Cassava miRNA Abundances

The data below are based on the microRNAs listed in the Sanger registry. Adjust libraries/reads to display on the control panel.

        

        miRNA         miRNA sequence Len Sum (norm) Average Max Min (>0)  Cassa_SteCassa_LfCassa_Calsm3684Msm3684_13F
mes-miR1446 UUCUGAACUCUCUCCCUCAU 20 0 0 0 0    0 0 0 0 0
mes-miR156a UGACAGAAGAGAGUGAGCAC 20 6,681 1,336 4,162 169    1,479 4,162 169 437 434
mes-miR156b UGACAGAAGAGAGUGAGCAC 20 6,681 1,336 4,162 169    1,479 4,162 169 437 434
mes-miR156c UGACAGAAGAGAGUGAGCAC 20 6,681 1,336 4,162 169    1,479 4,162 169 437 434
mes-miR156d UGACAGAAGAGAGUGAGCAC 20 6,681 1,336 4,162 169    1,479 4,162 169 437 434
mes-miR156e UGACAGAAGAGAGUGAGCAC 20 6,681 1,336 4,162 169    1,479 4,162 169 437 434
mes-miR156f UGACAGAAGAGAGUGAGCAC 20 6,681 1,336 4,162 169    1,479 4,162 169 437 434
mes-miR156g UGACAGAAGAGAGUGAGCAC 20 6,681 1,336 4,162 169    1,479 4,162 169 437 434
mes-miR156h UUGACAGAAGAUAGAGAGCAC 21 255,174 51,035 137,790 1,790    137,790 65,635 1,790 33,808 16,151
mes-miR156i UUGACAGAAGAUAGAGAGCAC 21 255,174 51,035 137,790 1,790    137,790 65,635 1,790 33,808 16,151
mes-miR156j UUGACAGAAGAUAGAGAGCAC 21 255,174 51,035 137,790 1,790    137,790 65,635 1,790 33,808 16,151
mes-miR156k UGACAGAAGAGAGAGAGCACA 21 16 5 9 1    1 0 0 9 6
mes-miR159a UUUGGAUUGAAGGGAGCUCUA 21 889,276 177,855 423,106 37,074    212,756 423,106 61,906 154,434 37,074
mes-miR159b UUUGGAUUGAAGGGAGCUCUA 21 889,276 177,855 423,106 37,074    212,756 423,106 61,906 154,434 37,074
mes-miR159c AUUGGAGUGAAGGGAGCUCUG 21 1 1 1 1    1 0 0 0 0
mes-miR159d AUUGGAGUGAAGGGAGCUCUG 21 1 1 1 1    1 0 0 0 0
mes-miR160a UGCCUGGCUCCCUGUAUGCCA 21 4,265 853 1,763 149    1,281 1,763 607 465 149
mes-miR160b UGCCUGGCUCCCUGUAUGCCA 21 4,265 853 1,763 149    1,281 1,763 607 465 149
mes-miR160c UGCCUGGCUCCCUGUAUGCCG 21 17 4 7 3    7 4 0 3 3
mes-miR160d UGCCUGGCUCCCUGUAUGCCA 21 4,265 853 1,763 149    1,281 1,763 607 465 149
mes-miR160e UGCCUGGCUCCCUGAAUGCCAUC 23 0 0 0 0    0 0 0 0 0
mes-miR160f UGCCUGGCUCCCUGAAUGCCAUC 23 0 0 0 0    0 0 0 0 0
mes-miR160g UGCCUGGCUCCCUGUAUGCCAUC 23 1 1 1 1    1 0 0 0 0
mes-miR160h UGCCUGGCUCCCUGUAUGCCAUU 23 4 1 1 1    1 1 1 1 0
mes-miR162 UCGAUAAACCUCUGCAUCCAG 21 10,918 2,184 5,766 705    2,184 1,289 705 5,766 974
mes-miR164a UGGAGAAGCAGGGCACGUGCA 21 710 142 263 7    129 263 7 210 101
mes-miR164b UGGAGAAGCAGGGCACGUGCA 21 710 142 263 7    129 263 7 210 101
mes-miR164c UGGAGAAGCAGGGCACGUGCA 21 710 142 263 7    129 263 7 210 101
mes-miR164d UGGAGAAGCAGGGCACAUGCU 21 5 3 3 2    0 0 3 2 0
mes-miR166a UCGGACCAGGCUUCAUUCCCC 21 12,738,872 2,547,774 4,614,815 341,939    1,787,215 3,822,900 341,939 2,172,003 4,614,815
mes-miR166b UCGGACCAGGCUUCAUUCCCC 21 12,738,872 2,547,774 4,614,815 341,939    1,787,215 3,822,900 341,939 2,172,003 4,614,815
mes-miR166c UCGGACCAGGCUUCAUUCCCC 21 12,738,872 2,547,774 4,614,815 341,939    1,787,215 3,822,900 341,939 2,172,003 4,614,815
mes-miR166d UCGGACCAGGCUUCAUUCCCC 21 12,738,872 2,547,774 4,614,815 341,939    1,787,215 3,822,900 341,939 2,172,003 4,614,815
mes-miR166e UCGGACCAGGCUUCAUUCCCC 21 12,738,872 2,547,774 4,614,815 341,939    1,787,215 3,822,900 341,939 2,172,003 4,614,815
mes-miR166f UCGGACCAGGCUUCAUUCCCC 21 12,738,872 2,547,774 4,614,815 341,939    1,787,215 3,822,900 341,939 2,172,003 4,614,815
mes-miR166g UCGGACCAGGCUUCAUUCCCC 21 12,738,872 2,547,774 4,614,815 341,939    1,787,215 3,822,900 341,939 2,172,003 4,614,815
mes-miR166h UCGGACCAGGCUUCAUUCCCGU 22 2,952 590 1,133 97    187 1,133 97 703 832
mes-miR166i UUGGACCAGGCUUCAUUCCCC 21 4,762 952 1,722 115    605 1,286 115 1,034 1,722
mes-miR166j UCGGACCAGGCUUCAUUCCUC 21 14,036 2,807 5,971 175    5,971 5,013 175 1,028 1,849
mes-miR167a UGAAGCUGCCAGCAUGAUCUG 21 39,136 7,827 21,662 739    739 21,662 1,107 7,701 7,927
mes-miR167b UGAAGCUGCCAGCAUGAUCUA 21 1,057 211 886 14    68 886 64 25 14
mes-miR167c UGAAGCUGCCAGCAUGAUCUA 21 1,057 211 886 14    68 886 64 25 14
mes-miR167d UGAAGCUGCCAGCAUGAUCUGA 22 10,373 2,075 5,324 186    186 5,324 499 2,341 2,023
mes-miR167e UGAAGCUGCCAGCAUGAUCUGA 22 10,373 2,075 5,324 186    186 5,324 499 2,341 2,023
mes-miR167f UGAAGCUGCCAGCAUGAUCUGA 22 10,373 2,075 5,324 186    186 5,324 499 2,341 2,023
mes-miR167g UGAAGCUGCCAGCAUGAUCUU 21 11,106 2,221 5,229 27    27 5,229 67 3,820 1,963
mes-miR167h UGAAGCUGCCAGCAUGAUCUU 21 11,106 2,221 5,229 27    27 5,229 67 3,820 1,963
mes-miR168a UCGCUUGGUGCAGGUCGGGAA 21 15,192 3,038 5,829 1,567    1,567 1,952 1,647 5,829 4,197
mes-miR169a CAGCCAAGGAUGACUUGCCGG 21 223 45 146 3    146 42 3 19 13
mes-miR169aa UAGCCAAGGAUGACUUGCCUG 21 228 57 139 10    68 139 0 11 10
mes-miR169ab UAGCCAAGGAUGACUUGCCUA 21 42 14 35 2    35 5 0 0 2
mes-miR169ac UAGCCAAGGAUGACUUGCCUA 21 42 14 35 2    35 5 0 0 2
mes-miR169b CAGCCAAGGAUGACUUGCCGG 21 223 45 146 3    146 42 3 19 13
mes-miR169c CAGCCAAGGAUGACUUGCCGG 21 223 45 146 3    146 42 3 19 13
mes-miR169d CAGCCAAGGAUGACUUGCCGG 21 223 45 146 3    146 42 3 19 13
mes-miR169e CAGCCAAGGAUGACUUGCCGG 21 223 45 146 3    146 42 3 19 13
mes-miR169f UAGCCAAGGAUGACUUGCCGG 21 268 89 205 1    0 1 0 205 62
mes-miR169g CAGCCAAGGAUGACUUGCCGA 21 3 1 1 1    0 1 1 0 1
mes-miR169h UGAGCCAAGGAUGACUUGCCG 21 3 3 3 3    0 3 0 0 0
mes-miR169i GAGCCAAGAAUGACUUGCCGG 21 0 0 0 0    0 0 0 0 0
mes-miR169j GAGCCAAGAAUGACUUGCCGG 21 0 0 0 0    0 0 0 0 0
mes-miR169k GAGCCAAGAAUGACUUGCCGG 21 0 0 0 0    0 0 0 0 0
mes-miR169l CAGCCAAGAAUGACUUGCCGG 21 2 1 1 1    1 1 0 0 0
mes-miR169m CAGCCAAGAAUGACUUGCCGG 21 2 1 1 1    1 1 0 0 0
mes-miR169n GAGCCAAGAAUGACUUGCCGA 21 0 0 0 0    0 0 0 0 0
mes-miR169o UAGCCAAGGAUGACUUGCCUG 21 228 57 139 10    68 139 0 11 10
mes-miR169p UAGCCAAGGAUGACUUGCCUG 21 228 57 139 10    68 139 0 11 10
mes-miR169q UAGCCAAGGAUGACUUGCCUG 21 228 57 139 10    68 139 0 11 10
mes-miR169r UAGCCAAGGAUGACUUGCCCG 21 353 88 257 1    94 257 1 0 1
mes-miR169s UAGCCAAGGAUGACUUGCCUG 21 228 57 139 10    68 139 0 11 10
mes-miR169t UAGCCAAGGAUGACUUGCCCG 21 353 88 257 1    94 257 1 0 1
mes-miR169u UAGCCAAGGAUGACUUGCCUG 21 228 57 139 10    68 139 0 11 10
mes-miR169v UAGCCAAGGAUGACUUGCCCG 21 353 88 257 1    94 257 1 0 1
mes-miR169w UAGCCAAGGAUGACUUGCCUG 21 228 57 139 10    68 139 0 11 10
mes-miR169x UAGCCAAGGAUGACUUGCCCG 21 353 88 257 1    94 257 1 0 1
mes-miR169y UAGCCAAGGAUGACUUGCCUG 21 228 57 139 10    68 139 0 11 10
mes-miR169z UAGCCAAGGAUGACUUGCCCG 21 353 88 257 1    94 257 1 0 1
mes-miR171a GGAUUGAGCCGCGUCAAUAUC 21 0 0 0 0    0 0 0 0 0
mes-miR171b UUGAGCCGUGCCAAUAUCACG 21 479 96 343 6    7 22 6 343 101
mes-miR171c UUGAGCCGUGCCAAUAUCACG 21 479 96 343 6    7 22 6 343 101
mes-miR171d AUGAGCCGUGCCAAUAUCACG 21 2 1 1 1    0 0 0 1 1
mes-miR171e AGAUUGAGCCGCGCCAAUAUC 21 0 0 0 0    0 0 0 0 0
mes-miR171f AGAUUGAGCCGCGCCAAUAUC 21 0 0 0 0    0 0 0 0 0
mes-miR171g UGAUUGAGCCGUGCCAAUAUC 21 4,618 924 2,784 284    450 346 754 2,784 284
mes-miR171h UGAUUGAGCCGUGCCAAUAUC 21 4,618 924 2,784 284    450 346 754 2,784 284
mes-miR171i UGAUUGAGCCGUGCCAAUAUC 21 4,618 924 2,784 284    450 346 754 2,784 284
mes-miR171j UGAUUGAGCCGUGCCAAUAUC 21 4,618 924 2,784 284    450 346 754 2,784 284
mes-miR171k UGAUUGAGCCGUGCCAAUAUC 21 4,618 924 2,784 284    450 346 754 2,784 284
mes-miR172a AGAAUCUUGAUGAUGCUGCAU 21 391 78 203 14    39 39 14 203 96
mes-miR172b AGAAUCUUGAUGAUGCUGCAU 21 391 78 203 14    39 39 14 203 96
mes-miR172c UGAAUCUUGAUGAUGCUACGC 21 0 0 0 0    0 0 0 0 0
mes-miR172d AGAAUCUUGAUGAUGCUGCAU 21 391 78 203 14    39 39 14 203 96
mes-miR172e GGAAUCUUGAUGAUGCUGCAG 21 767 192 413 10    115 0 10 413 229
mes-miR172f GGAAUCUUGAUGAUGCUGCAG 21 767 192 413 10    115 0 10 413 229
mes-miR2111a UAAUCUGCAUCCUGAGGUUUA 21 133 27 48 1    48 4 1 38 42
mes-miR2111b UAAUCUGCAUCCUGAGGUUUA 21 133 27 48 1    48 4 1 38 42
mes-miR2275 UUUGGUUUCCUCCAAUAUCUUA 22 0 0 0 0    0 0 0 0 0
mes-miR2950 UUCCAUCUCUUGCACACUGGA 21 1,473 295 1,236 9    1,236 30 9 142 56
mes-miR319a UUGGACUGAAGGGAGCUCCCU 21 76,708 15,342 49,494 1,343    49,494 1,343 10,116 7,883 7,872
mes-miR319b UUGGACUGAAGGGAGCUCCCU 21 76,708 15,342 49,494 1,343    49,494 1,343 10,116 7,883 7,872
mes-miR319c UUGGACUGAAGGGAGCUCCCU 21 76,708 15,342 49,494 1,343    49,494 1,343 10,116 7,883 7,872
mes-miR319d UUGGACUGAAGGGAGCUCCCU 21 76,708 15,342 49,494 1,343    49,494 1,343 10,116 7,883 7,872
mes-miR319e UUGGACUGAAGGGAGCUCCCU 21 76,708 15,342 49,494 1,343    49,494 1,343 10,116 7,883 7,872
mes-miR319f UUGGACUGAAGGGAGCUCCUU 21 146 29 82 6    82 23 6 25 10
mes-miR319g UUGGACUGAAGGGAGCUCCUU 21 146 29 82 6    82 23 6 25 10
mes-miR319h CUUGGACUGAAGGGAGCUCCU 21 208 42 67 8    22 53 8 67 58
mes-miR390 CGCUAUCCAUCCUGAGUUUC 20 170 34 85 1    1 2 45 37 85
mes-miR393a UCCAAAGGGAUCGCAUUGAUCC 22 767 153 308 19    52 308 133 255 19
mes-miR393b UCCAAAGGGAUCGCAUUGAUCC 22 767 153 308 19    52 308 133 255 19
mes-miR393c UCCAAAGGGAUCGCAUUGAUCU 22 130,821 26,164 106,910 984    9,292 1,874 984 106,910 11,761
mes-miR393d UCCAAAGGGAUCGCAUUGAUCU 22 130,821 26,164 106,910 984    9,292 1,874 984 106,910 11,761
mes-miR394a UUGGCAUUCUGUCCACCUCC 20 11,329 2,266 5,373 276    2,688 1,617 276 5,373 1,375
mes-miR394b UUGGCAUUCUGUCCACCUCC 20 11,329 2,266 5,373 276    2,688 1,617 276 5,373 1,375
mes-miR394c UUGGCAUUCUGUCCACCUCCAU 22 2 1 1 1    1 0 0 1 0
mes-miR395a CUGAAGUGUUUGGGGGAACUC 21 23,394 4,679 16,747 45    176 16,747 45 4,525 1,901
mes-miR395b CUGAAGUGUUUGGGGGAACUC 21 23,394 4,679 16,747 45    176 16,747 45 4,525 1,901
mes-miR395c CUGAAGUGUUUGGGGGAACUC 21 23,394 4,679 16,747 45    176 16,747 45 4,525 1,901
mes-miR395d CUGAAGUGUUUGGGGGAACUC 21 23,394 4,679 16,747 45    176 16,747 45 4,525 1,901
mes-miR395e CUGAAGGGUUUGGAGGAACUC 21 544 109 359 1    4 153 1 359 27
mes-miR396a UUCCACAGCUUUCUUGAACUG 21 101,117 20,223 77,890 419    77,890 7,979 11,836 2,993 419
mes-miR396b UUCCACAGCUUUCUUGAACUG 21 101,117 20,223 77,890 419    77,890 7,979 11,836 2,993 419
mes-miR396c UUCCACAGCUUUCUUGAACUU 21 93,318 18,664 60,490 1,717    60,490 11,230 1,717 14,510 5,371
mes-miR396d UUCCACAGCUUUCUUGAACUU 21 93,318 18,664 60,490 1,717    60,490 11,230 1,717 14,510 5,371
mes-miR396e UUCCACAGCUUUCUUGAACUU 21 93,318 18,664 60,490 1,717    60,490 11,230 1,717 14,510 5,371
mes-miR396f UUCCACAGCUUUCUUGAACUU 21 93,318 18,664 60,490 1,717    60,490 11,230 1,717 14,510 5,371
mes-miR397 UUUGAGUGCAGCGUUGAUGA 20 0 0 0 0    0 0 0 0 0
mes-miR399a UGCCAAAGGAGAAUUGCCCUG 21 1,882 376 960 1    593 960 1 217 111
mes-miR399b UGCCAAAGGAGAUUUGCCCGG 21 317 79 128 30    45 128 0 114 30
mes-miR399c UGCCAAAGGAGAUUUGCCCGG 21 317 79 128 30    45 128 0 114 30
mes-miR399d UGCCAAAGGAGAUUUGCCCGG 21 317 79 128 30    45 128 0 114 30
mes-miR399e UGCCAAAGGAGAUUUGCUCGG 21 1 1 1 1    1 0 0 0 0
mes-miR399f UGCCAAAGGAGAGUUGCCCUG 21 1,509 302 808 2    205 808 2 337 157
mes-miR399g UGCCAAAGGAGAUUUGCCCGG 21 317 79 128 30    45 128 0 114 30
mes-miR403a UUAGAUUCACGCACAAACUCG 21 37,762 7,552 13,046 1,038    7,912 13,046 8,485 7,281 1,038
mes-miR403b UUAGAUUCACGCACAAACUCG 21 37,762 7,552 13,046 1,038    7,912 13,046 8,485 7,281 1,038
mes-miR408 AUGCACUGCCUCUUCCCUGGC 21 7,920 1,584 3,057 526    748 2,836 3,057 753 526
mes-miR477a CUCUCCCUCAAGGGCUUCUG 20 29 7 21 1    21 1 0 4 3
mes-miR477b CUCUCCCUCAAGGGCUUCUG 20 29 7 21 1    21 1 0 4 3
mes-miR477c CUCUCCCUCAAGGGCUUCUG 20 29 7 21 1    21 1 0 4 3
mes-miR477d CUCUCCCUCAAGGGCUUCUC 20 3 2 2 1    2 0 0 0 1
mes-miR477e CUCUCCCUCAAGGGCUUCUG 20 29 7 21 1    21 1 0 4 3
mes-miR477f AUCUCCCUCAAAGGCUUCCA 20 0 0 0 0    0 0 0 0 0
mes-miR477g AUCUCCCUCAAAGGCUUCCA 20 0 0 0 0    0 0 0 0 0
mes-miR477h ACUCUCCCUCAAGGGCUUCAG 21 679 136 308 1    308 70 1 128 172
mes-miR477i ACUCUCCCUCAAGGGCUUCCG 21 11 3 4 1    2 1 0 4 4
mes-miR482 UCUUCCCUACUCCACCCAUUCC 22 166 33 78 6    78 66 6 7 9
mes-miR530a UGCAUUUGCACCUGCACCUU 20 60 15 25 11    12 11 0 25 12
mes-miR530b UGCAUUUGCACCUGCACCUU 20 60 15 25 11    12 11 0 25 12
mes-miR535a UGACAACGAGAGAGAGCACGU 21 35,315 7,063 12,608 1,578    8,093 12,608 1,578 7,275 5,761
mes-miR535b UGACAACGAGAGAGAGCACGG 21 4,293 859 2,977 229    542 2,977 312 229 233
mes-miR827 UUAGAUGACCAUCAACAAACA 21 5,270 1,054 3,068 169    169 669 399 3,068 965
mes-miR828a UCUUGCUCAAAUGAGUAUUCCA 22 2 2 2 2    2 0 0 0 0
mes-miR828b UCUUGCUCAAAUGAGUAUUCCA 22 2 2 2 2    2 0 0 0 0