Brachypodium miRNA Abundances

The data below are based on the microRNAs listed in the Sanger registry. Adjust libraries/reads to display on the control panel.

        

        miRNA         miRNA sequence Len Sum (norm) Average Max Min (>0)  BDI21BDI23
bdi-miR1122 UAGAUACAUCCGUAUUUGGA 20 0 0 0 0    0 0
bdi-miR1127 AACUACUCCCUCCGUCCGAUA 21 0 0 0 0    0 0
bdi-miR1135 UUUCGACAAGUAAUUCCGACCGGA 24 0 0 0 0    0 0
bdi-miR1139 GAGUAACAUACACUAGUAACA 21 0 0 0 0    0 0
bdi-miR1432 UUCAGGAGAGAUGACACCGACA 22 0 0 0 0    0 0
bdi-miR156a UGACAGAAGAGAGAGAGCACA 21 0 0 0 0    0 0
bdi-miR156b-3p GCUCACUUCUCUCUCUGUCACC 22 0 0 0 0    0 0
bdi-miR156b-5p UGACAGAAGAGAGUGAGCAC 20 166 83 137 29    137 29
bdi-miR156c UGACAGAAGAGAGUGAGCAC 20 166 83 137 29    137 29
bdi-miR156d-3p GCUCACUGCUCUGUCUGUCACC 22 0 0 0 0    0 0
bdi-miR156d-5p UGACAGAAGAGAGUGAGCAC 20 166 83 137 29    137 29
bdi-miR156e-3p GCUCACUUCUCUCUCUGUCAGC 22 0 0 0 0    0 0
bdi-miR156e-5p UGACAGAAGAGAGUGAGCAC 20 166 83 137 29    137 29
bdi-miR156f-3p GCUCACUGCUCUAUCUGUCAGC 22 0 0 0 0    0 0
bdi-miR156f-5p UGACAGAAGAGAGUGAGCAC 20 166 83 137 29    137 29
bdi-miR156g-3p GCUCACCCUCUCUCUGUCAGC 21 0 0 0 0    0 0
bdi-miR156g-5p UGACAGAAGAGAGUGAGCAC 20 166 83 137 29    137 29
bdi-miR156h-3p GCUCACUGCUCUUCCUGUCAUC 22 0 0 0 0    0 0
bdi-miR156h-5p UGACAGAAGAGAGUGAGCAC 20 166 83 137 29    137 29
bdi-miR156i-3p GCUCACCCUCUCUCUGUCAGC 21 0 0 0 0    0 0
bdi-miR156i-5p UGACAGAAGAGAGUGAGCAC 20 166 83 137 29    137 29
bdi-miR156j UGACAGAAGAGAGAGAGCAC 20 1 1 1 1    1 0
bdi-miR159a-3p CUUGGAUUGAAGGGAGCUCU 20 0 0 0 0    0 0
bdi-miR159a-5p AGCUCCCUUCGAUCCAAUC 19 0 0 0 0    0 0
bdi-miR159b-3p.1 UUUGGAUUGAAGGGAGCUCUG 21 0 0 0 0    0 0
bdi-miR159b-3p.2 AUCCACCCCUUGCCGACCGCUG 22 0 0 0 0    0 0
bdi-miR159b-3p.3 UUUGCAUGACCGAGGAGCCGC 21 0 0 0 0    0 0
bdi-miR159b-5p.1 GAGCUCCUAUCAUUCCAAUGA 21 0 0 0 0    0 0
bdi-miR159b-5p.2 AAGGUCUGUCAGAAGGGUGAUAC 23 0 0 0 0    0 0
bdi-miR159b-5p.3 AGCUGCUUGUUCAUGGUUCCC 21 0 0 0 0    0 0
bdi-miR159c UUUGGUUUGAAGGGGGCUCUG 21 0 0 0 0    0 0
bdi-miR160a-3p GCGUGCGAGGAGCCAAGCAUG 21 0 0 0 0    0 0
bdi-miR160a-5p UGCCUGGCUCCCUGUAUGCCA 21 0 0 0 0    0 0
bdi-miR160b-3p GCGUGCAAGGAGCCAAGCAUG 21 0 0 0 0    0 0
bdi-miR160b-5p UGCCUGGCUCCCUGUAUGCCA 21 0 0 0 0    0 0
bdi-miR160c-3p GCGUGCAAGGAGCCAAGCAUG 21 0 0 0 0    0 0
bdi-miR160c-5p UGCCUGGCUCCCUGUAUGCCA 21 0 0 0 0    0 0
bdi-miR160d-3p GCGUGCACGGAGCCAAGCAUA 21 0 0 0 0    0 0
bdi-miR160d-5p UGCCUGGCUCCCUGUAUGCCA 21 0 0 0 0    0 0
bdi-miR160e-3p GCAUUGAGGGAGUCAUGCAGG 21 0 0 0 0    0 0
bdi-miR160e-5p UGCCUGGCUCCCUGAAUGCCA 21 0 0 0 0    0 0
bdi-miR160f UGCCUGGCUCCCUGUAUGCC 20 15 8 8 7    8 7
bdi-miR162 UCGAUAAACCUCUGCAUCCGG 21 0 0 0 0    0 0
bdi-miR164a-3p CAUGUGCCCUUCUUCUCCACC 21 0 0 0 0    0 0
bdi-miR164a-5p UGGAGAAGCAGGGCACGUGCA 21 0 0 0 0    0 0
bdi-miR164b UGGAGAAGCAGGGCACGUGCA 21 0 0 0 0    0 0
bdi-miR164c-3p CAUGUGCGCUCCUUCUCCAGC 21 0 0 0 0    0 0
bdi-miR164c-5p UGGAGAAGCAGGGCACGUGCU 21 0 0 0 0    0 0
bdi-miR164e UGGAGAAGCAGGGCACGUGCA 21 0 0 0 0    0 0
bdi-miR164f UGGAGAAGAAGGGCACAUGCA 21 0 0 0 0    0 0
bdi-miR166a-3p UCGGACCAGGCUUCAUUCCCC 21 0 0 0 0    0 0
bdi-miR166a-5p GAAUGACGCCGGGUCUGAAAG 21 0 0 0 0    0 0
bdi-miR166b-3p UCGGACCAGGCUUCAUUCCCC 21 0 0 0 0    0 0
bdi-miR166b-5p GGAAUGUUGUCUGGCUCGGGG 21 0 0 0 0    0 0
bdi-miR166c-3p UCGGACCAGGCUUCAUUCCCC 21 0 0 0 0    0 0
bdi-miR166c-5p GGAAUGUUGUCUGGUUCAAGG 21 0 0 0 0    0 0
bdi-miR166d-3p UCGGACCAGGCUUCAUUCCCC 21 0 0 0 0    0 0
bdi-miR166d-5p GGAAUGUUGUCUGGUUGGAGA 21 0 0 0 0    0 0
bdi-miR166e-3p CUCGGACCAGGCUUCAUUCCC 21 0 0 0 0    0 0
bdi-miR166e-5p GGAAUGUUGUCUGGCUCGAGG 21 0 0 0 0    0 0
bdi-miR166f UCUCGGACCAGGCUUCAUUCC 21 0 0 0 0    0 0
bdi-miR166g-3p UGUGGUGAUCUCGGACCAGGC 21 0 0 0 0    0 0
bdi-miR166g-5p UCUGGUUCAAGGUCUCCACAU 21 0 0 0 0    0 0
bdi-miR166h-3p UCGGACCAGGCUUCAAUCCCU 21 0 0 0 0    0 0
bdi-miR166h-5p GGUUUGUUGUCUGGCUCGGGG 21 0 0 0 0    0 0
bdi-miR166i-3p UCGGACCAGGCUUCAUUCCCC 21 0 0 0 0    0 0
bdi-miR166i-5p GGCAUGUCGUGUGGCCCGAGA 21 0 0 0 0    0 0
bdi-miR166j UCGGACCAGGCUUCAUUCCUU 21 0 0 0 0    0 0
bdi-miR167a UGAAGCUGCCAGCAUGAUCUA 21 0 0 0 0    0 0
bdi-miR167b UGAAGCUGCCAGCAUGAUCUA 21 0 0 0 0    0 0
bdi-miR167c-3p GAUCAUGCUGUGCAGUUUCAUC 22 0 0 0 0    0 0
bdi-miR167c-5p UGAAGCUGCCAGCAUGAUCUGA 22 0 0 0 0    0 0
bdi-miR167d-3p AGAUCAUGUUGCAGCUUCAC 20 0 0 0 0    0 0
bdi-miR167d-5p UGAAGCUGCCAGCAUGAUCUGA 22 0 0 0 0    0 0
bdi-miR167e-3p AGGUCAUGCUGGAGUUUCAUC 21 0 0 0 0    0 0
bdi-miR167e-5p UGAAGCUGCCAGCAUGAUCUGA 22 0 0 0 0    0 0
bdi-miR167f UGAAGCUGCCAGCAUGAUCUA 21 0 0 0 0    0 0
bdi-miR167g UGAAGCUGCCAGCAUGAUCUGA 22 0 0 0 0    0 0
bdi-miR168-3p CCCGCCUUGCACCAAGUGAAU 21 0 0 0 0    0 0
bdi-miR168-5p UCGCUUGGUGCAGAUCGGGAC 21 0 0 0 0    0 0
bdi-miR169a-3p GGCGAGUUGUUCUUGGCUACA 21 0 0 0 0    0 0
bdi-miR169a-5p CAGCCAAGGAUGACUUGCCGA 21 0 0 0 0    0 0
bdi-miR169b UAGCCAAGGAUGACUUGCCGG 21 0 0 0 0    0 0
bdi-miR169c-3p GGCAGGUUGUCCUUGGCUAC 20 0 0 0 0    0 0
bdi-miR169c-5p CAGCCAAGGAUGACUUGCCGG 21 0 0 0 0    0 0
bdi-miR169d UAGCCAAGAAUGACUUGCCUA 21 0 0 0 0    0 0
bdi-miR169e-3p GGCAGUCUCCUUGGCUAGC 19 0 0 0 0    0 0
bdi-miR169e-5p UAGCCAAGGAUGACUUGCCUG 21 0 0 0 0    0 0
bdi-miR169f CAGCCAAGGAUGACUUGCCGG 21 0 0 0 0    0 0
bdi-miR169g UAGCCAAGGAUGACUUGCCUG 21 0 0 0 0    0 0
bdi-miR169h-3p GGCAGUCACCUUGGCUAGC 19 0 0 0 0    0 0
bdi-miR169h-5p UAGCCAAGGAUGACUUGCCUA 21 0 0 0 0    0 0
bdi-miR169i CCAGCCAAGAAUGGCUUGCCUA 22 0 0 0 0    0 0
bdi-miR169j-3p UGGUCAAGCCUUCCUGACUAGG 22 0 0 0 0    0 0
bdi-miR169j-5p UAGCCAGGAAUGGCUUGCCUA 21 0 0 0 0    0 0
bdi-miR169k-3p GGGCAAGUCAGCCUGGCUACC 21 0 0 0 0    0 0
bdi-miR169k-5p UAGCCAAGGAUGAUUUGCCUGU 22 0 0 0 0    0 0
bdi-miR169l UAGCCAAGGAUGAAUUGCCGG 21 0 0 0 0    0 0
bdi-miR169m UAGCCAAGGAUGACUUGCCG 20 0 0 0 0    0 0
bdi-miR169n UAGCCAAGGAUGACUUGCCUA 21 0 0 0 0    0 0
bdi-miR171a UGAUUGAGCCGCGCCAAUAUC 21 0 0 0 0    0 0
bdi-miR171b UGAUUGAGCCGUGCCAAUAUC 21 0 0 0 0    0 0
bdi-miR171c-3p UGAUUGAGCCGUGCCAAUAUC 21 0 0 0 0    0 0
bdi-miR171c-5p CGGUAUUGGUGCGGUUCAAUC 21 0 0 0 0    0 0
bdi-miR171d-3p UGAUUGAGCCGUGCCAAUAUC 21 0 0 0 0    0 0
bdi-miR171d-5p UGUUGGCUCGACUCACUCAGA 21 0 0 0 0    0 0
bdi-miR171e UGAUUGAGCCGUGCCAAUAUC 21 0 0 0 0    0 0
bdi-miR171f UGAGCCGAACCAAUAUCACCC 21 0 0 0 0    0 0
bdi-miR172a-3p AGAAUCUUGAUGAUGCUGCAU 21 0 0 0 0    0 0
bdi-miR172a-5p GCAGCACCACCAAGAUUCACA 21 0 0 0 0    0 0
bdi-miR172b GGAAUCUUGAUGAUGCUGCAU 21 0 0 0 0    0 0
bdi-miR172d AGAAUCCUGAUGAUGCUGCAG 21 0 0 0 0    0 0
bdi-miR1878-3p AUUUGUAGUGUUCAGAUUGAGUUU 24 0 0 0 0    0 0
bdi-miR1878-5p ACUUAGUCUGAACACUAUAAAAAA 24 0 0 0 0    0 0
bdi-miR2118a UUUCCGAUGCCUCCCAUUCCUA 22 0 0 0 0    0 0
bdi-miR2118b UUCCUGAUGCCUCCCAUUCCUA 22 0 0 0 0    0 0
bdi-miR2275a UUUGGUUUCCUCCAAUGUCUCA 22 0 0 0 0    0 0
bdi-miR2275b UUCAGUUUCUUCUAAUAUCUCA 22 0 0 0 0    0 0
bdi-miR2275c UUUGGUUUCCUCCAAUAUCUCA 22 0 0 0 0    0 0
bdi-miR319a UGAGGGAGCUUUCUUCUGUCC 21 0 0 0 0    0 0
bdi-miR319b-3p UUGGACUGAAGGGUGCUCCCU 21 0 0 0 0    0 0
bdi-miR319b-5p AGAGCUCUCUUCAGUCCACUC 21 0 0 0 0    0 0
bdi-miR390a-3p CGCUAUCUAUCCUGAGCUCCA 21 0 0 0 0    0 0
bdi-miR390a-5p AAGCUCAGGAGGGAUAGCGCC 21 0 0 0 0    0 0
bdi-miR393a UCCAAAGGGAUCGCAUUGAUC 21 0 0 0 0    0 0
bdi-miR393b-3p UCAGUGCAAUCCCUUUGGAAU 21 0 0 0 0    0 0
bdi-miR393b-5p UCCAAAGGGAUCGCAUUGAUC 21 0 0 0 0    0 0
bdi-miR394 UUGGCAUUCUGUCCACCUCC 20 3 3 3 3    0 3
bdi-miR395a UGAAGUGUUUGGGGGAACUC 20 5 5 5 5    0 5
bdi-miR395b UGAAGUGUUUGGGGGAACUC 20 5 5 5 5    0 5
bdi-miR395c-3p UGAAGUGUUUGGGGGAACUC 20 5 5 5 5    0 5
bdi-miR395c-5p GUUCCCUGCAAGCACUUCAUG 21 0 0 0 0    0 0
bdi-miR395d-3p AAGUGUUUGGGGAACUCUAGG 21 0 0 0 0    0 0
bdi-miR395d-5p UGGGGUUCCCUCCAAACACUUCA 23 0 0 0 0    0 0
bdi-miR395e-3p UGAAGUGUUUGGGGGAACUC 20 5 5 5 5    0 5
bdi-miR395e-5p GUUCUCCUCAAAUCACUUCAGU 22 0 0 0 0    0 0
bdi-miR395f-3p UGAAGUGUUUGGGGGAACUC 20 5 5 5 5    0 5
bdi-miR395f-5p GUUCCCUUCAAACACUUUACG 21 0 0 0 0    0 0
bdi-miR395g-3p UGAAGUGUUUGGGGGAACUC 20 5 5 5 5    0 5
bdi-miR395g-5p GUUUCCUGCAAACACUUCACG 21 0 0 0 0    0 0
bdi-miR395h-3p UGAAGUGUUUGGGGGAACUC 20 5 5 5 5    0 5
bdi-miR395h-5p GUUCCCUGCAAGCACUUCACG 21 0 0 0 0    0 0
bdi-miR395j-3p UGAAGUGUUUGGGGGAACUC 20 5 5 5 5    0 5
bdi-miR395j-5p GUUUCCCGCAAGCACUUCACG 21 0 0 0 0    0 0
bdi-miR395k-3p UGAAGUGUUUGGGGGAACUC 20 5 5 5 5    0 5
bdi-miR395k-5p GUUCCCUGCAAGCACUUCAUG 21 0 0 0 0    0 0
bdi-miR395l-3p UGAAGUGUUUGGGGGAACUC 20 5 5 5 5    0 5
bdi-miR395l-5p GUUCCCUGCAAGCACUUCACG 21 0 0 0 0    0 0
bdi-miR395m UGAAGUGUUUGGGGGAACUC 20 5 5 5 5    0 5
bdi-miR395n-3p UGAAGUGUUUGGGGGAACUC 20 5 5 5 5    0 5
bdi-miR395n-5p GUUCCCUGCAAGCACUUCACC 21 0 0 0 0    0 0
bdi-miR395o-3p UGAAGUGUUUGGGGGAACUC 20 5 5 5 5    0 5
bdi-miR395o-5p AUUCCCUACAAGCACUUCACA 21 0 0 0 0    0 0
bdi-miR395p-3p UGAAGUGUUUGGAGGAACUC 20 0 0 0 0    0 0
bdi-miR395p-5p GUUUCCUGCAAGCACUUCACG 21 0 0 0 0    0 0
bdi-miR395q UGAAGUGUUUGGGGGAACUC 20 5 5 5 5    0 5
bdi-miR396a-3p GUUCAAGAAAGUCCUUGGAAA 21 0 0 0 0    0 0
bdi-miR396a-5p UCCACAGGCUUUCUUGAACUG 21 0 0 0 0    0 0
bdi-miR396b-3p GUUCAAGAAAGCCCAUGGAAA 21 0 0 0 0    0 0
bdi-miR396b-5p UCCACAGGCUUUCUUGAACUG 21 0 0 0 0    0 0
bdi-miR396c-3p GUUCAAUAAAGCUGUGGGAAA 21 0 0 0 0    0 0
bdi-miR396c-5p UUCCACAGCUUUCUUGAACUG 21 0 0 0 0    0 0
bdi-miR396d-3p GUUCAAUAAAGCUGUGGGAAA 21 0 0 0 0    0 0
bdi-miR396d-5p UUCCACAGCUUUCUUGAACUG 21 0 0 0 0    0 0
bdi-miR396e-3p GGUCAAGAAAGCUGUGGGAAG 21 0 0 0 0    0 0
bdi-miR396e-5p UUCCACAGCUUUCUUGAACUU 21 0 0 0 0    0 0
bdi-miR397a UCAUUGAGUGCAGCGUUGAUG 21 0 0 0 0    0 0
bdi-miR397b-3p CUUCGACCCUGCACCCAAUCA 21 0 0 0 0    0 0
bdi-miR397b-5p AUUGAGUGCAGCGUUGAUGAA 21 0 0 0 0    0 0
bdi-miR398a UGUGUUCUCAGGUCGCCCCUG 21 0 0 0 0    0 0
bdi-miR398b CAGGAGUGUCACUGAGAACACA 22 0 0 0 0    0 0
bdi-miR399a UGCCAAAGGAGAAUUACCCUG 21 0 0 0 0    0 0
bdi-miR399b UGCCAAAGGAGAAUUGCCCUG 21 0 0 0 0    0 0
bdi-miR399c UGCCAAAGGAGAAUUGCCCUG 21 0 0 0 0    0 0
bdi-miR399d UGCCAAAGGAGAUUUGCCCGG 21 0 0 0 0    0 0
bdi-miR408-3p CUGCACUGCCUCUUCCCUGGC 21 0 0 0 0    0 0
bdi-miR408-5p CAGGGAUGGAGCAGAGCAUGG 21 0 0 0 0    0 0
bdi-miR437 GAACUUAGAGAAGUUUGACUU 21 0 0 0 0    0 0
bdi-miR444a UUGCUGCCUCAAGCUUGCUGC 21 0 0 0 0    0 0
bdi-miR444b UGCAGUUGCUGCCUCAAGCUU 21 0 0 0 0    0 0
bdi-miR444c UGCAGUUGUUGUCUCAAGCUU 21 0 0 0 0    0 0
bdi-miR444d UGCAGUUGUUGUCUCAAGCUU 21 0 0 0 0    0 0
bdi-miR5049-3p CAAGUAAUAUGGAUCGGAGGAAGU 24 0 0 0 0    0 0
bdi-miR5049-5p UCCUUCCGACCCAUAUUACUUGU 23 0 0 0 0    0 0
bdi-miR5054 UCCCCACGGUCGGCGCCA 18 0 0 0 0    0 0
bdi-miR5055 UCUCGCUGCUGAGCUCGGCGU 21 0 0 0 0    0 0
bdi-miR5056 AGGAAGAACCGGUAAUAAGCA 21 0 0 0 0    0 0
bdi-miR5057 AAAUUUCAAAUCAUUUUGACA 21 0 0 0 0    0 0
bdi-miR5058 AACAGUUGAGGGAUGAAAAACA 22 0 0 0 0    0 0
bdi-miR5059 CGGCCUGGGCAGCACCACCA 20 0 0 0 0    0 0
bdi-miR5060 CGGCUAGCUAGAGACCGCCAA 21 0 0 0 0    0 0
bdi-miR5061 UCUGUUCUGUCCUGCUCGGUA 21 0 0 0 0    0 0
bdi-miR5062a UGAACCUUGGGGAAAAGCCGCCU 23 0 0 0 0    0 0
bdi-miR5063 UCCACUGGAAAAGGCUUUUGCU 22 0 0 0 0    0 0
bdi-miR5064 CGAAUUUGUCCAUAGCAUCAG 21 0 0 0 0    0 0
bdi-miR5065 UAGGCAAUUCACUUAUACACU 21 0 0 0 0    0 0
bdi-miR5066 AAGUGUAUAAGUGGAGUGCCU 21 0 0 0 0    0 0
bdi-miR5067 UCAGCGACAACUAAUAUGGAU 21 0 0 0 0    0 0
bdi-miR5068 AUCGGGUAGAGCGGGUAUGGGUAU 24 0 0 0 0    0 0
bdi-miR5069 UAGGUUAUUGAUUUGACCAAC 21 0 0 0 0    0 0
bdi-miR5070 AACUAAGUAGGGUCAGAGGGU 21 0 0 0 0    0 0
bdi-miR5163a-3p UUAGGUAUUUCAGGUUAGGUG 21 0 0 0 0    0 0
bdi-miR5163a-5p CCUAGCCUAAAAUAUUUAAAA 21 0 0 0 0    0 0
bdi-miR5163b-3p UAGAUAUUUCAGGUUGUGUGGA 22 0 0 0 0    0 0
bdi-miR5163b-5p CACCCAACUGAAAUAUUUAAA 21 0 0 0 0    0 0
bdi-miR5164 CGCAACUUUGUCUAGAUACGC 21 0 0 0 0    0 0
bdi-miR5165-3p CCUACCUUGAGCCAAAGAUAU 21 0 0 0 0    0 0
bdi-miR5165-5p AUCUUGGGCUCUAGGUAGGUU 21 0 0 0 0    0 0
bdi-miR5166 UGCCCACCAGGGUUCGAUCCA 21 0 0 0 0    0 0
bdi-miR5167a-3p CCAAUGACACCCAUAGUGGAA 21 0 0 0 0    0 0
bdi-miR5167a-5p CCACUUUGGGUGUCAUUGGUA 21 0 0 0 0    0 0
bdi-miR5167b-3p UGUGAAUUGCCUUAACGAGAGC 22 0 0 0 0    0 0
bdi-miR5167b-5p UCUAGUUAAGGUAAUUUAACU 21 0 0 0 0    0 0
bdi-miR5169a UUUGACCAAGUUUGUAGAACA 21 0 0 0 0    0 0
bdi-miR5169b UUUGACCAAGUUUGUAGAACA 21 0 0 0 0    0 0
bdi-miR5170 UCAUCAAGUUGAGUGACCGUA 21 0 0 0 0    0 0
bdi-miR5171a ACUUAAUAUGGGACGGAAGAA 21 0 0 0 0    0 0
bdi-miR5171b ACUUAAUAUGGGACGGAAGAA 21 0 0 0 0    0 0
bdi-miR5172-3p UGAUCUACUAGCUCCUCGGCA 21 0 0 0 0    0 0
bdi-miR5172-5p CGAGGAGCUAGUAGAUCGGGA 21 0 0 0 0    0 0
bdi-miR5173-3p UGCAUCUGUAUAUACGAGAAG 21 0 0 0 0    0 0
bdi-miR5173-5p UCUCGUAUAUGCGGAUGUACC 21 0 0 0 0    0 0
bdi-miR5174a CUCCGUUCCAUAAAGAUUGGC 21 0 0 0 0    0 0
bdi-miR5174b-3p CAACCUUUAUGGAACGGAGGG 21 0 0 0 0    0 0
bdi-miR5174b-5p CCUCUGUUCCAUAAAGAUUGG 21 0 0 0 0    0 0
bdi-miR5174c-3p CAAUUUUGCGUGGAACUGAGGGAG 24 0 0 0 0    0 0
bdi-miR5174c-5p UCCCUCCGUUCUAUGAAGAUUGGC 24 0 0 0 0    0 0
bdi-miR5174d-3p CAAUCUUUAUGGAACGGAGAGAGU 24 0 0 0 0    0 0
bdi-miR5174d-5p UCCCUCCGUUUCAUAAAGAUUGGC 24 0 0 0 0    0 0
bdi-miR5174e-3p.1 CAACCUUUAUGGAACGGAGGG 21 0 0 0 0    0 0
bdi-miR5174e-3p.2 UUUAUGGAACGGAGGGAGUAG 21 0 0 0 0    0 0
bdi-miR5174e-5p.1 CCUCUGUUCCAUAAAGAUUGG 21 0 0 0 0    0 0
bdi-miR5174e-5p.2 UACUCCCUCUGUUCCAUAAAG 21 0 0 0 0    0 0
bdi-miR5174f CCUCCGUUUCAUAAAGGUUGG 21 0 0 0 0    0 0
bdi-miR5175a AAGAAUUUAGGAACGGAGGGA 21 0 0 0 0    0 0
bdi-miR5175b CCUCUGUUCCUAAAUUCUUGU 21 0 0 0 0    0 0
bdi-miR5176-3p UGUGAUGAUGUGGCAUAGAAU 21 0 0 0 0    0 0
bdi-miR5176-5p UAUGCCAUGUCGUCACAUAUC 21 0 0 0 0    0 0
bdi-miR5177 UGAGGUUGUAAAACAGACAGU 21 0 0 0 0    0 0
bdi-miR5178-3p UCUGACCGGUGGGCCUGAGCG 21 0 0 0 0    0 0
bdi-miR5178-5p CUUGGGACCGCCGGUCAGAGC 21 0 0 0 0    0 0
bdi-miR5179 UUUUGCUCAAGACCGCGCAAC 21 0 0 0 0    0 0
bdi-miR5180a UAAGUGUCUCAGUUUUGAACU 21 0 0 0 0    0 0
bdi-miR5180b UAAGUGUCUCAGUUUUGAACU 21 0 0 0 0    0 0
bdi-miR5181a-3p CGGCACUUAUUAUGGAUCAGA 21 0 0 0 0    0 0
bdi-miR5181a-5p UGAUCCAUAAUAAGUGUCAGG 21 0 0 0 0    0 0
bdi-miR5181b UCCGAUCCAUAAUAAGUGUCG 21 0 0 0 0    0 0
bdi-miR5181c-3p ACUUCUUAUGGAUUGUAGGGA 21 0 0 0 0    0 0
bdi-miR5181c-5p CCUCCGGUCCACAAUAAGUGU 21 0 0 0 0    0 0
bdi-miR5181d ACUUAUUAUGGACCGGAGGGA 21 0 0 0 0    0 0
bdi-miR5181e CGACACUUACUGUGGCUCGGA 21 0 0 0 0    0 0
bdi-miR5182 UGAUGAUCUUGGAACACGUGC 21 0 0 0 0    0 0
bdi-miR5183 UAUUUGGACAAAUUUGAGUCA 21 0 0 0 0    0 0
bdi-miR5184 UUCUAACAUUAUGCACAUCUA 21 0 0 0 0    0 0
bdi-miR5185a-3p UUUGAGAAUUGAACUAGAAGC 21 0 0 0 0    0 0
bdi-miR5185a-5p UUCUAGUUCAUUUUUCAAAUC 21 0 0 0 0    0 0
bdi-miR5185b-3p UUUGAGAAUUGAACUAGAAGC 21 0 0 0 0    0 0
bdi-miR5185b-5p UUCUAGUUCAUUUUUCAAAUC 21 0 0 0 0    0 0
bdi-miR5185c-3p UUUGAGAAUUGAACUAGAAGC 21 0 0 0 0    0 0
bdi-miR5185c-5p UUCUAGUUCAUUUUUCAAAUC 21 0 0 0 0    0 0
bdi-miR5185d-3p UUUGAGAAUUGAACUAGAAGC 21 0 0 0 0    0 0
bdi-miR5185d-5p UUCUAGUUCAUUUUUCAAAUC 21 0 0 0 0    0 0
bdi-miR5185e-3p UUUGAGAAUUGAACUAGAAGC 21 0 0 0 0    0 0
bdi-miR5185e-5p UUCUAGUUCAUUUUUCAAAUC 21 0 0 0 0    0 0
bdi-miR5185f-3p UUUGAGAAUUGAACUAGAAGC 21 0 0 0 0    0 0
bdi-miR5185f-5p UUCUAGUUCAUUUUUCAAAUC 21 0 0 0 0    0 0
bdi-miR5185g-3p UUUGAGAAUUGAACUAGAAGC 21 0 0 0 0    0 0
bdi-miR5185g-5p UUCUAGUUCAUUUUUCAAAUC 21 0 0 0 0    0 0
bdi-miR5185h-3p UUUGAGAAUUGAACUAGAAGC 21 0 0 0 0    0 0
bdi-miR5185h-5p UUCUAGUUCAUUUUUCAAAUC 21 0 0 0 0    0 0
bdi-miR5185i-3p UUUGAGAAUUGAACUAGAAGC 21 0 0 0 0    0 0
bdi-miR5185i-5p UUCUAGUUCAUUUUUCAAAUC 21 0 0 0 0    0 0
bdi-miR5185j-3p UUUGAGAAUUGAACUAGAAGC 21 0 0 0 0    0 0
bdi-miR5185j-5p UUCUAGUUCAUUUUUCAAAUC 21 0 0 0 0    0 0
bdi-miR5185k-3p UUUGAGAAUUGAACUAGAAGC 21 0 0 0 0    0 0
bdi-miR5185k-5p UUCUAGUUCAUUUUUCAAAUC 21 0 0 0 0    0 0
bdi-miR5185l-3p UUUGGAGAUUGACUUAGAAGC 21 0 0 0 0    0 0
bdi-miR5185l-5p UUCUAAGUCAAUCUCUAAAUC 21 0 0 0 0    0 0
bdi-miR5185m-3p UUUGAAAAUUGAACUAGAAGC 21 0 0 0 0    0 0
bdi-miR5185m-5p UUCUAGUUCAUUUUUCGAAUC 21 0 0 0 0    0 0
bdi-miR5198 GGGGAAAAGAGAUUGAGGGAG 21 0 0 0 0    0 0
bdi-miR5199 UGUUCAUACGGUUGAUAGCAC 21 0 0 0 0    0 0
bdi-miR5200a-3p UGUAGAUACUCCCUAAGGCUU 21 0 0 0 0    0 0
bdi-miR5200a-5p GCCUUAGGGAAUAUCUACACU 21 0 0 0 0    0 0
bdi-miR5200b-3p UGUAGAUACUCCCUAAGGCUU 21 0 0 0 0    0 0
bdi-miR5200b-5p GCCUUAGAGAGUAUCUACACU 21 0 0 0 0    0 0
bdi-miR5200c UGUAGAUACUCUCUAAGGCUU 21 0 0 0 0    0 0
bdi-miR5201-3p AGGGCGAGGCAAAUGAUCAAA 21 0 0 0 0    0 0
bdi-miR5201-5p UGAUCAUUUGCCCCGUCUUGU 21 0 0 0 0    0 0
bdi-miR5202 UUACGUGAGUUAAAUCGUCGA 21 0 0 0 0    0 0
bdi-miR528-3p CCUGUGCCUGCCUCUUCCAUU 21 0 0 0 0    0 0
bdi-miR528-5p UGGAAGGGGCAUGCAGAGGAG 21 0 0 0 0    0 0
bdi-miR5281a UCUUAUAAAUAGGAACGGAGG 21 0 0 0 0    0 0
bdi-miR5281b UCUUAUAAAUAGGAACGGAGG 21 0 0 0 0    0 0
bdi-miR529-3p GCUGUACCCUCUCUCUUCUUC 21 0 0 0 0    0 0
bdi-miR529-5p AGAAGAGAGAGAGUACAGCCU 21 0 0 0 0    0 0
bdi-miR530a UGCAUUUGCACCUGCACCUAC 21 0 0 0 0    0 0
bdi-miR530b UGCAUUUGCACCUGCACCUAC 21 0 0 0 0    0 0
bdi-miR531 GAUGCUCGCCGGAGCAGCGUGCUG 24 0 0 0 0    0 0
bdi-miR7707-3p UUUGAUCGAUGUAUGGCUGAACGG 24 0 0 0 0    0 0
bdi-miR7707-5p GUUCAGCCAUACAUCGAUCGAAGC 24 0 0 0 0    0 0
bdi-miR7708a-3p UGUAAUGGUACUGAACAAAGACGC 24 0 0 0 0    0 0
bdi-miR7708a-5p GUUUUUCCUCAGUACCGUUACAAU 24 0 0 0 0    0 0
bdi-miR7708b-3p AAAUGGCCCGAGAAUUGUAAUGGU 24 0 0 0 0    0 0
bdi-miR7708b-5p CAUUACAAUUCUUGGGACAUUUGC 24 0 0 0 0    0 0
bdi-miR7709-3p UGUGCCUAGUCGUACUUUGAU 21 0 0 0 0    0 0
bdi-miR7709-5p UAAAGUAUGACUAGGCACACG 21 0 0 0 0    0 0
bdi-miR7710-3p AUUGAUGUCACAAACUAUAGUAGC 24 0 0 0 0    0 0
bdi-miR7710-5p UACUACAGAUCGUGAUGUCAACUU 24 0 0 0 0    0 0
bdi-miR7711-3p.1 AGAUUGUUAAAGAGGCCAAGUAUU 24 0 0 0 0    0 0
bdi-miR7711-3p.3 UAUGAGUCGAUUUCUCUUAUGGCU 24 0 0 0 0    0 0
bdi-miR7711-3p.4 UAUCCUAGCCAUAAAAUUCAGUAU 24 0 0 0 0    0 0
bdi-miR7711-5p.1 UACUUAGCCUCUUUGACAAUCUUG 24 0 0 0 0    0 0
bdi-miR7711-5p.2 AUGAUAGAAUUUCUAAAUUAGAAG 24 0 0 0 0    0 0
bdi-miR7711-5p.3 CCAUAAGUGAAAUCAACUCAUUCU 24 0 0 0 0    0 0
bdi-miR7711-5p.4 UCUGAAUUUUAUGACCAAGAUAAC 24 0 0 0 0    0 0
bdi-miR7712-3p UUAUUGUGGUAACUUUAAGAUGGC 24 0 0 0 0    0 0
bdi-miR7712-5p UAGAGCUCUGAAGUUACCACCCAC 24 0 0 0 0    0 0
bdi-miR7713-3p UUGAGACUGGCAGCAUUAGCAAGC 24 0 0 0 0    0 0
bdi-miR7713-5p UAGGAAUUGAUGGAACAGCUCACA 24 0 0 0 0    0 0
bdi-miR7714-3p CUAAUAUGUAUCGAAGGGAGUAGC 24 0 0 0 0    0 0
bdi-miR7714-5p UAUUUUCUCGGAUCAAUAUUACUU 24 0 0 0 0    0 0
bdi-miR7715-3p UAAGAAAACCCACCUUUGAUG 21 0 0 0 0    0 0
bdi-miR7715-5p UCAAAGAUGGGAUUUCUGAAC 21 0 0 0 0    0 0
bdi-miR7716-3p UUCGUUCUUCUCCAGUAAUUGACC 24 0 0 0 0    0 0
bdi-miR7716-5p UCAGUUGCUAGAGAAGAACGAAAC 24 0 0 0 0    0 0
bdi-miR7717a-3p GAUGGAUACGAUUGUCGACUGAGA 24 0 0 0 0    0 0
bdi-miR7717a-5p UCAUUGAGAUUCGUGUAAAUUAA 23 0 0 0 0    0 0
bdi-miR7717b-3p AACUAUUUUUAAGUUGACCGAGAA 24 0 0 0 0    0 0
bdi-miR7717b-5p UCUAAGACGACUGAGAAAUAACUA 24 0 0 0 0    0 0
bdi-miR7717c-3p UUAGUUGACUGAGAAAUAGACGGU 24 0 0 0 0    0 0
bdi-miR7717c-5p UUGCUAUUUCUUGGGCGACUGAGA 24 0 0 0 0    0 0
bdi-miR7718-3p AUCGCCUUAGACGAAUAAAUGAGG 24 0 0 0 0    0 0
bdi-miR7718-5p UCAUUUAUUCGUCCAUGGCGAUGG 24 0 0 0 0    0 0
bdi-miR7719-3p UAGAAGCAUAUAUGGCGAAGA 21 0 0 0 0    0 0
bdi-miR7719-5p UCCGCCAUACAUGUUUCUAUC 21 0 0 0 0    0 0
bdi-miR7720-3p UUUUACACAUGAUUUGGGUUGGAC 24 0 0 0 0    0 0
bdi-miR7720-5p UCGAAAUUGAUCGUGCGGAGAAGC 24 0 0 0 0    0 0
bdi-miR7721-3p AAAGUUUGGCAUAGAAUUCAAUGC 24 0 0 0 0    0 0
bdi-miR7721-5p ACGGGAUUUUAUAACGGACUUUGG 24 0 0 0 0    0 0
bdi-miR7722-3p GAAGGGUAUCGGGAUGAGAGG 21 0 0 0 0    0 0
bdi-miR7722-5p UCUCCUCCCGGUACCCUUCUU 21 0 0 0 0    0 0
bdi-miR7723a-3p GAGGGCCAAGGUAGUUGUUUCACA 24 0 0 0 0    0 0
bdi-miR7723a-5p UGAAACAACUAUCUUGGCCUUCUC 24 0 0 0 0    0 0
bdi-miR7723b-3p AUGAAGGUAGUAGUUUCAAAAUGG 24 0 0 0 0    0 0
bdi-miR7723b-5p AUUUUGAUACUACUACCUUCAUCA 24 0 0 0 0    0 0
bdi-miR7724a-3p UUGGCCCACAUUGACAUGUUCACC 24 0 0 0 0    0 0
bdi-miR7724a-5p UGAACAUGUACAUGCUGGCCAACC 24 0 0 0 0    0 0
bdi-miR7724b-3p UUGGCCCACAUUGACAUGUUCACC 24 0 0 0 0    0 0
bdi-miR7724b-5p UGAACAUGUACAUGCUGGCCAACC 24 0 0 0 0    0 0
bdi-miR7725a-3p UGCAAACAAUGUGAUUUCGUCAAG 24 0 0 0 0    0 0
bdi-miR7725a-5p UGACGAGAUCACAUCGUUUGCACA 24 0 0 0 0    0 0
bdi-miR7725b-3p.1 UGAAAACCAUAUUCCUAGCUC 21 0 0 0 0    0 0
bdi-miR7725b-3p.2 CAAAUAAGAGGAGACGAGACAUAG 24 0 0 0 0    0 0
bdi-miR7725b-5p.1 ACUAGGGAGAUGGUUUUCGCU 21 0 0 0 0    0 0
bdi-miR7725b-5p.2 AUGCUCCACCUCAUAUUUGAC 21 0 0 0 0    0 0
bdi-miR7726a-3p UGCGAAUCUGUCACCGUUGUCCCC 24 0 0 0 0    0 0
bdi-miR7726a-5p UGAUGAUGGUACGGACGUCGCGGU 24 0 0 0 0    0 0
bdi-miR7726b-3p UGCGAUACGUCACUUCACCGAAAU 24 0 0 0 0    0 0
bdi-miR7726b-5p UUUGAUGACAUGACGUACGGCGGC 24 0 0 0 0    0 0
bdi-miR7727-3p CCAAGUCGAUUGGAACUAAUGAGC 24 0 0 0 0    0 0
bdi-miR7727-5p UGAUUAGUUUCAGUUGGUCUGGGC 24 0 0 0 0    0 0
bdi-miR7728-3p AAAUACACUCAAUUCAAGCAG 21 0 0 0 0    0 0
bdi-miR7728-5p UGCUCGGAUUGAGUGUAUUUU 21 0 0 0 0    0 0
bdi-miR7729a-3p AGCAAUGGUGGUGGUUUGGAGGAG 24 0 0 0 0    0 0
bdi-miR7729a-5p UGUUUUCAUAGGCCAUGUAGAGC 23 0 0 0 0    0 0
bdi-miR7729b-3p AGCAAUGGUGGUGGUUUGGAGGAG 24 0 0 0 0    0 0
bdi-miR7729b-5p UGUUUUCAUAGGCCAUGUAGAGC 23 0 0 0 0    0 0
bdi-miR7730-3p AACUUUCUCCCGCAGCUGUUCUGU 24 0 0 0 0    0 0
bdi-miR7730-5p AGAACAGCCACGGUUGAAAGUUAU 24 0 0 0 0    0 0
bdi-miR7731-3p AGGUUUGCUCUGGACUUUGGAAUC 24 0 0 0 0    0 0
bdi-miR7731-5p UUCCAAAUUCCUGAGCAAACAUAU 24 0 0 0 0    0 0
bdi-miR7732-3p GAUCGAGAUCGUGGAGGAACC 21 0 0 0 0    0 0
bdi-miR7732-5p UUCCUCCAAGAUCUCGGAGACUC 23 0 0 0 0    0 0
bdi-miR7733-3p CCUGCGUUGGCGAAGGCGAGAAGC 24 0 0 0 0    0 0
bdi-miR7733-5p UUCUCGCCAUUGCCAAACCAGGGC 24 0 0 0 0    0 0
bdi-miR7734-3p UUAACCUAGUCACAUUCAACG 21 0 0 0 0    0 0
bdi-miR7734-5p UUGAACGUGACUGGGUUAACG 21 0 0 0 0    0 0
bdi-miR7735-3p CCGGUCGGAGCCAAGAGACGCGGC 24 0 0 0 0    0 0
bdi-miR7735-5p UUGUUUUCCUUCUGCACUCCCGGC 24 0 0 0 0    0 0
bdi-miR7736-3p UGACAUAUCUGAUGGUAAAGG 21 0 0 0 0    0 0
bdi-miR7736-5p UUUACUAUCUGGGAUGUCACA 21 0 0 0 0    0 0
bdi-miR7737-3p ACUUGAGACGGACUGUAUUAAAAA 24 0 0 0 0    0 0
bdi-miR7737-5p UUUCGGUCAAUGUAUUUCAAGCAG 24 0 0 0 0    0 0
bdi-miR7738-3p GUGCUUGACAGACGACUCUGG 21 0 0 0 0    0 0
bdi-miR7738-5p AGAGUCGUUUGUCAAGCUCGG 21 0 0 0 0    0 0
bdi-miR7739-3p UUGAGUCUGAGAAGUAUUUCUG 22 0 0 0 0    0 0
bdi-miR7739-5p AGAUGCGUCGAAGCGGACUGGAUC 24 0 0 0 0    0 0
bdi-miR7740-3p GAGACAGAGGUUGUUCGGAUG 21 0 0 0 0    0 0
bdi-miR7740-5p UUUGAACAACCUCGGUCUCAU 21 0 0 0 0    0 0
bdi-miR7741-3p.1 AGAUCUUCCAUGAGUAAAAAU 21 0 0 0 0    0 0
bdi-miR7741-3p.2 UGCAUGUGGAACUUCCAGAUC 21 0 0 0 0    0 0
bdi-miR7741-5p.1 UUUUAAUUGUGGAAGCUCUUG 21 0 0 0 0    0 0
bdi-miR7741-5p.2 UCUUGAAGUUUCGCAUGCAGU 21 0 0 0 0    0 0
bdi-miR7742-3p UGUGUGUUCGAGUGAAUGAGU 21 0 0 0 0    0 0
bdi-miR7742-5p UCAUUCGCUCAUUCACACAGU 21 0 0 0 0    0 0
bdi-miR7743-3p UUUGAACUUUUGUAUUGGAUCUUU 24 0 0 0 0    0 0
bdi-miR7743-5p AGCAUCUACUGAUAGUUUGACUGC 24 0 0 0 0    0 0
bdi-miR7744-3p CAUCGACAACUUUUGCCAUCCUUA 24 0 0 0 0    0 0
bdi-miR7744-5p AGGAUGGCAAGAUUUAUCGAUGGG 24 0 0 0 0    0 0
bdi-miR7745-3p UUGUUGUUACUUAAGUCUUGGUAC 24 0 0 0 0    0 0
bdi-miR7745-5p AGUAAGGCUUUAGUAACAAGAGAU 24 0 0 0 0    0 0
bdi-miR7746-3p UUCUAUUGGAACUCUUAAUCUAUG 24 0 0 0 0    0 0
bdi-miR7746-5p AUAGACUAAGAGUUCCAACAGAAG 24 0 0 0 0    0 0
bdi-miR7747-3p AUCCUAUAACAAAACAAACUGAUC 24 0 0 0 0    0 0
bdi-miR7747-5p AUCAGAUUGUUUUGUUGUAGGAUG 24 0 0 0 0    0 0
bdi-miR7748a-3p AAUAUGUUUUCUAUUGUUGGACGG 24 0 0 0 0    0 0
bdi-miR7748a-5p AUCCAACAACAAGGGACGUGUUAG 24 0 0 0 0    0 0
bdi-miR7748b-3p UUGGUCAAAGAAAAUCUAAUACGC 24 0 0 0 0    0 0
bdi-miR7748b-5p AUGUUAGGAUUCGGUUGACCAAGC 24 0 0 0 0    0 0
bdi-miR7749-3p UGGAAUGGGCGCUCUCAGGGAAGC 24 0 0 0 0    0 0
bdi-miR7749-5p AUCGUCGAGGGCGGAGAUUGCGGC 24 0 0 0 0    0 0
bdi-miR7750-3p CAUGGUCGGCAAUGAUACAGACGA 24 0 0 0 0    0 0
bdi-miR7750-5p AUCUGAAUCAUUGCCGACCAUGCA 24 0 0 0 0    0 0
bdi-miR7751-3p UUUGGUGCACCCGGCUGGAGAUGG 24 0 0 0 0    0 0
bdi-miR7751-5p AUCUUCCUCGUGGACAAGCGGUAG 24 0 0 0 0    0 0
bdi-miR7752-3p AAAAUGAUAGGUUGGAAGAACACGC 25 0 0 0 0    0 0
bdi-miR7752-5p AUGCUCUUCCCACUGUCAUUUUCC 24 0 0 0 0    0 0
bdi-miR7753-3p UGAGCAAGGGAGAAGACAUGG 21 0 0 0 0    0 0
bdi-miR7753-5p AUGUCUUCUUCCUUGCUCAUC 21 0 0 0 0    0 0
bdi-miR7754-3p UUCUCUCGGCUAAGGAACUGC 21 0 0 0 0    0 0
bdi-miR7754-5p AUGUUCUCUCGGCUGAGGAAC 21 0 0 0 0    0 0
bdi-miR7755-3p UCAAUUUACGGUGUAGAAUUG 21 0 0 0 0    0 0
bdi-miR7755-5p AUUCCACACUGUAAAUUGAAU 21 0 0 0 0    0 0
bdi-miR7756-3p UGGAGAUGUUGGCAUUGAAUUGGC 24 0 0 0 0    0 0
bdi-miR7756-5p CAAUGCAAUGCCAAGUCUUUCGA 23 0 0 0 0    0 0
bdi-miR7757-3p.1 GGUAGUUGAAUGUUUUGUUUA 21 0 0 0 0    0 0
bdi-miR7757-3p.2 AGAUAACUUGAUAUGUAAGUG 21 0 0 0 0    0 0
bdi-miR7757-5p.1 CACAAAACCUUCAGCUACCCA 21 0 0 0 0    0 0
bdi-miR7757-5p.2 CUUCCAUAUCAAAUCAUCUCU 21 0 0 0 0    0 0
bdi-miR7758-3p UAGCGGUCAACUAACUGUAGUGGC 24 0 0 0 0    0 0
bdi-miR7758-5p CACUACCGUUAGUUGACCGUUAAG 24 0 0 0 0    0 0
bdi-miR7759-3p GGCUUAUGCCGACGUGGCUAC 21 0 0 0 0    0 0
bdi-miR7759-5p CAGCCACGUCGGCAUAAGCGAG 22 0 0 0 0    0 0
bdi-miR7760-3p GGCUUUGCUCGGAGUGCUGUGGC 23 0 0 0 0    0 0
bdi-miR7760-5p CAGCGGACAGAAUGGAGCAAGCAG 24 0 0 0 0    0 0
bdi-miR7761-3p UCUUGAUCAAGAGACGGCUCUGGC 24 0 0 0 0    0 0
bdi-miR7761-5p CAGUGCCGUCUCUUCCUCAAGUUC 24 0 0 0 0    0 0
bdi-miR7762-3p CUCGGAAUUUGGUCAUCAACUGGC 24 0 0 0 0    0 0
bdi-miR7762-5p CAGUUGAUGACCAAGUUCUCGAGA 24 0 0 0 0    0 0
bdi-miR7763-3p AUUCCCGUACGUCAAGAUUGC 21 0 0 0 0    0 0
bdi-miR7763-5p AAUCUUGAUGUGCGGGGAUAG 21 0 0 0 0    0 0
bdi-miR7764-3p AAAUAGAUCUUGGCGUUAUGGG 22 0 0 0 0    0 0
bdi-miR7764-5p CAUAACCUAGAUCUGUAUCA 20 0 0 0 0    0 0
bdi-miR7765-3p UUACAAGAAGUUGGACUAAAAUGC 24 0 0 0 0    0 0
bdi-miR7765-5p CAUUUUAGUCCAACAAGUUGCAA 23 0 0 0 0    0 0
bdi-miR7766-3p CGAGGCUGACUGGGACUAAGCGGC 24 0 0 0 0    0 0
bdi-miR7766-5p CCAACUGGGCCAGUCGGCCUGGGC 24 0 0 0 0    0 0
bdi-miR7767-3p AGGAGCAAGCAGCUUGAAGGU 21 0 0 0 0    0 0
bdi-miR7767-5p CCCCAAGCUGAGAGCUCUCCC 21 0 0 0 0    0 0
bdi-miR7768a-3p CGGCGCCGUCCUCGACCGGGAG 22 0 0 0 0    0 0
bdi-miR7768a-5p CCCGGUCGAGGACGGCCCCGC 21 0 0 0 0    0 0
bdi-miR7768b-3p CGGCGCCGUCCUCGACCGGGAG 22 0 0 0 0    0 0
bdi-miR7768b-5p CCCGGUCGAGGACGGCCCCGC 21 0 0 0 0    0 0
bdi-miR7769-3p UGUCAUGUUGGCACUGAUGGG 21 0 0 0 0    0 0
bdi-miR7769-5p CCGUCAGUGCCAACAUGCCAG 21 0 0 0 0    0 0
bdi-miR7770-3p UCUAGACGGGCCUUCAAAGAG 21 0 0 0 0    0 0
bdi-miR7770-5p CCUUGAAAGCCUGUCUAGACA 21 0 0 0 0    0 0
bdi-miR7771-3p AUGUGUACUAUAGAAGUCAAGGGU 24 0 0 0 0    0 0
bdi-miR7771-5p CCUUGACUCCUAUAGUACACAUUC 24 0 0 0 0    0 0
bdi-miR7772-3p AGAUCUCCAUGAACUGAGAAACGG 24 0 0 0 0    0 0
bdi-miR7772-5p CGCUUUUCGGUCCGUGGAGACGCA 24 0 0 0 0    0 0
bdi-miR7773-3p UUUUUCCUUCGGCUGACACGU 21 0 0 0 0    0 0
bdi-miR7773-5p CGGGUCAACGAAGGAAAAAUU 21 0 0 0 0    0 0
bdi-miR7774-3p GAGCGAACGUUAAAUUCCGUGGGG 24 0 0 0 0    0 0
bdi-miR7774-5p ACUAUGGUCUGUGAGGAUGGCAAC 24 0 0 0 0    0 0
bdi-miR7775-3p CUAGUGCUUAGACAAAACCCGGUU 24 0 0 0 0    0 0
bdi-miR7775-5p ACCGGUUUAUUCUGAAGCACCAGU 24 0 0 0 0    0 0
bdi-miR7776-3p.1 AAAGAUAUCAGAGGGCAACG 20 0 0 0 0    0 0
bdi-miR7776-3p.2 UUGAUAAUGGGUUGAAUGCGC 21 0 0 0 0    0 0
bdi-miR7776-5p.1 CUUGCCCUCUGAUAUCUUGG 20 0 0 0 0    0 0
bdi-miR7776-5p.2 ACAUUCAACUCAUUAUUAAUG 21 0 0 0 0    0 0
bdi-miR7777-3p.1 UUGUUCCACCCAACAGAAGAU 21 0 0 0 0    0 0
bdi-miR7777-3p.2 UGAGAUGGUGUCUGUUGAAGG 21 0 0 0 0    0 0
bdi-miR7777-5p.1 CUUUGGUUGGGUAGAACUACC 21 0 0 0 0    0 0
bdi-miR7777-5p.2 UCUGACAAACACCAUCGCAAC 21 0 0 0 0    0 0
bdi-miR7778-3p CUGCGCCGCGACUUUCGGACGAG 23 0 0 0 0    0 0
bdi-miR7778-5p GAGCAUCGUGUCGGCGUGCGCGGC 24 0 0 0 0    0 0
bdi-miR7779-3p UUCUCGAUCUGUAGACCGAUCUAG 24 0 0 0 0    0 0
bdi-miR7779-5p GAGGUCAUUGUCAGACAUGGGAAG 24 0 0 0 0    0 0
bdi-miR7780-3p GUAGGGACCUUGCUGAAGACGUUU 24 0 0 0 0    0 0
bdi-miR7780-5p GAUAAUUUAGUGGCCUUCCUACUU 24 0 0 0 0    0 0
bdi-miR7781-3p CAUGUCUGUAGUCAGAAAAAUCAA 24 0 0 0 0    0 0
bdi-miR7781-5p GAUUUUUCUGACGACGGACAUGGC 24 0 0 0 0    0 0
bdi-miR7782-3p ACCUGCUCUGAUACCAUGUUGUGA 24 0 0 0 0    0 0
bdi-miR7782-5p GCGGCAUGGUAUUAGAGCAAGUUG 24 0 0 0 0    0 0
bdi-miR7783-3p AGCUCUGAUACCAUGUGGAUGAGA 24 0 0 0 0    0 0
bdi-miR7783-5p GCGUCUACUUGGUAUCCAAGCUUA 24 0 0 0 0    0 0
bdi-miR7784a-3p CAUAGACUUAUGAGACGAGUACAU 24 0 0 0 0    0 0
bdi-miR7784a-5p GUACAUGAACUUAUAAGACGAGUA 24 0 0 0 0    0 0
bdi-miR7784b-3p CAUAGACUUAUGAGACGAGUACAU 24 0 0 0 0    0 0
bdi-miR7784b-5p GUACAUGAACUUAUAAGACGAGUA 24 0 0 0 0    0 0
bdi-miR7785-3p UUUCUUCUGUGAGCCUGACUGAGC 24 0 0 0 0    0 0
bdi-miR7785-5p GUAGAAUGGGUGAUGGGAGAAGGC 24 0 0 0 0    0 0
bdi-miR7786-3p UGCACAAACUGUGGAGUAGUCGGC 24 0 0 0 0    0 0
bdi-miR7786-5p GUCUAUGUCUAUGUCUGUGCACGC 24 0 0 0 0    0 0
bdi-miR7787-3p UGCUUCGGUCUGUGCUUGGGCACG 24 0 0 0 0    0 0
bdi-miR7787-5p GUGCUCGUCCACAAGAGAAGCAGG 24 0 0 0 0    0 0
bdi-miR827-3p UUAGAUGACCAUCAGCAAACA 21 0 0 0 0    0 0
bdi-miR827-5p UUUUGUUGGUUGUCAUCUAACC 22 0 0 0 0    0 0
bdi-miR845 UGCUCUGAUACCAAUUGUUGG 21 0 0 0 0    0 0
bdi-miR9480a UAUGUGAGGGUGGUAACUGAA 21 0 0 0 0    0 0
bdi-miR9480b UAUGUGAGGGUGGUAACUGAA 21 0 0 0 0    0 0
bdi-miR9481a UCAGUCGGAUUUCUCACCUUCGAA 24 0 0 0 0    0 0
bdi-miR9481b UCAGUCGGAUUUCUCACCUUC 21 0 0 0 0    0 0
bdi-miR9482 CCUUUGGGGAAGAAGGGAAAC 21 0 0 0 0    0 0
bdi-miR9483a UUGAACUGUUUCCUCUGAAGUUCC 24 0 0 0 0    0 0
bdi-miR9483b UUGAACUGUUUCCUCUGAAGUUCC 24 0 0 0 0    0 0
bdi-miR9484 UAGUGCAGGGAGAAGUCGGUC 21 0 0 0 0    0 0
bdi-miR9485 UUAUGACGUGUAGGAGUUGCA 21 0 0 0 0    0 0
bdi-miR9486a AUGCUUUCAAGGGAUUAGAGGUUC 24 0 0 0 0    0 0
bdi-miR9486b UAAGUGAUUAGAGGUUCCAGU 21 0 0 0 0    0 0
bdi-miR9487 CCUUGUUCGAUUGCAAGAUGA 21 0 0 0 0    0 0
bdi-miR9488 UGAGGGCUAGGCUUUUAUGUAA 22 0 0 0 0    0 0
bdi-miR9489 UCAGCUCCACGGACUUGGUGA 21 0 0 0 0    0 0
bdi-miR9490 AGGCCACACCCUAAUGGUCGUGCG 24 0 0 0 0    0 0
bdi-miR9491 UGGUAUGUUACCUCUGAUCAG 21 0 0 0 0    0 0
bdi-miR9492 UAUCUACUCUGUCAUGGUAUC 21 0 0 0 0    0 0
bdi-miR9493 AAGAAUUAUGAAACGAAGGGAGUA 24 0 0 0 0    0 0
bdi-miR9494 UUCAUCACCUUCGUCUCCGUC 21 0 0 0 0    0 0
bdi-miR9495 UGAAAAAUGCCUCUGGACGUG 21 0 0 0 0    0 0
bdi-miR9496 CUGGUUGGGCUUAGAUGGGUCC 22 0 0 0 0    0 0
bdi-miR9497 UUUCUGAAUACAUGGUGUAUC 21 0 0 0 0    0 0
bdi-miR9498 GACCGUCAAGUGGUUGUUGAG 21 0 0 0 0    0 0
bdi-miR9499 CCCUCGUCGACGCGGCAGCUC 21 0 0 0 0    0 0