Chicken Small RNA miRNA Abundances

The data below are based on the microRNAs listed in the miRBase registry. Adjust libraries/reads to display on the control panel.


        miRNA         miRNA sequence Len Sum (norm) Average Max Min (>0)  MSB1HVTILTVSpln1Spln2TcellaTcel1aTcel2Tumr1Tumr2454Lib241454Lib242
gga-let-7a-2-3p CUGUACAACCUCCUAGCUUUCC 22 26 2 23 3    0 3 23 0 0 0 0 0 0 0 0 0
gga-let-7a-3p CUAUACAAUCUACUGUCUUUCC 22 19 2 14 1    0 1 14 1 2 1 0 0 0 0 0 0
gga-let-7a-5p UGAGGUAGUAGGUUGUAUAGUU 22 963,975 80,331 215,982 3    93,546 196,252 146,620 215,982 211,184 84,618 7,281 7,323 604 557 5 3
gga-let-7b UGAGGUAGUAGGUUGUGUGGUU 22 94,495 7,875 33,712 39    39 15,951 11,419 32,758 33,712 374 70 42 56 74 0 0
gga-let-7c-3p CUGUACAACCUUCUAGCUUUCC 22 4 0 4 4    0 0 4 0 0 0 0 0 0 0 0 0
gga-let-7c-5p UGAGGUAGUAGGUUGUAUGGUU 22 141,750 11,813 67,885 1    277 67,885 17,129 23,865 24,754 6,379 598 572 153 137 1 0
gga-let-7d AGAGGUAGUGGGUUGCAUAGU 21 186 16 55 1    24 35 55 27 33 11 1 0 0 0 0 0
gga-let-7f-3p CUAUACAAUCUAUUGCCUUCCC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-let-7f-5p UGAGGUAGUAGAUUGUAUAGUU 22 1,571,228 130,936 343,588 1    343,588 177,727 170,841 277,212 283,164 272,110 21,736 22,254 1,305 1,289 1 1
gga-let-7g-3p CUGUACAGGCCACUGCCUUGCC 22 2 0 2 2    0 0 2 0 0 0 0 0 0 0 0 0
gga-let-7g-5p UGAGGUAGUAGUUUGUACAGU 21 10,347 862 2,827 4    773 555 1,305 2,827 2,806 1,853 109 106 4 9 0 0
gga-let-7i UGAGGUAGUAGUUUGUGCUGU 21 8,625 719 4,351 1    4,351 542 781 1,253 1,213 446 20 17 1 1 0 0
gga-let-7j-3p CUAUACAGUCUAUUGCCUUCCU 22 42 4 18 1    0 4 18 7 7 5 1 0 0 0 0 0
gga-let-7j-5p UGAGGUAGUAGGUUGUAUAGUU 22 963,975 80,331 215,982 3    93,546 196,252 146,620 215,982 211,184 84,618 7,281 7,323 604 557 5 3
gga-let-7k-3p CUAUACAAUCUACUGUCUUUCC 22 19 2 14 1    0 1 14 1 2 1 0 0 0 0 0 0
gga-let-7k-5p UGAGGUAGUAGAUUGAAUAGUU 22 23,347 1,946 5,988 15    15 3,020 3,580 5,618 5,988 3,975 530 552 31 38 0 0
gga-let-7l-3p CGAUGCAGCCGACUACUUUCC 21 4 0 3 1    0 0 1 3 0 0 0 0 0 0 0 0
gga-let-7l-5p UGAGGUAGUCGGUUGUAUUGUU 22 3,293 274 875 5    875 559 845 162 162 508 100 64 13 5 0 0
gga-miR-100-3p AAGCUUGUAUCUAUAGGUAUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-100-5p AACCCGUAGAUCCGAACUUGUG 22 4,396 366 2,984 2    26 1,127 2,984 110 114 28 2 2 3 0 0 0
gga-miR-101-1-5p UCGGUUAUCAUGGUACCGGUGCU 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-101-2-5p UCAGUUAUCACAGUGCUGAUGCU 23 8 1 3 1    1 1 0 1 0 2 0 3 0 0 0 0
gga-miR-101-3p GUACAGUACUGUGAUAACUGAA 22 17,944 1,495 4,931 1    2,089 2,518 2,070 2,788 2,738 4,931 394 381 20 14 0 1
gga-miR-103-1-5p UCGGCUUCUUUACAGUGCUGCCUUG 25 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-103-2-5p AGCUUCUUUACAGUGCUGCCUUG 23 5 0 5 5    0 0 5 0 0 0 0 0 0 0 0 0
gga-miR-103-3p AGCAGCAUUGUACAGGGCUAUGA 23 61,481 5,123 18,027 1    1,402 12,373 18,027 8,736 8,386 7,857 2,191 2,387 63 58 0 1
gga-miR-10585-3p GGAUAGGUGGGUUUCAUUGA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-10585-5p UGAUGAAAUCCCCCUAUGGCCUGU 24 5 0 2 1    0 0 1 0 0 2 0 2 0 0 0 0
gga-miR-106-3p ACUGCAGUAUAAGCACUUCUGG 22 29 2 16 1    3 3 16 3 3 1 0 0 0 0 0 0
gga-miR-106-5p AAAAGUGCUUACAGUGCAGGUA 22 562 47 380 1    27 14 380 61 57 20 1 1 0 0 1 0
gga-miR-107-3p AGCAGCAUUGUACAGGGCUAUCA 23 9,163 764 4,431 4    153 1,710 4,431 1,045 1,054 604 88 69 4 5 0 0
gga-miR-107-5p AGCUUCUUUACAGUGUUGCCUUG 23 3 0 1 1    1 0 0 0 0 1 0 0 0 0 1 0
gga-miR-10a-3p AAAUUCGUAUCUAGGGGAAUA 21 26 2 20 1    0 1 20 3 2 0 0 0 0 0 0 0
gga-miR-10a-5p UACCCUGUAGAUCCGAAUUUGU 22 32,446 2,704 10,262 12    0 1,815 10,262 10,016 10,006 288 13 15 12 19 0 0
gga-miR-10b-3p AGAUUCGAUUCUAGGGGAAUA 21 10 1 9 1    0 1 9 0 0 0 0 0 0 0 0 0
gga-miR-10b-5p UACCCUGUAGAACCGAAUUUGU 22 2,712 226 2,506 1    0 193 2,506 8 3 1 0 0 1 0 0 0
gga-miR-10c-3p CAAAUUCGUCUCUAGGGGAAU 21 2 0 2 2    0 0 2 0 0 0 0 0 0 0 0 0
gga-miR-10c-5p UACCCUGUAGACUCGAAUUUGU 22 29 2 17 1    0 11 17 0 0 1 0 0 0 0 0 0
gga-miR-122-3p AACGCCAUUAUCACACUAAAUA 22 2 0 1 1    0 0 0 0 1 1 0 0 0 0 0 0
gga-miR-122-5p UGGAGUGUGACAAUGGUGUUUGU 23 4,122 344 2,637 1    1 92 2,637 398 434 320 139 101 0 0 0 0
gga-miR-12207-3p CUGCUCCCUCCCGGCUGCCUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12207-5p ACGCAGCACGCAGGAGAGCCGAG 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12208-3p AACACAGUGCUCUGCCACUGGA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12208-5p UGGGGCACAGCAUUGUGUGUGG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12209-3p UCGUGACCUUCUCUUUGUAUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12209-5p AUCAAAGUGAAAGGUCAAGAUU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12210-3p CAAGAUAGAUUCAGAACAACUU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12210-5p GUUGUUCUGAAUCUAUCUUGGA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12211-3p UUAGAGGACAAUGGCCAAUACU 22 21 2 7 1    0 2 4 6 7 1 0 1 0 0 0 0
gga-miR-12211-5p UAAGUGCUGGCCGUUGUCCUCU 22 2 0 1 1    0 1 0 0 0 1 0 0 0 0 0 0
gga-miR-12212-5p CCGGGCGGGAGGGGAGCGGC 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12213-3p CUACAAACCACCUGGUGCUGGU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12213-5p UGUGCACCAGCUGGUGGGUUGGA 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12214-3p ACACAUUUCAGUGCUUCCCUGA 22 3 0 1 1    0 1 0 1 0 1 0 0 0 0 0 0
gga-miR-12214-5p AGAAGAGCAUUUAAAUGUGUGC 22 3 0 2 1    0 0 0 1 2 0 0 0 0 0 0 0
gga-miR-12215-5p GGCGGCGGAGGGAGGAGGAGGCGGU 25 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12216-3p UCAGCACCCCUCCGUCCCCGCAGU 24 3 0 1 1    0 0 0 0 0 1 1 1 0 0 0 0
gga-miR-12216-5p GGCGGGGGCGCGGGGUGCUGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12217-3p CCGGGCGGGGCGGGGAGGG 19 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12218-3p CUCAUGCCCUCUCUGUGCCAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12218-5p UGGGCACAAAGAGGGCAGUGGGAGC 25 4 0 1 1    0 0 1 0 0 1 1 1 0 0 0 0
gga-miR-12219-3p GCAACCGCUUCCAGCCCGGCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12219-5p AGGAGCAGGGGGUGGUCAAGCUGA 24 2 0 1 1    1 0 0 0 0 0 0 1 0 0 0 0
gga-miR-12220-3p CUGAGCCCCGUUACCCUGCAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12220-5p GUGCAGUGCUGGGGGGCACAGCG 23 3 0 2 1    0 1 2 0 0 0 0 0 0 0 0 0
gga-miR-12221-2-3p UGCCAUCGUCCUUUGUCCGCUG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12221-3p UUCGUGUGCCAUCGUCCUUUGU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12221-5p GCGGACAAAGGACGAUGGCAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12222-3p AUUGAAACCUGUUGCAUUG 19 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12222-5p UCUGCUUUGACCAGGUUGGGUGG 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12223-3p UCAUCAGAGAGGCUGGGCUCU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12223-5p UAGUUCAGCUGUCUGUGAAUGAGG 24 2 0 2 2    0 0 2 0 0 0 0 0 0 0 0 0
gga-miR-12224-3p UGUUAGGUGUCUUCCACAGGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12224-5p AACAGUGGAAUGCACCUAGCUGA 23 1 0 1 1    0 0 0 0 1 0 0 0 0 0 0 0
gga-miR-12225-3p UCCGCCUGCGGGAUGACGUCGC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12225-5p ACCUCACCCCGAUGGCGUAGCG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12226-3p CGGCCCGCCGCGGCCCUCACGCC 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12226-5p GUGAGGCGGCGGUCGGGACGCG 22 7 1 3 1    0 1 3 1 0 0 1 1 0 0 0 0
gga-miR-12227-3p CUGCCCUCAUUGCUCCUCAAAG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12227-5p CAGUGGGGAGCACAGGGCAGGG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12228-3p UCCCCACUGCUCCCCCACAG 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12228-5p AAGGGGGGAGCAUUGGGUGGCA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12229-3p GAGCCCCGCAGGCCCGGCCCG 21 8 1 4 1    0 1 0 0 0 1 4 2 0 0 0 0
gga-miR-12229-5p GAGCCGGGCCCCGCGGGGCUCC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12230-5p AAAGUGGAUGAAGACACCAUGG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12231-3p AUCCUCUCAGAUGAACAGCU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12231-5p UGCUGUCCCCUGAGAGGAUCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12232-3p UGUCCUUCGGUGUCUCUGCUGGU 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12232-5p UCUGCAGAGCCUCCCAGGAGCA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12233-3p AGUCCGUGCCCCCCCGGUUCCC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12233-5p GAGGGAACCGGUGGGGGGCACGGA 24 1 0 1 1    0 1 0 0 0 0 0 0 0 0 0 0
gga-miR-12234-3p UAAUCUUUUCCUUUUCUUCACAG 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12234-5p AGUGGGAAAAGGUGAGAUCUGU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12235-3p UCACUCAGCCCUCCGUUUGCCCGC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12235-5p UGUGUGUGAGCGGGGGGGGGCCGG 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12236-3p AGUGCAAAUUAUGAAUAAUGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12236-5p AUUGAUUCAUUCUUUGCUCUUCU 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12237-3p CCGCCCGGCCCCGCCCGCACCG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12237-5p GGGCGCGGGGGGGCUGGGCUCGGC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12238-3p UUGGGCUGGGCUUGCUGCGUGG 22 3 0 1 1    1 1 0 1 0 0 0 0 0 0 0 0
gga-miR-12239-3p UCUGCUGCUUUCUGCUGGCAUCA 23 1 0 1 1    0 0 1 0 0 0 0 0 0 0 0 0
gga-miR-12239-5p AUGUUGCUGGAAGGAGCAGA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12240-3p AAGGUGCUGCGGGAGGUUGUGC 22 1 0 1 1    0 0 1 0 0 0 0 0 0 0 0 0
gga-miR-12240-5p UCCUCCUCCUUCAUGGCCUCGUU 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12241-3p CCGGGCGGGAGGGAGCGGG 19 1 0 1 1    0 0 0 0 1 0 0 0 0 0 0 0
gga-miR-12242-3p UGCCCGCAGCACCGCUUCUCGCU 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12242-5p GCCGAGGGGGGGUUGCGGCGCAGU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12243-3p AGGAAGAAGAGGGGAGGGGAGC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12243-5p UUCAUCCUCCUCAUCUUCGUCCUUGC 26 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12244-5p ACAGCCACUCCGCGUCCACCCG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12245-3p CCCCGCCCCGCCCGGCCCCGCC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12245-5p AGGGGCCGCGAUGGGAGGGGGUU 23 1 0 1 1    0 0 1 0 0 0 0 0 0 0 0 0
gga-miR-12246-3p UUUUCCAACCUUCUUCCCCCC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12246-5p UUGGGUGGACGGUUGGACUUGA 22 1 0 1 1    0 1 0 0 0 0 0 0 0 0 0 0
gga-miR-12247-3p CCCAGCACGCCUACCCCGGGCC 22 2 0 1 1    0 0 1 0 0 0 0 1 0 0 0 0
gga-miR-12247-5p CCCGGGGUGGGCACGCUGUACG 22 1 0 1 1    0 0 0 0 1 0 0 0 0 0 0 0
gga-miR-12248-3p GGUACGGACAUGGGGGCUUUGG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12248-5p UCAGCCCAUUUGUCCUCAUGCCU 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12249-3p ACCCCAUCCCUCAGCCUCACCCC 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12249-5p GUGAGUAAUGGGAGAGGGUCC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12250-3p CGUGCUCUGCUCUCUCCCCAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12250-5p AGGGGAUGGAGCCGAGUGCCACA 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12251-3p ACCUGCGAUCCCUGCCUUUGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12251-5p UAUGGCAAGGAGGCUGCAGACC 22 1 0 1 1    0 1 0 0 0 0 0 0 0 0 0 0
gga-miR-12252-3p GUGAGGCUGUGCUCCCCCCGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12252-5p AUCAUCGUGGGGGUCGGCC 19 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12253-3p CCUCUGCCCCUCUCCUCCCGCA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12253-5p GGCGGGAGCUGAGGGGGGGAGG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12254-3p AAACAUCCUCUCCUGCCCCCAGU 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12254-5p UAUGGGGGCACAGAAGGGUCAUUG 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12255-3p CGUGGCACCGCUCCCGGCACCGCG 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12255-5p GGGUCGGGCGCGGUGCUGCACUG 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12256-3p UCUCACUGCUCCUCUUUCCUCA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12256-5p AGGGGGUGUGGGGAGCAUGG 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12257-3p UGACCCCCUGUCCUCACACAGU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12257-5p UGUGGAGGCAGCGGGGUCAGGG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12258-3p GGAGGAGGACGCAGCCAUGUGC 22 2 0 1 1    0 1 1 0 0 0 0 0 0 0 0 0
gga-miR-12258-5p UGCACGGCUGCAGCCUCCUCACC 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12259-3p UCUGCCUCUUUGUCUAUCUGC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12259-5p UGCAGGUAGGCAGGGGGAGCAGG 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12260-3p AGAAGGAGCGGAUCCGCGAGC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12260-5p AAGCGGUUCAGCUACUUCUCC 21 2 0 2 2    0 0 2 0 0 0 0 0 0 0 0 0
gga-miR-12261-3p CCUGCAGAGCCCUGGGAGAGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12261-5p CCUCCGCAGGAGCCCUUUGCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12262-5p UUGUCACAGACCCUGCUAAAGA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12263-3p CUCGGGAGGGCAUCGCGCGGAGG 23 1 0 1 1    0 0 1 0 0 0 0 0 0 0 0 0
gga-miR-12263-5p CCCGCGCAGCCCGGCCGCAGCG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12264-3p AUGGCUGUUCUAGCAGUAGAUC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12264-5p CCUACUGCUAGGUUUGCCCUUA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12265-3p UCAGCCGUCUUGCAGCCUCCU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12265-5p AUGGCUGUGAGUGCGGCUGAGG 22 1 0 1 1    0 1 0 0 0 0 0 0 0 0 0 0
gga-miR-12266-3p AAGGGCAAACCCGAUGGGCACC 22 19 2 13 1    0 4 13 1 1 0 0 0 0 0 0 0
gga-miR-12266-5p GCCCCCAUCGAUUUGCUCUAC 21 2 0 1 1    0 0 1 0 0 0 0 1 0 0 0 0
gga-miR-12267-3p GGGUCGCCCCGGGUCUCGGUGU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12267-5p CCGACACCCCCGGUGACAGCCGU 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12268-5p GCGCGGGGCGGGCGGGCGGC 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12269-3p UCUCUCCACCCUGUGUCCCCAGU 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12269-5p UUGGGGCUGCAAGGUGAGGCAAAGG 25 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12270-3p CAGCCCUGGGCAUUUGCAUUCU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12270-5p UCAGUAAGUGCCCUGUGGGUAUG 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12271-3p UAGGUCACAGUCUGAACCAAUGG 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12271-5p UUCAUGCUGUGAAGGGGUU 19 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12272-3p CCAAAGGUGGCUCGCGGAACUG 22 7 1 2 1    0 0 2 1 1 1 0 1 1 0 0 0
gga-miR-12272-5p UUCCGCGAACCGCCUUCGGUC 21 2 0 1 1    0 0 0 1 1 0 0 0 0 0 0 0
gga-miR-12273-3p CGGCCGGUCGCCGCGGGCAAC 21 7 1 2 1    1 1 0 1 2 1 0 1 0 0 0 0
gga-miR-12273-5p CUGCCCGCGGCGCCCGGCCGCG 22 1 0 1 1    0 1 0 0 0 0 0 0 0 0 0 0
gga-miR-12274-3p CUUAGAUACUGCUCUGCACGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12274-5p GAGCAGCAGAAGGAUCUGAGUG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12275-3p CACGAGCAGAGCAGGGCGCUGG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12275-5p AGCGUUCUGCUUUCCUGGUGUG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12276-3p UGUAGAGAGUGGUGGGGUCUCU 22 1 0 1 1    0 0 1 0 0 0 0 0 0 0 0 0
gga-miR-12276-5p UGACCCCAACCUCGCUACCACC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12277-3p UUUGGGUGCCAGCCCCGUUGCG 22 7 1 3 1    1 1 3 1 1 0 0 0 0 0 0 0
gga-miR-12277-5p GGACGGGGCUGGGAUCCAGGA 21 12 1 5 1    4 1 5 1 0 0 1 0 0 0 0 0
gga-miR-12278-3p CUGAUCAGCCACUUGAGGGAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12278-5p AUCCUUCAAGUGCCUGAUAACA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12279-3p CGCAGCGCUCCCCCCCCACCCC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12279-5p UGCGGGCGGGGGCAGCGCGGCGG 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12280-3p CCAGGCUGUAAGGGAACUUGGC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12280-5p CCAAGUUCCCUUACAGCCCUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12281-3p UGCUCCGUCAGACCCAUCAGCA 22 2 0 1 1    0 0 0 0 1 1 0 0 0 0 0 0
gga-miR-12282-3p UUCUCCUCCCUUCGCACGGCGCA 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12282-5p UGCCGGGGCGCUGGGGAGGGGCAGC 25 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12283-3p UCUUCUCUCUGUCUUUCUCAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12283-5p UGGGGAGGAUAGGGAGAAAGGGU 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12284-3p UGCUGUCCCUCUGUCCCCAAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12284-5p UGGGGGCACUGGGACGUAUGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12285-3p CCCGGCCUGCCCCGCUCAUCU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12285-5p GUGAGUGCUGCAGGGCCGCGCG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12286-3p UCACAGCCCUUCCGCCCCCCUU 22 1 0 1 1    0 0 0 0 0 0 0 1 0 0 0 0
gga-miR-12286-5p UGGGGCUGCAGGGCUGGGAGAUG 23 23 2 7 1    4 1 7 3 0 1 6 1 0 0 0 0
gga-miR-12287-5p UGGGGGUGCAGGUGGGGGGCU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12288-3p CCUCGCUGCAUCCCGGCGUA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12288-5p CACGCCGGGAUGCAGCGAGGC 21 1 0 1 1    0 0 1 0 0 0 0 0 0 0 0 0
gga-miR-12289-3p CCGACGCCGGCGACGCGGGUUG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12289-5p GCCCCGACGCCGGCACCGUGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12290-3p UGACCCCCACGUGCCCCCCAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12290-5p UGGGGGUGCCGUUGGGGUCAGU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12291-3p UCUCCUCUUGUCCCCUCCCAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12292-3p AUGGGGUCUUGGGGUCACU 19 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12292-5p UCUGUGAGGUCCUUGGGG 18 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12293-3p UGACUGAAGCACUAGAUCAAGA 22 1 0 1 1    1 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12293-5p CGCCUCUUGAUCUACUGUUCAGU 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12294-3p CCAAGCCUCCCAGGGAAGAAGG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12294-5p UCUUCCCUCAGCCAGGCUUGACU 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12295-3p CGCUGCCCGCCCCAUCCCGACC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-12295-5p ACGGGACGGGGCGGGACGGCGCU 23 9 1 3 1    3 1 2 0 0 1 1 1 0 0 0 0
gga-miR-122b AGUGUGACACUGGUGUUUUU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-122b-3p AAACACCAUUGUCACACUCCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-122b-5p UUUAGUGUGAUAAUGGCGUUUG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-124a-3p UUAAGGCACGCGGUGAAUGCCA 22 1 0 1 1    0 1 0 0 0 0 0 0 0 0 0 0
gga-miR-124a-5p GUUCACAGCGGACCUUGAU 19 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-124b UUAAGGCACGCAGUGAAUGCCA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-124c-3p UCAAGGUCCGCUGUGAACACGG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-124c-5p CAUUCACCGCGUGCCUUAAUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-125b-3p ACAAGUCAGGCUCUUGGGACCU 22 3 0 2 1    0 2 0 1 0 0 0 0 0 0 0 0
gga-miR-125b-5p UCCCUGAGACCCUAACUUGUGA 22 7,896 658 5,682 1    7 1,056 5,682 474 487 148 13 13 7 8 1 0
gga-miR-126-3p UCGUACCGUGAGUAAUAAUGCGC 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-126-5p CAUUAUUACUUUUGGUACGCG 21 204 17 81 1    0 1 46 74 81 1 0 0 0 1 0 0
gga-miR-128-1-5p CGGGGCCGUAACACUGUCUGAGA 23 13 1 4 1    0 1 4 1 1 1 1 4 0 0 0 0
gga-miR-128-2-5p GGGGGCCGUUACACUGUAAGAGA 23 16 1 8 3    0 0 8 0 0 0 5 3 0 0 0 0
gga-miR-128-3p UCACAGUGAACCGGUCUCUUU 21 23,532 1,961 7,858 1    536 2,620 7,858 5,111 4,843 1,918 303 323 5 14 1 0
gga-miR-129-1-3p AAGCCCUUACCCCAAAAAGCAU 22 749 62 367 1    2 185 367 19 26 61 42 41 5 1 0 0
gga-miR-129-3p AAGCCCUUACCCCAAAAAGGAU 22 2 0 1 1    0 1 0 0 1 0 0 0 0 0 0 0
gga-miR-129-5p CUUUUUGCGGUCUGGGCUUGC 21 259 22 153 2    0 83 153 8 8 3 2 2 0 0 0 0
gga-miR-1306-3p UGGACGUUGGCUCUGGUGGUGAU 23 7 1 2 1    0 2 1 0 1 1 0 2 0 0 0 0
gga-miR-1306-5p ACCACCUCCCCUGCAAACGUCCAGU 25 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-130a-3p CAGUGCAAUAUUAAAAGGGCAU 22 4,477 373 2,984 1    49 893 2,984 253 231 56 2 5 3 1 0 0
gga-miR-130a-5p GCCCUUUUUCUGUUGUACUACU 22 26 2 17 1    2 6 17 0 0 1 0 0 0 0 0 0
gga-miR-130b-3p CAGUGCAAUAAUGAAAGGGCGU 22 4,767 397 3,566 1    62 843 3,566 140 128 16 4 6 1 1 0 0
gga-miR-130b-5p CCUCUUUCCCUGUUGCACUACU 22 43 4 35 1    0 5 35 0 1 1 0 0 1 0 0 0
gga-miR-130c-3p CAGUGCAAUGUUAAAAGGGCAU 22 2,391 199 827 3    16 268 827 527 540 190 10 10 3 0 0 0
gga-miR-130c-5p GCCCUUUUUAUGUUGUACUACU 22 1 0 1 1    0 1 0 0 0 0 0 0 0 0 0 0
gga-miR-1329-3p CCUCGUAGCUUGAUCACGAUAU 22 12 1 4 1    0 4 4 1 1 2 0 0 0 0 0 0
gga-miR-1329-5p UACAGUGAUCACGUUACGAUGG 22 41 3 19 2    0 10 19 2 6 4 0 0 0 0 0 0
gga-miR-132a-3p UAACAGUCUACAGCCAUGGUCG 22 119 10 78 6    0 15 78 10 10 6 0 0 0 0 0 0
gga-miR-132a-5p ACCGUGGCUUUAGAUUGUUACU 22 341 28 101 3    0 100 101 29 27 71 10 3 0 0 0 0
gga-miR-132b-3p UAACAAUCUAAAGCCACGGUCG 22 5 0 3 2    0 2 3 0 0 0 0 0 0 0 0 0
gga-miR-132b-5p ACCAUGGCUGUAGACUGUUAC 21 3 0 2 1    0 1 2 0 0 0 0 0 0 0 0 0
gga-miR-132c-3p CAGUAAGCAGUCUAGAGCCAAG 22 18 2 11 7    0 7 11 0 0 0 0 0 0 0 0 0
gga-miR-132c-5p AGCCAUGACUGUAGACUGUUACU 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-133a-3p UUGGUCCCCUUCAACCAGCUGU 22 68 6 36 1    0 19 36 6 6 1 0 0 0 0 0 0
gga-miR-133a-5p AGCUGGUAAAAUGGAACCAAAUC 23 2 0 1 1    0 1 0 0 1 0 0 0 0 0 0 0
gga-miR-133b UUGGUCCCCUUCAACCAGCUA 21 2 0 2 2    0 2 0 0 0 0 0 0 0 0 0 0
gga-miR-133c-3p UUGGUCCCCUUCAACCAGCUGC 22 1 0 1 1    0 1 0 0 0 0 0 0 0 0 0 0
gga-miR-133c-5p GCUGGUAAAAAGGAACCAGAUC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1354 CAUGGUGAUGAUGUGCUGAAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-135a-1-3p AUAUAGGGAUUGAAGCCGUGCA 22 7 1 7 7    0 0 7 0 0 0 0 0 0 0 0 0
gga-miR-135a-2-3p AUGUAGGGAUGGAAGCCAUGAA 22 6 1 5 1    0 1 5 0 0 0 0 0 0 0 0 0
gga-miR-135a-3-3p AUGUAGGGCGAAAAGCCAUGGG 22 34 3 34 34    0 0 34 0 0 0 0 0 0 0 0 0
gga-miR-135a-5p UAUGGCUUUUUAUUCCUAUGUGA 23 1,203 100 1,184 1    1 15 1,184 1 1 0 1 0 0 0 0 0
gga-miR-135b UAUGGCUUUUUAUUCCUUUU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-137-3p UAUUGCUUAAGAAUACGCGUAG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-137-5p ACGGGUAUUCUUGGGUGGAUAAUA 24 2 0 1 1    0 1 1 0 0 0 0 0 0 0 0 0
gga-miR-138-1-3p UACUUCACAACACCAGGGUG 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-138-2-3p UAUUUCACUACACCAGGGUU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-138-5p AGCUGGUGUUGUGAAUC 17 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1388a-3p AUCUCAGGUUCGUCAGCCCAUG 22 4,450 371 1,825 1    3 1 3 1,825 1,721 835 34 28 0 0 0 0
gga-miR-1388a-5p AGGACUGUCUAACCUGAGAAUG 22 1,198 100 644 1    1 0 0 222 240 644 43 45 3 0 0 0
gga-miR-1388b-3p UUCUCAGGUUAGACAGUCCUCG 22 2 0 1 1    0 1 0 0 0 1 0 0 0 0 0 0
gga-miR-1388b-5p CAUGGGCUGACGAACCUGAGAUU 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1397-3p GAUGUAACCCAACGCAGCAUGA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1397-5p UGCAUUGCGACGGGUUAUAUCA 22 4 0 3 1    0 3 1 0 0 0 0 0 0 0 0 0
gga-miR-140-3p CCACAGGGUAGAACCACGGAC 21 535 45 147 3    16 87 147 133 128 17 4 3 0 0 0 0
gga-miR-140-5p AGUGGUUUUACCCUAUGGUAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1416-3p ACAAUUGUAUGAGUUGAGUACA 22 1 0 1 1    0 0 0 0 1 0 0 0 0 0 0 0
gga-miR-1416-5p UCCUUAACUCAUGCCGCUGUG 21 21 2 15 1    0 4 15 1 1 0 0 0 0 0 0 0
gga-miR-142-3p UGUAGUGUUUCCUACUUUAUGG 22 194 16 67 3    10 0 4 55 67 55 0 3 0 0 0 0
gga-miR-142-5p CCCAUAAAGUAGAAAGCACUAC 22 1,088 91 472 3    384 7 17 84 82 472 12 24 3 3 0 0
gga-miR-143-3p UGAGAUGAAGCACUGUAGCUCG 22 1,284 107 478 1    0 241 478 287 270 4 0 1 3 0 0 0
gga-miR-143-5p GGUGCAGUGCUGCAUCUCUGG 21 627 52 410 55    0 106 410 56 55 0 0 0 0 0 0 0
gga-miR-1434 GUGCGUGAUGAUGGAAAAUU 20 266 22 184 5    23 7 5 7 7 184 18 15 0 0 0 0
gga-miR-144-3p CUACAGUAUAGAUGAUGUACUC 22 5 0 3 1    0 0 0 3 1 1 0 0 0 0 0 0
gga-miR-144-5p GGAUAUCAUCAUAUACUGUAAG 22 18 2 8 2    0 0 0 8 8 2 0 0 0 0 0 0
gga-miR-145-3p AUUCCUGGAAAUACUGUUCUU 21 201 17 78 1    0 13 29 78 78 2 1 0 0 0 0 0
gga-miR-145-5p GUCCAGUUUUCCCAGGAAUCCCUU 24 225 19 115 1    0 26 115 44 32 3 0 0 1 3 1 0
gga-miR-1451-3p CGUAACUCGCUGCUGUGAGAGGC 23 3 0 1 1    0 1 0 1 1 0 0 0 0 0 0 0
gga-miR-1451-5p UCGCACAGGAGCAAGUUACCGC 22 499 42 404 1    8 11 404 34 27 12 0 2 1 0 0 0
gga-miR-1452 UUGAGAUAAGACAGAGGAUAUU 22 2 0 1 1    0 1 1 0 0 0 0 0 0 0 0 0
gga-miR-1453 UGGGCAGCCUCUCAGUGAGCUCU 23 2 0 1 1    0 0 1 0 0 1 0 0 0 0 0 0
gga-miR-1454 GUACAAUGAUGAGACUUUGGCUCC 24 32 3 9 1    1 1 3 9 3 8 4 3 0 0 0 0
gga-miR-1456-3p CGGGGUCGUCGCCGUCCCUUC 21 2 0 1 1    0 1 1 0 0 0 0 0 0 0 0 0
gga-miR-1456-5p GAAAGGACGGAGGCGGCCCGCGC 23 4 0 2 1    1 0 2 0 1 0 0 0 0 0 0 0
gga-miR-1457 CACUACAGGCUGCAAAAGGGUU 22 1 0 1 1    0 0 1 0 0 0 0 0 0 0 0 0
gga-miR-1458 UUCCUGUGAUGCUCAUGAGAA 21 3 0 2 1    0 2 1 0 0 0 0 0 0 0 0 0
gga-miR-1459 AUCCUGUGAUGUUCUAUAACUGAGGUUU 28 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1460 AAUUUAUUGCAGCCUUCUCAGGGU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1462-3p UAUCUGUCCUUGUGAGCCCCAGA 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1462-5p UGGCUUUCCAUGACAGGUUGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1463 GUUCUAUGAUGCUUUGCUGAGAAUU 25 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1464 UGCUGUUUGCAGGGCCGCCUCGGA 24 1 0 1 1    0 0 0 0 0 0 0 1 0 0 0 0
gga-miR-1465 UUUCAGAGGUGCUGGGUGCUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1466 GCGCUCAGGCUGGUGCUGGGGGAU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1467-3p UCACACCAGAGUAACUGGGAUC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1467-5p UCUCAGCUACAUCGGUGUAAAUC 23 5 0 4 1    0 1 4 0 0 0 0 0 0 0 0 0
gga-miR-146a-3p ACCCAUGGGGCUCAGUUCUUCAG 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-146a-5p UGAGAACUGAAUUCCAUGGGUU 22 396 33 127 1    1 2 24 127 124 95 11 11 1 0 0 0
gga-miR-146b-3p CCCUAUGGAUUCAGUUCUGC 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-146b-5p UGAGAACUGAAUUCCAUAGGCG 22 531 44 145 1    3 92 33 145 136 52 31 34 4 1 0 0
gga-miR-146c-3p AGUCCAUGGUAUUCAGUUCUCU 22 28 2 10 1    10 1 2 2 1 10 0 1 1 0 0 0
gga-miR-146c-5p UGAGAACUGAAUUCCAUGGACUG 23 12,438 1,037 5,586 69    5,586 600 3,090 713 742 1,209 181 169 79 69 0 0
gga-miR-147 GUGUGCGGAAAUGCUUCUGC 20 1 0 1 1    0 0 0 1 0 0 0 0 0 0 0 0
gga-miR-148a-3p UCAGUGCACUACAGAACUUUGU 22 10,988 916 3,829 4    411 3,829 1,386 2,174 2,220 822 50 56 13 4 9 14
gga-miR-148a-5p AAAGUUCUGUGACACUCAGACU 22 14 1 7 1    2 7 1 1 1 1 1 0 0 0 0 0
gga-miR-148b-3p UCAGUGCAUCACAGAACUUGGU 22 46,506 3,876 20,551 1    943 6,662 20,551 5,489 5,403 6,649 364 401 20 20 1 3
gga-miR-148b-5p GAGGUUCUGUCCUACACUCCGGCU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-153-3p UUGCAUAGUCACAAAAGUGA 20 2 0 1 1    0 0 0 1 1 0 0 0 0 0 0 0
gga-miR-153-5p UCAUUUUUGUGAUGUUGCAGCU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-155 UUAAUGCUAAUCGUGAUAGGGG 22 401 33 94 1    0 0 1 84 94 53 79 90 0 0 0 0
gga-miR-1550-3p CUUCACUUACACUGCUCACUGGU 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1550-5p UGAUGGGGGUGUAGUGCAGCA 21 9 1 5 2    2 2 5 0 0 0 0 0 0 0 0 0
gga-miR-1551-3p UGAGUUUGUGUUGCUGCUUUCU 22 4 0 2 1    1 0 2 1 0 0 0 0 0 0 0 0
gga-miR-1551-5p CUAGCAGCAAAAAGAACUUCAGA 23 27 2 9 1    0 9 5 3 3 4 2 1 0 0 0 0
gga-miR-1552-3p CUAGCUGCUCUGCACUGACUG 21 6 1 5 1    0 1 5 0 0 0 0 0 0 0 0 0
gga-miR-1552-5p UUAGUGCGCGGUAAGCUAGGGUG 23 62 5 40 1    0 6 40 1 1 5 9 0 0 0 0 0
gga-miR-1553-3p UGUGGUGGGAGGACAGUGAUGU 22 3 0 3 3    0 3 0 0 0 0 0 0 0 0 0 0
gga-miR-1553-5p AGUCCUGUCCUGUCUACCUACUGU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1554 GCAGGUGAUGAGGCUUUGCUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1555-3p CAGGGUUAUUGGUUUUGUGUGA 22 5 0 3 1    0 1 3 0 1 0 0 0 0 0 0 0
gga-miR-1555-5p AGCAAACCCUUCACCCUGCC 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1556 UGCAGGCUGGAAGUAGGAGUGU 22 1 0 1 1    0 0 1 0 0 0 0 0 0 0 0 0
gga-miR-1557 CCCGUCGGCUGAGCGGCUGC 20 4 0 1 1    1 1 1 0 0 0 1 0 0 0 0 0
gga-miR-1558 CUGCUGUGAUGGGAGCUCUG 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1559-3p AGUUACAUGUAUGCAUCGAGCA 22 16 1 13 1    0 2 13 0 0 1 0 0 0 0 0 0
gga-miR-1559-5p UUCGAUGCUUGUAUGCUACUCC 22 517 43 297 3    6 67 297 54 59 26 5 3 0 0 0 0
gga-miR-1560-3p GCAUCUCUGGACGCGCUCGUUC 22 10 1 7 1    0 2 7 1 0 0 0 0 0 0 0 0
gga-miR-1560-5p GCGGCGCGAGCAGAGAGGCGCU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1561 GCCGGGUUUGCGGCCGCUUUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1562-3p UGUGCCCCGUGUAUGCAGUGCA 22 1 0 1 1    0 0 1 0 0 0 0 0 0 0 0 0
gga-miR-1562-5p GCACUGUAGAUGGAGGGGCUGC 22 1 0 1 1    0 0 1 0 0 0 0 0 0 0 0 0
gga-miR-1563 GCACAUGAUGAGGAAGCACUGAAA 24 62 5 20 1    9 2 8 0 1 6 20 14 1 1 0 0
gga-miR-1564-3p CUCCUCUGCCGUGCUGGUUGUG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1564-5p GCAAUGAACACGGCAGUAGAGGU 23 2 0 1 1    0 0 1 0 0 0 1 0 0 0 0 0
gga-miR-1565 CGAGGGUCGUGCCUGGUUUUGCU 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1567 GACUGCUCAUGGCUGCCUGUUC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1568 GACUCAUAGAUCUGAAGGCAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1569 UGUUUGGGACGUUGCUCUGCAG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1570 GAAGGGUGUGCAGAAGAAUGUGA 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1571 UGUUUCCUAUCCAGGCAGCACU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1572 GAACCUGACACACGGGCCUGC 21 1 0 1 1    0 0 1 0 0 0 0 0 0 0 0 0
gga-miR-1573 UGUUCUGCAGGUGCCAGUCU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1574-3p ACAGGAGGAUGUCAGGAAGCUU 22 1 0 1 1    0 1 0 0 0 0 0 0 0 0 0 0
gga-miR-1574-5p CUGUGACUUCUCCUUGUCAGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1575 CUGGCAGCACGUAGGAGCAGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1576 CUCGGGCGGGCGGAGCGGCAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1577 CUCAGGGGUGGAAGUAGGAGAA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1578 UGUGCCGUUCUGACACAGCUCU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1579 CGUGGCGGGAAGGGAUGGGCG 21 1 0 1 1    0 0 1 0 0 0 0 0 0 0 0 0
gga-miR-1580 CGGCUUCUCGGUACCUGCGUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1581 CGAGCCGAAGGGGUGGGCGCUGC 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1582 GAAAGAGAGCCAGAACACAG 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1583 CGUAGGGCCGUGGGACGGCA 20 1 0 1 1    0 0 0 0 1 0 0 0 0 0 0 0
gga-miR-1584 CCGGGUGGGGCUGGGCUGGG 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1585 AGUGCCCAGGUGUGGUUAAUCCUG 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1586 CAGUCAGCUGUGGGUGGGUGGCA 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1587 GGGCUGGGCUGGGCUGGGCA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1588 CAGGAACCAGCUUUCGGCUCU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1589 CAGCCUCUGCUGAUCGUCUUUU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1590 AGGGACAAAUUGCUCUCUGGAAG 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1591-3p CAGACUUGGCCAUGGGUAGGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1591-5p UGAUUCAUUGCCUGGCUCUGC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1592 CACUGCCUCAGACAACGGGUGU 22 1 0 1 1    0 1 0 0 0 0 0 0 0 0 0 0
gga-miR-1593 ACCAUCUGAUUUGGACACGCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1594 UGGUGGGGAUGGGUUGGGGUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1595-3p UAGCCCCGCUGUCCUACUGCUG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1595-5p AAGCACGAGUGUGGUGGAGCUC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1596-3p AAAGGUGGCCGUGGGUGAAUGA 22 2 0 1 1    0 0 0 0 0 1 1 0 0 0 0 0
gga-miR-1596-5p AUUCUCCUUCAAUCCAUCUUUGU 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1597-3p UGAGGAGCUCUGCAAGCAUGCA 22 2 0 1 1    0 1 0 0 0 1 0 0 0 0 0 0
gga-miR-1597-5p AUGUUUACAGGGCUCUUCAUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1598 AUGGUAGCACGGCAAUGAGCAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1599 GGAGGGAGGAAAAAAAAAAA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-15a UAGCAGCACAUAAUGGUUUGU 21 1,403 117 478 1    8 35 342 478 476 56 4 1 0 3 0 0
gga-miR-15b-3p GAAUCAUUAUUUGCUGCUUUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-15b-5p UAGCAGCACAUCAUGGUUUGCA 22 6,543 545 2,921 1    127 585 2,921 1,172 1,126 548 32 28 3 1 0 0
gga-miR-15c-3p CAGACCAUUCUGGGCUGCCUCA 22 10 1 6 1    0 1 6 2 1 0 0 0 0 0 0 0
gga-miR-15c-5p UAGCAGCACAUCAUGGUUUGUA 22 1,275 106 949 1    39 67 949 85 93 36 2 3 1 0 0 0
gga-miR-16-1-3p CCAGUAUUAACUGUGCUGCUGAA 23 3 0 2 1    0 1 2 0 0 0 0 0 0 0 0 0
gga-miR-16-2-3p CCAAUAUUAUUGUGCUGCUUAA 22 11 1 7 1    0 1 7 1 0 2 0 0 0 0 0 0
gga-miR-16-5p UAGCAGCACGUAAAUAUUGGUG 22 5,862 489 2,640 1    108 194 2,640 1,384 1,384 130 10 6 5 1 0 0
gga-miR-1600 UGGGCUGACAACAGAGGGCC 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1601 AGUGUGAGCAGGUGCAGAGCUG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1602 UGGGCUCUGCAUCACCCCAUGG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1603 AGUGGUUGGUUUGGUGCUGUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1604 UGGGCCCAGGGCUGUGCUGGAGA 23 4 0 3 1    0 0 3 1 0 0 0 0 0 0 0 0
gga-miR-1605 AGGGUUUCAUGUGUAUCUCUUG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1606 AGGGGGCAACAGAACAGUCCUGA 23 1 0 1 1    0 0 1 0 0 0 0 0 0 0 0 0
gga-miR-1607 AGGGGCGGGAGGGGUCGGGC 20 1 0 1 1    0 1 0 0 0 0 0 0 0 0 0 0
gga-miR-1608 UGGGACAGUGGCUGCGCCCUCU 22 1 0 1 1    0 0 0 0 1 0 0 0 0 0 0 0
gga-miR-1609 AGGCUGAGGCUGUGCUGGUUGU 22 1 0 1 1    0 0 1 0 0 0 0 0 0 0 0 0
gga-miR-1610 UGGCUUGUGGUGGAACGGGCG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1611 GGAGGGCUUGCAGGCGGUGUGC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1612 GAAGGAAAAGGAGCUGACUGGG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1613 UACAUGCGUAUAUUCUGGCAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1614-3p CAGGGAGGAACUGCCAGCAGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1614-5p GGCAUGGCAGACUCACCCUGC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1615 UGGCAGCUGCACAGAAGCCCUUU 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1616 UGGAUCCUGCAGUUUGCUUUCA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1617 AGAGGCCUUCAGAUACUGUUUU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1618-3p GAGCCCGGAGCCAGGCUGCUGU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1618-5p UGCAUCCUGGCUCCUGGCGUCC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1619 AGAAUUCAUAGCAAUACGGACU 22 1 0 1 1    0 0 0 0 1 0 0 0 0 0 0 0
gga-miR-1620 ACUUUAAUGGGCUUUGGAUCAC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1621-3p GGUUCGCCGUGCCGCCGCGC 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1621-5p ACCGGCUGCCUCGGUGGCAC 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1622 CACAUAUGAUGAGUACUGAUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1623 GCAGGCACAGACAGGCAGUA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1624 ACACCGCACUGGCAGGGAGCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1625-3p GCAGCAGAAUAUCCCUGCCAUU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1625-5p UGGACCAGGGCUCUUCCUGCUGGCU 25 31 3 19 1    1 5 19 0 0 0 0 6 0 0 0 0
gga-miR-1626-3p UCUGGAAGUUGCCCUGGACGUG 22 1 0 1 1    0 0 1 0 0 0 0 0 0 0 0 0
gga-miR-1626-5p UUUCCAUGGCAGACUUUCUAGGCU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1627-3p CAGCCACGCUACUGUCACUGGU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1627-5p GAAGUGACAUGUGGUUGAUGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1628 AAGAGCUCUUCCUGUUGUGACC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1629 UGCUGUCGGUGGGUUUGUUCU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1630 AAAGAGGAAACUGAAGCUGAAA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1631 AAACUGGCGACGUGGGACGGUC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1632-3p AACUCAUUCAUUAACCAGCUUUU 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1632-5p UGCUUGUUUUUGGAUGAGCUUGC 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1633 UGCGCUUCUGCUCAGCUCGGUGU 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1634 UGCGACGCAUCGGCCUUUCUUC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1635 UGCCCAGGCUGUGCUGUGCUCUGGG 25 2 0 1 1    0 1 1 0 0 0 0 0 0 0 0 0
gga-miR-1636 UGCAGGUGAUGGCGGGGCUG 20 1 0 1 1    0 1 0 0 0 0 0 0 0 0 0 0
gga-miR-1637 UGAUAGCUGCUGUGGCACGGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1638 GUAGUUUGUGUUGUUUGUUU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1639 UUGUGCAAGGUACGUUGGGUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1640 UUGUCACUGCAGGGCCCCGCGGCC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1641 UGAGGAUUAAUGACUGUCUGGG 22 1 0 1 1    0 1 0 0 0 0 0 0 0 0 0 0
gga-miR-1642 UGAGAGGCUGUCAGUUUGUGGGG 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1643-3p UAAAAGUGCUGCUGGUGGAAGAA 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1643-5p UCUUAUCACGAGGAGCACUUUU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1644 UCUGUUGUGCAGGGCUGUGCU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1645 UCUGCUGAAGUACUGUCAGA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1646 UCUGCCCUGCAGCACUGAGAUCU 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1647 UCUCUGCCUGAGGGGUACUCU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1648-3p UGGGAGUGGAGCGGAGCUGUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1648-5p CGGCUCGGCUCGGCUCCGCUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1649-3p CUCCGUGCACUCUGCAGGCA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1649-5p UCCUGCAGAAGGUGCGGCUG 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1650 UCCUCUGAGCUCAGCUUCGCCUCU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1651-3p UUGCUUUUGUUGGCCUCUGCUG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1651-5p GCUAAGACUGAUAAAAGCAAGC 22 4 0 1 1    1 1 0 1 0 1 0 0 0 0 0 0
gga-miR-1652 UCCCUGUGUCCCCUCGGUGGCA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1653 CAGGAGCUGUGCUGCAUGCAGG 22 15 1 11 1    0 3 11 0 0 1 0 0 0 0 0 0
gga-miR-1654 UUGCUGGUGGAGGGAGCUGAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1655-3p AUUUACCCAUGGUGGGCUGAUA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1655-5p UCAGCUGGUCUUGGGUAAAUGC 22 3 0 3 3    0 0 3 0 0 0 0 0 0 0 0 0
gga-miR-1656 UCACCAGCGGGCAUUGGCAUCA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1657 UAUAUGUGUAUUGUUGGUGUGUG 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1658-3p GAGCUGUGGGUUGGUGUUGAUGG 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1658-5p UAUACCACCCCCAGGAGUUCUGC 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1659 UAGGGCAGAAUGAAGGAGUCCCU 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1660 UAGGCCUGUGUUUUUGUGCAUA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1661 UAGCAGAUGUUUAGGAAUGUGCCU 24 4 0 2 1    0 1 0 0 0 1 0 2 0 0 0 0
gga-miR-1662 UUGACAUCAUCAUACUUGGGAU 22 65 5 29 1    0 29 19 8 6 2 0 0 0 0 0 1
gga-miR-1663-3p UGGCAUCCAGAACAGCGGUAC 21 13 1 3 1    3 0 3 3 3 1 0 0 0 0 0 0
gga-miR-1663-5p UACCACUGUCCUGGGUGCCU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1664-3p UCUGUGACCUCAUUUACCUCC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1664-5p CCAGACAGGGAGAGAACAGG 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1665 UAAGGCCCAGGAGCGCUGCAGC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1666 UAACGCCACGGGGCUGAGGCUG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1667-3p UAACAUGAUGUCAGGAUUUCCC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1667-5p GAGAUUCUGACACAAUGUUUAGA 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1668-3p UGCUGUGUCCUCACUCACCUU 21 1 0 1 1    0 0 1 0 0 0 0 0 0 0 0 0
gga-miR-1668-5p GUGGGCUGGGAGCACAGGCACU 22 2 0 1 1    0 1 1 0 0 0 0 0 0 0 0 0
gga-miR-1669 GUGGGCUCAGAGCAGGCACA 20 1 0 1 1    1 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1670 GUGGGACGUAGCCUCACAGUGG 22 1 0 1 1    0 1 0 0 0 0 0 0 0 0 0 0
gga-miR-1671 GUGAGGACUGUUGAGUGGCCAAA 23 1 0 1 1    0 0 0 1 0 0 0 0 0 0 0 0
gga-miR-1672 GUCAGGCCAGGAAGGGAUGUGAGG 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1673 GGUGUGAGUGGAAGUCAGAGGU 22 1 0 1 1    0 0 1 0 0 0 0 0 0 0 0 0
gga-miR-1674 GGGCUAUGAUGCUGGAUUUUCUGAG 25 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1675 GGACGCCAUCUUGACUGUGGGCAG 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1676-3p AGAGCGAAGUGGGUGGGAAUGU 22 6 1 3 3    0 3 3 0 0 0 0 0 0 0 0 0
gga-miR-1676-5p CCUGACUCAUCCCCUUUGCUCC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1677-3p UGACUUCAGUAGGAGCAGGAUU 22 86 7 42 1    0 11 42 17 15 1 0 0 0 0 0 0
gga-miR-1677-5p UCCUGCACCGCUGAAGUCAAU 21 57 5 39 1    0 6 39 6 5 0 0 0 0 1 0 0
gga-miR-1678 UUUGACAAAGACAGAAGGAGCU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1679 UUGUCAGCACAGUGGUAUAUGCA 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1680-3p CAGGCGGUAUCAGGAGGCUGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1680-5p UUCCUCCUGGGUACAACUCUGC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1681 UUCACAUGAUGUCUUGCUGAUG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1682 UGGGUCAGAUGGAGCUGAGGG 21 1 0 1 1    0 0 0 0 0 1 0 0 0 0 0 0
gga-miR-1683 UCUGGGACAGUCACAGCAUCUUU 23 3 0 2 1    0 0 2 1 0 0 0 0 0 0 0 0
gga-miR-1684a-3p AAGUAUGAGGAAAUGGAGCUCU 22 23 2 11 1    0 9 11 1 2 0 0 0 0 0 0 0
gga-miR-1684a-5p AGCUCUGCUUCCUCAUACAUAC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1684b-3p AAGUAUGAGGAAAUGGAGAUCU 22 84 7 65 1    0 65 12 0 0 6 1 0 0 0 0 0
gga-miR-1685-3p ACAGUAAUGGUAUGAACUCAGA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1685-5p UGGAGUCACUACCAGUGCUGUG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1686 UGGAGGCUGUGCGUCAUCCCCA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1687-3p UUGCUGGCUGUUUCUCAGUGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1687-5p UGAGGAAAUGAGCCAGCUGAG 21 2 0 1 1    0 1 1 0 0 0 0 0 0 0 0 0
gga-miR-1688 UGAGCAUGGUAGAGACAAUGAUG 23 1 0 1 1    0 1 0 0 0 0 0 0 0 0 0 0
gga-miR-1689-3p CCGGUGACUGGAAGCAGCGUUGA 23 3 0 1 1    1 0 1 0 0 0 0 1 0 0 0 0
gga-miR-1689-5p UCUCUGCUUACAGUGUCUGGGG 22 2 0 1 1    0 1 1 0 0 0 0 0 0 0 0 0
gga-miR-1690-5p UCCAGAGGCAAAGGAGCACUGCU 23 1 0 1 1    0 0 1 0 0 0 0 0 0 0 0 0
gga-miR-1691 UCAGCUGACCUGGGCCUGCAGUG 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1692 UGUAGCUCAGUUGGUAGAGU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1693 GCAAAGGAUGAAGCUGUGAUG 21 1 0 1 1    0 0 1 0 0 0 0 0 0 0 0 0
gga-miR-1694 GGAGGACGAGGCUGCGAGCGGA 22 1 0 1 1    0 0 0 0 0 0 0 1 0 0 0 0
gga-miR-1695 GAGCACAGUUUGGUCAUGGAGC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1696 CUGCUGUGAUGUGAGCUGAGCAUC 24 2 0 1 1    0 1 0 0 0 0 1 0 0 0 0 0
gga-miR-1697 CUCUCAUGGGACUGUGUGCAGC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1698 CGAGGCUGCGGCAAUCCCUGCG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1699 CCAGAGGGACAUGGCAGGGCAA 22 2 0 1 1    0 0 0 0 1 1 0 0 0 0 0 0
gga-miR-16c-3p CCAGUAUUGCAUUGCUGCUUUA 22 1 0 1 1    0 0 1 0 0 0 0 0 0 0 0 0
gga-miR-16c-5p UAGCAGCACGUAAAUACUGGAG 22 2,408 201 678 1    239 390 678 470 465 148 7 9 1 1 0 0
gga-miR-17-3p ACUGCAGUGAAGGCACUUGU 20 20 2 13 1    1 1 13 4 1 0 0 0 0 0 0 0
gga-miR-17-5p CAAAGUGCUUACAGUGCAGGUAGU 24 461 38 256 1    1 2 256 40 46 16 32 67 0 0 1 0
gga-miR-1700 CAUCAGAGGGAUAGGAUGGAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1701 GGCUGGUUAGUUGGUUGUUU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1702 AUUGCAUUCAGAGCGAGCUGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1703-3p CUCGUGACUUCAGCUCCAGCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1703-5p AGAGGCUGUAGGUCCCGUGCUUU 23 5 0 3 1    0 1 3 1 0 0 0 0 0 0 0 0
gga-miR-1704 ACAGCAGAUUGAUGGGGCACA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1705 AAUCUGGAAGUCAGCACAUGCU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1706 UGUGGAGGUGGGAUGAGGUUCC 22 3 0 1 1    1 1 0 0 0 1 0 0 0 0 0 0
gga-miR-1707 UUUGAGCGGGAUCUGUUAUCGUG 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1708 UGGGGUGUGGAAUGAAUCCUU 21 1 0 1 1    0 0 0 0 1 0 0 0 0 0 0 0
gga-miR-1709 UGGAAUGAUGAGUGCACUGACU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1710 UCAUCUGCUGCAUAACCAUCCA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1711 GUGCAGUGCUGCAUCUCUUC 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1712-3p UUCAGUUAUCAGUGGAGUUUGG 22 3 0 1 1    1 1 0 0 1 0 0 0 0 0 0 0
gga-miR-1712-5p GGCUCCAGUCUUAACUACAGGC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1713 CUCGGAGAGGGAAGAACGCGGUG 23 1 0 1 1    0 0 1 0 0 0 0 0 0 0 0 0
gga-miR-1714 CCUAGUAGGGCUGCUGAGGUGAU 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1715-3p UGACACUGCGGGUACCUCUUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1715-5p AGGAUCAGUAGAAGUCAGCUGUGC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1716 AGCGGGGCGGCUGUGAGCUGAGCU 24 4 0 2 1    0 2 1 0 0 0 1 0 0 0 0 0
gga-miR-1717 ACUCUCUAACCUGACAGAAAACU 23 1 0 1 1    0 0 1 0 0 0 0 0 0 0 0 0
gga-miR-1718 ACUAAGGACAGAGGAACGGAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1719 AAAGAUGAUGAGUUGCUGAUG 21 1 0 1 1    1 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1720-3p AAGCAACGAGAGGUCGGUCUGA 22 3 0 2 1    0 0 2 0 0 1 0 0 0 0 0 0
gga-miR-1720-5p UGAUCACCUCGGACGUUGCUUU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1721 AGAGAUGAUGUUGGUCUGAUG 21 1 0 1 1    1 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1722-3p UAGAGCAUCACCAAGGGGCAAG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1722-5p UGUCACCCUAAGACUGCUCUAAU 23 1 0 1 1    0 0 1 0 0 0 0 0 0 0 0 0
gga-miR-1723 UGGGAGCGGAAUGUGCAGCCUCA 23 5 0 2 1    1 0 2 1 1 0 0 0 0 0 0 0
gga-miR-1724 UGCUGAGCGUUGGCUGCGCUGCG 23 2 0 1 1    0 1 1 0 0 0 0 0 0 0 0 0
gga-miR-1725 UAUGAUAUAGUUAGAGCUGCU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1726 AAGCUUGUUGGGUUUGGUUUGU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1727 AAGCUGCUCUAAUGAACUGAAGG 23 2 0 2 2    0 0 2 0 0 0 0 0 0 0 0 0
gga-miR-1728-3p AGGCUUCUGUAGAUCAGCCAGC 22 2 0 1 1    0 1 1 0 0 0 0 0 0 0 0 0
gga-miR-1728-5p UGGUUGAUCCAUUGGAAGACUGA 23 8 1 3 1    0 3 1 2 1 1 0 0 0 0 0 0
gga-miR-1729-3p CUACUCGGUGAGUAAGGAUAGC 22 5 0 2 1    1 1 2 0 1 0 0 0 0 0 0 0
gga-miR-1729-5p AUCCCUUACUCACAUGAGUAGUC 23 448 37 271 1    1 271 84 55 31 6 0 0 0 0 0 0
gga-miR-1730-3p AAGGCCAUGGCUGUUUGCUGCU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1730-5p CAGCUAACAGAGGUGGAACCUUG 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1731-3p UGGCAGUUCCUUGGUCUUGUCC 22 1 0 1 1    0 0 1 0 0 0 0 0 0 0 0 0
gga-miR-1731-5p ACUUGACUGCAGGCACUGCUGCU 23 1 0 1 1    0 0 1 0 0 0 0 0 0 0 0 0
gga-miR-1732 CACCGUGCUGCUGUCGGGCUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1733 CUGGAUGGCUGUGAAUUGUCU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1734 AUAUGCCCCAAUGUAUAAGCU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1735 AGGGGCUUUGGGCAGCAUCUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1736-3p AGCACCUUCGGAACUGUCCUCA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1736-5p AGGGCAAUUCCUGAUAGGUGCU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1737 CAGCACUGCUGCGCUCGGUG 20 14 1 5 1    1 1 4 3 5 0 0 0 0 0 0 0
gga-miR-1738 ACUGACUGCUCAGAGGGAUUGG 22 2 0 1 1    0 0 1 0 0 1 0 0 0 0 0 0
gga-miR-1739 CACAGGACAGGUAGCCAGGCUGG 23 5 0 1 1    1 1 0 0 1 1 0 1 0 0 0 0
gga-miR-1740-3p UCAUCCAAUUAAACCACAAA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1740-5p UGUAGUUUAAGAGGAUAGGUCUU 23 2 0 1 1    0 1 1 0 0 0 0 0 0 0 0 0
gga-miR-1741 AUGGCUCUGGAUUACACCUU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1742 AAUCGUCGUUCGGGAUCCGC 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1743 UGGAAUGCAGCAAUUAUCACCU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1744-3p ACUUCAACAGGAGCAAGACUGA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1744-5p UGCUCUGUUGAACUCAAAAGCU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1745 UGCUCUGCUUGGCAAACUGCUC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1746 CUCAGAGCUGUGGUCCCAUGGU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1747-3p CCUGAAUCCCUUCAAGUGGACA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1747-5p UGCACUUGAAUGGAGUUCUGGG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1748 ACUGAGGUCUGGGUGCAGCUGA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1749-3p UUGGCUCUGUUCCCUAUUUCC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1749-5p AGAUAAGGAACUGAACUGGCU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1750 UGAGGACCAAGUGCAUCACUGC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1751-5p UGAGCUGCUCUGUUCCUGCAUCC 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1752 UUCUGUUGGAGAGAAGAGACA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1753 GUGAAAUCCGGGUGAAGGCUGU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1754-3p AGGGCAGCUCACAGCACGGGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1754-5p UCGUGCUGGAGCUGUUCUGG 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1755 UCGGUGAAUGGCUUGGCAUG 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1756a UCCAGUGAUUCACACCAGCUGU 22 1 0 1 1    0 0 1 0 0 0 0 0 0 0 0 0
gga-miR-1756b UUCUCUGAUUUACACUAGCUGAG 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1757 UCAGAGGCGGAACAGUAGGUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1758 UCACCAAGCACUUGUCGGGCUAU 23 1 0 1 1    0 0 0 0 0 1 0 0 0 0 0 0
gga-miR-1759-3p GCCUCCUCUCCCAUCCUCUCCUUCU 25 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1759-5p UAGGGUAGGAGGAGAGAGGUGU 22 11 1 10 1    0 1 10 0 0 0 0 0 0 0 0 0
gga-miR-1760 UACCUCCUGUCUGACUGAUUUAU 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1761 CAGGGGUCACUUUUUUGUUU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1762 GGCAGGAGGGAAGCAGAGCUUAGA 24 1 0 1 1    0 0 0 0 0 0 0 1 0 0 0 0
gga-miR-1763 GAGGGCGGGAGCGGAGCGCGGGA 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1763b-3p AAGGGCGGGAAAGGAAGGCGA 21 1 0 1 1    0 1 0 0 0 0 0 0 0 0 0 0
gga-miR-1763b-5p UCGCCUUCCCUUCCCGCCCUUC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1764-3p AGCUGCUUGUUGGCUGGGGAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1764-5p GCUCAGGCAGCAGGAGGCUUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1765 CGGAGCGCGGCCCUGCGCUG 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1766 GGCAGAUGAUUGAAAACUGAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1767 AGGCGAGGAGAACAGCAGCU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1768 GAGCAGAGGAUUGUCGUGCUGA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1769-3p AGUGUGAAAUCUGCCUGAAAGUC 23 18 2 9 1    0 1 9 1 1 6 0 0 0 0 0 0
gga-miR-1769-5p CUUCAGGCUUUUCUCACACCUG 22 3 0 2 1    0 0 2 1 0 0 0 0 0 0 0 0
gga-miR-1770 CUGCGGGGGAGGAGGGAGGGGG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1771 CUCCAAGGCUGUUUCCUCUGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1772-3p UCGUUGUCUGUUCGGUGGCAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1772-5p CGCUGCCAGCGGAGAACGAGUU 22 1 0 1 1    0 0 1 0 0 0 0 0 0 0 0 0
gga-miR-1773-3p GGAGAGGCAUUGUCCCCUGGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1773-5p UGGGGGAGGAGGGACCUCUGCUU 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1774 CCCCUGCUGAGGUUCUGCUUC 21 1 0 1 1    0 0 1 0 0 0 0 0 0 0 0 0
gga-miR-1775-3p UCCUGUAGCCAGAAGAUUCUGA 22 3 0 2 1    0 1 2 0 0 0 0 0 0 0 0 0
gga-miR-1775-5p UGAAUGCUUCGUGCAACAGGAAG 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1776 UGUAGUGAUAAGGAGACUGUCU 22 1 0 1 1    0 1 0 0 0 0 0 0 0 0 0 0
gga-miR-1777 GUGGGCGGUGCGGGGCGGCG 20 4 0 1 1    1 1 0 0 0 0 1 1 0 0 0 0
gga-miR-1778 GAGGGAAGAGAAAUGGUCUGCU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1779 AGACGUGGACUGGAACACCUGAG 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1780 UCUGCGACUGCAUCUCCACUC 21 1 0 1 1    0 0 1 0 0 0 0 0 0 0 0 0
gga-miR-1781-3p UUUAAAUCAUGCAGCUGUUGA 21 22 2 6 2    3 3 2 6 6 2 0 0 0 0 0 0
gga-miR-1781-5p AACAGCUGAGUGAUUUAAAGCA 22 1 0 1 1    0 0 1 0 0 0 0 0 0 0 0 0
gga-miR-1782 ACAUUCAUUGGAGCAGGGACA 21 20 2 9 1    0 1 9 3 2 2 2 1 0 0 0 0
gga-miR-1783 UGCUCUGAACGAGCUGAGAGGCA 23 1 0 1 1    0 1 0 0 0 0 0 0 0 0 0 0
gga-miR-1784-5p UUCUGCUCUUAUUGAAAUCAGU 22 2 0 1 1    0 1 0 0 0 1 0 0 0 0 0 0
gga-miR-1784b-3p UGAUUUCAAUAAGAGCAGAAUU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1784b-5p UUCUGCUCCUAUUUAAGUCAAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1785 UGAGGGCAGCACUGUGUCCGGG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1786 AUUCUUUUCUGCUGUGUUACU 21 2 0 1 1    0 1 1 0 0 0 0 0 0 0 0 0
gga-miR-1787 UGUUGUUUACGGAAGGGGGA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1788-3p CAGGCAGCGAAAGCAAGUCUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1788-5p GGCUUGUUUUCCGUUGCCUGCG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1789 UGGGUGUACUUGCGGAUGAAUG 22 1 0 1 1    0 1 0 0 0 0 0 0 0 0 0 0
gga-miR-1790 CGGGUGAGGGCGGUGGGGGA 20 1 0 1 1    0 0 1 0 0 0 0 0 0 0 0 0
gga-miR-1791-3p GCGAUGUGACUGAUGCAGGCUG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1791-5p UGGGCUGCAUCAGUCAUGCCAUG 23 1 0 1 1    0 0 1 0 0 0 0 0 0 0 0 0
gga-miR-1792 GCGAUAGCUCAGGAACACUGCAG 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1793 UGUAAGGAGCAGAAGUGUGAAGC 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1794 GCCAGAAUGGACAUGGGCAGCAA 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1795 GCAAGAUGAAGAACAGGCCUGU 22 1 0 1 1    0 1 0 0 0 0 0 0 0 0 0 0
gga-miR-1796 GAACUGCUGAAGGAGGGCUGA 21 2 0 1 1    0 1 0 1 0 0 0 0 0 0 0 0
gga-miR-1797 GCUUGGAACUGAGCAGGAACUG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1798-3p UGGUUUUCAGAAGUGUAGCGUU 22 4 0 2 2    0 2 2 0 0 0 0 0 0 0 0 0
gga-miR-1798-5p AACGUGACACUUUAGAAAAC 20 1 0 1 1    0 1 0 0 0 0 0 0 0 0 0 0
gga-miR-1799 UGAAGUGAUGAUGCCUGAUUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1800 ACUACGUGAUGCGAUCUGAUG 21 5 0 5 5    5 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1801 CCCGGCAUGCUGCACUGUCCUG 22 1 0 1 1    0 1 0 0 0 0 0 0 0 0 0 0
gga-miR-1802 CAGUGACUGCUUUUGUGCUUAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1803 AUUGACUUCAGCGGGGUUUGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1804 UCAGAAGUUGUGAAAGCUGCAG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1805-3p UGUAUUGGAACACUACAGCUC 21 1 0 1 1    0 0 0 1 0 0 0 0 0 0 0 0
gga-miR-1805-5p GAGUUGUAGUCUUUCAAACAGA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1806 AGGCAGGAUCACAAGGUCUGGA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1807 GCAGAAUGAGGCUAGAGCUGAG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1808 UUUGUUGGGAAUGAAUACAUAUU 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1809 ACGUGGGAAGUUUGGCAGAGCAUG 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1811 UAUUGCAGCGCUGGGUGCAU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1812-3p CAUACUAUACAGUAUAUAUCUA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1812-5p AUAUAUACUGUAUACUGUGUCA 22 1 0 1 1    0 1 0 0 0 0 0 0 0 0 0 0
gga-miR-1813 UUCUGUGGCUGCAAGGAGAG 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1814 AGGUUGUUUGGUUUUGUUUU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1815 UAGGUUUUAUGGUUUUGUUUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1816 GUAGGUUUUGUGGUUUUGUU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-181a-3p ACCAUCGACCGUUGAUUGUACC 22 199 17 79 3    8 15 79 28 30 36 0 3 0 0 0 0
gga-miR-181a-5p AACAUUCAACGCUGUCGGUGAGU 23 4,667 389 1,753 1    117 363 1,753 844 798 560 107 123 1 1 0 0
gga-miR-181b-1-3p UCACUGAACAAUGAAUGCAAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-181b-2-3p UCACUGAUCAAUGAAUGCAAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-181b-5p AACAUUCAUUGCUGUCGGUGGG 22 651 54 214 22    32 92 214 85 98 80 28 22 0 0 0 0
gga-miR-182-3p UGGUUCUAGACUUGCCAAC 19 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-182-5p UUUGGCAAUGGUAGAACUCACACUG 25 30 3 16 1    2 1 1 0 0 1 16 9 0 0 0 0
gga-miR-183 UAUGGCACUGGUAGAAUUCACUG 23 10 1 4 1    1 4 1 1 1 2 0 0 0 0 0 0
gga-miR-184-3p UGGACGGAGAACUGAUAAGGGU 22 418 35 158 2    0 39 61 147 158 8 2 3 0 0 0 0
gga-miR-184-5p CCUUAUCACUUUUCCAGCCCAGC 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1845 CCGGCUGCGCCCGGAGGA 18 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-184b-3p UGGGCUGGAAAAGUGAUAAGGGG 23 4 0 2 1    0 0 2 1 1 0 0 0 0 0 0 0
gga-miR-184b-5p CCUUAUCAGUUCUCCGUCCAAC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-187-3p UCGUGUCUUGUGUUGCAGCC 20 2 0 2 2    0 0 2 0 0 0 0 0 0 0 0 0
gga-miR-187-5p GGCUACAACACAGGACAUGGGA 22 6 1 5 1    0 1 5 0 0 0 0 0 0 0 0 0
gga-miR-18a-3p ACUGCCCUAAGUGCUCCUUCUG 22 5 0 3 2    2 0 3 0 0 0 0 0 0 0 0 0
gga-miR-18a-5p UAAGGUGCAUCUAGUGCAGAUA 22 50 4 22 1    3 4 22 8 12 1 0 0 0 0 0 0
gga-miR-18b-3p UACUGCCCUAAAUGCUCCUUCUGGC 25 1 0 1 1    0 0 1 0 0 0 0 0 0 0 0 0
gga-miR-18b-5p UAAGGUGCAUCUAGUGCAGUUA 22 50 4 24 1    10 5 24 3 6 0 0 0 0 1 0 1
gga-miR-190a-3p CUAUAUAUCAAACAUAUUCCU 21 1 0 1 1    0 0 1 0 0 0 0 0 0 0 0 0
gga-miR-190a-5p UGAUAUGUUUGAUAUAUUAGGU 22 5 0 2 1    2 0 0 1 1 1 0 0 0 0 0 0
gga-miR-190b-3p CUAAAUAUCAAACAUAUUCUUA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-190b-5p UGAUAUGUUUGAUAUUAGGUUG 22 5 0 2 1    2 1 1 1 0 0 0 0 0 0 0 0
gga-miR-191-3p CUGCCCUGGGAUUUCGUUACC 21 49 4 16 1    4 0 4 16 14 10 0 1 0 0 0 0
gga-miR-191-5p CAACGGAAUCCCAAAAGCAGCUG 23 23,793 1,983 8,169 44    489 134 2,357 8,169 7,765 4,126 310 350 44 49 0 0
gga-miR-193a-3p AACUGGCCUACAAAGUCCCAGU 22 278 23 181 1    0 181 66 17 13 1 0 0 0 0 0 0
gga-miR-193a-5p UGGGUCUUUGCGGGCGAGAUGA 22 798 67 563 1    3 214 563 6 9 1 0 0 1 1 0 0
gga-miR-193b-3p AACUGGCCCACAAAGUCCCGCUUU 24 84 7 17 1    0 0 4 1 8 17 17 10 13 14 0 0
gga-miR-193b-5p CGGGGUUUUGGGGGCGAGAUGA 22 17 1 8 1    0 3 8 1 1 1 1 2 0 0 0 0
gga-miR-194 UGUAACAGCAACUCCAUGUGGA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-196-1-3p CAAGAACAUCAAACUACCUGAU 22 24 2 24 24    0 0 24 0 0 0 0 0 0 0 0 0
gga-miR-196-2-3p CUACAGCACGAAACUGCCUUAA 22 2 0 2 2    0 0 2 0 0 0 0 0 0 0 0 0
gga-miR-196-5p UAGGUAGUUUCAUGUUGUUGG 21 197 16 105 1    0 105 91 0 0 0 0 0 0 0 1 0
gga-miR-199-3p UACAGUAGUCUGCACAUUGG 20 113 9 51 1    0 51 13 24 24 1 0 0 0 0 0 0
gga-miR-199-5p CCCAGUGUUCAGACUACCUGUUC 23 211 18 113 1    0 67 113 12 18 1 0 0 0 0 0 0
gga-miR-199b CAGUAGUCUGCACAUUUGGU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-19a-3p UGUGCAAAUCUAUGCAAAACUGA 23 180 15 139 1    10 5 139 10 11 1 1 2 0 1 0 0
gga-miR-19a-5p AGUUUUGCAUAGUUGCACUAC 21 3 0 1 1    1 0 1 0 1 0 0 0 0 0 0 0
gga-miR-19b-3p UGUGCAAAUCCAUGCAAAACUGA 23 4,304 359 3,489 3    126 42 3,489 259 233 122 16 9 3 5 0 0
gga-miR-19b-5p AGUUUUGCAGGUUUGCAUCCAGC 23 23 2 20 1    0 0 20 1 0 2 0 0 0 0 0 0
gga-miR-1a-1-5p ACAUACUUCUUUAUAUGCCCAUA 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1a-2-5p ACAUACUUCUUUAUGUACCCAUA 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1a-3p UGGAAUGUAAAGAAGUAUGUA 21 1,036 86 580 1    0 580 43 204 188 17 0 1 3 0 0 0
gga-miR-1b-3p UGGAAUGUUAAGAAGUAUGUA 21 8 1 4 1    0 3 0 1 4 0 0 0 0 0 0 0
gga-miR-1b-5p ACAUACUUCUUCAUAUGCCCAUA 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-1c UGGAAUGGAAAGCAGUAUGUAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-200a-3p UAACACUGUCUGGUAACGAUGU 22 352 29 346 1    0 1 346 1 1 1 0 0 1 1 0 0
gga-miR-200a-5p CAUCUUACUAGACAGUGCUGGA 22 21 2 21 21    0 0 21 0 0 0 0 0 0 0 0 0
gga-miR-200b-3p UAAUACUGCCUGGUAAUGAUGAU 23 1,930 161 1,914 1    0 10 1,914 1 2 0 0 0 3 0 0 0
gga-miR-200b-5p UCUUACUGGGCAGCAUUGGA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-202-3p AGAGGCAUAGAGCAUGGGAAAA 22 1 0 1 1    0 0 1 0 0 0 0 0 0 0 0 0
gga-miR-202-5p UUUCCUAUGCAUAUACUUCUUU 22 24 2 23 1    0 1 23 0 0 0 0 0 0 0 0 0
gga-miR-203a GUGAAAUGUUUAGGACCACUUG 22 302 25 211 1    2 211 85 1 0 2 0 1 0 0 0 0
gga-miR-203b-3p UUGAACUGUUAAGAACCACUGC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-204 UUCCCUUUGUCAUCCUAUGCCU 22 127 11 72 1    20 14 72 6 8 6 1 0 0 0 0 0
gga-miR-205a UCCUUCAUUCCACCGGAGUCUG 22 3 0 1 1    0 1 1 1 0 0 0 0 0 0 0 0
gga-miR-205b CCCUUCAUUCCACCGGAAUCUG 22 7 1 6 1    0 1 6 0 0 0 0 0 0 0 0 0
gga-miR-205c-3p GACUCCGGUGGAAUGAAGGA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-205c-5p GCUUCACUCCACUGAAAUCUGG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-206 UGGAAUGUAAGGAAGUGUGUGG 22 30,820 2,568 30,797 1    6 30,797 8 2 2 1 0 3 1 0 0 0
gga-miR-20a-3p AAUCUACUGCAUUAUAAGCACUUAAAGU 28 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-20a-5p UAAAGUGCUUAUAGUGCAGGUAG 23 1,811 151 888 3    98 78 888 290 265 128 29 27 5 3 0 0
gga-miR-20b-3p ACUGUAAUGUGGGCACUUACAG 22 6 1 2 1    2 1 1 1 1 0 0 0 0 0 0 0
gga-miR-20b-5p CAAAGUGCUCAUAGUGCAGGUAG 23 3,074 256 1,899 5    102 206 1,899 342 355 90 32 34 9 5 0 0
gga-miR-21-3p CAACAACAGUCGGUAGGCUGUC 22 12 1 6 1    2 6 2 1 1 0 0 0 0 0 0 0
gga-miR-21-5p UAGCUUAUCAGACUGAUGUUGA 22 38,621 3,218 8,779 1    4,185 5,205 8,666 8,499 8,779 2,907 132 160 56 31 0 1
gga-miR-210a-3p CUGUGCGUGUGACAGCGGCUAA 22 2,734 228 2,247 1    8 177 2,247 104 102 61 16 18 1 0 0 0
gga-miR-210a-5p AGCCACUGACUAACGCACAUUG 22 1,820 152 1,646 2    15 52 1,646 19 28 50 2 8 0 0 0 0
gga-miR-210b-3p AUGUGCGUUAGUCAGUGGCUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-210b-5p UUAGCCGCUGUCACACGCAC 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-211 UUCCCUUUGUCAUCCUAUGCCU 22 127 11 72 1    20 14 72 6 8 6 1 0 0 0 0 0
gga-miR-212-3p UAACAGUCUACAGUCAUGGCU 21 15 1 14 1    0 0 14 1 0 0 0 0 0 0 0 0
gga-miR-212-5p ACCUUGGCUCUAGACUGCUUACU 23 255 21 86 1    1 85 86 28 28 24 2 1 0 0 0 0
gga-miR-2126 AGCGGCGCGGUAGGAGCA 18 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-2127 CGGGAGGGGAGGGAGGGCGGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-2128 UGCAGUGACGUCUCUUCCCC 20 1 0 1 1    0 0 1 0 0 0 0 0 0 0 0 0
gga-miR-2129 CAGCAGGACUGGCUUUGUUACGA 23 1 0 1 1    0 0 0 1 0 0 0 0 0 0 0 0
gga-miR-2130 UCCCAGUGGAGCUCUGCAAGGAC 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-2131-3p CUGUUACUGUUCUUCUGAUGG 21 29 2 12 1    1 12 6 5 3 2 0 0 0 0 0 0
gga-miR-2131-5p AUGCAGAAGUGCACGGAAACAGCU 24 142 12 85 2    2 15 85 6 11 10 6 7 0 0 0 0
gga-miR-214 ACAGCAGGCACAGACAGGCAG 21 152 13 54 1    0 50 54 21 26 0 0 0 1 0 0 0
gga-miR-214b-3p CACAGCAAGUGUAGACAGGCA 21 6 1 2 1    2 1 2 0 1 0 0 0 0 0 0 0
gga-miR-214b-5p UGCCUGUCUGUGCCUGCUGUAC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-215-3p CCUGUCAUUUCUAUAGGCCAAUA 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-215-5p AUGACCUAUGAAUUGACAGAC 21 29 2 13 1    1 13 5 2 3 4 0 0 1 0 0 0
gga-miR-216a UAAUCUCAGCUGGCAACUGUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-216b AAAUCUCUGCAGGCAAAUGUGA 22 12 1 4 1    0 2 2 4 3 0 0 0 0 1 0 0
gga-miR-216c AUCUCUACAGGUAAUUGUGAGA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-217-3p CCAUCAGUUCCUAAUGCAUUGCC 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-217-5p UACUGCAUCAGGAACUGAUUGGAU 24 2 0 1 1    0 1 0 0 0 0 0 0 0 1 0 0
gga-miR-218-3p CAUGGUUCUGUCAAGCACCAUG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-218-5p UUGUGCUUGAUCUAACCAUGU 21 154 13 134 3    0 14 134 3 3 0 0 0 0 0 0 0
gga-miR-2184a-3p GCAUGUGAGCUCCUACUGCCGC 22 11 1 10 1    0 1 10 0 0 0 0 0 0 0 0 0
gga-miR-2184a-5p AACAGUAAGAGUUGAUGUGCGG 22 4,050 338 1,887 2    25 1,887 1,479 312 303 32 10 2 0 0 0 0
gga-miR-2184b-3p ACAUCAACUCUUACUGUUCGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-2184b-5p CGGCAGUAGGAGCUCACAUGC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-2188-3p GAUAUAUGUGGUCAGACCUAUC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-2188-5p AAGGUCCAACCUCACAUGUCCU 22 1,716 143 721 1    0 1 10 721 674 272 7 15 9 7 0 0
gga-miR-219a UGAUUGUCCAAACGCAAUUCU 21 1 0 1 1    0 0 0 0 1 0 0 0 0 0 0 0
gga-miR-219b CACAAGAAUUGCGUUUGGACAA 22 1,175 98 391 9    39 96 47 391 362 220 11 9 0 0 0 0
gga-miR-22-3p AAGCUGCCAGUUGAAGAACUGU 22 6,994 583 3,455 1    310 987 3,455 1,042 1,015 155 11 15 1 3 0 0
gga-miR-22-5p AGUUCUUCAGUGGCAAGCUUUA 22 393 33 303 1    3 58 303 7 11 10 1 0 0 0 0 0
gga-miR-221-3p AGCUACAUUGUCUGCUGGGUUUC 23 50,393 4,199 25,744 3    4,928 6,721 25,744 1,832 1,903 3,978 2,636 2,577 30 32 3 9
gga-miR-221-5p AACCUGGCAUACAAUGUAGAUUUCUGU 27 114 10 60 1    0 0 1 0 0 1 52 60 0 0 0 0
gga-miR-222a AGCUACAUCUGGCUACUGGGUCUC 24 29,585 2,465 15,622 1    2,981 3,228 15,622 240 253 1,663 2,780 2,785 15 14 1 3
gga-miR-222b-3p AGCUACAUCUGAUUACUGGGUCAC 24 4,694 391 1,775 1    159 1 698 54 61 203 1,725 1,775 7 11 0 0
gga-miR-222b-5p UGCUCAGUAGUCAGUGUAGGAUCUGU 26 528 44 263 1    1 0 2 0 0 13 248 263 1 0 0 0
gga-miR-223 UGUCAGUUUGUCAAAUACCCC 21 56 5 27 1    1 0 7 27 19 2 0 0 0 0 0 0
gga-miR-23b-3p AUCACAUUGCCAGGGAUUACC 21 96 8 41 1    0 3 41 23 25 3 1 0 0 0 0 0
gga-miR-23b-5p GGGUUCCUGGCAUGAUGAUUU 21 19 2 13 1    1 4 13 0 0 0 0 1 0 0 0 0
gga-miR-24-3p UGGCUCAGUUCAGCAGGAACAG 22 6,112 509 4,024 1    274 958 4,024 408 412 18 7 9 1 1 0 0
gga-miR-24-5p GUGCCUACUGAGCUGAUAUCAGU 23 1 0 1 1    0 0 0 0 1 0 0 0 0 0 0 0
gga-miR-26a-2-5p UUCAAGUAAUCCAGGAUAGGCU 22 34,232 2,853 11,893 6    788 1,925 11,893 8,240 7,999 3,008 156 167 17 23 10 6
gga-miR-26a-3p CCUAUUCUUGGUUACUUGCACUG 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-26a-5p UUCAAGUAAUCCAGGAUAGGC 21 1,821 152 640 1    38 64 640 479 441 134 12 12 0 0 0 1
gga-miR-27b-3p UUCACAGUGGCUAAGUUCUGC 21 603 50 282 1    3 108 282 83 84 34 2 6 1 0 0 0
gga-miR-27b-5p AGAGCUUAGCUGAUUGGUGAACA 23 75 6 37 2    3 18 37 7 4 4 0 2 0 0 0 0
gga-miR-2954 CAUCCCCAUUCCACUCCUAGCA 22 2,112 176 1,061 1    10 111 1,061 293 267 307 33 26 1 3 0 0
gga-miR-2984-3p AUUUCACUCUCAGCAGGCUCC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-2984-5p GUGCCUGCUGUGAGUGAAAUUG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-2985-2-3p UGUUAUAGUAUCCCACCUACCC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-2985-3p UGUUAUAGUAUUCCACCUUCCC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-2985-5p GUGGGUGGAAUAGUAUAACAAU 22 1 0 1 1    0 1 0 0 0 0 0 0 0 0 0 0
gga-miR-29a-3p UAGCACCAUUUGAAAUCGGUU 21 449 37 127 1    28 16 107 127 120 41 6 3 1 0 0 0
gga-miR-29a-5p CUGAUUUCUUUUGGUGUUCAGA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-29b-1-5p AGCUGGUUUCAUAUGGUGGUUUAGA 25 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-29b-2-5p AGCUGGUUUCACAUGGUGGCUUAGA 25 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-29b-3p UAGCACCAUUUGAAAUCAGUGUU 23 490 41 134 3    47 83 42 93 65 134 7 9 7 3 0 0
gga-miR-29c-3p UAGCACCAUUUGAAAUCGGU 20 26 2 7 1    2 1 3 6 7 4 2 1 0 0 0 0
gga-miR-29c-5p CCGAUUUCUCUUGGUGUUCAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-301a-3p CAGUGCAAUAAUAUUGUCAAAGCAU 25 40 3 34 1    0 1 34 0 3 0 0 2 0 0 0 0
gga-miR-301a-5p UCUGACAAUGUUGCACUACU 20 2 0 1 1    1 0 0 0 1 0 0 0 0 0 0 0
gga-miR-301b-3p CAGUGCAAUAGUAUUGUCAAAGCAU 25 70 6 43 1    1 2 43 9 13 1 0 1 0 0 0 0
gga-miR-301b-5p GCUCUGACUUUAUUGCACUACU 22 108 9 33 5    5 26 33 19 17 8 0 0 0 0 0 0
gga-miR-302a AAGUGCUUCCAUGUUUUAGUGA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-302b-3p UAAGUGCUUCCAUGUUUUAGUAG 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-302b-5p ACUUUAACAUGGAGGUGCUUUCU 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-302c-3p UAAGUGCUUCCAUGUUUCAGUGG 23 2 0 1 1    0 0 0 0 0 0 1 1 0 0 0 0
gga-miR-302c-5p UUUAACAUGGAGGUACCUGCUG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-302d UAAGUGCUUCCAUGUUUUAGUUG 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-3064-3p UUGCCACACUGCAACACUUUACA 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-3064-5p UGGCUGUUGUGGUGUGCAAAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-30a-3p CUUUCAGUCGGAUGUUUGCAGC 22 725 60 460 1    0 111 460 65 80 8 1 0 0 0 0 0
gga-miR-30a-5p UGUAAACAUCCUCGACUGGAAG 22 1,648 137 571 1    3 99 346 568 571 51 2 7 1 0 0 0
gga-miR-30b-3p CUGGGGGGUGGAUGUUUACUUC 22 9 1 3 1    2 1 3 1 1 1 0 0 0 0 0 0
gga-miR-30b-5p UGUAAACAUCCUACACUCAGCU 22 657 55 509 1    8 16 509 54 44 24 1 1 0 0 0 0
gga-miR-30c-1-3p UGGGAGAGGAUUGUUUACGCC 21 99 8 24 2    8 6 17 22 24 20 0 2 0 0 0 0
gga-miR-30c-2-3p UGGGAGAAGGCUGUUUACUCU 21 29 2 24 1    0 2 24 2 1 0 0 0 0 0 0 0
gga-miR-30c-5p UGUAAACAUCCUACACUCUCAGCU 24 2,236 186 1,531 2    34 69 1,531 167 160 214 20 26 9 4 2 0
gga-miR-30d UGUAAACAUCCCCGACUGGAAG 22 2,037 170 691 12    188 64 691 468 420 170 12 24 0 0 0 0
gga-miR-30e-3p UUUCAGUCGGAUGUUUACAGC 21 76 6 18 2    4 8 17 18 17 10 0 2 0 0 0 0
gga-miR-30e-5p UGUAAACAUCCUUGACUGG 19 30 3 15 1    0 1 2 11 15 1 0 0 0 0 0 0
gga-miR-31-3p UGCUAUGCCAACAUAUUGUCAUC 23 11 1 9 1    0 1 9 0 0 1 0 0 0 0 0 0
gga-miR-31-5p AGGCAAGAUGUUGGCAUAGCUG 22 1,653 138 1,495 1    0 126 1,495 2 5 23 1 1 0 0 0 0
gga-miR-32-3p AAUUUAGUGUGUGCGAUACU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-32-5p UAUUGCACAUUACUAAGUUGC 21 22 2 9 1    0 1 3 7 9 2 0 0 0 0 0 0
gga-miR-33-2-5p GUGCAUUGUAGUUGCAUUGCAU 22 18 2 7 3    0 7 0 3 5 3 0 0 0 0 0 0
gga-miR-33-3p AAUGUUCCUGCAGUGCAGUA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-33-5p GUGCAUUGUAGUUGCAUUGC 20 457 38 190 1    93 190 13 83 76 1 0 1 0 0 0 0
gga-miR-338-3p UCCAGCAUCAGUGAUUUUGUUGA 23 173 14 60 6    9 15 30 60 53 6 0 0 0 0 0 0
gga-miR-338-5p AACAAUAUCCUGGUGCUGAGU 21 6 1 2 1    1 1 2 2 0 0 0 0 0 0 0 0
gga-miR-34a-3p CAAUCAGCAAGUAUACUGCCCUA 23 3 0 1 1    1 1 1 0 0 0 0 0 0 0 0 0
gga-miR-34a-5p UGGCAGUGUCUUAGCUGGUUGUU 23 23 2 9 1    2 7 9 3 1 1 0 0 0 0 0 0
gga-miR-34b-3p AAUCACUAAAUUCACUGCCAUC 22 1 0 1 1    0 0 0 0 1 0 0 0 0 0 0 0
gga-miR-34b-5p CAGGCAGUGUAGUUAGCUGAUUG 23 4 0 1 1    0 0 0 1 1 0 0 0 1 1 0 0
gga-miR-34c-3p AAUCACUAACCACACAGCCAGG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-34c-5p AGGCAGUGUAGUUAGCUGAUUGC 23 51 4 13 1    5 1 2 11 13 1 0 2 8 8 0 0
gga-miR-3523 CCGCGCAGUGCCUCGUCCUCGA 22 107 9 73 2    0 12 73 2 2 8 5 5 0 0 0 0
gga-miR-3524a CAGAAUCGCAGAAUGGCUGAGG 22 5 0 2 1    0 0 1 2 1 1 0 0 0 0 0 0
gga-miR-3524b-3p CACAGAAUUGUGGGAUGGCUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-3525 CAGCCAUUCUGCGAUUCUGUGA 22 11 1 4 1    0 2 4 1 3 1 0 0 0 0 0 0
gga-miR-3526 UUGAAGAUGAAGUUGGUGU 19 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-3528 CAUGCCCCAGUCGUGUUGCAGA 22 8 1 3 1    0 0 0 1 2 0 2 0 0 3 0 0
gga-miR-3529 AGGCAGACUGUGACUUGUUGU 21 20 2 8 1    3 6 8 1 1 1 0 0 0 0 0 0
gga-miR-3530-3p CAAUGGUGUGAGCUGGGAUGG 21 6 1 4 1    0 4 0 1 1 0 0 0 0 0 0 0
gga-miR-3530-5p GCUCUGCUCGCACCAUUGUGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-3531-3p CCUUGCAACACAAACAGGAGACA 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-3531-5p UCCUUGUUUGGGUUGUAAUGA 21 5 0 2 1    0 1 0 1 2 1 0 0 0 0 0 0
gga-miR-3532-3p UUGGAGGCUGCAGUGUCAUGGU 22 27 2 15 2    0 15 7 2 3 0 0 0 0 0 0 0
gga-miR-3532-5p GUUGCACUGCAGCUGCUCUUGG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gga-miR-3533 AUGAAGUGUGAUGUGGAUAU 20 3 0 2 1    0 0 0 1 2 0 0 0 0 0 0 0
gga-miR-3534 UGUGGGUUGACAGUGCUGAGGU 22 10 1 5 1    3 5 1 1 0 0 0 0 0 0 0 0
gga-miR-3535 GGAUAUGAUGACUGAUUAUCUGAAA 25 118 10 56 1    1 1 4 1 1 14 56 39 1 0 0 0
gga-miR-3536 CUGCAUACGAGUAGACCCUUUC 22 7 1 3 1    0 0 0 3 2 1 0 1 0 0 0 0
gga-miR-3537 GUGAGUGCUGUAGGAUGGGGCUC 23 15 1 7 1    0 0 0 0 1 2 5 7 0 0 0 0
gga-miR-3538 GUUCGGUGAUGAAACCAUGGA 21 12 1 4 1    3 1 1 1 2 4 0 0 0 0 0 0
gga-miR-3539 CAGAGGAAGACUGAUGCUAGUU 22 8 1 4 1    0 2 1 1 4 0 0 0 0