Brachypodium miRNA Abundances

The data below are based on the microRNAs listed in the Sanger registry. Adjust libraries/reads to display on the control panel.

        

        miRNA         miRNA sequence Len Sum (norm) Average Max Min (>0)  BDI04BDI06OBD02BDI05OBD01BDI01OBD04
bdi-miR1122 UAGAUACAUCCGUAUUUGGA 20 0 0 0 0    0 0 0 0 0 0 0
bdi-miR1127 AACUACUCCCUCCGUCCGAUA 21 0 0 0 0    0 0 0 0 0 0 0
bdi-miR1135 UUUCGACAAGUAAUUCCGACCGGA 24 6 2 2 2    2 2 0 2 0 0 0
bdi-miR1139 GAGUAACAUACACUAGUAACA 21 0 0 0 0    0 0 0 0 0 0 0
bdi-miR1432 UUCAGGAGAGAUGACACCGACA 22 2,741 392 2,081 8    2,081 113 8 21 12 490 16
bdi-miR156a UGACAGAAGAGAGAGAGCACA 21 0 0 0 0    0 0 0 0 0 0 0
bdi-miR156b-3p GCUCACUUCUCUCUCUGUCACC 22 159 53 119 5    0 0 35 0 5 0 119
bdi-miR156b-5p UGACAGAAGAGAGUGAGCAC 20 117,701 16,814 100,588 33    100,588 8,677 81 2,572 33 5,649 101
bdi-miR156c UGACAGAAGAGAGUGAGCAC 20 117,701 16,814 100,588 33    100,588 8,677 81 2,572 33 5,649 101
bdi-miR156d-3p GCUCACUGCUCUGUCUGUCACC 22 93 16 63 1    3 1 20 1 5 0 63
bdi-miR156d-5p UGACAGAAGAGAGUGAGCAC 20 117,701 16,814 100,588 33    100,588 8,677 81 2,572 33 5,649 101
bdi-miR156e-3p GCUCACUUCUCUCUCUGUCAGC 22 20 7 17 1    0 0 2 0 17 0 1
bdi-miR156e-5p UGACAGAAGAGAGUGAGCAC 20 117,701 16,814 100,588 33    100,588 8,677 81 2,572 33 5,649 101
bdi-miR156f-3p GCUCACUGCUCUAUCUGUCAGC 22 84 28 55 14    0 0 14 0 55 0 15
bdi-miR156f-5p UGACAGAAGAGAGUGAGCAC 20 117,701 16,814 100,588 33    100,588 8,677 81 2,572 33 5,649 101
bdi-miR156g-3p GCUCACCCUCUCUCUGUCAGC 21 35 12 15 9    0 0 9 0 15 0 11
bdi-miR156g-5p UGACAGAAGAGAGUGAGCAC 20 117,701 16,814 100,588 33    100,588 8,677 81 2,572 33 5,649 101
bdi-miR156h-3p GCUCACUGCUCUUCCUGUCAUC 22 40 10 26 1    1 0 9 0 4 0 26
bdi-miR156h-5p UGACAGAAGAGAGUGAGCAC 20 117,701 16,814 100,588 33    100,588 8,677 81 2,572 33 5,649 101
bdi-miR156i-3p GCUCACCCUCUCUCUGUCAGC 21 35 12 15 9    0 0 9 0 15 0 11
bdi-miR156i-5p UGACAGAAGAGAGUGAGCAC 20 117,701 16,814 100,588 33    100,588 8,677 81 2,572 33 5,649 101
bdi-miR156j UGACAGAAGAGAGAGAGCAC 20 247 82 219 12    219 16 0 12 0 0 0
bdi-miR159a-3p CUUGGAUUGAAGGGAGCUCU 20 371 74 246 1    0 0 64 1 246 4 56
bdi-miR159a-5p AGCUCCCUUCGAUCCAAUC 19 0 0 0 0    0 0 0 0 0 0 0
bdi-miR159b-3p.1 UUUGGAUUGAAGGGAGCUCUG 21 61,495 8,785 23,500 328    2,112 370 15,898 328 18,530 757 23,500
bdi-miR159b-3p.2 AUCCACCCCUUGCCGACCGCUG 22 9 2 4 1    1 1 1 1 1 4 0
bdi-miR159b-3p.3 UUUGCAUGACCGAGGAGCCGC 21 555 79 173 4    48 35 126 34 135 4 173
bdi-miR159b-5p.1 GAGCUCCUAUCAUUCCAAUGA 21 351 117 146 71    0 0 71 0 134 0 146
bdi-miR159b-5p.2 AAGGUCUGUCAGAAGGGUGAUAC 23 967 138 271 28    271 138 28 156 75 223 76
bdi-miR159b-5p.3 AGCUGCUUGUUCAUGGUUCCC 21 38 13 19 9    0 0 9 0 10 0 19
bdi-miR159c UUUGGUUUGAAGGGGGCUCUG 21 18 6 10 3    0 0 5 0 3 0 10
bdi-miR160a-3p GCGUGCGAGGAGCCAAGCAUG 21 10 3 7 1    0 2 0 1 0 7 0
bdi-miR160a-5p UGCCUGGCUCCCUGUAUGCCA 21 1,957 280 735 22    23 24 403 38 712 22 735
bdi-miR160b-3p GCGUGCAAGGAGCCAAGCAUG 21 88 15 41 1    6 19 1 20 1 41 0
bdi-miR160b-5p UGCCUGGCUCCCUGUAUGCCA 21 1,957 280 735 22    23 24 403 38 712 22 735
bdi-miR160c-3p GCGUGCAAGGAGCCAAGCAUG 21 88 15 41 1    6 19 1 20 1 41 0
bdi-miR160c-5p UGCCUGGCUCCCUGUAUGCCA 21 1,957 280 735 22    23 24 403 38 712 22 735
bdi-miR160d-3p GCGUGCACGGAGCCAAGCAUA 21 56 14 41 1    0 9 0 5 1 41 0
bdi-miR160d-5p UGCCUGGCUCCCUGUAUGCCA 21 1,957 280 735 22    23 24 403 38 712 22 735
bdi-miR160e-3p GCAUUGAGGGAGUCAUGCAGG 21 58 10 29 1    1 1 7 1 29 0 19
bdi-miR160e-5p UGCCUGGCUCCCUGAAUGCCA 21 13,645 1,949 7,162 7    163 16 4,658 16 1,623 7 7,162
bdi-miR160f UGCCUGGCUCCCUGUAUGCC 20 62 21 44 7    0 0 44 0 7 0 11
bdi-miR162 UCGAUAAACCUCUGCAUCCGG 21 0 0 0 0    0 0 0 0 0 0 0
bdi-miR164a-3p CAUGUGCCCUUCUUCUCCACC 21 17 3 6 1    0 1 0 1 6 4 5
bdi-miR164a-5p UGGAGAAGCAGGGCACGUGCA 21 3,334 476 1,079 100    574 1,079 111 961 222 100 287
bdi-miR164b UGGAGAAGCAGGGCACGUGCA 21 3,334 476 1,079 100    574 1,079 111 961 222 100 287
bdi-miR164c-3p CAUGUGCGCUCCUUCUCCAGC 21 2 1 1 1    0 0 1 0 1 0 0
bdi-miR164c-5p UGGAGAAGCAGGGCACGUGCU 21 121 17 42 1    29 42 1 42 1 4 2
bdi-miR164e UGGAGAAGCAGGGCACGUGCA 21 3,334 476 1,079 100    574 1,079 111 961 222 100 287
bdi-miR164f UGGAGAAGAAGGGCACAUGCA 21 22 7 8 6    8 6 0 8 0 0 0
bdi-miR166a-3p UCGGACCAGGCUUCAUUCCCC 21 27,949 3,993 9,242 452    4,818 8,922 452 9,242 1,882 802 1,831
bdi-miR166a-5p GAAUGACGCCGGGUCUGAAAG 21 933 133 271 5    144 57 163 5 58 271 235
bdi-miR166b-3p UCGGACCAGGCUUCAUUCCCC 21 27,949 3,993 9,242 452    4,818 8,922 452 9,242 1,882 802 1,831
bdi-miR166b-5p GGAAUGUUGUCUGGCUCGGGG 21 60 10 15 2    14 13 0 13 3 15 2
bdi-miR166c-3p UCGGACCAGGCUUCAUUCCCC 21 27,949 3,993 9,242 452    4,818 8,922 452 9,242 1,882 802 1,831
bdi-miR166c-5p GGAAUGUUGUCUGGUUCAAGG 21 1,197 200 729 2    0 2 212 3 729 7 244
bdi-miR166d-3p UCGGACCAGGCUUCAUUCCCC 21 27,949 3,993 9,242 452    4,818 8,922 452 9,242 1,882 802 1,831
bdi-miR166d-5p GGAAUGUUGUCUGGUUGGAGA 21 148 25 42 14    29 25 16 22 42 0 14
bdi-miR166e-3p CUCGGACCAGGCUUCAUUCCC 21 60 10 23 2    23 16 0 8 4 7 2
bdi-miR166e-5p GGAAUGUUGUCUGGCUCGAGG 21 11 4 7 1    7 3 0 1 0 0 0
bdi-miR166f UCUCGGACCAGGCUUCAUUCC 21 3,731 533 2,494 25    339 2,494 25 447 52 319 55
bdi-miR166g-3p UGUGGUGAUCUCGGACCAGGC 21 1,272 182 399 46    399 153 46 241 155 96 182
bdi-miR166g-5p UCUGGUUCAAGGUCUCCACAU 21 1 1 1 1    0 0 0 1 0 0 0
bdi-miR166h-3p UCGGACCAGGCUUCAAUCCCU 21 3,783 540 1,932 21    106 1,377 21 1,932 173 100 74
bdi-miR166h-5p GGUUUGUUGUCUGGCUCGGGG 21 26 7 12 2    0 6 0 6 12 0 2
bdi-miR166i-3p UCGGACCAGGCUUCAUUCCCC 21 27,949 3,993 9,242 452    4,818 8,922 452 9,242 1,882 802 1,831
bdi-miR166i-5p GGCAUGUCGUGUGGCCCGAGA 21 5 3 4 1    0 0 0 1 0 4 0
bdi-miR166j UCGGACCAGGCUUCAUUCCUU 21 2,619 374 1,302 26    103 826 32 1,302 279 26 51
bdi-miR167a UGAAGCUGCCAGCAUGAUCUA 21 9,956 1,422 4,709 215    710 462 1,128 1,532 4,709 215 1,200
bdi-miR167b UGAAGCUGCCAGCAUGAUCUA 21 9,956 1,422 4,709 215    710 462 1,128 1,532 4,709 215 1,200
bdi-miR167c-3p GAUCAUGCUGUGCAGUUUCAUC 22 23 12 22 1    1 0 0 0 0 22 0
bdi-miR167c-5p UGAAGCUGCCAGCAUGAUCUGA 22 88,116 12,588 27,671 393    12,415 1,234 23,800 2,246 20,357 393 27,671
bdi-miR167d-3p AGAUCAUGUUGCAGCUUCAC 20 0 0 0 0    0 0 0 0 0 0 0
bdi-miR167d-5p UGAAGCUGCCAGCAUGAUCUGA 22 88,116 12,588 27,671 393    12,415 1,234 23,800 2,246 20,357 393 27,671
bdi-miR167e-3p AGGUCAUGCUGGAGUUUCAUC 21 22 4 8 2    2 2 3 4 3 0 8
bdi-miR167e-5p UGAAGCUGCCAGCAUGAUCUGA 22 88,116 12,588 27,671 393    12,415 1,234 23,800 2,246 20,357 393 27,671
bdi-miR167f UGAAGCUGCCAGCAUGAUCUA 21 9,956 1,422 4,709 215    710 462 1,128 1,532 4,709 215 1,200
bdi-miR167g UGAAGCUGCCAGCAUGAUCUGA 22 88,116 12,588 27,671 393    12,415 1,234 23,800 2,246 20,357 393 27,671
bdi-miR168-3p CCCGCCUUGCACCAAGUGAAU 21 914 131 445 14    27 22 176 14 156 74 445
bdi-miR168-5p UCGCUUGGUGCAGAUCGGGAC 21 1,212,572 173,225 350,406 39,990    335,030 350,406 39,990 221,376 64,661 129,038 72,071
bdi-miR169a-3p GGCGAGUUGUUCUUGGCUACA 21 23 4 9 1    1 1 4 1 9 0 7
bdi-miR169a-5p CAGCCAAGGAUGACUUGCCGA 21 5,824 832 1,561 55    658 55 1,289 127 1,540 594 1,561
bdi-miR169b UAGCCAAGGAUGACUUGCCGG 21 395 66 269 9    10 11 9 78 269 0 18
bdi-miR169c-3p GGCAGGUUGUCCUUGGCUAC 20 268 54 112 3    42 112 3 78 0 33 0
bdi-miR169c-5p CAGCCAAGGAUGACUUGCCGG 21 3,515 502 790 266    603 544 271 266 440 601 790
bdi-miR169d UAGCCAAGAAUGACUUGCCUA 21 117 17 45 3    23 15 8 12 3 45 11
bdi-miR169e-3p GGCAGUCUCCUUGGCUAGC 19 18 3 5 2    4 2 2 5 2 0 3
bdi-miR169e-5p UAGCCAAGGAUGACUUGCCUG 21 855 122 690 6    48 57 16 29 6 690 9
bdi-miR169f CAGCCAAGGAUGACUUGCCGG 21 3,515 502 790 266    603 544 271 266 440 601 790
bdi-miR169g UAGCCAAGGAUGACUUGCCUG 21 855 122 690 6    48 57 16 29 6 690 9
bdi-miR169h-3p GGCAGUCACCUUGGCUAGC 19 46 7 14 1    6 7 1 14 4 11 3
bdi-miR169h-5p UAGCCAAGGAUGACUUGCCUA 21 447 64 275 11    20 20 42 11 35 275 44
bdi-miR169i CCAGCCAAGAAUGGCUUGCCUA 22 439 63 141 7    86 24 84 7 86 11 141
bdi-miR169j-3p UGGUCAAGCCUUCCUGACUAGG 22 165 24 41 9    39 17 30 9 14 15 41
bdi-miR169j-5p UAGCCAGGAAUGGCUUGCCUA 21 8 3 6 1    1 1 6 0 0 0 0
bdi-miR169k-3p GGGCAAGUCAGCCUGGCUACC 21 3 1 1 1    1 1 0 1 0 0 0
bdi-miR169k-5p UAGCCAAGGAUGAUUUGCCUGU 22 600 86 185 32    49 42 132 32 185 122 38
bdi-miR169l UAGCCAAGGAUGAAUUGCCGG 21 7 2 5 1    0 1 0 1 5 0 0
bdi-miR169m UAGCCAAGGAUGACUUGCCG 20 1,589 227 596 8    596 423 8 252 11 289 10
bdi-miR169n UAGCCAAGGAUGACUUGCCUA 21 447 64 275 11    20 20 42 11 35 275 44
bdi-miR171a UGAUUGAGCCGCGCCAAUAUC 21 71 24 27 21    0 0 21 0 27 0 23
bdi-miR171b UGAUUGAGCCGUGCCAAUAUC 21 17,375 2,482 8,752 93    129 140 4,086 209 8,752 93 3,966
bdi-miR171c-3p UGAUUGAGCCGUGCCAAUAUC 21 17,375 2,482 8,752 93    129 140 4,086 209 8,752 93 3,966
bdi-miR171c-5p CGGUAUUGGUGCGGUUCAAUC 21 34 6 22 1    1 2 5 3 22 0 1
bdi-miR171d-3p UGAUUGAGCCGUGCCAAUAUC 21 17,375 2,482 8,752 93    129 140 4,086 209 8,752 93 3,966
bdi-miR171d-5p UGUUGGCUCGACUCACUCAGA 21 229 38 131 1    1 11 29 21 131 0 36
bdi-miR171e UGAUUGAGCCGUGCCAAUAUC 21 17,375 2,482 8,752 93    129 140 4,086 209 8,752 93 3,966
bdi-miR171f UGAGCCGAACCAAUAUCACCC 21 1 1 1 1    0 0 1 0 0 0 0
bdi-miR172a-3p AGAAUCUUGAUGAUGCUGCAU 21 49,095 7,014 17,652 822    17,652 14,477 822 8,363 990 5,690 1,101
bdi-miR172a-5p GCAGCACCACCAAGAUUCACA 21 12 2 4 1    1 1 2 1 4 0 3
bdi-miR172b GGAAUCUUGAUGAUGCUGCAU 21 1,082 155 690 5    11 160 5 157 49 690 10
bdi-miR172d AGAAUCCUGAUGAUGCUGCAG 21 0 0 0 0    0 0 0 0 0 0 0
bdi-miR1878-3p AUUUGUAGUGUUCAGAUUGAGUUU 24 98 16 38 1    1 2 22 2 38 0 33
bdi-miR1878-5p ACUUAGUCUGAACACUAUAAAAAA 24 6 3 5 1    5 0 0 1 0 0 0
bdi-miR2118a UUUCCGAUGCCUCCCAUUCCUA 22 4 4 4 4    0 0 0 0 4 0 0
bdi-miR2118b UUCCUGAUGCCUCCCAUUCCUA 22 7 4 6 1    0 0 1 0 6 0 0
bdi-miR2275a UUUGGUUUCCUCCAAUGUCUCA 22 102 26 77 1    1 0 7 0 77 0 17
bdi-miR2275b UUCAGUUUCUUCUAAUAUCUCA 22 11 11 11 11    0 0 0 0 11 0 0
bdi-miR2275c UUUGGUUUCCUCCAAUAUCUCA 22 23 6 19 1    0 1 2 0 19 0 1
bdi-miR319a UGAGGGAGCUUUCUUCUGUCC 21 0 0 0 0    0 0 0 0 0 0 0
bdi-miR319b-3p UUGGACUGAAGGGUGCUCCCU 21 10,401 1,486 5,825 3    3 132 2,658 76 5,825 41 1,666
bdi-miR319b-5p AGAGCUCUCUUCAGUCCACUC 21 1 1 1 1    0 1 0 0 0 0 0
bdi-miR390a-3p CGCUAUCUAUCCUGAGCUCCA 21 19 5 8 1    0 1 3 0 8 0 7
bdi-miR390a-5p AAGCUCAGGAGGGAUAGCGCC 21 449 64 212 4    4 40 37 33 45 212 78
bdi-miR393a UCCAAAGGGAUCGCAUUGAUC 21 1,077 154 620 32    202 89 32 42 33 620 59
bdi-miR393b-3p UCAGUGCAAUCCCUUUGGAAU 21 4,455 743 1,775 7    43 17 1,775 7 1,133 0 1,480
bdi-miR393b-5p UCCAAAGGGAUCGCAUUGAUC 21 1,077 154 620 32    202 89 32 42 33 620 59
bdi-miR394 UUGGCAUUCUGUCCACCUCC 20 1,974 329 1,051 9    12 36 359 9 507 0 1,051
bdi-miR395a UGAAGUGUUUGGGGGAACUC 20 1,116 159 640 4    31 15 164 7 255 4 640
bdi-miR395b UGAAGUGUUUGGGGGAACUC 20 1,116 159 640 4    31 15 164 7 255 4 640
bdi-miR395c-3p UGAAGUGUUUGGGGGAACUC 20 1,116 159 640 4    31 15 164 7 255 4 640
bdi-miR395c-5p GUUCCCUGCAAGCACUUCAUG 21 2 1 1 1    1 0 1 0 0 0 0
bdi-miR395d-3p AAGUGUUUGGGGAACUCUAGG 21 160 32 68 2    5 2 38 0 47 0 68
bdi-miR395d-5p UGGGGUUCCCUCCAAACACUUCA 23 34 11 17 3    0 0 3 0 17 0 14
bdi-miR395e-3p UGAAGUGUUUGGGGGAACUC 20 1,116 159 640 4    31 15 164 7 255 4 640
bdi-miR395e-5p GUUCUCCUCAAAUCACUUCAGU 22 17 6 9 3    0 0 3 0 5 0 9
bdi-miR395f-3p UGAAGUGUUUGGGGGAACUC 20 1,116 159 640 4    31 15 164 7 255 4 640
bdi-miR395f-5p GUUCCCUUCAAACACUUUACG 21 1 1 1 1    0 0 1 0 0 0 0
bdi-miR395g-3p UGAAGUGUUUGGGGGAACUC 20 1,116 159 640 4    31 15 164 7 255 4 640
bdi-miR395g-5p GUUUCCUGCAAACACUUCACG 21 2 1 1 1    1 0 0 0 0 0 1
bdi-miR395h-3p UGAAGUGUUUGGGGGAACUC 20 1,116 159 640 4    31 15 164 7 255 4 640
bdi-miR395h-5p GUUCCCUGCAAGCACUUCACG 21 12 3 6 1    6 1 1 0 0 4 0
bdi-miR395j-3p UGAAGUGUUUGGGGGAACUC 20 1,116 159 640 4    31 15 164 7 255 4 640
bdi-miR395j-5p GUUUCCCGCAAGCACUUCACG 21 2 1 1 1    1 1 0 0 0 0 0
bdi-miR395k-3p UGAAGUGUUUGGGGGAACUC 20 1,116 159 640 4    31 15 164 7 255 4 640
bdi-miR395k-5p GUUCCCUGCAAGCACUUCAUG 21 2 1 1 1    1 0 1 0 0 0 0
bdi-miR395l-3p UGAAGUGUUUGGGGGAACUC 20 1,116 159 640 4    31 15 164 7 255 4 640
bdi-miR395l-5p GUUCCCUGCAAGCACUUCACG 21 12 3 6 1    6 1 1 0 0 4 0
bdi-miR395m UGAAGUGUUUGGGGGAACUC 20 1,116 159 640 4    31 15 164 7 255 4 640
bdi-miR395n-3p UGAAGUGUUUGGGGGAACUC 20 1,116 159 640 4    31 15 164 7 255 4 640
bdi-miR395n-5p GUUCCCUGCAAGCACUUCACC 21 1 1 1 1    0 0 0 0 1 0 0
bdi-miR395o-3p UGAAGUGUUUGGGGGAACUC 20 1,116 159 640 4    31 15 164 7 255 4 640
bdi-miR395o-5p AUUCCCUACAAGCACUUCACA 21 0 0 0 0    0 0 0 0 0 0 0
bdi-miR395p-3p UGAAGUGUUUGGAGGAACUC 20 45 8 17 1    3 1 11 1 12 0 17
bdi-miR395p-5p GUUUCCUGCAAGCACUUCACG 21 1 1 1 1    1 0 0 0 0 0 0
bdi-miR395q UGAAGUGUUUGGGGGAACUC 20 1,116 159 640 4    31 15 164 7 255 4 640
bdi-miR396a-3p GUUCAAGAAAGUCCUUGGAAA 21 985 164 640 3    3 24 174 24 640 0 120
bdi-miR396a-5p UCCACAGGCUUUCUUGAACUG 21 65,102 9,300 28,949 148    701 397 28,949 422 19,822 148 14,663
bdi-miR396b-3p GUUCAAGAAAGCCCAUGGAAA 21 14 5 7 1    0 0 6 1 7 0 0
bdi-miR396b-5p UCCACAGGCUUUCUUGAACUG 21 65,102 9,300 28,949 148    701 397 28,949 422 19,822 148 14,663
bdi-miR396c-3p GUUCAAUAAAGCUGUGGGAAA 21 52 9 32 1    1 5 3 3 32 0 8
bdi-miR396c-5p UUCCACAGCUUUCUUGAACUG 21 249 36 107 4    8 34 41 29 107 4 26
bdi-miR396d-3p GUUCAAUAAAGCUGUGGGAAA 21 52 9 32 1    1 5 3 3 32 0 8
bdi-miR396d-5p UUCCACAGCUUUCUUGAACUG 21 249 36 107 4    8 34 41 29 107 4 26
bdi-miR396e-3p GGUCAAGAAAGCUGUGGGAAG 21 84 12 34 1    1 12 8 12 34 7 10
bdi-miR396e-5p UUCCACAGCUUUCUUGAACUU 21 2,710 452 1,080 4    10 4 1,080 10 824 0 782
bdi-miR397a UCAUUGAGUGCAGCGUUGAUG 21 10 3 6 2    0 0 2 0 2 0 6
bdi-miR397b-3p CUUCGACCCUGCACCCAAUCA 21 1 1 1 1    0 0 0 0 1 0 0
bdi-miR397b-5p AUUGAGUGCAGCGUUGAUGAA 21 17,688 2,948 16,237 1    1 2 1,059 1 16,237 0 388
bdi-miR398a UGUGUUCUCAGGUCGCCCCUG 21 23 8 13 5    0 0 5 0 5 0 13
bdi-miR398b CAGGAGUGUCACUGAGAACACA 22 1 1 1 1    0 0 0 0 1 0 0
bdi-miR399a UGCCAAAGGAGAAUUACCCUG 21 0 0 0 0    0 0 0 0 0 0 0
bdi-miR399b UGCCAAAGGAGAAUUGCCCUG 21 7 2 3 1    1 0 3 0 1 0 2
bdi-miR399c UGCCAAAGGAGAAUUGCCCUG 21 7 2 3 1    1 0 3 0 1 0 2
bdi-miR399d UGCCAAAGGAGAUUUGCCCGG 21 62 12 21 1    2 0 20 1 18 0 21
bdi-miR408-3p CUGCACUGCCUCUUCCCUGGC 21 62 21 32 14    0 0 14 0 32 0 16
bdi-miR408-5p CAGGGAUGGAGCAGAGCAUGG 21 35 6 22 1    1 2 0 1 22 4 5
bdi-miR437 GAACUUAGAGAAGUUUGACUU 21 0 0 0 0    0 0 0 0 0 0 0
bdi-miR444a UUGCUGCCUCAAGCUUGCUGC 21 0 0 0 0    0 0 0 0 0 0 0
bdi-miR444b UGCAGUUGCUGCCUCAAGCUU 21 465 66 241 3    117 57 3 41 3 241 3
bdi-miR444c UGCAGUUGUUGUCUCAAGCUU 21 130 19 63 4    30 11 9 6 4 63 7
bdi-miR444d UGCAGUUGUUGUCUCAAGCUU 21 130 19 63 4    30 11 9 6 4 63 7
bdi-miR5049-3p CAAGUAAUAUGGAUCGGAGGAAGU 24 3 2 2 1    0 2 0 1 0 0 0
bdi-miR5049-5p UCCUUCCGACCCAUAUUACUUGU 23 0 0 0 0    0 0 0 0 0 0 0
bdi-miR5054 UCCCCACGGUCGGCGCCA 18 306 44 97 6    6 9 80 13 97 19 82
bdi-miR5055 UCUCGCUGCUGAGCUCGGCGU 21 0 0 0 0    0 0 0 0 0 0 0
bdi-miR5056 AGGAAGAACCGGUAAUAAGCA 21 0 0 0 0    0 0 0 0 0 0 0
bdi-miR5057 AAAUUUCAAAUCAUUUUGACA 21 0 0 0 0    0 0 0 0 0 0 0
bdi-miR5058 AACAGUUGAGGGAUGAAAAACA 22 0 0 0 0    0 0 0 0 0 0 0
bdi-miR5059 CGGCCUGGGCAGCACCACCA 20 1 1 1 1    1 0 0 0 0 0 0
bdi-miR5060 CGGCUAGCUAGAGACCGCCAA 21 0 0 0 0    0 0 0 0 0 0 0
bdi-miR5061 UCUGUUCUGUCCUGCUCGGUA 21 0 0 0 0    0 0 0 0 0 0 0
bdi-miR5062a UGAACCUUGGGGAAAAGCCGCCU 23 0 0 0 0    0 0 0 0 0 0 0
bdi-miR5063 UCCACUGGAAAAGGCUUUUGCU 22 0 0 0 0    0 0 0 0 0 0 0
bdi-miR5064 CGAAUUUGUCCAUAGCAUCAG 21 0 0 0 0    0 0 0 0 0 0 0
bdi-miR5065 UAGGCAAUUCACUUAUACACU 21 0 0 0 0    0 0 0 0 0 0 0
bdi-miR5066 AAGUGUAUAAGUGGAGUGCCU 21 0 0 0 0    0 0 0 0 0 0 0
bdi-miR5067 UCAGCGACAACUAAUAUGGAU 21 0 0 0 0    0 0 0 0 0 0 0
bdi-miR5068 AUCGGGUAGAGCGGGUAUGGGUAU 24 0 0 0 0    0 0 0 0 0 0 0
bdi-miR5069 UAGGUUAUUGAUUUGACCAAC 21 0 0 0 0    0 0 0 0 0 0 0
bdi-miR5070 AACUAAGUAGGGUCAGAGGGU 21 4 4 4 4    0 0 0 0 0 4 0
bdi-miR5163a-3p UUAGGUAUUUCAGGUUAGGUG 21 5,615 802 2,091 26    61 34 2,091 33 1,627 26 1,743
bdi-miR5163a-5p CCUAGCCUAAAAUAUUUAAAA 21 0 0 0 0    0 0 0 0 0 0 0
bdi-miR5163b-3p UAGAUAUUUCAGGUUGUGUGGA 22 17,178 2,454 4,068 805    2,841 1,465 3,247 1,193 4,068 805 3,559
bdi-miR5163b-5p CACCCAACUGAAAUAUUUAAA 21 0 0 0 0    0 0 0 0 0 0 0
bdi-miR5164 CGCAACUUUGUCUAGAUACGC 21 11 3 6 1    0 0 3 1 6 0 1
bdi-miR5165-3p CCUACCUUGAGCCAAAGAUAU 21 2 1 1 1    0 0 0 1 1 0 0
bdi-miR5165-5p AUCUUGGGCUCUAGGUAGGUU 21 28 5 7 1    5 6 0 7 1 7 2
bdi-miR5166 UGCCCACCAGGGUUCGAUCCA 21 18 9 10 8    0 0 0 0 10 0 8
bdi-miR5167a-3p CCAAUGACACCCAUAGUGGAA 21 2 1 1 1    0 1 0 0 1 0 0
bdi-miR5167a-5p CCACUUUGGGUGUCAUUGGUA 21 185 31 83 1    1 1 59 1 83 0 40
bdi-miR5167b-3p UGUGAAUUGCCUUAACGAGAGC 22 2 2 2 2    0 0 2 0 0 0 0
bdi-miR5167b-5p UCUAGUUAAGGUAAUUUAACU 21 0 0 0 0    0 0 0 0 0 0 0
bdi-miR5169a UUUGACCAAGUUUGUAGAACA 21 138 23 87 1    87 19 3 25 3 0 1
bdi-miR5169b UUUGACCAAGUUUGUAGAACA 21 138 23 87 1    87 19 3 25 3 0 1
bdi-miR5170 UCAUCAAGUUGAGUGACCGUA 21 49 8 13 1    13 4 11 1 12 0 8
bdi-miR5171a ACUUAAUAUGGGACGGAAGAA 21 1 1 1 1    0 0 0 0 1 0 0
bdi-miR5171b ACUUAAUAUGGGACGGAAGAA 21 1 1 1 1    0 0 0 0 1 0 0
bdi-miR5172-3p UGAUCUACUAGCUCCUCGGCA 21 67 10 16 4    7 10 9 4 14 7 16
bdi-miR5172-5p CGAGGAGCUAGUAGAUCGGGA 21 49 10 29 1    6 29 0 9 1 4 0
bdi-miR5173-3p UGCAUCUGUAUAUACGAGAAG 21 22 4 9 1    9 3 3 2 4 0 1
bdi-miR5173-5p UCUCGUAUAUGCGGAUGUACC 21 149 21 34 10    30 10 23 11 34 22 19
bdi-miR5174a CUCCGUUCCAUAAAGAUUGGC 21 15 5 8 2    0 0 2 0 5 0 8
bdi-miR5174b-3p CAACCUUUAUGGAACGGAGGG 21 0 0 0 0    0 0 0 0 0 0 0
bdi-miR5174b-5p CCUCUGUUCCAUAAAGAUUGG 21 5 1 1 1    1 1 0 1 1 0 1
bdi-miR5174c-3p CAAUUUUGCGUGGAACUGAGGGAG 24 0 0 0 0    0 0 0 0 0 0 0
bdi-miR5174c-5p UCCCUCCGUUCUAUGAAGAUUGGC 24 0 0 0 0    0 0 0 0 0 0 0
bdi-miR5174d-3p CAAUCUUUAUGGAACGGAGAGAGU 24 3 1 1 1    1 1 0 1 0 0 0
bdi-miR5174d-5p UCCCUCCGUUUCAUAAAGAUUGGC 24 7 2 5 1    0 0 1 0 1 0 5
bdi-miR5174e-3p.1 CAACCUUUAUGGAACGGAGGG 21 0 0 0 0    0 0 0 0 0 0 0
bdi-miR5174e-3p.2 UUUAUGGAACGGAGGGAGUAG 21 1 1 1 1    0 0 0 0 1 0 0
bdi-miR5174e-5p.1 CCUCUGUUCCAUAAAGAUUGG 21 5 1 1 1    1 1 0 1 1 0 1
bdi-miR5174e-5p.2 UACUCCCUCUGUUCCAUAAAG 21 0 0 0 0    0 0 0 0 0 0 0
bdi-miR5174f CCUCCGUUUCAUAAAGGUUGG 21 302 101 129 70    0 0 70 0 129 0 103
bdi-miR5175a AAGAAUUUAGGAACGGAGGGA 21 133 19 63 3    13 18 3 20 10 63 6
bdi-miR5175b CCUCUGUUCCUAAAUUCUUGU 21 1 1 1 1    0 0 0 0 1 0 0
bdi-miR5176-3p UGUGAUGAUGUGGCAUAGAAU 21 812 116 221 22    130 30 178 31 221 22 200
bdi-miR5176-5p UAUGCCAUGUCGUCACAUAUC 21 44 6 9 4    8 9 4 4 8 4 7
bdi-miR5177 UGAGGUUGUAAAACAGACAGU 21 8 3 6 1    6 0 0 1 1 0 0
bdi-miR5178-3p UCUGACCGGUGGGCCUGAGCG 21 53 9 19 3    19 9 3 10 6 0 6
bdi-miR5178-5p CUUGGGACCGCCGGUCAGAGC 21 4 2 3 1    0 0 1 0 3 0 0
bdi-miR5179 UUUUGCUCAAGACCGCGCAAC 21 660 94 194 12    24 194 12 173 127 100 30
bdi-miR5180a UAAGUGUCUCAGUUUUGAACU 21 0 0 0 0    0 0 0 0 0 0 0
bdi-miR5180b UAAGUGUCUCAGUUUUGAACU 21 0 0 0 0    0 0 0 0 0 0 0
bdi-miR5181a-3p CGGCACUUAUUAUGGAUCAGA 21 41 7 14 2    9 2 8 2 6 0 14
bdi-miR5181a-5p UGAUCCAUAAUAAGUGUCAGG 21 24 5 10 1    1 0 10 1 6 0 6
bdi-miR5181b UCCGAUCCAUAAUAAGUGUCG 21 3 1 1 1    0 0 1 0 1 0 1
bdi-miR5181c-3p ACUUCUUAUGGAUUGUAGGGA 21 93 13 28 2    8 2 16 2 28 11 26
bdi-miR5181c-5p CCUCCGGUCCACAAUAAGUGU 21 8 4 7 1    0 0 0 0 1 0 7
bdi-miR5181d ACUUAUUAUGGACCGGAGGGA 21 15 2 5 1    1 1 2 1 5 4 1
bdi-miR5181e CGACACUUACUGUGGCUCGGA 21 123 21 56 3    56 14 0 20 4 26 3
bdi-miR5182 UGAUGAUCUUGGAACACGUGC 21 360 90 139 1    0 0 139 1 92 0 128
bdi-miR5183 UAUUUGGACAAAUUUGAGUCA 21 4 1 1 1    1 0 1 1 1 0 0
bdi-miR5184 UUCUAACAUUAUGCACAUCUA 21 4 2 3 1    0 0 3 0 1 0 0
bdi-miR5185a-3p UUUGAGAAUUGAACUAGAAGC 21 99 14 48 3    48 6 9 9 5 19 3
bdi-miR5185a-5p UUCUAGUUCAUUUUUCAAAUC 21 4 1 2 1    0 0 1 0 2 0 1
bdi-miR5185b-3p UUUGAGAAUUGAACUAGAAGC 21 99 14 48 3    48 6 9 9 5 19 3
bdi-miR5185b-5p UUCUAGUUCAUUUUUCAAAUC 21 4 1 2 1    0 0 1 0 2 0 1
bdi-miR5185c-3p UUUGAGAAUUGAACUAGAAGC 21 99 14 48 3    48 6 9 9 5 19 3
bdi-miR5185c-5p UUCUAGUUCAUUUUUCAAAUC 21 4 1 2 1    0 0 1 0 2 0 1
bdi-miR5185d-3p UUUGAGAAUUGAACUAGAAGC 21 99 14 48 3    48 6 9 9 5 19 3
bdi-miR5185d-5p UUCUAGUUCAUUUUUCAAAUC 21 4 1 2 1    0 0 1 0 2 0 1
bdi-miR5185e-3p UUUGAGAAUUGAACUAGAAGC 21 99 14 48 3    48 6 9 9 5 19 3
bdi-miR5185e-5p UUCUAGUUCAUUUUUCAAAUC 21 4 1 2 1    0 0 1 0 2 0 1
bdi-miR5185f-3p UUUGAGAAUUGAACUAGAAGC 21 99 14 48 3    48 6 9 9 5 19 3
bdi-miR5185f-5p UUCUAGUUCAUUUUUCAAAUC 21 4 1 2 1    0 0 1 0 2 0 1
bdi-miR5185g-3p UUUGAGAAUUGAACUAGAAGC 21 99 14 48 3    48 6 9 9 5 19 3
bdi-miR5185g-5p UUCUAGUUCAUUUUUCAAAUC 21 4 1 2 1    0 0 1 0 2 0 1
bdi-miR5185h-3p UUUGAGAAUUGAACUAGAAGC 21 99 14 48 3    48 6 9 9 5 19 3
bdi-miR5185h-5p UUCUAGUUCAUUUUUCAAAUC 21 4 1 2 1    0 0 1 0 2 0 1
bdi-miR5185i-3p UUUGAGAAUUGAACUAGAAGC 21 99 14 48 3    48 6 9 9 5 19 3
bdi-miR5185i-5p UUCUAGUUCAUUUUUCAAAUC 21 4 1 2 1    0 0 1 0 2 0 1
bdi-miR5185j-3p UUUGAGAAUUGAACUAGAAGC 21 99 14 48 3    48 6 9 9 5 19 3
bdi-miR5185j-5p UUCUAGUUCAUUUUUCAAAUC 21 4 1 2 1    0 0 1 0 2 0 1
bdi-miR5185k-3p UUUGAGAAUUGAACUAGAAGC 21 99 14 48 3    48 6 9 9 5 19 3
bdi-miR5185k-5p UUCUAGUUCAUUUUUCAAAUC 21 4 1 2 1    0 0 1 0 2 0 1
bdi-miR5185l-3p UUUGGAGAUUGACUUAGAAGC 21 145 24 57 1    3 1 57 1 42 0 41
bdi-miR5185l-5p UUCUAAGUCAAUCUCUAAAUC 21 0 0 0 0    0 0 0 0 0 0 0
bdi-miR5185m-3p UUUGAAAAUUGAACUAGAAGC 21 22 3 11 1    11 1 3 1 1 4 1
bdi-miR5185m-5p UUCUAGUUCAUUUUUCGAAUC 21 0 0 0 0    0 0 0 0 0 0 0
bdi-miR5198 GGGGAAAAGAGAUUGAGGGAG 21 1 1 1 1    0 0 0 0 1 0 0
bdi-miR5199 UGUUCAUACGGUUGAUAGCAC 21 56 11 22 1    2 0 13 1 22 0 18
bdi-miR5200a-3p UGUAGAUACUCCCUAAGGCUU 21 144 29 61 1    24 61 0 56 1 0 2
bdi-miR5200a-5p GCCUUAGGGAAUAUCUACACU 21 1 1 1 1    0 0 0 1 0 0 0
bdi-miR5200b-3p UGUAGAUACUCCCUAAGGCUU 21 144 29 61 1    24 61 0 56 1 0 2
bdi-miR5200b-5p GCCUUAGAGAGUAUCUACACU 21 0 0 0 0    0 0 0 0 0 0 0
bdi-miR5200c UGUAGAUACUCUCUAAGGCUU 21 0 0 0 0    0 0 0 0 0 0 0
bdi-miR5201-3p AGGGCGAGGCAAAUGAUCAAA 21 11 2 6 1    2 6 0 1 1 0 1
bdi-miR5201-5p UGAUCAUUUGCCCCGUCUUGU 21 25 8 11 6    0 0 8 0 11 0 6
bdi-miR5202 UUACGUGAGUUAAAUCGUCGA 21 203 51 113 26    113 34 0 26 0 30 0
bdi-miR528-3p CCUGUGCCUGCCUCUUCCAUU 21 8 3 6 1    0 1 0 0 6 0 1
bdi-miR528-5p UGGAAGGGGCAUGCAGAGGAG 21 2,989 427 1,623 7    376 1,623 7 108 152 687 36
bdi-miR5281a UCUUAUAAAUAGGAACGGAGG 21 30 4 11 1    10 2 1 1 3 11 2
bdi-miR5281b UCUUAUAAAUAGGAACGGAGG 21 30 4 11 1    10 2 1 1 3 11 2
bdi-miR529-3p GCUGUACCCUCUCUCUUCUUC 21 130 33 60 1    0 1 21 0 48 0 60
bdi-miR529-5p AGAAGAGAGAGAGUACAGCCU 21 236 47 92 1    41 46 0 92 1 56 0
bdi-miR530a UGCAUUUGCACCUGCACCUAC 21 1 1 1 1    0 0 0 0 1 0 0
bdi-miR530b UGCAUUUGCACCUGCACCUAC 21 1 1 1 1    0 0 0 0 1 0 0
bdi-miR531 GAUGCUCGCCGGAGCAGCGUGCUG 24 277 40 90 6    90 42 6 58 29 33 19
bdi-miR7707-3p UUUGAUCGAUGUAUGGCUGAACGG 24 0 0 0 0    0 0 0 0 0 0 0
bdi-miR7707-5p GUUCAGCCAUACAUCGAUCGAAGC 24 0 0 0 0    0 0 0 0 0 0 0
bdi-miR7708a-3p UGUAAUGGUACUGAACAAAGACGC 24 4 1 2 1    1 2 0 1 0 0 0
bdi-miR7708a-5p GUUUUUCCUCAGUACCGUUACAAU 24 0 0 0 0    0 0 0 0 0 0 0
bdi-miR7708b-3p AAAUGGCCCGAGAAUUGUAAUGGU 24 24 3 9 1    1 2 3 1 4 4 9
bdi-miR7708b-5p CAUUACAAUUCUUGGGACAUUUGC 24 2 2 2 2    0 0 2 0 0 0 0
bdi-miR7709-3p UGUGCCUAGUCGUACUUUGAU 21 10 3 3 1    0 1 3 0 3 0 3
bdi-miR7709-5p UAAAGUAUGACUAGGCACACG 21 1 1 1 1    0 0 0 1 0 0 0
bdi-miR7710-3p AUUGAUGUCACAAACUAUAGUAGC 24 0 0 0 0    0 0 0 0 0 0 0
bdi-miR7710-5p UACUACAGAUCGUGAUGUCAACUU 24 0 0 0 0    0 0 0 0 0 0 0
bdi-miR7711-3p.1 AGAUUGUUAAAGAGGCCAAGUAUU 24 56 11 26 1    26 20 1 8 1 0 0
bdi-miR7711-3p.3 UAUGAGUCGAUUUCUCUUAUGGCU 24 93 13 20 4    20 17 18 9 9 4 16
bdi-miR7711-3p.4 UAUCCUAGCCAUAAAAUUCAGUAU 24 0 0 0 0    0 0 0 0 0 0 0
bdi-miR7711-5p.1 UACUUAGCCUCUUUGACAAUCUUG 24 19 5 9 1    1 0 4 0 5 0 9
bdi-miR7711-5p.2 AUGAUAGAAUUUCUAAAUUAGAAG 24 3 3 3 3    3 0 0 0 0 0 0
bdi-miR7711-5p.3 CCAUAAGUGAAAUCAACUCAUUCU 24 0 0 0 0    0 0 0 0 0 0 0
bdi-miR7711-5p.4 UCUGAAUUUUAUGACCAAGAUAAC 24 0 0 0 0    0 0 0 0 0 0 0
bdi-miR7712-3p UUAUUGUGGUAACUUUAAGAUGGC 24 1 1 1 1    0 0 0 1 0 0 0
bdi-miR7712-5p UAGAGCUCUGAAGUUACCACCCAC 24 0 0 0 0    0 0 0 0 0 0 0
bdi-miR7713-3p UUGAGACUGGCAGCAUUAGCAAGC 24 1 1 1 1    0 0 0 0 0 0 1
bdi-miR7713-5p UAGGAAUUGAUGGAACAGCUCACA 24 0 0 0 0    0 0 0 0 0 0 0
bdi-miR7714-3p CUAAUAUGUAUCGAAGGGAGUAGC 24 2 1 1 1    0 0 0 0 1 0 1
bdi-miR7714-5p UAUUUUCUCGGAUCAAUAUUACUU 24 0 0 0 0    0 0 0 0 0 0 0
bdi-miR7715-3p UAAGAAAACCCACCUUUGAUG 21 1 1 1 1    0 0 0 0 0 0 1
bdi-miR7715-5p UCAAAGAUGGGAUUUCUGAAC 21 16 3 8 1    3 1 3 0 1 0 8
bdi-miR7716-3p UUCGUUCUUCUCCAGUAAUUGACC 24 1 1 1 1    0 0 0 0 0 0 1
bdi-miR7716-5p UCAGUUGCUAGAGAAGAACGAAAC 24 123 31 58 1    39 58 0 25 1 0 0
bdi-miR7717a-3p GAUGGAUACGAUUGUCGACUGAGA 24 0 0 0 0    0 0 0 0 0 0 0
bdi-miR7717a-5p UCAUUGAGAUUCGUGUAAAUUAA 23 0 0 0 0    0 0 0 0 0 0 0
bdi-miR7717b-3p AACUAUUUUUAAGUUGACCGAGAA 24 0 0 0 0    0 0 0 0 0 0 0
bdi-miR7717b-5p UCUAAGACGACUGAGAAAUAACUA 24 0 0 0 0    0 0 0 0 0 0 0
bdi-miR7717c-3p UUAGUUGACUGAGAAAUAGACGGU 24 7 4 6 1    6 0 0 1 0 0 0
bdi-miR7717c-5p UUGCUAUUUCUUGGGCGACUGAGA 24 0 0 0 0    0 0 0 0 0 0 0
bdi-miR7718-3p AUCGCCUUAGACGAAUAAAUGAGG 24 25 5 11 1    1 1 6 0 6 0 11
bdi-miR7718-5p UCAUUUAUUCGUCCAUGGCGAUGG 24 7 2 3 1    1 0 0 1 3 0 2
bdi-miR7719-3p UAGAAGCAUAUAUGGCGAAGA 21 4 1 2 1    0 0 1 1 2 0 0
bdi-miR7719-5p UCCGCCAUACAUGUUUCUAUC 21 4 1 1 1    1 1 1 0 1 0 0
bdi-miR7720-3p UUUUACACAUGAUUUGGGUUGGAC 24 5 1 2 1    1 2 0 1 1 0 0
bdi-miR7720-5p UCGAAAUUGAUCGUGCGGAGAAGC 24 3 1 1 1    0 1 0 1 1 0 0
bdi-miR7721-3p AAAGUUUGGCAUAGAAUUCAAUGC 24 0 0 0 0    0 0 0 0 0 0 0
bdi-miR7721-5p ACGGGAUUUUAUAACGGACUUUGG 24 0 0 0 0    0 0 0 0 0 0 0
bdi-miR7722-3p GAAGGGUAUCGGGAUGAGAGG 21 2 1 1 1    1 0 0 0 1 0 0
bdi-miR7722-5p UCUCCUCCCGGUACCCUUCUU 21 0 0 0 0    0 0 0 0 0 0 0
bdi-miR7723a-3p GAGGGCCAAGGUAGUUGUUUCACA 24 39 8 11 1    11 11 0 5 1 11 0
bdi-miR7723a-5p UGAAACAACUAUCUUGGCCUUCUC 24 8 2 3 1    2 3 2 1 0 0 0
bdi-miR7723b-3p AUGAAGGUAGUAGUUUCAAAAUGG 24 9 2 3 1    2 1 0 0 3 0 3
bdi-miR7723b-5p AUUUUGAUACUACUACCUUCAUCA 24 0 0 0 0    0 0 0 0 0 0 0
bdi-miR7724a-3p UUGGCCCACAUUGACAUGUUCACC 24 2 1 1 1    0 0 1 0 1 0 0
bdi-miR7724a-5p UGAACAUGUACAUGCUGGCCAACC 24 0 0 0 0    0 0 0 0 0 0 0
bdi-miR7724b-3p UUGGCCCACAUUGACAUGUUCACC 24 2 1 1 1    0 0 1 0 1 0 0
bdi-miR7724b-5p UGAACAUGUACAUGCUGGCCAACC 24 0 0 0 0    0 0 0 0 0 0 0
bdi-miR7725a-3p UGCAAACAAUGUGAUUUCGUCAAG 24 3 2 2 1    1 0 2 0 0 0 0
bdi-miR7725a-5p UGACGAGAUCACAUCGUUUGCACA 24 1 1 1 1    0 0 0 0 1 0 0
bdi-miR7725b-3p.1 UGAAAACCAUAUUCCUAGCUC 21 0 0 0 0    0 0 0 0 0 0 0
bdi-miR7725b-3p.2 CAAAUAAGAGGAGACGAGACAUAG 24 0 0 0 0    0 0 0 0 0 0 0
bdi-miR7725b-5p.1 ACUAGGGAGAUGGUUUUCGCU 21 9 3 5 1    0 0 5 0 1 0 3
bdi-miR7725b-5p.2 AUGCUCCACCUCAUAUUUGAC 21 1 1 1 1    0 0 0 0 0 0 1
bdi-miR7726a-3p UGCGAAUCUGUCACCGUUGUCCCC 24 0 0 0 0    0 0 0 0 0 0 0
bdi-miR7726a-5p UGAUGAUGGUACGGACGUCGCGGU 24 9 2 6 1    0 6 1 1 1 0 0
bdi-miR7726b-3p UGCGAUACGUCACUUCACCGAAAU 24 0 0 0 0    0 0 0 0 0 0 0
bdi-miR7726b-5p UUUGAUGACAUGACGUACGGCGGC 24 6 2 3 1    1 1 0 0 3 0 1
bdi-miR7727-3p CCAAGUCGAUUGGAACUAAUGAGC 24 2 2 2 2    0 0 0 0 0 0 2
bdi-miR7727-5p UGAUUAGUUUCAGUUGGUCUGGGC 24 2 1 1 1    1 1 0 0 0 0 0
bdi-miR7728-3p AAAUACACUCAAUUCAAGCAG 21 1 1 1 1    0 0 0 1 0 0 0
bdi-miR7728-5p UGCUCGGAUUGAGUGUAUUUU 21 108 15 31 1    5 1 24 3 31 15 29
bdi-miR7729a-3p AGCAAUGGUGGUGGUUUGGAGGAG 24 1 1 1 1    0 1 0 0 0 0 0
bdi-miR7729a-5p UGUUUUCAUAGGCCAUGUAGAGC 23 0 0 0 0    0 0 0 0 0 0 0
bdi-miR7729b-3p AGCAAUGGUGGUGGUUUGGAGGAG 24 1 1 1 1    0 1 0 0 0 0 0
bdi-miR7729b-5p UGUUUUCAUAGGCCAUGUAGAGC 23 0 0 0 0    0 0 0 0 0 0 0
bdi-miR7730-3p AACUUUCUCCCGCAGCUGUUCUGU 24 10 3 7 1    0 0 1 0 1 7 1
bdi-miR7730-5p AGAACAGCCACGGUUGAAAGUUAU 24 6 2 4 1    1 0 0 1 0 4 0
bdi-miR7731-3p AGGUUUGCUCUGGACUUUGGAAUC 24 600 86 205 1    2 2 179 1 204 7 205
bdi-miR7731-5p UUCCAAAUUCCUGAGCAAACAUAU 24 5 2 2 1    0 0 2 1 2 0 0
bdi-miR7732-3p GAUCGAGAUCGUGGAGGAACC 21 36 7 14 1    0 1 7 1 14 0 13
bdi-miR7732-5p UUCCUCCAAGAUCUCGGAGACUC 23 53 8 21 2    21 7 3 11 5 4 2
bdi-miR7733-3p CCUGCGUUGGCGAAGGCGAGAAGC 24 6 2 4 1    4 1 0 1 0 0 0
bdi-miR7733-5p UUCUCGCCAUUGCCAAACCAGGGC 24 0 0 0 0    0 0 0 0 0 0 0
bdi-miR7734-3p UUAACCUAGUCACAUUCAACG 21 0 0 0 0    0 0 0 0 0 0 0
bdi-miR7734-5p UUGAACGUGACUGGGUUAACG 21 5 1 1 1    0 1 1 1 1 0 1
bdi-miR7735-3p CCGGUCGGAGCCAAGAGACGCGGC 24 8 2 4 1    0 1 1 1 1 4 0
bdi-miR7735-5p UUGUUUUCCUUCUGCACUCCCGGC 24 0 0 0 0    0 0 0 0 0 0 0
bdi-miR7736-3p UGACAUAUCUGAUGGUAAAGG 21 17 4 7 1    0 0 3 1 6 0 7
bdi-miR7736-5p UUUACUAUCUGGGAUGUCACA 21 14 5 6 3    0 0 6 0 3 0 5
bdi-miR7737-3p ACUUGAGACGGACUGUAUUAAAAA 24 1 1 1 1    1 0 0 0 0 0 0
bdi-miR7737-5p UUUCGGUCAAUGUAUUUCAAGCAG 24 1 1 1 1    0 1 0 0 0 0 0
bdi-miR7738-3p GUGCUUGACAGACGACUCUGG 21 331 66 218 3    0 4 33 3 218 0 73
bdi-miR7738-5p AGAGUCGUUUGUCAAGCUCGG 21 56 9 30 2    2 11 0 3 8 30 2
bdi-miR7739-3p UUGAGUCUGAGAAGUAUUUCUG 22 0 0 0 0    0 0 0 0 0 0 0
bdi-miR7739-5p AGAUGCGUCGAAGCGGACUGGAUC 24 3 2 2 1    0 1 2 0 0 0 0
bdi-miR7740-3p GAGACAGAGGUUGUUCGGAUG 21 4 1 2 1    0 0 2 0 1 0 1
bdi-miR7740-5p UUUGAACAACCUCGGUCUCAU 21 2 1 1 1    0 0 1 0 0 0 1
bdi-miR7741-3p.1 AGAUCUUCCAUGAGUAAAAAU 21 0 0 0 0    0 0 0 0 0 0 0
bdi-miR7741-3p.2 UGCAUGUGGAACUUCCAGAUC 21 48 8 20 1    5 3 8 1 20 0 11
bdi-miR7741-5p.1 UUUUAAUUGUGGAAGCUCUUG 21 513 73 189 1    8 4 189 1 148 7 156
bdi-miR7741-5p.2 UCUUGAAGUUUCGCAUGCAGU 21 19 5 11 1    1 0 2 0 11 0 5
bdi-miR7742-3p UGUGUGUUCGAGUGAAUGAGU 21 0 0 0 0    0 0 0 0 0 0 0
bdi-miR7742-5p UCAUUCGCUCAUUCACACAGU 21 0 0 0 0    0 0 0 0 0 0 0
bdi-miR7743-3p UUUGAACUUUUGUAUUGGAUCUUU 24 0 0 0 0    0 0 0 0 0 0 0
bdi-miR7743-5p AGCAUCUACUGAUAGUUUGACUGC 24 3 2 2 1    1 0 0 0 2 0 0
bdi-miR7744-3p CAUCGACAACUUUUGCCAUCCUUA 24 0 0 0 0    0 0 0 0 0 0 0
bdi-miR7744-5p AGGAUGGCAAGAUUUAUCGAUGGG 24 291 49 135 1    1 2 60 1 92 0 135
bdi-miR7745-3p UUGUUGUUACUUAAGUCUUGGUAC 24 0 0 0 0    0 0 0 0 0 0 0
bdi-miR7745-5p AGUAAGGCUUUAGUAACAAGAGAU 24 0 0 0 0    0 0 0 0 0 0 0
bdi-miR7746-3p UUCUAUUGGAACUCUUAAUCUAUG 24 0 0 0 0    0 0 0 0 0 0 0
bdi-miR7746-5p AUAGACUAAGAGUUCCAACAGAAG 24 1 1 1 1    1 0 0 0 0 0 0
bdi-miR7747-3p AUCCUAUAACAAAACAAACUGAUC 24 0 0 0 0    0 0 0 0 0 0 0
bdi-miR7747-5p AUCAGAUUGUUUUGUUGUAGGAUG 24 9 3 5 1    0 0 3 0 1 0 5
bdi-miR7748a-3p AAUAUGUUUUCUAUUGUUGGACGG 24 0 0 0 0    0 0 0 0 0 0 0
bdi-miR7748a-5p AUCCAACAACAAGGGACGUGUUAG 24 0 0 0 0    0 0 0 0 0 0 0
bdi-miR7748b-3p UUGGUCAAAGAAAAUCUAAUACGC 24 0 0 0 0    0 0 0 0 0 0 0
bdi-miR7748b-5p AUGUUAGGAUUCGGUUGACCAAGC 24 23 4 9 1    2 2 3 1 9 0 6
bdi-miR7749-3p UGGAAUGGGCGCUCUCAGGGAAGC 24 0 0 0 0    0 0 0 0 0 0 0
bdi-miR7749-5p AUCGUCGAGGGCGGAGAUUGCGGC 24 2 1 1 1    0 1 0 1 0 0 0
bdi-miR7750-3p CAUGGUCGGCAAUGAUACAGACGA 24 14 5 9 1    1 9 0 4 0 0 0
bdi-miR7750-5p AUCUGAAUCAUUGCCGACCAUGCA 24 7 2 5 1    5 0 0 1 1 0 0
bdi-miR7751-3p UUUGGUGCACCCGGCUGGAGAUGG 24 0 0 0 0    0 0 0 0 0 0 0
bdi-miR7751-5p AUCUUCCUCGUGGACAAGCGGUAG 24 6 2 4 1    1 1 0 0 0 4 0
bdi-miR7752-3p AAAAUGAUAGGUUGGAAGAACACGC 25 0 0 0 0    0 0 0 0 0 0 0
bdi-miR7752-5p AUGCUCUUCCCACUGUCAUUUUCC 24 0 0 0 0    0 0 0 0 0 0 0
bdi-miR7753-3p UGAGCAAGGGAGAAGACAUGG 21 8 4 7 1    1 0 0 0 0 7 0
bdi-miR7753-5p AUGUCUUCUUCCUUGCUCAUC 21 1 1 1 1    0 0 1 0 0 0 0
bdi-miR7754-3p UUCUCUCGGCUAAGGAACUGC 21 280 93 146 53    0 0 81 0 53 0 146
bdi-miR7754-5p AUGUUCUCUCGGCUGAGGAAC 21 2 1 1 1    1 0 0 0 0 0 1
bdi-miR7755-3p UCAAUUUACGGUGUAGAAUUG 21 21 7 9 5    0 0 7 0 9 0 5
bdi-miR7755-5p AUUCCACACUGUAAAUUGAAU 21 0 0 0 0    0 0 0 0 0 0 0
bdi-miR7756-3p UGGAGAUGUUGGCAUUGAAUUGGC 24 8 2 4 1    0 1 0 2 1 4 0
bdi-miR7756-5p CAAUGCAAUGCCAAGUCUUUCGA 23 0 0 0 0    0 0 0 0 0 0 0
bdi-miR7757-3p.1 GGUAGUUGAAUGUUUUGUUUA 21 13 3 6 1    0 1 2 0 4 0 6
bdi-miR7757-3p.2 AGAUAACUUGAUAUGUAAGUG 21 24 4 9 1    4 2 9 1 5 0 3
bdi-miR7757-5p.1 CACAAAACCUUCAGCUACCCA 21 598 85 151 19    115 151 19 112 24 130 47
bdi-miR7757-5p.2 CUUCCAUAUCAAAUCAUCUCU 21 35 7 16 1    1 1 16 0 2 0 15
bdi-miR7758-3p UAGCGGUCAACUAACUGUAGUGGC 24 12 2 4 1    1 4 2 1 0 4 0
bdi-miR7758-5p CACUACCGUUAGUUGACCGUUAAG 24 1 1 1 1    0 0 0 0 1 0 0
bdi-miR7759-3p GGCUUAUGCCGACGUGGCUAC 21 2 1 1 1    0 1 0 0 1 0 0
bdi-miR7759-5p CAGCCACGUCGGCAUAAGCGAG 22 7 2 5 1    0 0 0 1 1 0 5
bdi-miR7760-3p GGCUUUGCUCGGAGUGCUGUGGC 23 0 0 0 0    0 0 0 0 0 0 0
bdi-miR7760-5p CAGCGGACAGAAUGGAGCAAGCAG 24 3 1 1 1    1 1 0 1 0 0 0
bdi-miR7761-3p UCUUGAUCAAGAGACGGCUCUGGC 24 28 7 13 1    13 8 1 6 0 0 0
bdi-miR7761-5p CAGUGCCGUCUCUUCCUCAAGUUC 24 0 0 0 0    0 0 0 0 0 0 0
bdi-miR7762-3p CUCGGAAUUUGGUCAUCAACUGGC 24 14 3 7 1    1 7 1 3 2 0 0
bdi-miR7762-5p CAGUUGAUGACCAAGUUCUCGAGA 24 5 3 4 1    0 0 1 0 4 0 0
bdi-miR7763-3p AUUCCCGUACGUCAAGAUUGC 21 1,085 181 397 2    0 2 328 3 351 4 397
bdi-miR7763-5p AAUCUUGAUGUGCGGGGAUAG 21 176 35 80 6    0 11 31 6 80 0 48
bdi-miR7764-3p AAAUAGAUCUUGGCGUUAUGGG 22 13 3 5 1    0 1 3 1 5 0 3
bdi-miR7764-5p CAUAACCUAGAUCUGUAUCA 20 1 1 1 1    0 0 0 0 1 0 0
bdi-miR7765-3p UUACAAGAAGUUGGACUAAAAUGC 24 1 1 1 1    0 0 1 0 0 0 0
bdi-miR7765-5p CAUUUUAGUCCAACAAGUUGCAA 23 0 0 0 0    0 0 0 0 0 0 0
bdi-miR7766-3p CGAGGCUGACUGGGACUAAGCGGC 24 6 2 4 1    1 1 0 4 0 0 0
bdi-miR7766-5p CCAACUGGGCCAGUCGGCCUGGGC 24 0 0 0 0    0 0 0 0 0 0 0
bdi-miR7767-3p AGGAGCAAGCAGCUUGAAGGU 21 4 1 1 1    0 1 0 1 1 0 1
bdi-miR7767-5p CCCCAAGCUGAGAGCUCUCCC 21 5 1 1 1    1 1 1 1 1 0 0
bdi-miR7768a-3p CGGCGCCGUCCUCGACCGGGAG 22 4 1 2 1    2 1 0 0 1 0 0
bdi-miR7768a-5p CCCGGUCGAGGACGGCCCCGC 21 1,063 152 343 11    191 297 11 343 45 141 35
bdi-miR7768b-3p CGGCGCCGUCCUCGACCGGGAG 22 4 1 2 1    2 1 0 0 1 0 0
bdi-miR7768b-5p CCCGGUCGAGGACGGCCCCGC 21 1,063 152 343 11    191 297 11 343 45 141 35
bdi-miR7769-3p UGUCAUGUUGGCACUGAUGGG 21 22 3 8 1    4 1 8 1 1 4 3
bdi-miR7769-5p CCGUCAGUGCCAACAUGCCAG 21 1 1 1 1    0 0 0 0 0 0 1
bdi-miR7770-3p UCUAGACGGGCCUUCAAAGAG 21 85 14 24 3    19 9 15 3 15 0 24
bdi-miR7770-5p CCUUGAAAGCCUGUCUAGACA 21 7 2 3 1    1 0 1 0 3 0 2
bdi-miR7771-3p AUGUGUACUAUAGAAGUCAAGGGU 24 3 1 1 1    0 1 0 1 1 0 0
bdi-miR7771-5p CCUUGACUCCUAUAGUACACAUUC 24 0 0 0 0    0 0 0 0 0 0 0
bdi-miR7772-3p AGAUCUCCAUGAACUGAGAAACGG 24 1 1 1 1    1 0 0 0 0 0 0
bdi-miR7772-5p CGCUUUUCGGUCCGUGGAGACGCA 24 5 2 2 1    1 2 0 2 0 0 0
bdi-miR7773-3p UUUUUCCUUCGGCUGACACGU 21 41 7 14 1    1 2 14 1 14 0 9
bdi-miR7773-5p CGGGUCAACGAAGGAAAAAUU 21 2 1 1 1    0 1 0 1 0 0 0
bdi-miR7774-3p GAGCGAACGUUAAAUUCCGUGGGG 24 0 0 0 0    0 0 0 0 0 0 0
bdi-miR7774-5p ACUAUGGUCUGUGAGGAUGGCAAC 24 21 3 5 2    2 5 2 4 2 4 2
bdi-miR7775-3p CUAGUGCUUAGACAAAACCCGGUU 24 1 1 1 1    0 0 0 1 0 0 0
bdi-miR7775-5p ACCGGUUUAUUCUGAAGCACCAGU 24 4 1 2 1    0 0 2 0 1 0 1
bdi-miR7776-3p.1 AAAGAUAUCAGAGGGCAACG 20 0 0 0 0    0 0 0 0 0 0 0
bdi-miR7776-3p.2 UUGAUAAUGGGUUGAAUGCGC 21 146 21 50 1    5 1 45 1 29 15 50
bdi-miR7776-5p.1 CUUGCCCUCUGAUAUCUUGG 20 0 0 0 0    0 0 0 0 0 0 0
bdi-miR7776-5p.2 ACAUUCAACUCAUUAUUAAUG 21 1 1 1 1    1 0 0 0 0 0 0
bdi-miR7777-3p.1 UUGUUCCACCCAACAGAAGAU 21 1 1 1 1    0 0 0 0 0 0 1
bdi-miR7777-3p.2 UGAGAUGGUGUCUGUUGAAGG 21 1 1 1 1    0 1 0 0 0 0 0
bdi-miR7777-5p.1 CUUUGGUUGGGUAGAACUACC 21 1 1 1 1    0 0 0 0 0 0 1
bdi-miR7777-5p.2 UCUGACAAACACCAUCGCAAC 21 0 0 0 0    0 0 0 0 0 0 0
bdi-miR7778-3p CUGCGCCGCGACUUUCGGACGAG 23 0 0 0 0    0 0 0 0 0 0 0
bdi-miR7778-5p GAGCAUCGUGUCGGCGUGCGCGGC 24 0 0 0 0    0 0 0 0 0 0 0
bdi-miR7779-3p UUCUCGAUCUGUAGACCGAUCUAG 24 0 0 0 0    0 0 0 0 0 0 0
bdi-miR7779-5p GAGGUCAUUGUCAGACAUGGGAAG 24 14 5 7 3    0 0 4 0 7 0 3
bdi-miR7780-3p GUAGGGACCUUGCUGAAGACGUUU 24 25 6 15 2    3 5 0 2 0 15 0
bdi-miR7780-5p GAUAAUUUAGUGGCCUUCCUACUU 24 0 0 0 0    0 0 0 0 0 0 0
bdi-miR7781-3p CAUGUCUGUAGUCAGAAAAAUCAA 24 0 0 0 0    0 0 0 0 0 0 0
bdi-miR7781-5p GAUUUUUCUGACGACGGACAUGGC 24 0 0 0 0    0 0 0 0 0 0 0
bdi-miR7782-3p ACCUGCUCUGAUACCAUGUUGUGA 24 45,018 6,431 12,785 267    7,011 4,190 8,331 3,515 8,919 267 12,785
bdi-miR7782-5p GCGGCAUGGUAUUAGAGCAAGUUG 24 361 60 169 3    39 169 3 123 5 22 0
bdi-miR7783-3p AGCUCUGAUACCAUGUGGAUGAGA 24 6,270 896 2,513 17    1,685 921 17 1,028 57 2,513 49
bdi-miR7783-5p GCGUCUACUUGGUAUCCAAGCUUA 24 3 1 1 1    1 1 0 1 0 0 0
bdi-miR7784a-3p CAUAGACUUAUGAGACGAGUACAU 24 0 0 0 0    0 0 0 0 0 0 0
bdi-miR7784a-5p GUACAUGAACUUAUAAGACGAGUA 24 2 1 1 1    1 0 0 1 0 0 0
bdi-miR7784b-3p CAUAGACUUAUGAGACGAGUACAU 24 0 0 0 0    0 0 0 0 0 0 0
bdi-miR7784b-5p GUACAUGAACUUAUAAGACGAGUA 24 2 1 1 1    1 0 0 1 0 0 0
bdi-miR7785-3p UUUCUUCUGUGAGCCUGACUGAGC 24 1 1 1 1    0 0 0 0 1 0 0
bdi-miR7785-5p GUAGAAUGGGUGAUGGGAGAAGGC 24 0 0 0 0    0 0 0 0 0 0 0
bdi-miR7786-3p UGCACAAACUGUGGAGUAGUCGGC 24 5 2 2 1    2 1 0 2 0 0 0
bdi-miR7786-5p GUCUAUGUCUAUGUCUGUGCACGC 24 0 0 0 0    0 0 0 0 0 0 0
bdi-miR7787-3p UGCUUCGGUCUGUGCUUGGGCACG 24 0 0 0 0    0 0 0 0 0 0 0
bdi-miR7787-5p GUGCUCGUCCACAAGAGAAGCAGG 24 0 0 0 0    0 0 0 0 0 0 0
bdi-miR827-3p UUAGAUGACCAUCAGCAAACA 21 100 14 35 6    11 15 7 6 35 11 15
bdi-miR827-5p UUUUGUUGGUUGUCAUCUAACC 22 131 22 63 1    1 1 63 1 57 0 8
bdi-miR845 UGCUCUGAUACCAAUUGUUGG 21 18 6 14 2    0 0 2 0 14 0 2
bdi-miR9480a UAUGUGAGGGUGGUAACUGAA 21 796 114 350 19    52 71 102 49 350 19 153
bdi-miR9480b UAUGUGAGGGUGGUAACUGAA 21 796 114 350 19    52 71 102 49 350 19 153
bdi-miR9481a UCAGUCGGAUUUCUCACCUUCGAA 24 4 4 4 4    0 0 0 0 4 0 0
bdi-miR9481b UCAGUCGGAUUUCUCACCUUC 21 3 2 2 1    0 0 0 0 2 0 1
bdi-miR9482 CCUUUGGGGAAGAAGGGAAAC 21 124 18 82 1    13 82 3 8 6 11 1
bdi-miR9483a UUGAACUGUUUCCUCUGAAGUUCC 24 5 5 5 5    0 0 0 0 5 0 0
bdi-miR9483b UUGAACUGUUUCCUCUGAAGUUCC 24 5 5 5 5    0 0 0 0 5 0 0
bdi-miR9484 UAGUGCAGGGAGAAGUCGGUC 21 121 20 82 1    15 11 0 10 2 82 1
bdi-miR9485 UUAUGACGUGUAGGAGUUGCA 21 93 13 19 4    17 19 9 18 19 4 7
bdi-miR9486a AUGCUUUCAAGGGAUUAGAGGUUC 24 106 15 33 1    1 11 16 5 33 19 21
bdi-miR9486b UAAGUGAUUAGAGGUUCCAGU 21 61 10 22 1    4 2 16 1 16 0 22
bdi-miR9487 CCUUGUUCGAUUGCAAGAUGA 21 134 27 57 1    1 1 57 0 56 0 19
bdi-miR9488 UGAGGGCUAGGCUUUUAUGUAA 22 48 7 10 4    10 7 4 10 4 7 6
bdi-miR9489 UCAGCUCCACGGACUUGGUGA 21 105 21 47 3    0 4 18 3 47 0 33
bdi-miR9490 AGGCCACACCCUAAUGGUCGUGCG 24 44 9 17 1    1 1 12 0 13 0 17
bdi-miR9491 UGGUAUGUUACCUCUGAUCAG 21 34 7 9 2    2 0 9 0 8 7 8
bdi-miR9492 UAUCUACUCUGUCAUGGUAUC 21 52 10 25 1    1 0 25 0 11 4 11
bdi-miR9493 AAGAAUUAUGAAACGAAGGGAGUA 24 24 6 19 1    2 2 0 1 0 19 0
bdi-miR9494 UUCAUCACCUUCGUCUCCGUC 21 40 7 21 1    1 1 7 1 9 0 21
bdi-miR9495 UGAAAAAUGCCUCUGGACGUG 21 39 7 14 1    6 1 14 1 10 0 7
bdi-miR9496 CUGGUUGGGCUUAGAUGGGUCC 22 16 4 7 1    0 1 7 0 1 0 7
bdi-miR9497 UUUCUGAAUACAUGGUGUAUC 21 31 10 15 2    0 0 14 0 15 0 2
bdi-miR9498 GACCGUCAAGUGGUUGUUGAG 21 19 4 10 1    1 0 2 0 10 4 2
bdi-miR9499 CCCUCGUCGACGCGGCAGCUC 21 43 9 19 1    14 5 0 4 0 19 1