Common_bean miRNA Abundances

The data below are based on the microRNAs listed in the Sanger registry. Adjust libraries/reads to display on the control panel.

        

        miRNA         miRNA sequence Len Sum (norm) Average Max Min (>0)  CB_FLCB_SDLCB_RTCB_LFCB_ND
pvu-miR1514a UUCAUUUUGAAAAUAGGCAUUG 22 5,719 1,144 3,564 250    3,564 404 1,235 250 266
pvu-miR159a.1 UUUGGAUUGAAGGGAGCUCUA 21 1,772,105 354,421 716,413 88,184    716,413 587,492 177,321 88,184 202,695
pvu-miR159a.2 CUUCCAUAUCUGGGGAGCUUC 21 483 97 170 17    170 30 152 17 114
pvu-miR166a UCGGACCAGGCUUCAUUCCCC 21 159,777 31,955 76,829 7,324    35,694 19,617 20,313 7,324 76,829
pvu-miR2118 UUGCCGAUUCCACCCAUUCCUA 22 35,812 7,162 13,421 314    11,382 2,297 13,421 314 8,398
pvu-miR2119 UCAAAGGGAGUUGUAGGGGAA 21 2,329 466 1,401 8    29 8 1,401 112 779
pvu-miR319c UUGGACUGAAGGGAGCUCCUU 21 47 12 22 7    7 22 10 0 8
pvu-miR399a UGCCAAAGGAGAGUUGCCCUG 21 380 76 228 3    82 3 22 45 228
pvu-miR482-3p UCUUCCCAAUUCCGCCCAUUCC 22 345 86 204 6    204 0 54 6 81
pvu-miR482-5p GGAAUGGGCUGAUUGGGAAGCA 22 152 38 118 8    0 13 13 118 8