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR164c UGGAGAAGCAGGGCACGUGCA 21 198 4 32 1    32 3 6 11 0 0 0 0 1 13 0 0 0 0 0 0 10 12 7 11 0 0 1 0 18 6 5 0 0 0 0 0 12 7 0 0 0 1 0 0 24 10 0 4 2 0 2 0
vvi-miR164d UGGAGAAGCAGGGCACGUGCA 21 198 4 32 1    32 3 6 11 0 0 0 0 1 13 0 0 0 0 0 0 10 12 7 11 0 0 1 0 18 6 5 0 0 0 0 0 12 7 0 0 0 1 0 0 24 10 0 4 2 0 2 0
vvi-miR166a UCGGACCAGGCUUCAUUCC 19 19,826 413 1,936 5    271 122 313 177 132 216 201 186 1,162 861 553 141 574 106 459 255 1,206 516 321 217 730 541 401 354 1,936 426 446 5 422 143 181 76 1,520 442 294 507 155 62 396 161 869 529 161 138 453 181 178 130
vvi-miR166b UCGGACCAGGCUUCAUUCC 19 19,826 413 1,936 5    271 122 313 177 132 216 201 186 1,162 861 553 141 574 106 459 255 1,206 516 321 217 730 541 401 354 1,936 426 446 5 422 143 181 76 1,520 442 294 507 155 62 396 161 869 529 161 138 453 181 178 130
vvi-miR166c UCGGACCAGGCUUCAUUCCCC 21 17,706,997 368,896 975,545 1,602    323,782 115,768 303,704 495,943 293,402 413,372 162,567 175,592 214,677 292,087 138,704 202,906 396,264 219,481 240,845 384,434 491,028 358,363 379,057 545,570 590,504 857,361 222,589 371,641 483,033 220,493 899,210 1,602 202,288 273,066 209,948 116,038 975,545 244,619 970,368 433,932 318,477 132,855 667,358 238,006 380,120 242,185 519,283 717,415 658,197 296,930 190,489 125,899
vvi-miR166d UCGGACCAGGCUUCAUUCCCC 21 17,706,997 368,896 975,545 1,602    323,782 115,768 303,704 495,943 293,402 413,372 162,567 175,592 214,677 292,087 138,704 202,906 396,264 219,481 240,845 384,434 491,028 358,363 379,057 545,570 590,504 857,361 222,589 371,641 483,033 220,493 899,210 1,602 202,288 273,066 209,948 116,038 975,545 244,619 970,368 433,932 318,477 132,855 667,358 238,006 380,120 242,185 519,283 717,415 658,197 296,930 190,489 125,899
vvi-miR166e UCGGACCAGGCUUCAUUCCCC 21 17,706,997 368,896 975,545 1,602    323,782 115,768 303,704 495,943 293,402 413,372 162,567 175,592 214,677 292,087 138,704 202,906 396,264 219,481 240,845 384,434 491,028 358,363 379,057 545,570 590,504 857,361 222,589 371,641 483,033 220,493 899,210 1,602 202,288 273,066 209,948 116,038 975,545 244,619 970,368 433,932 318,477 132,855 667,358 238,006 380,120 242,185 519,283 717,415 658,197 296,930 190,489 125,899
vvi-miR166f UCGGACCAGGCUUCAUUCCCC 21 17,706,997 368,896 975,545 1,602    323,782 115,768 303,704 495,943 293,402 413,372 162,567 175,592 214,677 292,087 138,704 202,906 396,264 219,481 240,845 384,434 491,028 358,363 379,057 545,570 590,504 857,361 222,589 371,641 483,033 220,493 899,210 1,602 202,288 273,066 209,948 116,038 975,545 244,619 970,368 433,932 318,477 132,855 667,358 238,006 380,120 242,185 519,283 717,415 658,197 296,930 190,489 125,899
vvi-miR166g UCGGACCAGGCUUCAUUCCCC 21 17,706,997 368,896 975,545 1,602    323,782 115,768 303,704 495,943 293,402 413,372 162,567 175,592 214,677 292,087 138,704 202,906 396,264 219,481 240,845 384,434 491,028 358,363 379,057 545,570 590,504 857,361 222,589 371,641 483,033 220,493 899,210 1,602 202,288 273,066 209,948 116,038 975,545 244,619 970,368 433,932 318,477 132,855 667,358 238,006 380,120 242,185 519,283 717,415 658,197 296,930 190,489 125,899
vvi-miR166h UCGGACCAGGCUUCAUUCCCC 21 17,706,997 368,896 975,545 1,602    323,782 115,768 303,704 495,943 293,402 413,372 162,567 175,592 214,677 292,087 138,704 202,906 396,264 219,481 240,845 384,434 491,028 358,363 379,057 545,570 590,504 857,361 222,589 371,641 483,033 220,493 899,210 1,602 202,288 273,066 209,948 116,038 975,545 244,619 970,368 433,932 318,477 132,855 667,358 238,006 380,120 242,185 519,283 717,415 658,197 296,930 190,489 125,899
vvi-miR167a UGAAGCUGCCAGCAUGAUCUG 21 4,888 102 679 2    177 70 47 53 27 23 18 15 254 508 93 54 53 24 6 18 82 177 36 50 12 32 2 22 679 297 42 2 18 7 19 23 428 436 59 111 23 21 7 17 349 346 35 33 38 33 6 6
vvi-miR167b UGAAGCUGCCAGCAUGAUCUA 21 152 3 22 1    6 0 0 0 6 1 1 4 4 9 0 8 6 0 0 4 7 0 0 0 0 0 7 22 4 7 2 0 0 0 4 0 9 0 0 0 6 3 9 4 4 3 0 1 8 3 0 0
vvi-miR167c UGAAGCUGCCAGCAUGAUCUC 21 9,995 208 1,180 1    990 730 148 525 159 133 26 99 215 1,180 58 190 24 16 0 13 516 896 129 299 34 84 23 95 711 334 80 1 9 40 16 3 873 395 275 132 48 22 35 26 149 93 49 72 15 8 17 10
vvi-miR167d UGAAGCUGCCAGCAUGAUCUA 21 152 3 22 1    6 0 0 0 6 1 1 4 4 9 0 8 6 0 0 4 7 0 0 0 0 0 7 22 4 7 2 0 0 0 4 0 9 0 0 0 6 3 9 4 4 3 0 1 8 3 0 0
vvi-miR167e UGAAGCUGCCAGCAUGAUCUA 21 152 3 22 1    6 0 0 0 6 1 1 4 4 9 0 8 6 0 0 4 7 0 0 0 0 0 7 22 4 7 2 0 0 0 4 0 9 0 0 0 6 3 9 4 4 3 0 1 8 3 0 0
vvi-miR168 UCGCUUGGUGCAGGUCGGGAA 21 43,158 899 2,237 1    950 815 204 1,086 519 1,564 440 623 408 1,124 97 918 669 2,055 838 829 1,857 709 313 1,173 1,373 1,060 997 980 604 1,223 751 1 56 171 644 380 1,961 714 1,339 235 1,534 294 2,237 1,330 1,778 366 1,969 1,080 1,595 708 295 292
vvi-miR169a CAGCCAAGGAUGACUUGCCGG 21 5 0 2 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 2 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR169b UGAGCCAAGGAUGGCUUGCCG 21 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0
vvi-miR169c CAGCCAAGGAUGACUUGCCGG 21 5 0 2 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 2 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR169d CAGCCAAGAAUGAUUUGCCGG 21 97 2 16 1    3 0 2 0 6 1 5 6 1 4 0 0 0 0 0 0 0 3 0 0 5 0 2 4 0 1 0 0 0 0 0 0 8 6 2 0 16 8 4 8 1 0 0 1 0 0 0 0
vvi-miR169e UAGCCAAGGAUGACUUGCCUGC 22 2 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR169f CAGCCAAGGAUGACUUGCCGA 21 13 0 4 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 4 0 0 0 0 0 0 0 0 4 0 0 0 0 0 0 1 0 1 0 2 0 0 0 0
vvi-miR169g CAGCCAAGGAUGACUUGCCGA 21 13 0 4 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 4 0 0 0 0 0 0 0 0 4 0 0 0 0 0 0 1 0 1 0 2 0 0 0 0
vvi-miR169h UGAGCCAAGGAUGGCUUGCCG 21 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0
vvi-miR169i GAGCCAAGGAUGACUGGCCGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR169j CAGCCAAGGAUGACUUGCCGG 21 5 0 2 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 2 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR169k CAGCCAAGGAUGACUUGCCGG 21 5 0 2 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 2 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR169l GAGCCAAGGAUGACUUGCCGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR169m GAGCCAAGGAUGACUUGCCGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR169n GAGCCAAGGAUGACUUGCCGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR169o GAGCCAAGGAUGACUUGCCGC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR169p GAGCCAAGGAUGACUUGCCGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR169q GAGCCAAGGAUGACUUGCCGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR169r UGAGUCAAGGAUGACUUGCCG 21 11 0 4 1    0 0 0 0 2 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 0 0 0 0 0 0 1 0 0 0 0 2 0 0 0
vvi-miR169s CAGCCAAGGAUGACUUGCCGG 21 5 0 2 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 2 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR169t CGAGUCAAGGAUGACUUGCCG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR169u UGAGUCAAGGAUGACUUGCCG 21 11 0 4 1    0 0 0 0 2 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 0 0 0 0 0 0 1 0 0 0 0 2 0 0 0
vvi-miR169v AAGCCAAGGAUGAAUUGCCGG 21 10 0 3 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 1 0 0 0 0 0 0 0 3 0 0
vvi-miR169w CAGCCAAGGAUGACUUGCCGG 21 5 0 2 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 2 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR169x UAGCCAAGGAUGACUUGCCUA 21 13 0 4 1    0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 0 0 0 0 0 0 4 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 2 0
vvi-miR169y UAGCGAAGGAUGACUUGCCUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR171a UGAUUGAGCCGUGCCAAUAUC 21 811 17 138 1    53 9 4 3 10 11 9 27 14 138 3 17 4 12 6 15 7 31 4 1 10 1 2 85 23 15 3 0 5 16 13 8 34 1 12 0 1 7 17 17 51 5 11 12 45 13 18 8
vvi-miR171b UGAUUGAGCCGCGUCAAUAUC 21 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR171c UGAUUGAGCCGUGCCAAUAUC 21 811 17 138 1    53 9 4 3 10 11 9 27 14 138 3 17 4 12 6 15 7 31 4 1 10 1 2 85 23 15 3 0 5 16 13 8 34 1 12 0 1 7 17 17 51 5 11 12 45 13 18 8
vvi-miR171d UGAUUGAGCCGUGCCAAUAUC 21 811 17 138 1    53 9 4 3 10 11 9 27 14 138 3 17 4 12 6 15 7 31 4 1 10 1 2 85 23 15 3 0 5 16 13 8 34 1 12 0 1 7 17 17 51 5 11 12 45 13 18 8
vvi-miR171e UGAUUGAGCCGCGCCAAUAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR171f UUGAGCCGCGCCAAUAUCACU 21 47 1 14 1    14 0 0 0 0 0 0 0 3 0 0 0 0 0 0 0 0 9 2 0 0 0 0 0 2 1 0 0 0 0 0 0 7 0 0 0 0 0 0 1 4 4 0 0 0 0 0 0
vvi-miR171g UUGAGCCGAACCAAUAUCACC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR171h UGGUUGAGCCGCGCCAAUAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR171i UGAUUGAGCCGUGCCAAUAUC 21 811 17 138 1    53 9 4 3 10 11 9 27 14 138 3 17 4 12 6 15 7 31 4 1 10 1 2 85 23 15 3 0 5 16 13 8 34 1 12 0 1 7 17 17 51 5 11 12 45 13 18 8
vvi-miR171j UGAUUGAGCCGUGCCAAUAUC 21 811 17 138 1    53 9 4 3 10 11 9 27 14 138 3 17 4 12 6 15 7 31 4 1 10 1 2 85 23 15 3 0 5 16 13 8 34 1 12 0 1 7 17 17 51 5 11 12 45 13 18 8
vvi-miR172a UGAAUCUUGAUGAUGCUACAU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR172b UGAAUCUUGAUGAUGCUACAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR172c GGAAUCUUGAUGAUGCUGCAG 21 113 2 18 1    18 0 0 0 10 1 0 0 3 4 0 0 0 0 0 0 5 9 1 3 0 0 0 8 11 18 0 0 0 0 0 0 8 1 2 0 0 2 0 2 1 2 0 4 0 0 0 0
vvi-miR172d UGAGAAUCUUGAUGAUGCUGCAU 23 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR2111-3p GUCCUCUGGUUGCAGAUUACU 21 95 2 14 1    0 3 0 3 2 5 2 6 0 9 0 0 0 0 0 1 1 0 1 2 0 3 0 14 2 4 0 0 0 5 0 0 0 0 0 0 7 1 0 6 1 0 3 0 4 9 0 1
vvi-miR2111-5p UAAUCUGCAUCCUGAGGUCUA 21 1,476 31 124 2    27 3 4 37 56 64 26 40 6 22 0 21 24 53 12 41 7 6 30 42 45 56 58 51 7 7 29 0 4 5 29 18 8 7 29 29 92 50 77 124 6 14 22 40 45 86 2 15
vvi-miR2950-3p UGGUGUGCACGGGAUGGAAUA 21 581 12 65 1    0 3 2 8 10 18 3 2 2 0 6 4 38 65 12 16 3 1 13 6 0 49 21 6 7 6 0 3 15 9 6 8 7 5 17 21 18 4 48 11 11 1 27 6 49 6 4 4
vvi-miR2950-5p UUCCAUCUCUUGCACACUGGA 21 3,176 66 243 3    48 37 31 74 130 93 51 190 21 177 3 54 119 118 31 123 44 45 57 67 30 124 72 140 42 46 65 0 27 30 35 8 194 16 145 62 28 19 94 32 40 16 22 27 243 86 11 9
vvi-miR319b UUGGACUGAAGGGAGCUCCCU 21 5,650 118 1,224 1    1,224 208 25 21 12 8 0 0 137 22 0 0 4 24 0 5 1,117 600 44 66 3 7 8 3 72 250 21 0 2 5 7 3 504 494 115 49 6 7 4 16 127 298 25 68 8 30 0 1
vvi-miR319c UUGGACUGAAGGGAGCUCCCU 21 5,650 118 1,224 1    1,224 208 25 21 12 8 0 0 137 22 0 0 4 24 0 5 1,117 600 44 66 3 7 8 3 72 250 21 0 2 5 7 3 504 494 115 49 6 7 4 16 127 298 25 68 8 30 0 1
vvi-miR319e UUUGGACUGAAGGGAGCUCCU 21 40,107 836 2,642 20    549 241 265 1,007 1,111 2,199 559 656 150 495 125 897 556 2,185 147 899 333 362 208 1,418 852 1,231 324 1,356 174 325 908 20 196 1,225 1,145 680 550 277 819 214 2,553 977 1,489 1,084 476 528 1,069 1,667 2,642 2,539 293 132
vvi-miR319f UUGGACUGAAGGGAGCUCCCU 21 5,650 118 1,224 1    1,224 208 25 21 12 8 0 0 137 22 0 0 4 24 0 5 1,117 600 44 66 3 7 8 3 72 250 21 0 2 5 7 3 504 494 115 49 6 7 4 16 127 298 25 68 8 30 0 1
vvi-miR319g UUGGACUGAAGGGAGCUCCCA 21 56 1 14 1    13 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 6 2 0 0 0 0 0 0 4 1 0 0 0 0 0 0 14 11 0 0 0 0 0 0 0 2 0 0 0 0 0 0
vvi-miR3623-3p UGGUGCUUGGACGAAUUUGCUA 22 2,093 44 283 2    10 0 8 45 21 86 21 10 8 4 3 4 38 97 37 62 40 12 26 43 283 48 167 139 12 10 95 2 9 7 10 16 26 12 37 21 32 22 138 77 41 6 57 60 105 29 22 35
vvi-miR3623-5p UCACAAGUUCAUCCAAGCACCA 22 108,278 2,256 7,238 105    635 116 1,324 4,833 1,827 6,364 2,222 3,437 105 469 280 5,295 2,455 4,638 1,095 3,600 154 242 1,593 4,722 2,556 3,228 3,808 4,281 205 180 1,383 0 380 967 2,402 1,849 389 184 2,063 808 3,070 1,938 6,271 6,290 464 668 1,410 3,316 7,238 5,012 1,223 1,289
vvi-miR3624-3p UCAGGGCAGCAGCAUACUACU 21 20,435 426 3,082 2    60 6 72 496 228 1,315 219 234 7 34 0 33 598 1,312 361 1,489 60 71 59 128 593 502 374 543 63 40 109 2 131 282 899 643 143 38 159 41 601 170 1,443 703 33 18 199 244 3,082 1,669 341 588
vvi-miR3624-5p UAGUAUGCUGCUGUCUUUAGA 21 5 0 2 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0
vvi-miR3625-3p CGGGAGAUGACUACUGGAAGC 21 409 9 20 1    14 9 6 13 12 13 4 4 8 13 3 12 4 20 0 4 20 16 4 9 1 8 4 12 11 15 7 0 16 14 8 5 18 13 10 0 10 6 2 4 8 6 8 5 15 9 2 4
vvi-miR3625-5p UUCCAGCAGUCAUCUCCAAGG 21 17 0 3 1    0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 2 1 2 0 3 0 0 0 1 0 0 0 0 0 0 3 0 0 0 0 1 0 0 1 0 0 2 0 0 0 0
vvi-miR3626-3p CUUCAAUUUCACAGCGACCAC 21 46 1 13 1    1 0 0 8 0 2 0 0 0 0 0 0 0 0 0 1 0 2 0 5 0 0 0 1 5 0 0 0 0 0 0 0 1 0 5 0 0 1 0 0 0 0 0 0 13 1 0 0
vvi-miR3626-5p GGUAGUCGCUGUGAAAUUGAA 21 55 1 7 1    1 0 0 0 2 1 0 4 1 4 0 0 0 0 0 2 1 2 0 2 0 4 0 1 7 1 2 0 0 2 0 0 3 3 0 0 1 1 2 3 1 1 0 0 2 1 0 0
vvi-miR3627-3p UCGCCGCUCUCCUGUGACAAG 21 12,342 257 1,686 1    413 235 208 1,142 352 265 44 253 33 146 3 8 95 110 12 55 427 1,167 187 416 113 444 91 185 558 467 36 1 40 136 42 52 1,686 492 687 317 109 63 492 128 68 33 30 106 190 107 13 85
vvi-miR3627-5p UUGUCGCAGGAGAGACGGCACU 22 2,444 51 520 4    87 15 33 111 29 40 4 25 6 39 0 0 8 28 0 14 178 207 20 77 21 52 8 19 91 180 7 0 4 89 11 13 520 71 174 12 35 11 61 27 36 10 0 19 24 24 0 4
vvi-miR3628-3p CUAAGCACAGCUCUCGCAUCC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR3628-5p AUGCGAGAGCCGUGCUUAGUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR3629a-3p GGCUGCUGAGAAAAUGUAGGA 21 32 1 7 1    1 0 0 3 4 0 0 0 1 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 2 2 0 0 0 0 0 0 7 0 0 0 0 0 2 0 2 1 3 0 0 2 0 0
vvi-miR3629a-5p CGCAUUUUCUCAGCAGCCAAG 21 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR3629b GGCUGCUGAGAAAAUGUAGGA 21 32 1 7 1    1 0 0 3 4 0 0 0 1 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 2 2 0 0 0 0 0 0 7 0 0 0 0 0 2 0 2 1 3 0 0 2 0 0
vvi-miR3629c GGCUGCUGAGAAAAUGUAGGA 21 32 1 7 1    1 0 0 3 4 0 0 0 1 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 2 2 0 0 0 0 0 0 7 0 0 0 0 0 2 0 2 1 3 0 0 2 0 0
vvi-miR3630-3p UUUGGGAAUCUCUCUGAUGCAC 22 1,725 36 146 2    22 92 19 108 68 19 38 146 15 65 71 70 4 12 49 10 14 9 5 14 10 14 5 24 75 26 2 33 87 129 33 16 30 22 37 21 34 23 7 12 20 18 5 13 58 26 72 23
vvi-miR3630-5p UGCAAGUGACGAUAUCAGACA 21 264 6 25 1    5 0 2 13 2 6 7 2 3 4 0 4 6 0 24 9 0 6 4 5 10 14 3 10 4 1 4 0 2 5 2 0 3 5 0 25 16 7 17 5 3 1 0 0 6 11 2 6
vvi-miR3631a-3p UAUAUUGGAUGAUGUCAACAA 21 2 0 2 2    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR3631a-5p CAUGUUGACAUCAUCCAAUAUA 22 14 0 4 1    0 0 0 0 0 2 0 0 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 0 0 1 0 0 2 4 0 0 0
vvi-miR3631b-3p UGUUGGAUGAUGUCAAUAAGU 21 87 2 11 1    0 0 2 0 0 1 0 11 1 4 0 0 0 0 0 4 6 0 0 0 0 4 0 9 0 4 2 0 4 7 6 0 1 1 0 0 1 1 0 1 2 2 3 0 4 0 4 2
vvi-miR3631b-5p CAUGUUGACAUCAUCCAAUAUA 22 14 0 4 1    0 0 0 0 0 2 0 0 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 0 0 1 0 0 2 4 0 0 0
vvi-miR3631c CAUGUUGACAUCAUCCAAUAUA 22 14 0 4 1    0 0 0 0 0 2 0 0 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 0 0 1 0 0 2 4 0 0 0
vvi-miR3631d CAUGUUGACAUCAUCCAAUAUA 22 14 0 4 1    0 0 0 0 0 2 0 0 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 0 0 1 0 0 2 4 0 0 0
vvi-miR3632-3p UUUCCCAGACCCCCAAUACCAA 22 1,578 33 177 1    74 0 8 103 23 78 5 6 18 4 13 54 12 81 6 45 14 48 22 112 27 17 24 8 54 52 23 0 1 2 16 5 39 23 47 8 35 12 37 58 46 32 30 177 23 37 7 12
vvi-miR3632-5p GGAUUGGGGGCCGAUGGAAAGG 22 887 18 139 2    52 18 6 5 4 10 2 0 19 9 0 0 10 8 0 6 41 64 6 6 4 4 0 9 139 137 2 0 7 14 8 3 47 47 20 45 7 3 4 5 39 18 11 24 6 12 4 2
vvi-miR3633a-3p UUCCUAUACCACCCAUUCCCUA 22 1,469 31 154 2    31 6 2 45 10 59 12 13 4 9 6 37 40 154 67 109 8 20 14 30 24 20 19 37 23 8 16 0 4 5 22 5 22 7 69 8 18 11 63 26 15 8 16 123 115 97 2 10
vvi-miR3633a-5p GGAAUGGAUGGUUAGGAGAG 20 45,786 954 5,108 42    1,790 534 847 696 263 431 144 42 1,222 353 589 521 247 402 587 224 4,218 2,219 739 1,287 178 205 203 212 2,738 5,108 1,645 44 115 70 181 169 2,451 3,331 1,212 2,329 250 203 313 327 1,539 796 1,768 1,889 352 178 282 343
vvi-miR3633b-3p GUUCCCAUGCCAUCCAUUCCUA 22 5,610 117 561 13    79 52 43 90 39 61 28 21 43 271 13 355 142 390 153 229 75 32 34 121 46 90 62 67 130 186 181 0 20 66 76 57 69 25 152 29 47 35 109 78 93 141 117 561 425 396 28 53
vvi-miR3633b-5p GGAAUGGGUGGCUGGGAUCUA 21 4,843 101 507 1    116 76 72 364 12 18 3 8 54 125 23 186 24 57 0 15 102 108 79 274 0 8 1 10 193 442 173 0 9 19 28 39 199 195 243 74 42 16 7 17 392 90 507 271 83 56 7 6
vvi-miR3634-3p UUUCCGACUCGCACUCAUGCCGU 23 753,254 15,693 45,955 6    22,339 2,656 6,191 20,447 7,653 36,297 5,985 4,267 4,225 4,590 956 6,924 40,305 42,096 27,540 15,785 33,082 15,007 13,669 26,481 45,955 21,398 28,838 17,443 9,848 8,278 22,135 6 3,173 2,855 5,598 3,644 19,834 6,931 27,332 10,080 13,049 7,951 23,115 15,151 12,918 3,568 18,176 19,149 33,827 24,550 3,610 8,347
vvi-miR3634-5p GGCAUAUGUGUGACGGAAAGA 21 1,563 33 269 1    53 21 21 8 6 5 1 6 82 26 3 8 8 8 12 11 66 80 5 18 0 10 0 12 202 269 18 0 5 0 4 3 181 86 29 21 7 4 7 10 145 43 30 12 8 3 4 2
vvi-miR3635-3p AUUAUGUCCCACACAUGCCUC 21 399 8 33 1    18 15 14 21 4 11 3 4 26 4 0 4 0 4 18 4 8 33 18 23 4 6 2 5 7 24 6 0 0 0 3 0 10 6 7 25 1 2 0 5 15 9 16 12 2 0 0 0
vvi-miR3635-5p GGCAUGUGUGGGGCAUAAUAG 21 289 6 66 3    12 3 0 0 0 0 0 0 14 30 0 0 0 0 0 0 26 33 0 0 0 0 0 0 47 66 0 0 0 0 0 0 12 8 0 0 0 0 0 0 27 4 3 4 0 0 0 0
vvi-miR3636-3p GUCUGUCGGAGAAGCAAGUCGGAG 24 692 14 73 8    0 0 0 0 0 0 0 0 19 73 16 37 38 16 24 19 0 0 0 0 0 0 0 0 56 46 15 0 16 16 24 26 0 0 0 0 0 0 0 0 43 60 52 36 13 19 20 8
vvi-miR3636-5p UCGGUUUGCUUCUUUGAUAGAUUC 24 352 7 37 1    13 0 10 8 0 2 3 2 15 13 6 0 2 16 37 3 4 16 6 15 1 0 1 0 14 32 11 0 1 0 1 0 7 11 7 8 1 3 2 2 13 29 14 9 6 3 4 1
vvi-miR3637-3p UUUCGACAAGACACAAUGCAUAAA 24 44 1 12 1    4 0 0 0 0 4 1 2 0 0 0 0 0 0 0 1 0 2 0 3 0 0 0 12 0 0 2 0 0 0 0 0 0 0 0 0 0 1 0 4 1 0 0 3 0 4 0 0
vvi-miR3637-5p AUUUAUGUAUUGUGUUUUGUCGGA 24 14 0 3 1    3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 0 0 0 1 0 0 2 1 1 0 0 0 1 0 2
vvi-miR3638-3p GCAACAAGCAUGAAAAGGCACACC 24 20 0 4 1    0 0 0 0 0 2 1 2 0 4 0 0 0 0 0 0 0 1 1 0 0 1 0 1 0 0 2 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 3 0 0 0 0 0
vvi-miR3638-5p UGUGCCUUUUCGCGCUUGUUGCUA 24 5 0 2 1    0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 1 0 0
vvi-miR3639-3p GAGCUUUUGGCUUCUCAGAAGUCA 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR3639-5p AUUGACUUCUGAAAGGCUAAAAGC 24 1,086 23 181 1    0 0 0 0 0 0 0 0 63 69 10 41 18 20 24 19 0 0 0 0 0 0 0 0 79 132 42 1 15 21 25 8 0 0 0 0 0 0 0 0 86 181 46 58 43 67 6 12
vvi-miR3640-3p AUCGAAAAGGCAUCAUCAAUCAGG 24 273 6 17 1    16 9 2 8 4 8 0 6 3 9 0 0 10 4 0 2 4 16 8 16 1 8 3 8 4 11 2 0 0 0 0 0 5 17 2 4 6 4 4 6 10 5 16 8 11 8 2 3
vvi-miR3640-5p ACCUGAUUGGUGAUGCUUUUUUGG 24 1,321 28 301 1    29 15 2 11 8 12 5 2 46 43 6 4 10 0 6 3 10 40 10 9 0 1 1 1 154 301 16 1 34 52 17 16 34 42 12 4 7 8 0 4 121 32 35 22 58 39 29 9
vvi-miR390 AAGCUCAGGAGGGAUAGCGCC 21 5,046 105 660 5    253 214 6 34 12 11 24 13 162 336 19 17 14 32 31 89 304 414 18 20 10 13 10 56 509 660 14 0 19 23 50 47 435 159 54 33 17 5 57 23 323 105 27 19 209 76 40 30
vvi-miR393a UCCAAAGGGAUCGCAUUGAUC 21 5,152 107 552 10    75 37 25 18 68 142 39 82 47 112 10 45 330 552 263 132 39 67 61 62 87 191 70 530 47 87 21 0 46 14 26 60 39 48 56 140 117 264 308 205 60 62 41 64 154 145 33 31
vvi-miR393b UCCAAAGGGAUCGCAUUGAUC 21 5,152 107 552 10    75 37 25 18 68 142 39 82 47 112 10 45 330 552 263 132 39 67 61 62 87 191 70 530 47 87 21 0 46 14 26 60 39 48 56 140 117 264 308 205 60 62 41 64 154 145 33 31
vvi-miR394a UUGGCAUUCUGUCCACCUCCAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR394b UUGGCAUUCUGUCCACCUCC 20 412 9 49 1    23 3 2 8 6 11 1 11 3 47 3 8 4 0 0 11 6 29 17 4 3 11 9 21 49 8 4 0 2 0 7 3 38 4 5 12 4 3 7 3 7 5 0 1 4 5 0 0
vvi-miR394c UUGGCAUUCUGUCCACCUCCAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR395a CUGAAGUGUUUGGGGGAACUC 21 6,899 144 760 4    84 9 66 190 46 104 24 51 19 43 26 169 28 252 12 58 13 40 42 384 119 136 74 218 9 101 196 4 48 760 429 310 126 163 169 16 616 124 262 149 139 66 229 321 62 374 11 8
vvi-miR395b CUGAAGUGUUUGGGGGAACUC 21 6,899 144 760 4    84 9 66 190 46 104 24 51 19 43 26 169 28 252 12 58 13 40 42 384 119 136 74 218 9 101 196 4 48 760 429 310 126 163 169 16 616 124 262 149 139 66 229 321 62 374 11 8
vvi-miR395c CUGAAGUGUUUGGGGGAACUC 21 6,899 144 760 4    84 9 66 190 46 104 24 51 19 43 26 169 28 252 12 58 13 40 42 384 119 136 74 218 9 101 196 4 48 760 429 310 126 163 169 16 616 124 262 149 139 66 229 321 62 374 11 8
vvi-miR395d CUGAAGUGUUUGGGGGAACUC 21 6,899 144 760 4    84 9 66 190 46 104 24 51 19 43 26 169 28 252 12 58 13 40 42 384 119 136 74 218 9 101 196 4 48 760 429 310 126 163 169 16 616 124 262 149 139 66 229 321 62 374 11 8
vvi-miR395e CUGAAGUGUUUGGGGGAACUC 21 6,899 144 760 4    84 9 66 190 46 104 24 51 19 43 26 169 28 252 12 58 13 40 42 384 119 136 74 218 9 101 196 4 48 760 429 310 126 163 169 16 616 124 262 149 139 66 229 321 62 374 11 8
vvi-miR395f CUGAAGUGUUUGGGGGAACUC 21 6,899 144 760 4    84 9 66 190 46 104 24 51 19 43 26 169 28 252 12 58 13 40 42 384 119 136 74 218 9 101 196 4 48 760 429 310 126 163 169 16 616 124 262 149 139 66 229 321 62 374 11 8
vvi-miR395g CUGAAGUGUUUGGGGGAACUC 21 6,899 144 760 4    84 9 66 190 46 104 24 51 19 43 26 169 28 252 12 58 13 40 42 384 119 136 74 218 9 101 196 4 48 760 429 310 126 163 169 16 616 124 262 149 139 66 229 321 62 374 11 8
vvi-miR395h CUGAAGUGUUUGGGGGAACUC 21 6,899 144 760 4    84 9 66 190 46 104 24 51 19 43 26 169 28 252 12 58 13 40 42 384 119 136 74 218 9 101 196 4 48 760 429 310 126 163 169 16 616 124 262 149 139 66 229 321 62 374 11 8
vvi-miR395i CUGAAGUGUUUGGGGGAACUC 21 6,899 144 760 4    84 9 66 190 46 104 24 51 19 43 26 169 28 252 12 58 13 40 42 384 119 136 74 218 9 101 196 4 48 760 429 310 126 163 169 16 616 124 262 149 139 66 229 321 62 374 11 8
vvi-miR395j CUGAAGUGUUUGGGGGAACUC 21 6,899 144 760 4    84 9 66 190 46 104 24 51 19 43 26 169 28 252 12 58 13 40 42 384 119 136 74 218 9 101 196 4 48 760 429 310 126 163 169 16 616 124 262 149 139 66 229 321 62 374 11 8
vvi-miR395k CUGAAGUGUUUGGGGGAACUC 21 6,899 144 760 4    84 9 66 190 46 104 24 51 19 43 26 169 28 252 12 58 13 40 42 384 119 136 74 218 9 101 196 4 48 760 429 310 126 163 169 16 616 124 262 149 139 66 229 321 62 374 11 8
vvi-miR395l CUGAAGUGUUUGGGGGAACUC 21 6,899 144 760 4    84 9 66 190 46 104 24 51 19 43 26 169 28 252 12 58 13 40 42 384 119 136 74 218 9 101 196 4 48 760 429 310 126 163 169 16 616 124 262 149 139 66 229 321 62 374 11 8
vvi-miR395m CUGAAGUGUUUGGGGGAACUC 21 6,899 144 760 4    84 9 66 190 46 104 24 51 19 43 26 169 28 252 12 58 13 40 42 384 119 136 74 218 9 101 196 4 48 760 429 310 126 163 169 16 616 124 262 149 139 66 229 321 62 374 11 8
vvi-miR395n CUGAAGAGUCUGGAGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR396a UUCCACAGCUUUCUUGAACUA 21 15,069 314 2,560 8    497 15 117 2,560 112 693 90 89 41 198 10 165 140 244 98 158 460 202 360 1,097 229 502 231 470 161 108 369 0 8 30 53 16 801 163 1,548 124 123 66 286 85 351 136 426 978 291 135 13 20
vvi-miR396b UUCCACAGCUUUCUUGAACU 20 7,387 154 1,001 2    218 18 212 248 43 74 30 23 156 146 148 37 154 65 86 59 396 191 236 235 102 163 93 144 427 142 163 2 62 23 25 10 1,001 207 419 540 69 18 101 36 325 92 112 126 113 30 37 30
vvi-miR396c UUCCACAGCUUUCUUGAACUG 21 3,900 81 310 3    151 3 8 111 37 128 34 38 8 30 6 21 103 264 92 36 192 43 42 200 139 101 275 218 25 26 103 0 11 38 38 18 310 37 211 33 59 21 116 53 76 13 49 80 147 118 9 29
vvi-miR396d UUCCACAGCUUUCUUGAACUG 21 3,900 81 310 3    151 3 8 111 37 128 34 38 8 30 6 21 103 264 92 36 192 43 42 200 139 101 275 218 25 26 103 0 11 38 38 18 310 37 211 33 59 21 116 53 76 13 49 80 147 118 9 29
vvi-miR397a UCAUUGAGUGCAGCGUUGAUG 21 432 9 56 2    25 0 2 11 2 0 5 0 7 56 0 29 14 16 0 2 4 7 6 16 0 0 5 19 23 20 15 0 5 19 8 13 10 3 5 0 6 2 2 5 14 6 14 15 8 13 0 0
vvi-miR398a UGUGUUCUCAGGUCACCCCUU 21 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0
vvi-miR398b UGUGUUCUCAGGUCGCCCCUG 21 16,121 336 2,016 2    429 55 146 991 166 275 72 97 225 822 51 1,286 475 439 43 210 139 213 163 2,016 187 243 210 141 341 461 812 2 35 183 190 164 258 87 454 33 192 85 313 138 277 238 246 1,402 310 746 20 40
vvi-miR398c UGUGUUCUCAGGUCGCCCCUG 21 16,121 336 2,016 2    429 55 146 991 166 275 72 97 225 822 51 1,286 475 439 43 210 139 213 163 2,016 187 243 210 141 341 461 812 2 35 183 190 164 258 87 454 33 192 85 313 138 277 238 246 1,402 310 746 20 40
vvi-miR399a UGCCAAAGGAGAAUUGCCCUG 21 1,289 27 167 1    25 0 6 13 8 28 12 38 2 4 0 0 0 0 0 0 1 26 10 51 0 25 7 32 107 76 2 0 9 16 68 26 44 9 5 4 110 54 17 167 41 13 3 12 64 154 0 0
vvi-miR399b UGCCAAAGGAGAGUUGCCCUG 21 2,996 62 633 2    35 18 12 42 157 163 71 325 4 13 0 0 2 0 0 0 7 25 17 102 7 17 26 28 30 57 4 0 0 16 49 39 96 31 10 0 633 196 109 337 10 26 0 7 64 204 4 3
vvi-miR399c UGCCAAAGGAGAGUUGCCCUG 21 2,996 62 633 2    35 18 12 42 157 163 71 325 4 13 0 0 2 0 0 0 7 25 17 102 7 17 26 28 30 57 4 0 0 16 49 39 96 31 10 0 633 196 109 337 10 26 0 7 64 204 4 3
vvi-miR399d UGCCAAAGGAGAUUUGCUCGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR399e UGCCAAAGGAGAUUUGCCCGG 21 184 4 77 1    1 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 3 9 0 0 8 5 12 2 0 0 0 9 3 3 5 1 0 0 10 8 2 77 9 0 0 4 0 11 0 0
vvi-miR399f UGCCGAAGGAGAUUUGUCCUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR399g UGCCAAAGGAGAUUUGCCCCU 21 63 1 12 1    3 0 0 0 0 4 0 0 0 0 0 0 0 0 0 0 0 1 1 1 0 0 0 0 0 0 0 0 0 0 12 8 0 0 12 0 7 1 0 4 0 0 0 0 4 5 0 0
vvi-miR399h UGCCAAAGGAGAAUUGCCCUG 21 1,289 27 167 1    25 0 6 13 8 28 12 38 2 4 0 0 0 0 0 0 1 26 10 51 0 25 7 32 107 76 2 0 9 16 68 26 44 9 5 4 110 54 17 167 41 13 3 12 64 154 0 0
vvi-miR399i CGCCAAAGGAGAGUUGCCCUG 21 113,055 2,355 14,925 1    998 440 185 825 4,592 3,825 2,393 7,200 106 749 13 236 46 678 24 89 534 821 396 2,891 2,742 5,549 4,168 4,978 916 2,293 459 1 1,032 4,443 5,476 3,365 1,871 881 854 107 11,906 2,240 3,451 5,294 785 769 256 583 5,862 14,925 559 249
vvi-miR403a UUAGAUUCACGCACAAACUCG 21 82,567 1,720 6,317 3    1,663 3 189 762 606 3,844 1,197 589 233 73 39 54 4,958 5,840 2,533 4,976 947 1,317 376 1,317 3,019 3,093 5,625 5,324 618 544 724 0 502 530 1,131 826 1,884 1,117 797 256 1,709 1,896 3,973 2,517 827 254 707 1,036 6,317 4,045 539 1,241
vvi-miR403b UUAGAUUCACGCACAAACUCG 21 82,567 1,720 6,317 3    1,663 3 189 762 606 3,844 1,197 589 233 73 39 54 4,958 5,840 2,533 4,976 947 1,317 376 1,317 3,019 3,093 5,625 5,324 618 544 724 0 502 530 1,131 826 1,884 1,117 797 256 1,709 1,896 3,973 2,517 827 254 707 1,036 6,317 4,045 539 1,241
vvi-miR403c UUAGAUUCACGCACAAACUCG 21 82,567 1,720 6,317 3    1,663 3 189 762 606 3,844 1,197 589 233 73 39 54 4,958 5,840 2,533 4,976 947 1,317 376 1,317 3,019 3,093 5,625 5,324 618 544 724 0 502 530 1,131 826 1,884 1,117 797 256 1,709 1,896 3,973 2,517 827 254 707 1,036 6,317 4,045 539 1,241
vvi-miR403d UUAGAUUCACGCACAAACUCG 21 82,567 1,720 6,317 3    1,663 3 189 762 606 3,844 1,197 589 233 73 39 54 4,958 5,840 2,533 4,976 947 1,317 376 1,317 3,019 3,093 5,625 5,324 618 544 724 0 502 530 1,131 826 1,884 1,117 797 256 1,709 1,896 3,973 2,517 827 254 707 1,036 6,317 4,045 539 1,241
vvi-miR403e UUAGAUUCACGCACAAACUCG 21 82,567 1,720 6,317 3    1,663 3 189 762 606 3,844 1,197 589 233 73 39 54 4,958 5,840 2,533 4,976 947 1,317 376 1,317 3,019 3,093 5,625 5,324 618 544 724 0 502 530 1,131 826 1,884 1,117 797 256 1,709 1,896 3,973 2,517 827 254 707 1,036 6,317 4,045 539 1,241
vvi-miR403f UUAGAUUCACGCACAAACUCG 21 82,567 1,720 6,317 3    1,663 3 189 762 606 3,844 1,197 589 233 73 39 54 4,958 5,840 2,533 4,976 947 1,317 376 1,317 3,019 3,093 5,625 5,324 618 544 724 0 502 530 1,131 826 1,884 1,117 797 256 1,709 1,896 3,973 2,517 827 254 707 1,036 6,317 4,045 539 1,241
vvi-miR408 AUGCACUGCCUCUUCCCUGGC 21 6,566 137 446 9    147 73 78 211 118 143 9 23 240 86 26 446 321 240 49 103 91 157 123 350 71 257 76 254 183 397 249 0 31 16 28 34 52 69 162 62 72 45 166 77 145 82 221 323 203 223 11 23
vvi-miR477a AUCUCCCUCAAAGGCUUCCAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR477b-3p CGAAGUCUUUGGGGAGAGUGG 21 3,289 69 422 1    29 21 12 32 422 411 39 186 1 13 0 0 16 268 12 14 42 32 7 2 60 20 30 13 44 57 39 0 16 38 19 10 108 34 52 54 283 80 236 62 78 10 33 34 152 86 50 32
vvi-miR477b-5p ACUCUUUCUCAAGGGCUUCUAG 22 38 1 8 1    0 0 0 0 8 2 0 0 0 0 0 0 0 0 0 1 0 0 0 0 1 0 0 8 5 0 0 0 0 0 0 0 1 0 0 4 0 2 0 3 0 0 0 0 2 1 0 0
vvi-miR479 UGUGGUAUUGGUUCGGCUCAUC 22 4,449 93 391 2    391 275 16 45 14 17 7 11 106 344 10 0 22 16 55 9 237 354 30 63 17 35 7 63 309 364 78 2 76 108 122 42 194 256 27 29 10 12 33 32 121 219 22 69 62 24 39 55
vvi-miR482 UCUUUCCUACUCCUCCCAUUCC 22 42,801 892 2,199 2    1,981 656 1,215 2,199 1,453 1,413 544 774 246 388 129 1,810 958 2,104 1,267 943 449 862 2,089 1,793 557 1,275 732 1,293 751 223 522 2 204 237 415 175 920 388 1,729 1,880 333 472 1,404 864 257 429 398 1,769 643 948 227 481
vvi-miR535a UGACAACGAGAGAGAGCACGC 21 18,893 394 1,718 18    275 134 115 1,685 379 1,137 559 855 18 172 23 169 275 142 153 264 387 303 332 383 816 1,450 951 1,718 68 68 70 0 467 293 431 193 276 339 442 280 257 412 295 213 127 59 134 266 547 528 360 73
vvi-miR535b UGACAACGAGAGAGAGCACGC 21 18,893 394 1,718 18    275 134 115 1,685 379 1,137 559 855 18 172 23 169 275 142 153 264 387 303 332 383 816 1,450 951 1,718 68 68 70 0 467 293 431 193 276 339 442 280 257 412 295 213 127 59 134 266 547 528 360 73
vvi-miR535c UGACAACGAGAGAGAGCACGC 21 18,893 394 1,718 18    275 134 115 1,685 379 1,137 559 855 18 172 23 169 275 142 153 264 387 303 332 383 816 1,450 951 1,718 68 68 70 0 467 293 431 193 276 339 442 280 257 412 295 213 127 59 134 266 547 528 360 73
vvi-miR828a UCUUGCUCAAAUGAGUAUUCCA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR845a UAGCUCUGAUACCAAUUGAUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR845b UAGCUCUGAUACCAAUUGAUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR845c AGGCUCUGAUACCAAUUGAUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR845d UGGCUCUGAUACCAAUUGAUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
vvi-miR845e UGGCUCUGAUACCAAUUGAUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0