Brassica rapa Small RNA miRNA Abundances

The data below are based on the microRNAs listed in the Sanger registry. Adjust libraries/reads to display on the control panel.


        miRNA         miRNA sequence Len Sum (norm) Average Max Min (>0)  Bn_rdr2_1Bn_rdr2_2Bn_wt_1Bn_wt_2Bn_wt_3SRR2136646SRR2136647SRR2912893SRR2912894SRR2912891
bra-miR1140 ACAGCCUAAACCAAUCGGAGC 21 9,283 928 4,522 49    2,088 4,522 233 191 350 60 49 750 437 603
bra-miR156a-3p GCUUACUCUCUCUCUGUCACC 21 244 31 97 1    0 0 14 16 24 26 49 17 1 97
bra-miR156a-5p UGACAGAAGAGAGUGAGCAC 20 128,290 12,829 81,485 1,150    1,764 3,587 2,376 3,993 3,830 27,024 81,485 1,150 1,928 1,153
bra-miR156b-3p GCUCACUCUCUAUCUGUCACC 21 440 73 401 1    0 4 1 0 0 0 1 401 4 29
bra-miR156b-5p UGACAGAAGAGAGUGAGCAC 20 128,290 12,829 81,485 1,150    1,764 3,587 2,376 3,993 3,830 27,024 81,485 1,150 1,928 1,153
bra-miR156c-3p GCUCACUGCUCUAUCUGUCAGA 22 63 16 25 1    0 0 0 0 0 0 1 16 25 21
bra-miR156c-5p UGACAGAAGAGAGUGAGCAC 20 128,290 12,829 81,485 1,150    1,764 3,587 2,376 3,993 3,830 27,024 81,485 1,150 1,928 1,153
bra-miR156d-3p GCUCACUCUCUAUCUGUCACC 21 440 73 401 1    0 4 1 0 0 0 1 401 4 29
bra-miR156d-5p UGACAGAAGAGAGUGAGCAC 20 128,290 12,829 81,485 1,150    1,764 3,587 2,376 3,993 3,830 27,024 81,485 1,150 1,928 1,153
bra-miR156e-3p UGCUCACCUCUCUUUCUGUCAGU 23 899 90 236 28    142 138 28 38 36 34 35 153 59 236
bra-miR156e-5p UGACAGAAGAGAGUGAGCAC 20 128,290 12,829 81,485 1,150    1,764 3,587 2,376 3,993 3,830 27,024 81,485 1,150 1,928 1,153
bra-miR156f-3p UGCUCACUGCUCUUUCUGUCAGA 23 50 8 20 1    3 0 0 0 0 1 4 12 10 20
bra-miR156f-5p UGACAGAAGAGAGUGAGCAC 20 128,290 12,829 81,485 1,150    1,764 3,587 2,376 3,993 3,830 27,024 81,485 1,150 1,928 1,153
bra-miR156g-3p GCUCACUGCUCUAUCUGUCAGA 22 63 16 25 1    0 0 0 0 0 0 1 16 25 21
bra-miR156g-5p UGACAGAAGAGAGUGAGCAC 20 128,290 12,829 81,485 1,150    1,764 3,587 2,376 3,993 3,830 27,024 81,485 1,150 1,928 1,153
bra-miR157a UUGACAGAAGAUAGAGAGCAC 21 246,219 24,622 141,041 93    5,801 10,144 522 785 682 85,986 141,041 232 933 93
bra-miR158-3p UUUCCAAAUGUAGACAAAGCA 21 289,913 28,991 62,288 2,132    32,113 62,288 49,583 44,395 62,127 15,078 16,371 2,240 2,132 3,586
bra-miR158-5p CUUUGUCUAUCGUUUGGAAAAG 22 83,346 8,335 27,294 38    321 976 100 38 101 25,544 27,294 16,480 5,630 6,862
bra-miR159a UUUGGAUUGAAGGGAGCUCUA 21 299,333 29,933 117,744 486    9,150 7,246 6,778 4,669 6,363 486 625 79,219 117,744 67,053
bra-miR160a-3p GCGUAUGAGGAGCCAUGCAUA 21 4,276 535 2,105 4    0 11 4 0 20 2,086 2,105 14 4 32
bra-miR160a-5p UGCCUGGCUCCCUGUAUGCCA 21 4,588 459 2,118 64    355 486 104 158 334 64 105 485 379 2,118
bra-miR161-3p GUCACUUUCAAUGCGUUGAUC 21 328 66 146 5    0 0 0 0 0 5 5 146 126 46
bra-miR161-5p UCAAUGCACUGAAAGUGACUA 21 5,470 1,094 2,663 95    0 0 0 0 0 114 95 1,322 2,663 1,276
bra-miR162-3p UCGAUAAACCUCUGCAUCCAG 21 20,320 2,032 3,935 385    2,450 3,935 1,498 1,620 3,476 385 433 1,661 2,927 1,935
bra-miR162-5p GGAGGCAGCGGUUCAUCGAUC 21 351 44 158 4    0 11 12 0 36 118 158 6 4 6
bra-miR164a UGGAGAAGCAGGGCACGUGCA 21 19,473 2,164 6,279 1    14 11 1 0 2 6,060 6,279 2,236 2,153 2,717
bra-miR164b-3p CACGUGUUCUACUACUCCAAC 21 198 40 90 1    0 0 0 0 0 1 2 27 78 90
bra-miR164b-5p UGGAGAAGCAGGGCACGUGCG 21 1,741 348 724 56    0 0 0 0 0 724 541 56 168 252
bra-miR164c-3p CACGUGUUCUACUACUCCAAC 21 198 40 90 1    0 0 0 0 0 1 2 27 78 90
bra-miR164c-5p UGGAGAAGCAGGGCACGUGCG 21 1,741 348 724 56    0 0 0 0 0 724 541 56 168 252
bra-miR164d-3p CACGUGUUCUACUACUCCAAC 21 198 40 90 1    0 0 0 0 0 1 2 27 78 90
bra-miR164d-5p UGGAGAAGCAGGGCACGUGCG 21 1,741 348 724 56    0 0 0 0 0 724 541 56 168 252
bra-miR164e-3p CACGUGCUCCCCUCCUCCAAC 21 9 2 3 1    0 0 3 0 0 1 2 1 1 1
bra-miR164e-5p UGGAGAAGCAGGGCACGUGCAA 22 15 3 4 2    0 0 0 0 0 3 4 3 3 2
bra-miR167a UGAAGCUGCCAGCAUGAUCUA 21 473,368 47,337 235,368 551    1,379 1,454 798 551 777 154,375 235,368 1,039 66,370 11,257
bra-miR167b UGAAGCUGCCAGCAUGAUCUA 21 473,368 47,337 235,368 551    1,379 1,454 798 551 777 154,375 235,368 1,039 66,370 11,257
bra-miR167c UGAAGCUGCCAGCAUGAUCUA 21 473,368 47,337 235,368 551    1,379 1,454 798 551 777 154,375 235,368 1,039 66,370 11,257
bra-miR167d UGAAGCUGCCAGCAUGAUCUA 21 473,368 47,337 235,368 551    1,379 1,454 798 551 777 154,375 235,368 1,039 66,370 11,257
bra-miR168a-3p CCCGCCUUGUAUCAAGUGAAU 21 9,825 1,092 4,482 2    14 44 13 0 2 17 11 2,676 4,482 2,566
bra-miR168a-5p UCGCUUGGUGCAGGUCGGGAA 21 127,685 12,769 45,868 846    1,047 1,451 846 1,053 912 45,868 40,670 10,034 16,161 9,643
bra-miR168b-3p CCCGCCUUGCAUCAACUGAAU 21 7,705 771 3,143 55    152 334 80 55 73 2,267 3,143 357 836 408
bra-miR168b-5p UCGCUUGGUGCAGGUCGGGAC 21 290,259 29,026 136,799 2,314    4,555 6,894 2,622 2,749 2,314 106,555 136,799 5,794 16,180 5,797
bra-miR168c-3p CCCGCCUUGCAUCAACUGAAU 21 7,705 771 3,143 55    152 334 80 55 73 2,267 3,143 357 836 408
bra-miR168c-5p UCGCUUGGUGCAGGUCGGGAC 21 290,259 29,026 136,799 2,314    4,555 6,894 2,622 2,749 2,314 106,555 136,799 5,794 16,180 5,797
bra-miR171a UUGAGCCGUGCCAAUAUCACG 21 196 20 104 3    10 22 9 11 6 6 5 3 104 20
bra-miR171b UUGAGCCGUGCCAAUAUCACG 21 196 20 104 3    10 22 9 11 6 6 5 3 104 20
bra-miR171c UUGAGCCGUGCCAAUAUCACG 21 196 20 104 3    10 22 9 11 6 6 5 3 104 20
bra-miR171d UUGAGCCGUGCCAAUAUCACG 21 196 20 104 3    10 22 9 11 6 6 5 3 104 20
bra-miR171e UGAUUGAGCCGCGCCAAUAUC 21 1,924 192 625 16    57 87 58 22 51 571 625 16 414 23
bra-miR172a AGAAUCUUGAUGAUGCUGCAU 21 18,597 1,860 9,722 9    10 18 9 16 22 7,879 9,722 80 746 95
bra-miR172b-3p AGAAUCUUGAUGAUGCUGCAU 21 18,597 1,860 9,722 9    10 18 9 16 22 7,879 9,722 80 746 95
bra-miR172b-5p GCAGCACCAUUAAGAUUCACA 21 1,986 199 936 3    3 22 3 5 6 936 788 7 198 18
bra-miR172c-3p AGAAUCUUGAUGAUGCUGCAG 21 2,693 269 1,236 1    61 73 38 22 28 1,224 1,236 3 1 7
bra-miR172c-5p GCAUCAUCAUCAAGAUUCAGA 21 315 39 86 7    7 54 26 11 55 64 86 0 0 12
bra-miR172d-3p GGAAUCUUGAUGAUGCUGCAU 21 1,127 113 251 11    34 51 14 11 34 250 251 62 180 240
bra-miR172d-5p GCAGCAUCAUUAAGAUUCACA 21 1,040 208 436 4    0 0 0 0 0 436 322 103 4 175
bra-miR1885a CAUCAAUGAAAGGUAUGAUUCC 22 14,440 1,444 3,281 493    838 1,472 2,137 1,571 3,281 1,205 1,080 493 1,756 607
bra-miR1885b UACAUCUUCUCCGCGGAAGCUC 22 22,071 2,207 7,929 439    439 772 1,030 665 925 2,479 1,996 2,840 7,929 2,996
bra-miR2111-3p GACCUCAGGAUGCGGAUUACC 21 235 24 65 1    10 51 11 16 20 65 59 1 1 1
bra-miR2111-5p UAAUCUGCAUCCUGGGGUUUA 21 309 77 163 1    0 0 0 0 0 143 163 2 0 1
bra-miR2111a-3p GUCCUCGGGAUGCGGAUUACC 21 108 36 56 1    0 0 0 0 0 51 56 1 0 0
bra-miR2111a-5p UAAUCUGCAUCCUGAGGUUUA 21 200 40 77 10    0 0 0 0 0 62 77 14 10 37
bra-miR2111b-3p AUCCUCGGGAUACGGAUUACC 21 634 79 345 2    10 11 0 0 2 191 345 18 4 53
bra-miR2111b-5p UAAUCUGCAUCCUGAGGUUUA 21 200 40 77 10    0 0 0 0 0 62 77 14 10 37
bra-miR319-3p UUGGACUGAAGGGAGCUCCCU 21 60,368 6,037 48,585 19    1,912 2,814 925 802 997 19 29 48,585 394 3,891
bra-miR319-5p AGAGCUUCCUUGAGUCCAUUC 21 623 125 531 1    0 0 0 0 0 5 3 531 1 83
bra-miR390-3p CGCUGUCCAUCCUGAGUUUCA 21 1,492 149 474 11    44 91 39 11 61 176 152 474 183 261
bra-miR390-5p AAGCUCAGGAGGGAUAGCGCC 21 23,174 2,317 7,981 247    1,422 2,651 863 616 1,279 7,142 7,981 650 247 323
bra-miR391-3p ACGGUAUCUCUCCUACGUAGC 21 662 166 564 5    0 0 0 0 0 34 59 5 564 0
bra-miR391-5p UUCGCAGGAGAGAUAGCGCCA 21 865 216 398 1    0 0 0 0 0 319 398 0 147 1
bra-miR395a-3p CUGAAGUGUUUGGGGGAACUC 21 2,829 283 660 7    432 660 432 540 575 7 11 40 92 40
bra-miR395a-5p GUUCCUCUGAGCACUUCAUUG 21 62 10 25 1    0 0 3 0 2 0 1 25 22 9
bra-miR395b-3p CUGAAGUGUUUGGGGGAACUC 21 2,829 283 660 7    432 660 432 540 575 7 11 40 92 40
bra-miR395b-5p GUUCCUCUGAGCACUUCAUUG 21 62 10 25 1    0 0 3 0 2 0 1 25 22 9
bra-miR395c-3p CUGAAGUGUUUGGGGGAACUC 21 2,829 283 660 7    432 660 432 540 575 7 11 40 92 40
bra-miR395c-5p GUUCCUCUGAGCACUUCAUUG 21 62 10 25 1    0 0 3 0 2 0 1 25 22 9
bra-miR395d-3p CUGAAGUGUUUGGGGGAACUC 21 2,829 283 660 7    432 660 432 540 575 7 11 40 92 40
bra-miR395d-5p GUUCCUCUGAGCACUUCAUUG 21 62 10 25 1    0 0 3 0 2 0 1 25 22 9
bra-miR396-3p GCUCAAGAAAGCUGUGGGAAA 21 1,975 282 849 1    0 0 1 0 2 849 789 14 298 22
bra-miR396-5p UUCCACAGCUUUCUUGAACUU 21 21,358 2,136 5,799 44    4,220 5,799 1,251 2,302 1,608 44 58 228 5,551 297
bra-miR398-3p UGUGUUCUCAGGUCACCCCUG 21 801,317 89,035 505,431 1    171,791 505,431 34,664 29,057 58,413 0 1 157 1,366 437
bra-miR398-5p GGGUCGACAUGAGAACACAUG 21 5,536 554 2,525 33    135 976 247 104 492 49 33 466 2,525 509
bra-miR400-3p GACUUAUAAUGAUCUCAUGAA 21 65 13 16 10    0 0 0 0 0 14 10 12 16 13
bra-miR400-5p UAUGAGAGUAUUAUAAGUCAC 21 4,561 456 2,029 22    37 73 38 22 28 61 88 970 2,029 1,215
bra-miR403-3p UUAGAUUCACGCACAAACUCG 21 144,628 14,463 52,724 28    28,538 52,724 18,661 20,591 23,055 428 497 30 28 76
bra-miR403-5p UGUUUUGUGCGUGAAUCUAAUU 22 575 58 106 22    37 62 22 33 22 87 86 61 59 106
bra-miR408-3p UGCUUGUUCCCUGUCUCUCUC 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0
bra-miR408-5p GGGAGCCAGGGAAGAGGCAGU 21 1 1 1 1    0 0 0 0 0 0 1 0 0 0
bra-miR5654a AUAAAUCCCAAGCAUCAUCCA 21 10,516 1,052 2,424 45    71 65 46 49 45 1,542 1,804 2,140 2,330 2,424
bra-miR5654b AUAAAUCCCAAGCAUCAUCCA 21 10,516 1,052 2,424 45    71 65 46 49 45 1,542 1,804 2,140 2,330 2,424
bra-miR5711 UGUUUUGUGGGUUUCUACCGA 21 3,181 318 2,867 8    14 40 8 11 12 15 13 114 2,867 87
bra-miR5712 AAUAUUAAUAUAAUUGGUGAG 21 151 15 44 2    30 44 9 5 14 4 2 9 21 13
bra-miR5713 AGGCUUAGAAGAACGUUUGUU 21 6 2 2 2    0 0 0 0 0 2 2 0 2 0
bra-miR5714 AGACUCUACGACAUCAAGAAAC 22 86 12 37 1    37 36 0 0 4 1 5 0 2 1
bra-miR5715 ACGUGAUAAGCCUCUGAAGAA 21 19 3 5 1    0 4 1 0 0 1 0 5 3 5
bra-miR5716 UUGGAUAAUUGAAGAUAUAAA 21 41 10 26 2    0 0 0 0 0 11 26 0 2 2
bra-miR5717 GUUUGGAUUGUUUGCCUUGGC 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0
bra-miR5718 UCAGAACCAAACACAGAACAAG 22 98,774 9,877 32,078 1    18,915 32,078 8,508 11,297 12,913 5,784 9,226 1 51 1
bra-miR5719 UUGUGAUGAUAAUACGACUUC 21 46 9 14 5    0 0 0 0 0 10 14 5 10 7
bra-miR5720 UUGUGAUUUGGUUGGAAUAUC 21 12 4 5 3    0 0 0 0 0 3 4 0 5 0
bra-miR5721 AAAAAUGGAGUGAGAAAUGGA 21 9 3 5 1    0 0 0 0 0 3 5 1 0 0
bra-miR5722 UGAAAUAGAGUCAUGUGGAACG 22 3 1 1 1    0 0 0 0 0 1 1 0 1 0
bra-miR5723 AAUGUGCUGCAAUAUCUCUGC 21 4 4 4 4    0 0 0 0 0 0 0 0 4 0
bra-miR5724 AACCGCCGGUUUGAUAAUAGC 21 200 25 97 1    7 18 1 0 0 69 97 1 2 5
bra-miR5725 AUUUGGCACAAUCUGAUCUGC 21 55 11 43 1    3 4 0 0 4 0 0 1 43 0
bra-miR5726 CAAAGGUUGCUUGAAUAAGGU 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0
bra-miR6032-3p UCUGCUGGUCGUUCCAUGUUAA 22 9 1 2 1    0 0 1 0 2 1 1 1 2 1
bra-miR6032-5p AACAUGGAGCAUCAACAGAUC 21 24 8 12 1    0 0 0 0 0 11 12 0 1 0
bra-miR824 UAGACCAUUUGUGAGAAGGGA 21 61,161 6,116 25,987 5    20 47 8 5 20 459 447 25,987 12,497 21,671
bra-miR860-3p UCAAUACAUUGGACUACAUAU 21 286 32 77 3    14 51 22 0 38 57 77 13 11 3
bra-miR860-5p AUGUAGUCCAAUCUAUUGAAG 21 96 24 67 1    0 0 0 0 0 0 1 67 18 10
bra-miR9408-3p UUUCAUCUUAGAGAAUGUUGUU 22 968 484 593 375    0 0 0 0 0 593 375 0 0 0
bra-miR9408-5p CAACAGUCUCAGGAUGGAAAA 21 7 2 4 1    0 4 0 0 0 1 2 0 0 0
bra-miR9552a-3p UGACCAAGUAGACCGAUAGUC 21 3 2 2 1    0 0 0 0 0 2 1 0 0 0
bra-miR9552a-5p CUAUCGGUCUACUCGGUCAGC 21 1 1 1 1    0 0 0 0 0 0 0 0 0 1
bra-miR9552b-3p UGACCGAGUAGACCGAUAGUC 21 1,865 233 1,296 4    0 4 8 0 8 253 1,296 117 4 175
bra-miR9552b-5p CUAUCGGUCUACUUGGUCAGC 21 37 7 20 1    0 0 0 0 0 1 1 20 3 12
bra-miR9553-3p UAAUCAGCUCCAGCUAUGUACA 22 5 3 3 2    0 0 0 0 0 3 0 0 2 0
bra-miR9553-5p UACAAAGCUGAAGCUAAUUAUG 22 154 51 99 1    0 0 0 0 0 99 54 0 1 0
bra-miR9554-3p UCAUAUCCAAGUAUCAUUCCU 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0
bra-miR9554-5p GAAUGAUACUUGGAUAUAAUC 21 1 1 1 1    0 0 0 0 0 0 0 0 1 0
bra-miR9555a-3p UUUCCCGUAAAGCUUAGAACC 21 8 4 7 1    0 7 1 0 0 0 0 0 0 0
bra-miR9555a-5p UUCUAAGCUUUACGGGAAACC 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0
bra-miR9555b-3p UUAGAAACUUGCAAUUAUAUA 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0
bra-miR9555b-5p UGUAAUUGCGGGGUUCUAAGC 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0
bra-miR9556-3p UCUACUUUCACCAAUUGGCCU 21 397 57 154 1    34 83 59 65 154 0 1 0 0 1
bra-miR9556-5p GUCAAUUGGUGAUAGUAGUUC 21 1 1 1 1    0 0 0 0 0 0 1 0 0 0
bra-miR9557-3p GCUGAGUUGGAACGCAAAAUC 21 56 19 27 14    0 0 0 0 0 0 0 27 14 15
bra-miR9557-5p UUUUGCGUUUCAACUCGGUCC 21 255 51 92 5    0 0 0 0 0 5 8 85 65 92
bra-miR9558-3p UUGCAAGCCAGACAUUUCCUUU 22 39 10 19 1    3 0 0 0 0 19 16 0 1 0
bra-miR9558-5p AGAGAUGUCUGGCUUGCAACA 21 1,193 170 700 1    419 700 0 5 0 31 33 0 4 1
bra-miR9559-3p ACAAUGAACGAAAUCCAAAUC 21 2 1 1 1    0 0 0 0 0 0 0 1 0 1
bra-miR9559-5p UUUGGAUUUUGGUCAUUGUUG 21 3 1 1 1    0 0 0 0 0 0 0 1 1 1
bra-miR9560a-3p UCAUAUUAGUUCUACCUCCUGUUG 24 6 2 2 2    0 0 0 0 2 2 2 0 0 0
bra-miR9560a-5p ACAGGUGGUGGAACAAAUAUGAGU 24 57 6 22 1    3 7 3 5 4 22 11 0 1 1
bra-miR9560b-3p UCAUAUUAGUUCUACCUCCUGCUG 24 203 29 80 3    41 80 22 16 32 9 3 0 0 0
bra-miR9560b-5p ACAGGUGGUGGAACAAAUAUGAGU 24 57 6 22 1    3 7 3 5 4 22 11 0 1 1
bra-miR9561-3p GAGAGACUCUGAAAGACUCACC 22 2 1 1 1    0 0 0 0 0 0 0 1 0 1
bra-miR9561-5p UGAGUCUCUCACCAGUCUUUCAC 23 1 1 1 1    0 0 0 0 0 0 0 0 0 1
bra-miR9562-3p UUAUUCACAACUGCAUAAUUC 21 2 1 1 1    0 0 0 0 0 0 0 1 1 0
bra-miR9562-5p ACUAUGCAAUUGUGAACAAAC 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0
bra-miR9563a-3p UAAAAGUUAAGAGACAAGUUA 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0
bra-miR9563a-5p ACCCGUCUCUUAAUUUUUAAC 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0
bra-miR9563b-3p AAAUUAAGAGAUGAAUUCUUAC 22 0 nan 0 0    0 0 0 0 0 0 0 0 0 0
bra-miR9563b-5p AAGAACUCGUCUCUUAACUUUUAA 24 12 4 6 2    0 0 0 0 0 0 0 4 2 6
bra-miR9564-3p CGAGCUGUGUAAUCGUUUUGUU 22 0 nan 0 0    0 0 0 0 0 0 0 0 0 0
bra-miR9564-5p ACAAAACGAUUACACAGCUCGGUC 24 0 nan 0 0    0 0 0 0 0 0 0 0 0 0
bra-miR9565-3p CUGAAGCUAGUGAAAGAGAGA 21 1 1 1 1    0 0 0 0 0 0 1 0 0 0
bra-miR9565-5p UCUCGUUCUCUCGUUUCAGCU 21 2 1 1 1    0 0 0 0 0 1 1 0 0 0
bra-miR9566-3p GAGCCUAAGUAUUUGUCAACAAUG 24 0 nan 0 0    0 0 0 0 0 0 0 0 0 0
bra-miR9566-5p UUGUUGACAAAUACUUAGGCUC 22 5 3 4 1    0 0 0 0 4 0 0 1 0 0
bra-miR9567-3p AAACUAUAUGUGUUGCUUAGA 21 2 1 1 1    0 0 0 0 0 0 0 0 1 1
bra-miR9567-5p UAAACAACACAUAUAGUUUGC 21 0 nan 0 0    0 0 0 0 0 0 0 0 0 0
bra-miR9568-3p UCAUCGUAAGAGAUCUGCAUU 21 23 5 9 1    0 0 0 0 0 9 7 2 4 1
bra-miR9568-5p UGCGGAUAUCUUAGGAUGAGGU 22 1 1 1 1    0 0 0 0 0 0 0 0 0 1
bra-miR9569-3p ACACAGGAACAAUACUAACUCAUU 24 4,551 455 1,752 1    689 1,752 1 22 4 1,178 819 4 3 79
bra-miR9569-5p UGAGUUAUCAUUGGUCUUGUG 21 97 24 87 2    0 0 0 0 0 2 3 5 0 87