Brachypodium Small RNA miRNA Abundances

The data below are based on the microRNAs listed in the miRBase registry. Adjust libraries/reads to display on the control panel.


        miRNA         miRNA sequence Len Sum (norm) Average Max Min (>0)  OBD01BDI05BDI08OBD03BDI04BDI09BDI06OBD02BDI02BDI03BDI17BDI01BDI18BDI19BDI15BDI16OBD04
bdi-miR1122 UAGAUACAUCCGUAUUUGGA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR1127 AACUACUCCCUCCGUCCGAUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR1135 UUUCGACAAGUAAUUCCGACCGGA 24 21 1 6 1    0 2 6 0 2 0 2 0 1 0 1 0 2 3 1 1 0
bdi-miR1139 GAGUAACAUACACUAGUAACA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR1432 UUCAGGAGAGAUGACACCGACA 22 7,531 443 2,589 6    15 24 102 6 2,589 58 122 12 388 334 245 645 329 1,700 222 718 22
bdi-miR156a UGACAGAAGAGAGAGAGCACA 21 2 0 1 1    0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0
bdi-miR156b-3p GCUCACUUCUCUCUCUGUCACC 22 585 34 348 1    6 0 1 348 0 0 0 55 1 3 0 0 1 1 1 1 167
bdi-miR156b-5p UGACAGAAGAGAGUGAGCAC 20 1,326,913 78,054 315,312 40    40 2,969 32,782 320 125,104 18,681 9,400 125 11,983 57,386 233,527 7,438 166,658 30,449 314,596 315,312 143
bdi-miR156c UGACAGAAGAGAGUGAGCAC 20 1,326,913 78,054 315,312 40    40 2,969 32,782 320 125,104 18,681 9,400 125 11,983 57,386 233,527 7,438 166,658 30,449 314,596 315,312 143
bdi-miR156d-3p GCUCACUGCUCUGUCUGUCACC 22 335 20 109 1    6 1 3 79 3 0 1 31 109 6 1 0 2 4 1 0 88
bdi-miR156d-5p UGACAGAAGAGAGUGAGCAC 20 1,326,913 78,054 315,312 40    40 2,969 32,782 320 125,104 18,681 9,400 125 11,983 57,386 233,527 7,438 166,658 30,449 314,596 315,312 143
bdi-miR156e-3p GCUCACUUCUCUCUCUGUCAGC 22 436 26 409 1    20 0 0 409 0 0 0 3 0 0 0 0 0 1 0 1 2
bdi-miR156e-5p UGACAGAAGAGAGUGAGCAC 20 1,326,913 78,054 315,312 40    40 2,969 32,782 320 125,104 18,681 9,400 125 11,983 57,386 233,527 7,438 166,658 30,449 314,596 315,312 143
bdi-miR156f-3p GCUCACUGCUCUAUCUGUCAGC 22 1,452 85 1,336 1    67 0 5 1,336 0 0 0 21 0 0 0 0 0 0 1 1 21
bdi-miR156f-5p UGACAGAAGAGAGUGAGCAC 20 1,326,913 78,054 315,312 40    40 2,969 32,782 320 125,104 18,681 9,400 125 11,983 57,386 233,527 7,438 166,658 30,449 314,596 315,312 143
bdi-miR156g-3p GCUCACCCUCUCUCUGUCAGC 21 420 25 366 1    18 0 1 366 0 0 0 15 1 0 1 0 0 1 1 0 16
bdi-miR156g-5p UGACAGAAGAGAGUGAGCAC 20 1,326,913 78,054 315,312 40    40 2,969 32,782 320 125,104 18,681 9,400 125 11,983 57,386 233,527 7,438 166,658 30,449 314,596 315,312 143
bdi-miR156h-3p GCUCACUGCUCUUCCUGUCAUC 22 164 10 103 1    4 0 0 103 1 0 0 13 0 0 0 0 1 3 1 1 37
bdi-miR156h-5p UGACAGAAGAGAGUGAGCAC 20 1,326,913 78,054 315,312 40    40 2,969 32,782 320 125,104 18,681 9,400 125 11,983 57,386 233,527 7,438 166,658 30,449 314,596 315,312 143
bdi-miR156i-3p GCUCACCCUCUCUCUGUCAGC 21 420 25 366 1    18 0 1 366 0 0 0 15 1 0 1 0 0 1 1 0 16
bdi-miR156i-5p UGACAGAAGAGAGUGAGCAC 20 1,326,913 78,054 315,312 40    40 2,969 32,782 320 125,104 18,681 9,400 125 11,983 57,386 233,527 7,438 166,658 30,449 314,596 315,312 143
bdi-miR156j UGACAGAAGAGAGAGAGCAC 20 1,040 61 273 2    0 14 196 2 273 98 18 0 4 8 103 0 70 14 117 123 0
bdi-miR159a-3p CUUGGAUUGAAGGGAGCUCU 20 1,061 62 575 1    297 1 3 575 0 0 0 99 0 0 0 5 0 0 1 1 79
bdi-miR159a-5p AGCUCCCUUCGAUCCAAUC 19 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0
bdi-miR159b-3p.1 UUUGGAUUGAAGGGAGCUCUG 21 218,163 12,833 128,096 379    22,393 379 1,437 128,096 2,626 557 400 24,567 431 631 439 997 623 735 420 398 33,034
bdi-miR159b-3p.2 AUCCACCCCUUGCCGACCGCUG 22 23 1 5 1    1 1 4 4 1 0 1 1 1 0 0 5 1 1 1 1 0
bdi-miR159b-3p.3 UUUGCAUGACCGAGGAGCCGC 21 1,254 74 265 5    163 39 94 265 60 25 38 195 5 14 8 5 9 56 15 19 244
bdi-miR159b-5p.1 GAGCUCCUAUCAUUCCAAUGA 21 663 39 205 1    162 0 3 182 0 0 0 109 0 0 0 0 0 1 1 0 205
bdi-miR159b-5p.2 AAGGUCUGUCAGAAGGGUGAUAC 23 5,078 299 1,747 43    90 180 1,747 209 337 407 150 43 128 83 211 293 138 288 355 312 107
bdi-miR159b-5p.3 AGCUGCUUGUUCAUGGUUCCC 21 74 4 27 1    12 0 0 18 0 0 0 15 0 0 0 0 0 1 0 1 27
bdi-miR159c UUUGGUUUGAAGGGGGCUCUG 21 51 3 26 3    3 0 0 26 0 0 0 8 0 0 0 0 0 0 0 0 14
bdi-miR160a-3p GCGUGCGAGGAGCCAAGCAUG 21 61 4 13 1    0 1 3 0 0 0 3 0 13 3 5 10 7 4 7 5 0
bdi-miR160a-5p UGCCUGGCUCCCUGUAUGCCA 21 4,467 263 1,417 4    860 44 78 1,417 29 43 26 623 88 81 10 29 4 72 13 16 1,034
bdi-miR160b-3p GCGUGCAAGGAGCCAAGCAUG 21 378 22 55 1    1 23 53 0 7 6 20 1 55 14 16 54 39 22 32 35 0
bdi-miR160b-5p UGCCUGGCUCCCUGUAUGCCA 21 4,467 263 1,417 4    860 44 78 1,417 29 43 26 623 88 81 10 29 4 72 13 16 1,034
bdi-miR160c-3p GCGUGCAAGGAGCCAAGCAUG 21 378 22 55 1    1 23 53 0 7 6 20 1 55 14 16 54 39 22 32 35 0
bdi-miR160c-5p UGCCUGGCUCCCUGUAUGCCA 21 4,467 263 1,417 4    860 44 78 1,417 29 43 26 623 88 81 10 29 4 72 13 16 1,034
bdi-miR160d-3p GCGUGCACGGAGCCAAGCAUA 21 157 9 54 1    1 6 0 0 0 0 10 0 43 3 2 54 10 10 8 10 0
bdi-miR160d-5p UGCCUGGCUCCCUGUAUGCCA 21 4,467 263 1,417 4    860 44 78 1,417 29 43 26 623 88 81 10 29 4 72 13 16 1,034
bdi-miR160e-3p GCAUUGAGGGAGUCAUGCAGG 21 141 8 36 1    36 1 0 14 1 0 1 11 7 3 11 0 11 6 7 5 27
bdi-miR160e-5p UGCCUGGCUCCCUGAAUGCCA 21 23,480 1,381 10,068 3    1,961 19 3 3,610 203 52 17 7,198 28 128 40 10 12 96 17 18 10,068
bdi-miR160f UGCCUGGCUCCCUGUAUGCC 20 128 8 68 1    9 0 1 32 0 0 0 68 0 0 0 0 0 0 1 1 16
bdi-miR162 UCGAUAAACCUCUGCAUCCGG 21 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0
bdi-miR164a-3p CAUGUGCCCUUCUUCUCCACC 21 28 2 7 1    7 1 0 4 0 0 1 0 0 0 0 5 0 2 1 1 6
bdi-miR164a-5p UGGAGAAGCAGGGCACGUGCA 21 9,146 538 1,169 85    268 1,110 85 385 714 95 1,169 172 488 754 890 132 862 412 575 631 404
bdi-miR164b UGGAGAAGCAGGGCACGUGCA 21 9,146 538 1,169 85    268 1,110 85 385 714 95 1,169 172 488 754 890 132 862 412 575 631 404
bdi-miR164c-3p CAUGUGCGCUCCUUCUCCAGC 21 12 1 6 1    1 0 1 0 0 6 0 1 1 0 0 0 0 1 0 1 0
bdi-miR164c-5p UGGAGAAGCAGGGCACGUGCU 21 448 26 49 1    2 49 29 0 36 10 45 1 35 39 40 5 49 25 43 37 3
bdi-miR164e UGGAGAAGCAGGGCACGUGCA 21 9,146 538 1,169 85    268 1,110 85 385 714 95 1,169 172 488 754 890 132 862 412 575 631 404
bdi-miR164f UGGAGAAGAAGGGCACAUGCA 21 80 5 16 4    0 9 0 0 10 0 7 0 4 8 10 0 16 5 6 5 0
bdi-miR166a-3p UCGGACCAGGCUUCAUUCCCC 21 88,998 5,235 13,804 698    2,274 10,669 13,804 4,666 5,993 2,921 9,666 698 3,051 4,068 2,074 1,056 4,077 12,798 4,683 3,926 2,574
bdi-miR166a-5p GAAUGACGCCGGGUCUGAAAG 21 1,604 94 357 6    70 6 0 59 179 88 61 252 16 11 94 357 30 19 16 16 330
bdi-miR166b-3p UCGGACCAGGCUUCAUUCCCC 21 88,998 5,235 13,804 698    2,274 10,669 13,804 4,666 5,993 2,921 9,666 698 3,051 4,068 2,074 1,056 4,077 12,798 4,683 3,926 2,574
bdi-miR166b-5p GGAAUGUUGUCUGGCUCGGGG 21 365 21 68 3    3 15 68 16 17 28 14 0 63 6 44 20 21 18 13 16 3
bdi-miR166c-3p UCGGACCAGGCUUCAUUCCCC 21 88,998 5,235 13,804 698    2,274 10,669 13,804 4,666 5,993 2,921 9,666 698 3,051 4,068 2,074 1,056 4,077 12,798 4,683 3,926 2,574
bdi-miR166c-5p GGAAUGUUGUCUGGUUCAAGG 21 2,209 130 881 1    881 3 21 593 0 0 2 328 9 0 1 10 3 7 5 3 343
bdi-miR166d-3p UCGGACCAGGCUUCAUUCCCC 21 88,998 5,235 13,804 698    2,274 10,669 13,804 4,666 5,993 2,921 9,666 698 3,051 4,068 2,074 1,056 4,077 12,798 4,683 3,926 2,574
bdi-miR166d-5p GGAAUGUUGUCUGGUUGGAGA 21 388 23 67 4    51 25 0 12 36 67 27 24 4 0 43 0 4 17 30 29 19
bdi-miR166e-3p CUCGGACCAGGCUUCAUUCCC 21 156 9 28 3    4 10 23 12 28 0 17 0 5 3 5 10 4 22 5 5 3
bdi-miR166e-5p GGAAUGUUGUCUGGCUCGAGG 21 77 5 14 2    0 2 0 6 9 3 3 0 3 0 14 0 7 5 12 13 0
bdi-miR166f UCUCGGACCAGGCUUCAUUCC 21 33,832 1,990 26,878 39    63 516 26,878 1,128 422 259 2,702 39 163 206 51 420 120 487 174 127 77
bdi-miR166g-3p UGUGGUGAUCUCGGACCAGGC 21 2,644 156 496 47    188 278 0 170 496 102 165 71 96 192 135 127 47 148 92 81 256
bdi-miR166g-5p UCUGGUUCAAGGUCUCCACAU 21 2 0 1 1    0 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0
bdi-miR166h-3p UCGGACCAGGCUUCAAUCCCU 21 7,311 430 2,230 32    209 2,230 0 63 132 272 1,491 32 352 334 67 132 226 1,099 315 253 104
bdi-miR166h-5p GGUUUGUUGUCUGGCUCGGGG 21 65 4 15 1    15 7 0 14 0 8 7 0 5 0 1 0 2 1 1 1 3
bdi-miR166i-3p UCGGACCAGGCUUCAUUCCCC 21 88,998 5,235 13,804 698    2,274 10,669 13,804 4,666 5,993 2,921 9,666 698 3,051 4,068 2,074 1,056 4,077 12,798 4,683 3,926 2,574
bdi-miR166i-5p GGCAUGUCGUGUGGCCCGAGA 21 8 0 5 1    0 1 0 0 0 0 0 0 1 0 0 5 0 0 0 1 0
bdi-miR166j UCGGACCAGGCUUCAUUCCUU 21 5,157 303 1,503 5    338 1,503 5 65 128 125 895 49 172 156 65 34 278 822 241 209 72
bdi-miR167a UGAAGCUGCCAGCAUGAUCUA 21 24,154 1,421 5,690 242    5,690 1,768 1,086 2,073 883 242 501 1,743 725 876 749 283 1,228 3,270 700 651 1,686
bdi-miR167b UGAAGCUGCCAGCAUGAUCUA 21 24,154 1,421 5,690 242    5,690 1,768 1,086 2,073 883 242 501 1,743 725 876 749 283 1,228 3,270 700 651 1,686
bdi-miR167c-3p GAUCAUGCUGUGCAGUUUCAUC 22 81 5 29 2    0 0 5 2 2 0 0 0 8 0 7 29 12 3 6 7 0
bdi-miR167c-5p UGAAGCUGCCAGCAUGAUCUGA 22 254,332 14,961 64,788 518    24,601 2,593 6,618 64,788 15,440 3,172 1,337 36,777 2,710 3,656 11,032 518 15,529 10,245 8,849 7,569 38,898
bdi-miR167d-3p AGAUCAUGUUGCAGCUUCAC 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR167d-5p UGAAGCUGCCAGCAUGAUCUGA 22 254,332 14,961 64,788 518    24,601 2,593 6,618 64,788 15,440 3,172 1,337 36,777 2,710 3,656 11,032 518 15,529 10,245 8,849 7,569 38,898
bdi-miR167e-3p AGGUCAUGCUGGAGUUUCAUC 21 98 6 22 2    3 5 3 16 3 0 2 5 22 8 6 0 2 6 2 4 11
bdi-miR167e-5p UGAAGCUGCCAGCAUGAUCUGA 22 254,332 14,961 64,788 518    24,601 2,593 6,618 64,788 15,440 3,172 1,337 36,777 2,710 3,656 11,032 518 15,529 10,245 8,849 7,569 38,898
bdi-miR167f UGAAGCUGCCAGCAUGAUCUA 21 24,154 1,421 5,690 242    5,690 1,768 1,086 2,073 883 242 501 1,743 725 876 749 283 1,228 3,270 700 651 1,686
bdi-miR167g UGAAGCUGCCAGCAUGAUCUGA 22 254,332 14,961 64,788 518    24,601 2,593 6,618 64,788 15,440 3,172 1,337 36,777 2,710 3,656 11,032 518 15,529 10,245 8,849 7,569 38,898
bdi-miR168-3p CCCGCCUUGCACCAAGUGAAU 21 2,095 123 625 2    188 16 38 603 34 2 24 272 36 11 31 98 18 69 16 14 625
bdi-miR168-5p UCGCUUGGUGCAGAUCGGGAC 21 4,175,439 245,614 649,493 28,271    78,141 255,548 649,493 86,821 416,687 471,839 379,638 61,795 157,820 204,199 419,014 169,902 28,271 202,562 233,759 258,637 101,313
bdi-miR169a-3p GGCGAGUUGUUCUUGGCUACA 21 101 6 38 1    11 2 0 38 1 0 1 7 0 0 7 0 4 17 2 1 10
bdi-miR169a-5p CAGCCAAGGAUGACUUGCCGA 21 24,569 1,445 8,659 15    1,861 146 15 8,659 818 633 60 1,992 2,522 890 729 782 1,063 1,466 384 355 2,194
bdi-miR169b UAGCCAAGGAUGACUUGCCGG 21 611 36 325 1    325 91 10 16 13 15 12 13 28 31 7 0 12 9 2 1 26
bdi-miR169c-3p GGCAGGUUGUCCUUGGCUAC 20 3,551 209 2,003 5    0 89 2,003 18 52 233 122 5 24 25 111 44 64 470 158 133 0
bdi-miR169c-5p CAGCCAAGGAUGACUUGCCGG 21 18,120 1,066 3,357 307    531 307 3,357 2,765 750 940 589 419 1,750 1,996 557 792 690 875 364 327 1,111
bdi-miR169d UAGCCAAGAAUGACUUGCCUA 21 944 56 311 3    3 14 8 14 29 21 16 12 240 311 28 59 45 75 34 19 16
bdi-miR169e-3p GGCAGUCUCCUUGGCUAGC 19 132 8 40 1    3 6 7 40 5 4 3 3 19 0 4 0 1 28 2 2 5
bdi-miR169e-5p UAGCCAAGGAUGACUUGCCUG 21 4,893 288 1,916 7    7 33 194 73 60 155 61 25 461 1,916 87 909 148 642 65 44 13
bdi-miR169f CAGCCAAGGAUGACUUGCCGG 21 18,120 1,066 3,357 307    531 307 3,357 2,765 750 940 589 419 1,750 1,996 557 792 690 875 364 327 1,111
bdi-miR169g UAGCCAAGGAUGACUUGCCUG 21 4,893 288 1,916 7    7 33 194 73 60 155 61 25 461 1,916 87 909 148 642 65 44 13
bdi-miR169h-3p GGCAGUCACCUUGGCUAGC 19 182 11 31 1    5 16 1 10 7 11 8 1 24 31 14 15 1 13 9 11 5
bdi-miR169h-5p UAGCCAAGGAUGACUUGCCUA 21 3,225 190 1,180 13    43 13 32 69 24 72 22 65 1,180 784 125 362 120 99 80 72 63
bdi-miR169i CCAGCCAAGAAUGGCUUGCCUA 22 1,051 62 286 6    104 8 6 40 107 30 26 129 27 286 18 15 21 19 9 7 199
bdi-miR169j-3p UGGUCAAGCCUUCCUGACUAGG 22 846 50 140 10    16 10 16 22 49 50 19 47 26 28 140 20 128 134 48 35 58
bdi-miR169j-5p UAGCCAGGAAUGGCUUGCCUA 21 15 1 9 1    0 0 1 0 1 0 1 9 0 0 1 0 0 1 0 1 0
bdi-miR169k-3p GGGCAAGUCAGCCUGGCUACC 21 6 0 1 1    0 1 0 0 1 0 1 0 0 0 1 0 1 1 0 0 0
bdi-miR169k-5p UAGCCAAGGAUGAUUUGCCUGU 22 1,060 62 223 2    223 37 4 40 61 17 45 204 65 89 13 161 7 36 3 2 53
bdi-miR169l UAGCCAAGGAUGAAUUGCCGG 21 10 1 6 1    6 1 0 2 0 0 1 0 0 0 0 0 0 0 0 0 0
bdi-miR169m UAGCCAAGGAUGACUUGCCG 20 12,032 708 4,004 2    14 290 301 2 742 599 458 12 2,005 4,004 638 381 436 1,631 301 204 14
bdi-miR169n UAGCCAAGGAUGACUUGCCUA 21 3,225 190 1,180 13    43 13 32 69 24 72 22 65 1,180 784 125 362 120 99 80 72 63
bdi-miR171a UGAUUGAGCCGCGCCAAUAUC 21 126 7 33 1    33 0 1 20 0 0 0 32 5 0 0 0 0 1 1 1 32
bdi-miR171b UGAUUGAGCCGUGCCAAUAUC 21 33,219 1,954 10,577 93    10,577 241 103 7,167 160 93 151 6,314 736 139 210 122 314 948 207 162 5,575
bdi-miR171c-3p UGAUUGAGCCGUGCCAAUAUC 21 33,219 1,954 10,577 93    10,577 241 103 7,167 160 93 151 6,314 736 139 210 122 314 948 207 162 5,575
bdi-miR171c-5p CGGUAUUGGUGCGGUUCAAUC 21 62 4 26 1    26 4 0 14 1 1 2 8 0 0 0 0 1 2 0 1 2
bdi-miR171d-3p UGAUUGAGCCGUGCCAAUAUC 21 33,219 1,954 10,577 93    10,577 241 103 7,167 160 93 151 6,314 736 139 210 122 314 948 207 162 5,575
bdi-miR171d-5p UGUUGGCUCGACUCACUCAGA 21 465 27 158 2    158 25 0 93 2 14 11 45 16 8 2 0 3 24 8 5 51
bdi-miR171e UGAUUGAGCCGUGCCAAUAUC 21 33,219 1,954 10,577 93    10,577 241 103 7,167 160 93 151 6,314 736 139 210 122 314 948 207 162 5,575
bdi-miR171f UGAGCCGAACCAAUAUCACCC 21 6 0 2 1    0 0 1 2 0 0 0 1 1 0 0 0 0 1 0 0 0
bdi-miR172a-3p AGAAUCUUGAUGAUGCUGCAU 21 177,832 10,461 23,068 53    1,196 9,654 53 273 21,954 9,259 15,685 1,270 23,068 8,264 16,705 7,491 22,719 20,659 8,338 9,696 1,548
bdi-miR172a-5p GCAGCACCACCAAGAUUCACA 21 26 2 5 1    5 1 0 4 1 0 1 3 0 0 0 0 1 2 1 2 5
bdi-miR172b GGAAUCUUGAUGAUGCUGCAU 21 2,688 158 909 1    59 181 1 4 14 53 174 8 376 325 28 909 100 198 105 139 14
bdi-miR172d AGAAUCCUGAUGAUGCUGCAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR1878-3p AUUUGUAGUGUUCAGAUUGAGUUU 24 160 9 46 1    46 3 3 8 1 0 2 35 0 3 0 0 2 9 1 1 46
bdi-miR1878-5p ACUUAGUCUGAACACUAUAAAAAA 24 22 1 7 1    0 2 0 0 6 0 0 0 1 0 2 0 1 7 2 1 0
bdi-miR2118a UUUCCGAUGCCUCCCAUUCCUA 22 4 0 4 4    4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR2118b UUCCUGAUGCCUCCCAUUCCUA 22 11 1 8 1    8 0 0 2 0 0 0 1 0 0 0 0 0 0 0 0 0
bdi-miR2275a UUUGGUUUCCUCCAAUGUCUCA 22 141 8 93 1    93 0 0 10 1 0 0 11 0 0 0 0 0 0 1 1 24
bdi-miR2275b UUCAGUUUCUUCUAAUAUCUCA 22 16 1 14 2    14 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR2275c UUUGGUUUCCUCCAAUAUCUCA 22 33 2 23 1    23 0 0 2 0 0 1 3 0 0 0 0 0 1 1 0 2
bdi-miR319a UGAGGGAGCUUUCUUCUGUCC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR319b-3p UUGGACUGAAGGGUGCUCCCU 21 22,703 1,335 8,683 2    7,039 87 95 8,683 3 21 143 4,107 24 28 2 54 4 38 18 15 2,342
bdi-miR319b-5p AGAGCUCUCUUCAGUCCACUC 21 7 0 3 1    0 0 0 0 0 0 1 0 3 0 0 0 0 1 1 1 0
bdi-miR390a-3p CGCUAUCUAUCCUGAGCUCCA 21 42 2 12 1    10 0 0 12 0 0 1 4 3 0 0 0 0 1 0 1 10
bdi-miR390a-5p AAGCUCAGGAGGGAUAGCGCC 21 1,824 107 451 5    54 38 15 113 5 5 43 57 451 75 79 279 89 163 99 150 109
bdi-miR393a UCCAAAGGGAUCGCAUUGAUC 21 2,368 139 816 10    40 48 10 32 251 197 97 49 226 56 95 816 78 159 72 59 83
bdi-miR393b-3p UCAGUGCAAUCCCUUUGGAAU 21 6,912 407 2,743 8    1,369 8 0 385 53 12 18 2,743 22 131 13 0 22 38 9 8 2,081
bdi-miR393b-5p UCCAAAGGGAUCGCAUUGAUC 21 2,368 139 816 10    40 48 10 32 251 197 97 49 226 56 95 816 78 159 72 59 83
bdi-miR394 UUGGCAUUCUGUCCACCUCC 20 3,267 192 1,478 2    612 11 21 433 14 23 38 555 4 19 8 0 2 33 7 9 1,478
bdi-miR395a UGAAGUGUUUGGGGGAACUC 20 1,886 111 899 1    308 8 81 119 38 25 16 254 5 25 1 5 4 5 60 33 899
bdi-miR395b UGAAGUGUUUGGGGGAACUC 20 1,886 111 899 1    308 8 81 119 38 25 16 254 5 25 1 5 4 5 60 33 899
bdi-miR395c-3p UGAAGUGUUUGGGGGAACUC 20 1,886 111 899 1    308 8 81 119 38 25 16 254 5 25 1 5 4 5 60 33 899
bdi-miR395c-5p GUUCCCUGCAAGCACUUCAUG 21 6 0 2 1    0 0 2 0 1 0 0 1 0 0 0 0 0 1 0 1 0
bdi-miR395d-3p AAGUGUUUGGGGAACUCUAGG 21 238 14 96 1    57 0 0 10 6 0 2 59 1 3 0 0 3 0 0 1 96
bdi-miR395d-5p UGGGGUUCCCUCCAAACACUUCA 23 50 3 20 1    20 0 0 2 0 0 0 4 1 0 1 0 1 0 1 1 19
bdi-miR395e-3p UGAAGUGUUUGGGGGAACUC 20 1,886 111 899 1    308 8 81 119 38 25 16 254 5 25 1 5 4 5 60 33 899
bdi-miR395e-5p GUUCUCCUCAAAUCACUUCAGU 22 28 2 13 4    6 0 0 4 0 0 0 5 0 0 0 0 0 0 0 0 13
bdi-miR395f-3p UGAAGUGUUUGGGGGAACUC 20 1,886 111 899 1    308 8 81 119 38 25 16 254 5 25 1 5 4 5 60 33 899
bdi-miR395f-5p GUUCCCUUCAAACACUUUACG 21 1 0 1 1    0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0
bdi-miR395g-3p UGAAGUGUUUGGGGGAACUC 20 1,886 111 899 1    308 8 81 119 38 25 16 254 5 25 1 5 4 5 60 33 899
bdi-miR395g-5p GUUUCCUGCAAACACUUCACG 21 6 0 2 1    0 0 0 0 1 0 0 0 0 0 0 0 0 1 1 1 2
bdi-miR395h-3p UGAAGUGUUUGGGGGAACUC 20 1,886 111 899 1    308 8 81 119 38 25 16 254 5 25 1 5 4 5 60 33 899
bdi-miR395h-5p GUUCCCUGCAAGCACUUCACG 21 29 2 7 1    0 0 3 0 7 0 1 1 4 0 1 5 1 0 3 3 0
bdi-miR395j-3p UGAAGUGUUUGGGGGAACUC 20 1,886 111 899 1    308 8 81 119 38 25 16 254 5 25 1 5 4 5 60 33 899
bdi-miR395j-5p GUUUCCCGCAAGCACUUCACG 21 3 0 1 1    0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 1 0
bdi-miR395k-3p UGAAGUGUUUGGGGGAACUC 20 1,886 111 899 1    308 8 81 119 38 25 16 254 5 25 1 5 4 5 60 33 899
bdi-miR395k-5p GUUCCCUGCAAGCACUUCAUG 21 6 0 2 1    0 0 2 0 1 0 0 1 0 0 0 0 0 1 0 1 0
bdi-miR395l-3p UGAAGUGUUUGGGGGAACUC 20 1,886 111 899 1    308 8 81 119 38 25 16 254 5 25 1 5 4 5 60 33 899
bdi-miR395l-5p GUUCCCUGCAAGCACUUCACG 21 29 2 7 1    0 0 3 0 7 0 1 1 4 0 1 5 1 0 3 3 0
bdi-miR395m UGAAGUGUUUGGGGGAACUC 20 1,886 111 899 1    308 8 81 119 38 25 16 254 5 25 1 5 4 5 60 33 899
bdi-miR395n-3p UGAAGUGUUUGGGGGAACUC 20 1,886 111 899 1    308 8 81 119 38 25 16 254 5 25 1 5 4 5 60 33 899
bdi-miR395n-5p GUUCCCUGCAAGCACUUCACC 21 2 0 1 1    1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0
bdi-miR395o-3p UGAAGUGUUUGGGGGAACUC 20 1,886 111 899 1    308 8 81 119 38 25 16 254 5 25 1 5 4 5 60 33 899
bdi-miR395o-5p AUUCCCUACAAGCACUUCACA 21 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0
bdi-miR395p-3p UGAAGUGUUUGGAGGAACUC 20 73 4 24 1    15 1 3 2 3 0 1 17 3 0 0 0 0 1 1 2 24
bdi-miR395p-5p GUUUCCUGCAAGCACUUCACG 21 1 0 1 1    0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR395q UGAAGUGUUUGGGGGAACUC 20 1,886 111 899 1    308 8 81 119 38 25 16 254 5 25 1 5 4 5 60 33 899
bdi-miR396a-3p GUUCAAGAAAGUCCUUGGAAA 21 1,636 96 774 2    774 28 18 290 3 29 26 268 13 0 2 0 6 2 5 4 168
bdi-miR396a-5p UCCACAGGCUUUCUUGAACUG 21 117,192 6,894 44,734 195    23,954 487 382 14,848 872 680 430 44,734 831 6,904 232 195 348 1,217 254 212 20,612
bdi-miR396b-3p GUUCAAGAAAGCCCAUGGAAA 21 33 2 9 1    9 1 0 8 0 0 0 9 0 0 1 0 2 1 1 1 0
bdi-miR396b-5p UCCACAGGCUUUCUUGAACUG 21 117,192 6,894 44,734 195    23,954 487 382 14,848 872 680 430 44,734 831 6,904 232 195 348 1,217 254 212 20,612
bdi-miR396c-3p GUUCAAUAAAGCUGUGGGAAA 21 107 6 38 1    38 4 5 22 1 9 5 4 0 0 1 0 2 2 1 2 11
bdi-miR396c-5p UUCCACAGCUUUCUUGAACUG 21 558 33 129 1    129 33 71 55 10 10 37 64 32 42 1 5 4 17 7 4 37
bdi-miR396d-3p GUUCAAUAAAGCUGUGGGAAA 21 107 6 38 1    38 4 5 22 1 9 5 4 0 0 1 0 2 2 1 2 11
bdi-miR396d-5p UUCCACAGCUUUCUUGAACUG 21 558 33 129 1    129 33 71 55 10 10 37 64 32 42 1 5 4 17 7 4 37
bdi-miR396e-3p GGUCAAGAAAGCUGUGGGAAG 21 265 16 41 1    41 14 0 26 1 9 13 12 4 0 18 10 34 9 34 26 14
bdi-miR396e-5p UUCCACAGCUUUCUUGAACUU 21 4,440 261 1,669 2    996 11 0 468 12 0 5 1,669 93 47 4 0 6 23 4 2 1,100
bdi-miR397a UCAUUGAGUGCAGCGUUGAUG 21 22 1 8 3    3 0 0 8 0 0 0 3 0 0 0 0 0 0 0 0 8
bdi-miR397b-3p CUUCGACCCUGCACCCAAUCA 21 10 1 6 1    2 0 0 6 0 0 0 0 0 0 0 0 0 0 1 1 0
bdi-miR397b-5p AUUGAGUGCAGCGUUGAUGAA 21 42,590 2,505 20,330 1    19,621 2 142 20,330 1 0 2 1,636 1 14 2 0 3 2 138 151 545
bdi-miR398a UGUGUUCUCAGGUCGCCCCUG 21 105 6 73 6    6 0 0 73 0 0 0 8 0 0 0 0 0 0 0 0 18
bdi-miR398b CAGGAGUGUCACUGAGAACACA 22 7 0 6 1    1 0 0 6 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR399a UGCCAAAGGAGAAUUACCCUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR399b UGCCAAAGGAGAAUUGCCCUG 21 18 1 5 1    1 0 0 4 1 0 0 5 0 0 0 0 1 0 0 3 3
bdi-miR399c UGCCAAAGGAGAAUUGCCCUG 21 18 1 5 1    1 0 0 4 1 0 0 5 0 0 0 0 1 0 0 3 3
bdi-miR399d UGCCAAAGGAGAUUUGCCCGG 21 226 13 105 1    22 2 3 105 2 6 0 31 1 8 1 0 1 2 1 12 29
bdi-miR408-3p CUGCACUGCCUCUUCCCUGGC 21 773 45 686 1    39 0 1 686 0 0 0 21 0 0 0 0 0 0 1 3 22
bdi-miR408-5p CAGGGAUGGAGCAGAGCAUGG 21 533 31 248 1    26 1 6 71 1 0 2 0 1 0 3 5 1 1 161 248 6
bdi-miR437 GAACUUAGAGAAGUUUGACUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR444a UUGCUGCCUCAAGCUUGCUGC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR444b UGCAGUUGCUGCCUCAAGCUU 21 3,330 196 694 3    3 47 415 6 146 26 61 5 694 378 166 318 346 420 172 122 5
bdi-miR444c UGCAGUUGUUGUCUCAAGCUU 21 795 47 207 4    4 7 41 8 38 25 12 13 38 53 48 83 100 207 54 54 10
bdi-miR444d UGCAGUUGUUGUCUCAAGCUU 21 795 47 207 4    4 7 41 8 38 25 12 13 38 53 48 83 100 207 54 54 10
bdi-miR5049-3p CAAGUAAUAUGGAUCGGAGGAAGU 24 9 1 2 1    0 2 1 0 0 0 2 0 0 0 0 0 1 1 1 1 0
bdi-miR5049-5p UCCUUCCGACCCAUAUUACUUGU 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR5054 UCCCCACGGUCGGCGCCA 18 1,224 72 589 1    117 15 3 589 8 2 10 124 15 181 13 24 0 4 1 3 115
bdi-miR5055 UCUCGCUGCUGAGCUCGGCGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR5056 AGGAAGAACCGGUAAUAAGCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR5057 AAAUUUCAAAUCAUUUUGACA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR5058 AACAGUUGAGGGAUGAAAAACA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR5059 CGGCCUGGGCAGCACCACCA 20 1 0 1 1    0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR5060 CGGCUAGCUAGAGACCGCCAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR5061 UCUGUUCUGUCCUGCUCGGUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR5062a UGAACCUUGGGGAAAAGCCGCCU 23 9 1 3 1    0 0 0 0 0 0 0 0 0 3 1 0 1 2 1 1 0
bdi-miR5063 UCCACUGGAAAAGGCUUUUGCU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR5064 CGAAUUUGUCCAUAGCAUCAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR5065 UAGGCAAUUCACUUAUACACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR5066 AAGUGUAUAAGUGGAGUGCCU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR5067 UCAGCGACAACUAAUAUGGAU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR5068 AUCGGGUAGAGCGGGUAUGGGUAU 24 2 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0
bdi-miR5069 UAGGUUAUUGAUUUGACCAAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR5070 AACUAAGUAGGGUCAGAGGGU 21 5 0 5 5    0 0 0 0 0 0 0 0 0 0 0 5 0 0 0 0 0
bdi-miR5163a-3p UUAGGUAUUUCAGGUUAGGUG 21 10,424 613 3,232 1    1,967 38 18 1,812 76 1 36 3,232 7 6 115 34 213 212 109 97 2,451
bdi-miR5163a-5p CCUAGCCUAAAAUAUUUAAAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR5163b-3p UAGAUAUUUCAGGUUGUGUGGA 22 48,189 2,835 5,018 111    4,916 1,377 3,942 4,369 3,534 1,535 1,587 5,018 236 111 2,591 1,060 3,872 3,875 2,483 2,680 5,003
bdi-miR5163b-5p CACCCAACUGAAAUAUUUAAA 21 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0
bdi-miR5164 CGCAACUUUGUCUAGAUACGC 21 19 1 7 1    7 1 0 2 0 0 0 5 0 0 0 0 1 1 0 0 2
bdi-miR5165-3p CCUACCUUGAGCCAAAGAUAU 21 4 0 2 1    2 1 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0
bdi-miR5165-5p AUCUUGGGCUCUAGGUAGGUU 21 126 7 35 2    2 8 4 6 6 0 7 0 9 0 7 10 35 10 11 8 3
bdi-miR5166 UGCCCACCAGGGUUCGAUCCA 21 32 2 12 3    12 0 0 6 0 3 0 0 0 0 0 0 0 0 0 0 11
bdi-miR5167a-3p CCAAUGACACCCAUAGUGGAA 21 5 0 2 1    2 0 0 2 0 0 1 0 0 0 0 0 0 0 0 0 0
bdi-miR5167a-5p CCACUUUGGGUGUCAUUGGUA 21 332 20 100 1    100 1 3 75 1 0 1 91 0 0 0 0 1 1 1 1 56
bdi-miR5167b-3p UGUGAAUUGCCUUAACGAGAGC 22 3 0 3 3    0 0 0 0 0 0 0 3 0 0 0 0 0 0 0 0 0
bdi-miR5167b-5p UCUAGUUAAGGUAAUUUAACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR5169a UUUGACCAAGUUUGUAGAACA 21 369 22 109 2    3 29 21 4 109 19 21 5 0 0 15 0 33 76 14 18 2
bdi-miR5169b UUUGACCAAGUUUGUAGAACA 21 369 22 109 2    3 29 21 4 109 19 21 5 0 0 15 0 33 76 14 18 2
bdi-miR5170 UCAUCAAGUUGAGUGACCGUA 21 121 7 17 1    15 1 3 0 16 0 4 17 7 0 7 0 11 13 7 9 11
bdi-miR5171a ACUUAAUAUGGGACGGAAGAA 21 2 0 1 1    1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0
bdi-miR5171b ACUUAAUAUGGGACGGAAGAA 21 2 0 1 1    1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0
bdi-miR5172-3p UGAUCUACUAGCUCCUCGGCA 21 198 12 36 3    17 5 14 36 8 0 11 15 15 11 3 10 7 11 7 6 22
bdi-miR5172-5p CGAGGAGCUAGUAGAUCGGGA 21 218 13 78 2    2 11 78 2 8 6 32 0 11 3 10 5 10 13 15 12 0
bdi-miR5173-3p UGCAUCUGUAUAUACGAGAAG 21 109 6 27 2    5 2 2 4 12 6 3 5 0 0 9 0 15 27 10 7 2
bdi-miR5173-5p UCUCGUAUAUGCGGAUGUACC 21 339 20 50 5    41 12 8 16 38 13 11 36 11 11 9 29 10 50 12 5 27
bdi-miR5174a CUCCGUUCCAUAAAGAUUGGC 21 26 2 11 3    6 0 0 6 0 0 0 3 0 0 0 0 0 0 0 0 11
bdi-miR5174b-3p CAACCUUUAUGGAACGGAGGG 21 2 0 1 1    0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0
bdi-miR5174b-5p CCUCUGUUCCAUAAAGAUUGG 21 14 1 5 1    2 1 5 0 1 0 1 0 0 0 0 0 0 1 0 1 2
bdi-miR5174c-3p CAAUUUUGCGUGGAACUGAGGGAG 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR5174c-5p UCCCUCCGUUCUAUGAAGAUUGGC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR5174d-3p CAAUCUUUAUGGAACGGAGAGAGU 24 9 1 2 1    0 1 0 0 1 0 1 0 0 0 1 0 1 2 1 1 0
bdi-miR5174d-5p UCCCUCCGUUUCAUAAAGAUUGGC 24 11 1 6 1    2 0 0 2 0 0 0 1 0 0 0 0 0 0 0 0 6
bdi-miR5174e-3p.1 CAACCUUUAUGGAACGGAGGG 21 2 0 1 1    0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0
bdi-miR5174e-3p.2 UUUAUGGAACGGAGGGAGUAG 21 5 0 1 1    1 0 0 0 0 0 0 0 0 0 0 0 1 1 1 1 0
bdi-miR5174e-5p.1 CCUCUGUUCCAUAAAGAUUGG 21 14 1 5 1    2 1 5 0 1 0 1 0 0 0 0 0 0 1 0 1 2
bdi-miR5174e-5p.2 UACUCCCUCUGUUCCAUAAAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR5174f CCUCCGUUUCAUAAAGGUUGG 21 509 30 156 1    156 0 0 99 0 0 0 108 0 0 0 0 0 1 1 0 144
bdi-miR5175a AAGAAUUUAGGAACGGAGGGA 21 413 24 83 4    12 23 26 8 16 8 20 4 30 17 37 83 49 12 29 31 8
bdi-miR5175b CCUCUGUUCCUAAAUUCUUGU 21 2 0 2 2    2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR5176-3p UGUGAUGAUGUGGCAUAGAAU 21 2,061 121 281 25    267 35 77 253 162 160 32 275 26 25 80 29 96 130 75 58 281
bdi-miR5176-5p UAUGCCAUGUCGUCACAUAUC 21 116 7 25 3    10 5 0 8 10 0 10 7 5 0 5 5 9 25 3 4 10
bdi-miR5177 UGAGGUUGUAAAACAGACAGU 21 17 1 7 1    1 2 0 0 7 0 0 0 1 0 1 0 1 2 1 1 0
bdi-miR5178-3p UCUGACCGGUGGGCCUGAGCG 21 194 11 50 4    8 11 11 12 24 50 9 5 0 11 11 0 18 4 8 4 8
bdi-miR5178-5p CUUGGGACCGCCGGUCAGAGC 21 4 0 3 1    3 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0
bdi-miR5179 UUUUGCUCAAGACCGCGCAAC 21 1,490 88 213 12    154 200 12 32 29 36 210 19 213 150 23 132 72 95 32 39 42
bdi-miR5180a UAAGUGUCUCAGUUUUGAACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR5180b UAAGUGUCUCAGUUUUGAACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR5181a-3p CGGCACUUAUUAUGGAUCAGA 21 69 4 19 1    8 3 0 2 11 0 3 12 0 3 1 0 2 3 1 1 19
bdi-miR5181a-5p UGAUCCAUAAUAAGUGUCAGG 21 45 3 16 1    8 1 0 4 1 0 0 16 0 0 2 0 2 1 1 1 8
bdi-miR5181b UCCGAUCCAUAAUAAGUGUCG 21 6 0 2 1    1 0 0 0 0 0 0 1 0 0 0 0 0 1 1 0 2
bdi-miR5181c-3p ACUUCUUAUGGAUUGUAGGGA 21 193 11 45 1    34 3 9 45 10 5 2 24 1 0 1 15 1 3 2 1 37
bdi-miR5181c-5p CCUCCGGUCCACAAUAAGUGU 21 14 1 10 2    2 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 10
bdi-miR5181d ACUUAUUAUGGACCGGAGGGA 21 32 2 6 1    6 1 2 0 1 0 1 3 3 0 1 5 1 1 3 2 2
bdi-miR5181e CGACACUUACUGUGGCUCGGA 21 449 26 91 2    4 23 12 2 70 91 16 0 67 75 6 34 7 2 21 14 5
bdi-miR5182 UGAUGAUCUUGGAACACGUGC 21 651 38 215 1    111 1 0 138 0 0 0 215 1 0 1 0 1 2 1 0 180
bdi-miR5183 UAUUUGGACAAAUUUGAGUCA 21 10 1 2 1    2 1 0 2 1 0 0 1 0 0 0 0 0 1 1 1 0
bdi-miR5184 UUCUAACAUUAUGCACAUCUA 21 6 0 4 1    1 0 0 0 0 0 0 4 0 0 0 0 0 1 0 0 0
bdi-miR5185a-3p UUUGAGAAUUGAACUAGAAGC 21 300 18 60 4    6 11 60 4 60 38 7 13 9 11 4 24 13 25 5 5 5
bdi-miR5185a-5p UUCUAGUUCAUUUUUCAAAUC 21 6 0 3 1    3 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 2
bdi-miR5185b-3p UUUGAGAAUUGAACUAGAAGC 21 300 18 60 4    6 11 60 4 60 38 7 13 9 11 4 24 13 25 5 5 5
bdi-miR5185b-5p UUCUAGUUCAUUUUUCAAAUC 21 6 0 3 1    3 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 2
bdi-miR5185c-3p UUUGAGAAUUGAACUAGAAGC 21 300 18 60 4    6 11 60 4 60 38 7 13 9 11 4 24 13 25 5 5 5
bdi-miR5185c-5p UUCUAGUUCAUUUUUCAAAUC 21 6 0 3 1    3 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 2
bdi-miR5185d-3p UUUGAGAAUUGAACUAGAAGC 21 300 18 60 4    6 11 60 4 60 38 7 13 9 11 4 24 13 25 5 5 5
bdi-miR5185d-5p UUCUAGUUCAUUUUUCAAAUC 21 6 0 3 1    3 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 2
bdi-miR5185e-3p UUUGAGAAUUGAACUAGAAGC 21 300 18 60 4    6 11 60 4 60 38 7 13 9 11 4 24 13 25 5 5 5
bdi-miR5185e-5p UUCUAGUUCAUUUUUCAAAUC 21 6 0 3 1    3 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 2
bdi-miR5185f-3p UUUGAGAAUUGAACUAGAAGC 21 300 18 60 4    6 11 60 4 60 38 7 13 9 11 4 24 13 25 5 5 5
bdi-miR5185f-5p UUCUAGUUCAUUUUUCAAAUC 21 6 0 3 1    3 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 2
bdi-miR5185g-3p UUUGAGAAUUGAACUAGAAGC 21 300 18 60 4    6 11 60 4 60 38 7 13 9 11 4 24 13 25 5 5 5
bdi-miR5185g-5p UUCUAGUUCAUUUUUCAAAUC 21 6 0 3 1    3 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 2
bdi-miR5185h-3p UUUGAGAAUUGAACUAGAAGC 21 300 18 60 4    6 11 60 4 60 38 7 13 9 11 4 24 13 25 5 5 5
bdi-miR5185h-5p UUCUAGUUCAUUUUUCAAAUC 21 6 0 3 1    3 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 2
bdi-miR5185i-3p UUUGAGAAUUGAACUAGAAGC 21 300 18 60 4    6 11 60 4 60 38 7 13 9 11 4 24 13 25 5 5 5
bdi-miR5185i-5p UUCUAGUUCAUUUUUCAAAUC 21 6 0 3 1    3 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 2
bdi-miR5185j-3p UUUGAGAAUUGAACUAGAAGC 21 300 18 60 4    6 11 60 4 60 38 7 13 9 11 4 24 13 25 5 5 5
bdi-miR5185j-5p UUCUAGUUCAUUUUUCAAAUC 21 6 0 3 1    3 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 2
bdi-miR5185k-3p UUUGAGAAUUGAACUAGAAGC 21 300 18 60 4    6 11 60 4 60 38 7 13 9 11 4 24 13 25 5 5 5
bdi-miR5185k-5p UUCUAGUUCAUUUUUCAAAUC 21 6 0 3 1    3 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 2
bdi-miR5185l-3p UUUGGAGAUUGACUUAGAAGC 21 275 16 88 1    51 1 0 67 4 0 1 88 1 0 0 0 1 1 1 1 58
bdi-miR5185l-5p UUCUAAGUCAAUCUCUAAAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR5185m-3p UUUGAAAAUUGAACUAGAAGC 21 50 3 13 1    2 1 2 0 13 0 1 4 7 0 1 5 3 7 1 1 2
bdi-miR5185m-5p UUCUAGUUCAUUUUUCGAAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR5198 GGGGAAAAGAGAUUGAGGGAG 21 2 0 1 1    1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0
bdi-miR5199 UGUUCAUACGGUUGAUAGCAC 21 113 7 26 1    26 1 1 26 3 0 0 20 1 0 1 0 3 3 1 1 26
bdi-miR5200a-3p UGUAGAUACUCCCUAAGGCUU 21 1,001 59 782 1    1 65 0 4 30 10 66 0 12 6 1 0 6 782 8 7 3
bdi-miR5200a-5p GCCUUAGGGAAUAUCUACACU 21 6 0 5 1    0 1 0 0 0 0 0 0 0 0 0 0 0 5 0 0 0
bdi-miR5200b-3p UGUAGAUACUCCCUAAGGCUU 21 1,001 59 782 1    1 65 0 4 30 10 66 0 12 6 1 0 6 782 8 7 3
bdi-miR5200b-5p GCCUUAGAGAGUAUCUACACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR5200c UGUAGAUACUCUCUAAGGCUU 21 4 0 3 1    0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 1 0
bdi-miR5201-3p AGGGCGAGGCAAAUGAUCAAA 21 65 4 11 2    2 2 2 4 3 4 6 0 4 3 7 0 4 4 7 11 2
bdi-miR5201-5p UGAUCAUUUGCCCCGUCUUGU 21 44 3 14 8    14 0 0 10 0 0 0 12 0 0 0 0 0 0 0 0 8
bdi-miR5202 UUACGUGAGUUAAAUCGUCGA 21 643 38 141 15    0 30 49 0 141 109 36 0 15 22 19 39 36 68 39 40 0
bdi-miR528-3p CCUGUGCCUGCCUCUUCCAUU 21 20 1 8 1    8 0 3 0 0 0 1 0 0 0 0 0 0 0 3 3 2
bdi-miR528-5p UGGAAGGGGCAUGCAGAGGAG 21 85,213 5,013 51,033 11    183 125 3,340 490 468 101 1,759 11 210 195 473 904 345 162 25,363 51,033 51
bdi-miR5281a UCUUAUAAAUAGGAACGGAGG 21 68 4 15 1    3 2 3 2 12 2 2 1 4 6 2 15 4 3 1 3 3
bdi-miR5281b UCUUAUAAAUAGGAACGGAGG 21 68 4 15 1    3 2 3 2 12 2 2 1 4 6 2 15 4 3 1 3 3
bdi-miR529-3p GCUGUACCCUCUCUCUUCUUC 21 246 14 85 1    58 0 0 59 0 0 1 32 5 0 0 0 0 5 0 1 85
bdi-miR529-5p AGAAGAGAGAGAGUACAGCCU 21 1,070 63 185 1    1 106 8 0 51 0 50 0 27 53 185 73 183 76 96 161 0
bdi-miR530a UGCAUUUGCACCUGCACCUAC 21 4 0 1 1    1 0 0 0 0 0 0 0 1 0 0 0 0 1 1 0 0
bdi-miR530b UGCAUUUGCACCUGCACCUAC 21 4 0 1 1    1 0 0 0 0 0 0 0 1 0 0 0 0 1 1 0 0
bdi-miR531 GAUGCUCGCCGGAGCAGCGUGCUG 24 1,763 104 273 9    36 66 74 14 112 144 45 9 127 70 154 44 273 236 163 169 27
bdi-miR7707-3p UUUGAUCGAUGUAUGGCUGAACGG 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7707-5p GUUCAGCCAUACAUCGAUCGAAGC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7708a-3p UGUAAUGGUACUGAACAAAGACGC 24 14 1 3 1    0 1 3 0 1 0 3 0 0 0 1 0 1 2 1 1 0
bdi-miR7708a-5p GUUUUUCCUCAGUACCGUUACAAU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7708b-3p AAAUGGCCCGAGAAUUGUAAUGGU 24 45 3 13 1    4 1 0 8 1 0 2 5 0 0 1 5 1 2 1 1 13
bdi-miR7708b-5p CAUUACAAUUCUUGGGACAUUUGC 24 3 0 3 3    0 0 0 0 0 0 0 3 0 0 0 0 0 0 0 0 0
bdi-miR7709-3p UGUGCCUAGUCGUACUUUGAU 21 22 1 5 1    3 0 0 2 0 0 1 4 4 0 0 0 1 1 1 0 5
bdi-miR7709-5p UAAAGUAUGACUAGGCACACG 21 4 0 1 1    0 1 0 0 0 0 0 0 0 0 0 0 1 1 0 1 0
bdi-miR7710-3p AUUGAUGUCACAAACUAUAGUAGC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7710-5p UACUACAGAUCGUGAUGUCAACUU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7711-3p.1 AGAUUGUUAAAGAGGCCAAGUAUU 24 548 32 144 1    2 9 1 0 32 0 22 1 4 3 99 0 144 117 60 54 0
bdi-miR7711-3p.3 UAUGAGUCGAUUUCUCUUAUGGCU 24 293 17 45 5    10 11 26 14 25 12 19 28 30 8 11 5 14 45 6 7 22
bdi-miR7711-3p.4 UAUCCUAGCCAUAAAAUUCAGUAU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7711-5p.1 UACUUAGCCUCUUUGACAAUCUUG 24 52 3 24 1    6 0 0 24 1 0 0 7 0 0 0 0 0 1 0 0 13
bdi-miR7711-5p.2 AUGAUAGAAUUUCUAAAUUAGAAG 24 11 1 4 1    0 0 0 0 3 0 0 0 0 0 0 0 2 4 1 1 0
bdi-miR7711-5p.3 CCAUAAGUGAAAUCAACUCAUUCU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7711-5p.4 UCUGAAUUUUAUGACCAAGAUAAC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7712-3p UUAUUGUGGUAACUUUAAGAUGGC 24 5 0 2 1    0 1 0 2 0 0 0 0 0 0 0 0 1 0 1 0 0
bdi-miR7712-5p UAGAGCUCUGAAGUUACCACCCAC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7713-3p UUGAGACUGGCAGCAUUAGCAAGC 24 7 0 3 1    0 0 0 0 0 3 0 0 0 0 0 0 0 0 1 1 2
bdi-miR7713-5p UAGGAAUUGAUGGAACAGCUCACA 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7714-3p CUAAUAUGUAUCGAAGGGAGUAGC 24 3 0 2 1    1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2
bdi-miR7714-5p UAUUUUCUCGGAUCAAUAUUACUU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7715-3p UAAGAAAACCCACCUUUGAUG 21 2 0 2 2    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2
bdi-miR7715-5p UCAAAGAUGGGAUUUCUGAAC 21 26 2 11 1    2 0 1 0 3 0 1 5 1 0 1 0 0 1 0 0 11
bdi-miR7716-3p UUCGUUCUUCUCCAGUAAUUGACC 24 2 0 2 2    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2
bdi-miR7716-5p UCAGUUGCUAGAGAAGAACGAAAC 24 290 17 63 1    1 29 23 0 49 3 63 0 7 8 20 0 17 36 19 15 0
bdi-miR7717a-3p GAUGGAUACGAUUGUCGACUGAGA 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7717a-5p UCAUUGAGAUUCGUGUAAAUUAA 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7717b-3p AACUAUUUUUAAGUUGACCGAGAA 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7717b-5p UCUAAGACGACUGAGAAAUAACUA 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7717c-3p UUAGUUGACUGAGAAAUAGACGGU 24 25 1 7 1    0 1 0 0 7 5 0 0 0 0 3 0 3 4 1 1 0
bdi-miR7717c-5p UUGCUAUUUCUUGGGCGACUGAGA 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7718-3p AUCGCCUUAGACGAAUAAAUGAGG 24 50 3 16 1    8 0 0 6 1 0 1 9 1 0 1 0 2 3 1 1 16
bdi-miR7718-5p UCAUUUAUUCGUCCAUGGCGAUGG 24 13 1 4 1    3 1 0 4 1 0 0 0 0 0 0 0 0 1 0 0 3
bdi-miR7719-3p UAGAAGCAUAUAUGGCGAAGA 21 9 1 3 1    3 1 0 0 0 0 0 1 0 0 1 0 1 1 0 1 0
bdi-miR7719-5p UCCGCCAUACAUGUUUCUAUC 21 23 1 8 1    1 0 0 2 1 0 1 1 8 3 0 0 1 3 1 1 0
bdi-miR7720-3p UUUUACACAUGAUUUGGGUUGGAC 24 6 0 2 1    1 1 0 0 1 0 2 0 0 0 0 0 0 1 0 0 0
bdi-miR7720-5p UCGAAAUUGAUCGUGCGGAGAAGC 24 9 1 2 1    2 1 0 0 0 0 1 0 0 0 1 0 1 1 1 1 0
bdi-miR7721-3p AAAGUUUGGCAUAGAAUUCAAUGC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7721-5p ACGGGAUUUUAUAACGGACUUUGG 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7722-3p GAAGGGUAUCGGGAUGAGAGG 21 3 0 1 1    1 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7722-5p UCUCCUCCCGGUACCCUUCUU 21 2 0 2 2    0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7723a-3p GAGGGCCAAGGUAGUUGUUUCACA 24 189 11 38 1    1 6 3 0 14 0 11 0 1 8 29 15 38 31 17 15 0
bdi-miR7723a-5p UGAAACAACUAUCUUGGCCUUCUC 24 56 3 16 1    0 2 5 0 2 0 3 3 0 8 6 0 8 16 2 1 0
bdi-miR7723b-3p AUGAAGGUAGUAGUUUCAAAAUGG 24 37 2 7 1    3 0 0 6 3 0 1 0 0 0 3 0 7 7 1 1 5
bdi-miR7723b-5p AUUUUGAUACUACUACCUUCAUCA 24 2 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0
bdi-miR7724a-3p UUGGCCCACAUUGACAUGUUCACC 24 4 0 1 1    1 0 0 0 0 0 0 1 0 0 0 0 1 0 1 0 0
bdi-miR7724a-5p UGAACAUGUACAUGCUGGCCAACC 24 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0
bdi-miR7724b-3p UUGGCCCACAUUGACAUGUUCACC 24 4 0 1 1    1 0 0 0 0 0 0 1 0 0 0 0 1 0 1 0 0
bdi-miR7724b-5p UGAACAUGUACAUGCUGGCCAACC 24 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0
bdi-miR7725a-3p UGCAAACAAUGUGAUUUCGUCAAG 24 8 0 3 1    0 0 0 0 1 0 0 3 0 0 1 0 1 1 1 0 0
bdi-miR7725a-5p UGACGAGAUCACAUCGUUUGCACA 24 6 0 2 1    2 0 0 2 0 0 0 0 0 0 1 0 0 1 0 0 0
bdi-miR7725b-3p.1 UGAAAACCAUAUUCCUAGCUC 21 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0
bdi-miR7725b-3p.2 CAAAUAAGAGGAGACGAGACAUAG 24 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0
bdi-miR7725b-5p.1 ACUAGGGAGAUGGUUUUCGCU 21 17 1 8 2    2 0 0 2 0 0 0 8 0 0 0 0 0 0 0 0 5
bdi-miR7725b-5p.2 AUGCUCCACCUCAUAUUUGAC 21 2 0 2 2    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2
bdi-miR7726a-3p UGCGAAUCUGUCACCGUUGUCCCC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7726a-5p UGAUGAUGGUACGGACGUCGCGGU 24 14 1 6 1    1 1 1 0 0 3 6 1 1 0 0 0 0 0 0 0 0
bdi-miR7726b-3p UGCGAUACGUCACUUCACCGAAAU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7726b-5p UUUGAUGACAUGACGUACGGCGGC 24 11 1 3 1    3 0 0 0 1 0 1 0 0 0 1 0 1 1 0 1 2
bdi-miR7727-3p CCAAGUCGAUUGGAACUAAUGAGC 24 3 0 3 3    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3
bdi-miR7727-5p UGAUUAGUUUCAGUUGGUCUGGGC 24 4 0 1 1    0 0 0 0 1 0 1 0 0 0 0 0 1 1 0 0 0
bdi-miR7728-3p AAAUACACUCAAUUCAAGCAG 21 2 0 1 1    0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0
bdi-miR7728-5p UGCUCGGAUUGAGUGUAUUUU 21 239 14 57 1    37 4 1 57 6 0 1 37 4 0 2 20 5 19 3 3 40
bdi-miR7729a-3p AGCAAUGGUGGUGGUUUGGAGGAG 24 1 0 1 1    0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0
bdi-miR7729a-5p UGUUUUCAUAGGCCAUGUAGAGC 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7729b-3p AGCAAUGGUGGUGGUUUGGAGGAG 24 1 0 1 1    0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0
bdi-miR7729b-5p UGUUUUCAUAGGCCAUGUAGAGC 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7730-3p AACUUUCUCCCGCAGCUGUUCUGU 24 26 2 10 1    1 0 0 0 0 0 0 1 5 3 1 10 0 1 1 1 2
bdi-miR7730-5p AGAACAGCCACGGUUGAAAGUUAU 24 17 1 5 1    0 2 0 0 1 0 0 0 0 0 2 5 2 2 1 2 0
bdi-miR7731-3p AGGUUUGCUCUGGACUUUGGAAUC 24 1,152 68 289 2    247 2 10 279 2 12 2 276 4 0 3 10 3 5 4 4 289
bdi-miR7731-5p UUCCAAAUUCCUGAGCAAACAUAU 24 13 1 3 1    3 1 0 2 0 0 0 3 0 0 1 0 1 1 0 1 0
bdi-miR7732-3p GAUCGAGAUCGUGGAGGAACC 21 73 4 22 1    16 1 0 22 0 0 1 11 1 0 0 0 0 1 1 1 18
bdi-miR7732-5p UUCCUCCAAGAUCUCGGAGACUC 23 97 6 27 1    6 13 5 0 27 0 7 5 5 6 2 5 4 5 3 1 3
bdi-miR7733-3p CCUGCGUUGGCGAAGGCGAGAAGC 24 20 1 5 1    0 1 0 2 5 1 1 0 0 3 2 0 1 1 2 1 0
bdi-miR7733-5p UUCUCGCCAUUGCCAAACCAGGGC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7734-3p UUAACCUAGUCACAUUCAACG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7734-5p UUGAACGUGACUGGGUUAACG 21 17 1 4 1    2 1 4 2 0 0 1 1 0 0 1 0 1 1 0 1 2
bdi-miR7735-3p CCGGUCGGAGCCAAGAGACGCGGC 24 19 1 5 1    1 2 4 0 0 0 1 1 1 0 1 5 0 1 1 1 0
bdi-miR7735-5p UUGUUUUCCUUCUGCACUCCCGGC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7736-3p UGACAUAUCUGAUGGUAAAGG 21 36 2 10 1    7 1 1 10 0 0 0 4 0 0 0 0 1 1 1 0 10
bdi-miR7736-5p UUUACUAUCUGGGAUGUCACA 21 23 1 9 1    3 0 0 2 0 0 0 9 0 0 0 0 0 1 1 1 6
bdi-miR7737-3p ACUUGAGACGGACUGUAUUAAAAA 24 2 0 1 1    0 0 0 0 1 0 0 0 0 0 0 0 0 1 0 0 0
bdi-miR7737-5p UUUCGGUCAAUGUAUUUCAAGCAG 24 4 0 1 1    0 0 0 0 0 0 1 0 0 0 1 0 1 1 0 0 0
bdi-miR7738-3p GUGCUUGACAGACGACUCUGG 21 616 36 264 3    264 3 3 130 0 20 4 51 7 8 3 0 7 5 4 4 103
bdi-miR7738-5p AGAGUCGUUUGUCAAGCUCGG 21 123 7 39 2    10 4 0 8 2 0 12 0 11 8 3 39 6 7 6 4 3
bdi-miR7739-3p UUGAGUCUGAGAAGUAUUUCUG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7739-5p AGAUGCGUCGAAGCGGACUGGAUC 24 4 0 3 1    0 0 0 0 0 0 1 3 0 0 0 0 0 0 0 0 0
bdi-miR7740-3p GAGACAGAGGUUGUUCGGAUG 21 12 1 4 1    2 0 0 4 0 0 0 3 0 0 1 0 0 0 0 0 2
bdi-miR7740-5p UUUGAACAACCUCGGUCUCAU 21 6 0 2 1    0 0 0 0 0 0 0 1 0 0 1 0 1 1 0 0 2
bdi-miR7741-3p.1 AGAUCUUCCAUGAGUAAAAAU 21 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0
bdi-miR7741-3p.2 UGCAUGUGGAACUUCCAGAUC 21 130 8 30 1    24 1 13 30 6 11 3 12 0 0 3 0 4 1 4 2 16
bdi-miR7741-5p.1 UUUUAAUUGUGGAAGCUCUUG 21 945 56 292 1    179 1 30 174 10 2 4 292 7 6 1 10 3 2 2 2 220
bdi-miR7741-5p.2 UCUUGAAGUUUCGCAUGCAGU 21 47 3 20 1    14 0 0 20 1 0 0 3 0 0 1 0 1 1 0 0 6
bdi-miR7742-3p UGUGUGUUCGAGUGAAUGAGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7742-5p UCAUUCGCUCAUUCACACAGU 21 2 0 2 2    0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7743-3p UUUGAACUUUUGUAUUGGAUCUUU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7743-5p AGCAUCUACUGAUAGUUUGACUGC 24 9 1 3 1    3 0 0 0 1 0 0 0 0 0 1 0 1 1 1 1 0
bdi-miR7744-3p CAUCGACAACUUUUGCCAUCCUUA 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7744-5p AGGAUGGCAAGAUUUAUCGAUGGG 24 498 29 189 1    111 1 0 89 1 0 2 92 0 0 2 0 5 4 1 1 189
bdi-miR7745-3p UUGUUGUUACUUAAGUCUUGGUAC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7745-5p AGUAAGGCUUUAGUAACAAGAGAU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7746-3p UUCUAUUGGAACUCUUAAUCUAUG 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7746-5p AUAGACUAAGAGUUCCAACAGAAG 24 1 0 1 1    0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7747-3p AUCCUAUAACAAAACAAACUGAUC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7747-5p AUCAGAUUGUUUUGUUGUAGGAUG 24 14 1 6 1    1 0 0 2 0 0 0 5 0 0 0 0 0 0 0 0 6
bdi-miR7748a-3p AAUAUGUUUUCUAUUGUUGGACGG 24 2 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0
bdi-miR7748a-5p AUCCAACAACAAGGGACGUGUUAG 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7748b-3p UUGGUCAAAGAAAAUCUAAUACGC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7748b-5p AUGUUAGGAUUCGGUUGACCAAGC 24 62 4 10 1    10 1 9 0 2 5 3 4 1 0 4 0 6 5 3 1 8
bdi-miR7749-3p UGGAAUGGGCGCUCUCAGGGAAGC 24 1 0 1 1    0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0
bdi-miR7749-5p AUCGUCGAGGGCGGAGAUUGCGGC 24 10 1 3 1    0 1 1 0 0 0 1 0 3 0 1 0 1 0 1 1 0
bdi-miR7750-3p CAUGGUCGGCAAUGAUACAGACGA 24 25 1 9 1    0 5 0 0 1 0 9 0 1 0 1 0 1 3 2 2 0
bdi-miR7750-5p AUCUGAAUCAUUGCCGACCAUGCA 24 24 1 6 1    1 1 0 0 6 0 0 0 3 0 2 0 6 2 1 2 0
bdi-miR7751-3p UUUGGUGCACCCGGCUGGAGAUGG 24 1 0 1 1    0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7751-5p AUCUUCCUCGUGGACAAGCGGUAG 24 13 1 5 1    0 0 0 0 2 0 1 0 0 3 0 5 0 0 1 1 0
bdi-miR7752-3p AAAAUGAUAGGUUGGAAGAACACGC 25 3 0 2 1    0 0 0 2 0 0 0 0 0 0 0 0 1 0 0 0 0
bdi-miR7752-5p AUGCUCUUCCCACUGUCAUUUUCC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7753-3p UGAGCAAGGGAGAAGACAUGG 21 20 1 10 1    0 0 0 0 1 0 0 0 0 0 2 10 4 1 1 1 0
bdi-miR7753-5p AUGUCUUCUUCCUUGCUCAUC 21 1 0 1 1    0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0
bdi-miR7754-3p UUCUCUCGGCUAAGGAACUGC 21 570 34 205 1    64 0 0 174 0 0 0 125 1 0 1 0 0 0 0 0 205
bdi-miR7754-5p AUGUUCUCUCGGCUGAGGAAC 21 7 0 2 1    0 0 0 0 1 0 0 0 0 0 0 0 1 1 1 1 2
bdi-miR7755-3p UCAAUUUACGGUGUAGAAUUG 21 41 2 12 1    10 0 0 12 0 0 0 11 0 0 0 0 1 0 0 1 6
bdi-miR7755-5p AUUCCACACUGUAAAUUGAAU 21 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0
bdi-miR7756-3p UGGAGAUGUUGGCAUUGAAUUGGC 24 19 1 5 1    2 3 1 0 0 0 1 0 0 0 2 5 2 0 2 1 0
bdi-miR7756-5p CAAUGCAAUGCCAAGUCUUUCGA 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7757-3p.1 GGUAGUUGAAUGUUUUGUUUA 21 38 2 18 1    5 0 1 18 0 0 1 3 0 0 0 0 0 2 0 0 8
bdi-miR7757-3p.2 AGAUAACUUGAUAUGUAAGUG 21 68 4 16 1    6 1 2 4 5 0 3 15 3 0 1 0 3 16 2 2 5
bdi-miR7757-5p.1 CACAAAACCUUCAGCUACCCA 21 2,891 170 845 6    29 129 36 45 143 6 164 29 845 145 122 171 78 545 142 196 66
bdi-miR7757-5p.2 CUUCCAUAUCAAAUCAUCUCU 21 64 4 25 1    3 0 0 8 1 0 1 25 0 0 0 0 1 3 0 1 21
bdi-miR7758-3p UAGCGGUCAACUAACUGUAGUGGC 24 50 3 22 1    0 2 22 0 1 3 4 3 4 3 0 5 1 0 1 1 0
bdi-miR7758-5p CACUACCGUUAGUUGACCGUUAAG 24 3 0 1 1    1 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0
bdi-miR7759-3p GGCUUAUGCCGACGUGGCUAC 21 4 0 1 1    1 0 1 0 0 0 1 0 0 0 0 0 0 1 0 0 0
bdi-miR7759-5p CAGCCACGUCGGCAUAAGCGAG 22 24 1 6 1    2 2 1 0 0 0 0 0 0 3 1 0 3 3 2 1 6
bdi-miR7760-3p GGCUUUGCUCGGAGUGCUGUGGC 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7760-5p CAGCGGACAGAAUGGAGCAAGCAG 24 8 0 1 1    0 1 1 0 1 0 1 0 1 0 0 0 0 1 1 1 0
bdi-miR7761-3p UCUUGAUCAAGAGACGGCUCUGGC 24 93 5 23 1    0 7 23 2 16 11 9 1 0 0 4 0 4 8 4 4 0
bdi-miR7761-5p CAGUGCCGUCUCUUCCUCAAGUUC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7762-3p CUCGGAAUUUGGUCAUCAACUGGC 24 107 6 44 1    3 3 44 32 1 0 7 1 0 0 1 0 1 9 2 3 0
bdi-miR7762-5p CAGUUGAUGACCAAGUUCUCGAGA 24 18 1 10 1    4 0 3 10 0 0 0 1 0 0 0 0 0 0 0 0 0
bdi-miR7763-3p AUUCCCGUACGUCAAGAUUGC 21 2,029 119 558 1    425 3 1 516 0 0 3 507 1 0 1 5 2 5 1 1 558
bdi-miR7763-5p AAUCUUGAUGUGCGGGGAUAG 21 488 29 144 6    96 7 33 144 0 0 11 48 11 8 7 0 8 32 10 6 67
bdi-miR7764-3p AAAUAGAUCUUGGCGUUAUGGG 22 34 2 12 1    6 1 3 12 0 0 1 5 0 0 0 0 1 0 0 0 5
bdi-miR7764-5p CAUAACCUAGAUCUGUAUCA 20 2 0 1 1    1 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0
bdi-miR7765-3p UUACAAGAAGUUGGACUAAAAUGC 24 2 0 1 1    0 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 0
bdi-miR7765-5p CAUUUUAGUCCAACAAGUUGCAA 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7766-3p CGAGGCUGACUGGGACUAAGCGGC 24 11 1 5 1    0 5 1 0 1 0 1 0 0 0 1 0 1 1 0 0 0
bdi-miR7766-5p CCAACUGGGCCAGUCGGCCUGGGC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7767-3p AGGAGCAAGCAGCUUGAAGGU 21 6 0 2 1    1 1 0 0 0 0 1 0 0 0 0 0 0 0 0 1 2
bdi-miR7767-5p CCCCAAGCUGAGAGCUCUCCC 21 10 1 3 1    1 1 0 2 1 0 1 1 0 3 0 0 0 0 0 0 0
bdi-miR7768a-3p CGGCGCCGUCCUCGACCGGGAG 22 24 1 6 1    1 0 2 6 2 3 1 0 3 3 0 0 2 1 0 0 0
bdi-miR7768a-5p CCCGGUCGAGGACGGCCCCGC 21 2,278 134 396 17    55 396 161 65 237 66 322 17 82 108 122 186 33 202 89 87 50
bdi-miR7768b-3p CGGCGCCGUCCUCGACCGGGAG 22 24 1 6 1    1 0 2 6 2 3 1 0 3 3 0 0 2 1 0 0 0
bdi-miR7768b-5p CCCGGUCGAGGACGGCCCCGC 21 2,278 134 396 17    55 396 161 65 237 66 322 17 82 108 122 186 33 202 89 87 50
bdi-miR7769-3p UGUCAUGUUGGCACUGAUGGG 21 62 4 16 1    1 1 1 16 5 1 1 12 1 3 1 5 2 3 3 1 5
bdi-miR7769-5p CCGUCAGUGCCAACAUGCCAG 21 4 0 2 2    0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 2
bdi-miR7770-3p UCUAGACGGGCCUUCAAAGAG 21 179 11 34 2    18 4 0 34 23 0 10 23 8 0 6 0 7 8 2 2 34
bdi-miR7770-5p CCUUGAAAGCCUGUCUAGACA 21 14 1 4 1    3 0 0 4 1 0 0 1 0 0 0 0 1 1 0 0 3
bdi-miR7771-3p AUGUGUACUAUAGAAGUCAAGGGU 24 6 0 1 1    1 1 1 0 0 0 1 0 0 0 1 0 1 0 0 0 0
bdi-miR7771-5p CCUUGACUCCUAUAGUACACAUUC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7772-3p AGAUCUCCAUGAACUGAGAAACGG 24 15 1 4 1    0 0 1 0 2 0 0 0 0 0 3 0 4 1 2 2 0
bdi-miR7772-5p CGCUUUUCGGUCCGUGGAGACGCA 24 13 1 4 1    0 2 1 0 1 4 2 0 0 0 0 0 1 1 0 1 0
bdi-miR7773-3p UUUUUCCUUCGGCUGACACGU 21 79 5 21 1    16 1 0 6 2 0 3 21 8 3 2 0 2 2 0 0 13
bdi-miR7773-5p CGGGUCAACGAAGGAAAAAUU 21 5 0 1 1    0 1 0 0 0 0 1 0 0 0 1 0 1 1 0 0 0
bdi-miR7774-3p GAGCGAACGUUAAAUUCCGUGGGG 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7774-5p ACUAUGGUCUGUGAGGAUGGCAAC 24 48 3 6 2    3 5 2 0 2 0 5 3 0 0 2 5 6 5 4 3 3
bdi-miR7775-3p CUAGUGCUUAGACAAAACCCGGUU 24 4 0 1 1    0 1 0 0 0 0 0 0 1 0 0 0 0 1 0 1 0
bdi-miR7775-5p ACCGGUUUAUUCUGAAGCACCAGU 24 9 1 3 1    1 0 0 0 0 0 0 3 0 0 1 0 1 1 0 0 2
bdi-miR7776-3p.1 AAAGAUAUCAGAGGGCAACG 20 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0
bdi-miR7776-3p.2 UUGAUAAUGGGUUGAAUGCGC 21 248 15 71 1    35 1 0 22 6 0 1 69 1 6 5 20 2 6 2 1 71
bdi-miR7776-5p.1 CUUGCCCUCUGAUAUCUUGG 20 4 0 4 4    0 0 0 4 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7776-5p.2 ACAUUCAACUCAUUAUUAAUG 21 1 0 1 1    0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7777-3p.1 UUGUUCCACCCAACAGAAGAU 21 5 0 2 1    0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 2
bdi-miR7777-3p.2 UGAGAUGGUGUCUGUUGAAGG 21 6 0 2 1    0 0 0 2 0 0 1 0 0 0 0 0 1 1 1 0 0
bdi-miR7777-5p.1 CUUUGGUUGGGUAGAACUACC 21 2 0 2 2    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2
bdi-miR7777-5p.2 UCUGACAAACACCAUCGCAAC 21 1 0 1 1    0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0
bdi-miR7778-3p CUGCGCCGCGACUUUCGGACGAG 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7778-5p GAGCAUCGUGUCGGCGUGCGCGGC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7779-3p UUCUCGAUCUGUAGACCGAUCUAG 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7779-5p GAGGUCAUUGUCAGACAUGGGAAG 24 37 2 14 1    9 0 1 14 0 0 0 7 0 0 0 0 0 0 1 0 5
bdi-miR7780-3p GUAGGGACCUUGCUGAAGACGUUU 24 73 4 20 1    0 2 14 0 3 9 5 0 3 0 4 20 1 5 4 3 0
bdi-miR7780-5p GAUAAUUUAGUGGCCUUCCUACUU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7781-3p CAUGUCUGUAGUCAGAAAAAUCAA 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7781-5p GAUUUUUCUGACGACGGACAUGGC 24 5 0 1 1    0 0 0 0 0 0 0 0 1 0 1 0 0 1 1 1 0
bdi-miR7782-3p ACCUGCUCUGAUACCAUGUUGUGA 24 85,945 5,056 17,972 352    10,778 4,057 4,220 6,410 8,720 1,249 4,540 12,873 589 1,777 1,123 352 2,043 6,902 1,301 1,039 17,972
bdi-miR7782-5p GCGGCAUGGUAUUAGAGCAAGUUG 24 1,126 66 248 5    6 142 36 0 49 5 183 5 82 6 106 29 57 248 93 79 0
bdi-miR7783-3p AGCUCUGAUACCAUGUGGAUGAGA 24 58,393 3,435 27,842 27    69 1,186 267 61 2,096 366 998 27 27,842 7,029 2,558 3,308 5,310 3,302 1,917 1,988 69
bdi-miR7783-5p GCGUCUACUUGGUAUCCAAGCUUA 24 22 1 11 1    0 1 2 0 1 0 1 0 11 0 1 0 1 2 1 1 0
bdi-miR7784a-3p CAUAGACUUAUGAGACGAGUACAU 24 5 0 1 1    0 0 0 0 0 0 0 0 0 0 1 0 1 1 1 1 0
bdi-miR7784a-5p GUACAUGAACUUAUAAGACGAGUA 24 5 0 1 1    0 1 0 0 1 0 0 0 0 0 1 0 1 0 0 1 0
bdi-miR7784b-3p CAUAGACUUAUGAGACGAGUACAU 24 5 0 1 1    0 0 0 0 0 0 0 0 0 0 1 0 1 1 1 1 0
bdi-miR7784b-5p GUACAUGAACUUAUAAGACGAGUA 24 5 0 1 1    0 1 0 0 1 0 0 0 0 0 1 0 1 0 0 1 0
bdi-miR7785-3p UUUCUUCUGUGAGCCUGACUGAGC 24 3 0 2 1    1 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7785-5p GUAGAAUGGGUGAUGGGAGAAGGC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7786-3p UGCACAAACUGUGGAGUAGUCGGC 24 16 1 4 1    0 2 0 0 2 4 1 0 1 0 1 0 1 2 1 1 0
bdi-miR7786-5p GUCUAUGUCUAUGUCUGUGCACGC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7787-3p UGCUUCGGUCUGUGCUUGGGCACG 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR7787-5p GUGCUCGUCCACAAGAGAAGCAGG 24 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0
bdi-miR827-3p UUAGAUGACCAUCAGCAAACA 21 738 43 404 7    43 7 8 16 13 0 16 11 11 28 14 15 9 32 90 404 21
bdi-miR827-5p UUUUGUUGGUUGUCAUCUAACC 22 243 14 97 1    69 1 5 47 1 0 1 97 0 0 1 0 0 2 1 7 11
bdi-miR845 UGCUCUGAUACCAAUUGUUGG 21 935 55 913 3    16 0 0 913 0 0 0 3 0 0 0 0 0 0 0 0 3
bdi-miR9480a UAUGUGAGGGUGGUAACUGAA 21 2,134 126 423 12    423 56 144 290 64 19 77 157 12 33 106 24 160 122 120 112 215
bdi-miR9480b UAUGUGAGGGUGGUAACUGAA 21 2,134 126 423 12    423 56 144 290 64 19 77 157 12 33 106 24 160 122 120 112 215
bdi-miR9481a UCAGUCGGAUUUCUCACCUUCGAA 24 608 36 603 5    5 0 0 603 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR9481b UCAGUCGGAUUUCUCACCUUC 21 116 7 111 2    3 0 0 111 0 0 0 0 0 0 0 0 0 0 0 0 2
bdi-miR9482 CCUUUGGGGAAGAAGGGAAAC 21 440 26 237 2    7 10 237 4 16 11 89 4 3 3 2 15 0 7 15 15 2
bdi-miR9483a UUGAACUGUUUCCUCUGAAGUUCC 24 500 29 494 6    6 0 0 494 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR9483b UUGAACUGUUUCCUCUGAAGUUCC 24 500 29 494 6    6 0 0 494 0 0 0 0 0 0 0 0 0 0 0 0 0
bdi-miR9484 UAGUGCAGGGAGAAGUCGGUC 21 355 21 108 2    3 11 23 10 19 22 11 0 12 58 10 108 20 19 12 15 2
bdi-miR9485 UUAUGACGUGUAGGAGUUGCA 21 342 20 44 4    23 20 12 6 21 21 21 15 4 25 10 5 24 39 44 42 10
bdi-miR9486a AUGCUUUCAAGGGAUUAGAGGUUC 24 353 21 132 1    40 6 51 132 1 0 12 25 5 3 1 24 3 9 4 8 29
bdi-miR9486b UAAGUGAUUAGAGGUUCCAGU 21 156 9 30 2    19 2 5 14 5 0 2 24 3 3 6 0 18 9 9 7 30
bdi-miR9487 CCUUGUUCGAUUGCAAGAUGA 21 247 15 88 1    68 0 0 57 1 0 1 88 1 0 0 0 2 1 0 1 27
bdi-miR9488 UGAGGGCUAGGCUUUUAUGUAA 22 206 12 34 2    5 11 2 0 12 12 8 7 3 8 22 10 34 33 19 12 8
bdi-miR9489 UCAGCUCCACGGACUUGGUGA 21 202 12 57 1    57 4 1 45 0 4 4 28 3 3 1 0 1 3 1 1 46
bdi-miR9490 AGGCCACACCCUAAUGGUCGUGCG 24 162 10 87 1    16 0 2 87 2 0 1 19 4 0 0 0 2 4 1 0 24
bdi-miR9491 UGGUAUGUUACCUCUGAUCAG 21 95 6 35 1    10 0 0 8 2 0 0 15 35 0 1 10 2 0 1 0 11
bdi-miR9492 UAUCUACUCUGUCAUGGUAUC 21 90 5 39 1    14 0 1 0 2 6 0 39 1 0 1 5 1 2 1 1 16
bdi-miR9493 AAGAAUUAUGAAACGAAGGGAGUA 24 72 4 24 1    0 1 1 0 3 0 3 0 0 0 8 24 15 5 6 6 0
bdi-miR9494 UUCAUCACCUUCGUCUCCGUC 21 76 4 29 1    11 1 0 10 1 0 1 11 0 8 0 0 1 3 0 0 29
bdi-miR9495 UGAAAAAUGCCUCUGGACGUG 21 73 4 21 1    12 1 5 12 7 0 1 21 1 0 1 0 0 1 0 1 10
bdi-miR9496 CUGGUUGGGCUUAGAUGGGUCC 22 65 4 32 1    2 0 2 32 0 0 1 11 1 0 2 0 1 1 1 1 10
bdi-miR9497 UUUCUGAAUACAUGGUGUAUC 21 48 3 21 3    18 0 0 6 0 0 0 21 0 0 0 0 0 0 0 0 3
bdi-miR9498 GACCGUCAAGUGGUUGUUGAG 21 29 2 12 1    12 0 0 2 1 0 0 3 1 0 0 5 1 0 1 0 3
bdi-miR9499 CCCUCGUCGACGCGGCAGCUC 21 184 11 71 1    0 5 8 0 18 71 5 0 24 19 2 24 2 1 2 1 2