Arabidopsis miRNA Abundances

The data below are based on the microRNAs listed in the Sanger registry. Adjust libraries/reads to display on the control panel.

        

        miRNA         miRNA sequence Len Sum (norm) Average Max Min (>0)  control_Colcontrol_Col_rep1control_Col_rep2control_Col_rep3Col_sdn_1Col__sdn_2AGO10_OE_rep1AGO10_OE_rep2AGO10_OE_rep3AGO10_OE_rep4AGO10_OE_flowerIPGFP_AGO10_OE_1IPGFP_AGO10_OE_2IPGFP_AGO10_OE_3IP_AGO10_OE_rep1IP_AGO10_OE_rep2IP_AGO10_OE_rep3IP_AGO10_OEAGO10_OE_4mAGO1sdn1_2_AGO10OE_1sdn1_2_AGO10OE_2hen1_8_1hen1_8_2hen1_8_sdn1_2_1hen1_8_sdn1_2_2sdn1_2_Rep1sdn1_2_Rep2ago10_13_Rep1ago10_13_Rep2ago10_13_Rep3Ler_Rep1Ler_Rep2Ler_Rep3pnh_2_Rep1pnh_2_Rep2pnh_2_Rep3DBI_nrpd1a1b_infDBI_WT_inflDBI_nrpd2a2b_infDBI_nrpd1b_inflDBI_nrpd1a_inflXCwt_1XCwt_2XCpd1_1XCpd1_2XCdcl3_1XCdcl3_2XCrdr2_1XCrdr2_2XCdcl234_1XCdcl234_2XCdcl234pd1_1XCdcl234pd1_2XCclsy1_1
ath-miR156a-3p GCUCACUGCUCUUUCUGUCAGA 22 259 15 50 1    0 7 22 0 0 0 5 0 28 14 0 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 0 24 6 0 50 0 48 14 14 16 2 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 4 0
ath-miR156a-5p UGACAGAAGAGAGUGAGCAC 20 813,609 15,067 156,589 427    13,781 18,006 11,525 8,739 689 773 6,614 3,546 19,921 3,103 814 2,579 796 507 83,803 156,589 125,785 9,540 16,377 1,879 875 427 493 515 519 1,960 1,211 27,030 23,996 27,341 20,997 16,494 16,959 27,314 33,681 26,745 4,751 1,365 3,632 1,416 4,996 2,406 1,593 10,914 13,210 3,384 4,851 11,029 14,472 2,876 3,193 7,367 7,463 2,768
ath-miR156b-3p UGCUCACCUCUCUUUCUGUCAGU 23 177,888 3,706 88,101 1    88,101 62 0 14 16 5 37 13 18 7 28 73 70 42 3,474 1,691 4,619 78,871 33 119 28 0 0 0 0 8 8 24 37 42 30 35 0 21 62 11 26 14 31 31 26 4 1 27 6 3 8 22 28 4 6 26 11 15
ath-miR156b-5p UGACAGAAGAGAGUGAGCAC 20 813,609 15,067 156,589 427    13,781 18,006 11,525 8,739 689 773 6,614 3,546 19,921 3,103 814 2,579 796 507 83,803 156,589 125,785 9,540 16,377 1,879 875 427 493 515 519 1,960 1,211 27,030 23,996 27,341 20,997 16,494 16,959 27,314 33,681 26,745 4,751 1,365 3,632 1,416 4,996 2,406 1,593 10,914 13,210 3,384 4,851 11,029 14,472 2,876 3,193 7,367 7,463 2,768
ath-miR156c-3p GCUCACUGCUCUAUCUGUCAGA 22 1,158 30 129 1    23 98 129 14 1 0 28 26 65 35 0 0 0 0 0 0 1 35 55 36 3 0 2 0 0 7 1 48 55 83 60 35 60 76 69 58 9 1 2 1 7 3 1 5 6 0 3 0 7 0 0 7 0 3
ath-miR156c-5p UGACAGAAGAGAGUGAGCAC 20 813,609 15,067 156,589 427    13,781 18,006 11,525 8,739 689 773 6,614 3,546 19,921 3,103 814 2,579 796 507 83,803 156,589 125,785 9,540 16,377 1,879 875 427 493 515 519 1,960 1,211 27,030 23,996 27,341 20,997 16,494 16,959 27,314 33,681 26,745 4,751 1,365 3,632 1,416 4,996 2,406 1,593 10,914 13,210 3,384 4,851 11,029 14,472 2,876 3,193 7,367 7,463 2,768
ath-miR156d-3p GCUCACUCUCUUUUUGUCAUAAC 23 175 8 24 1    0 0 0 0 5 10 0 0 0 0 6 0 0 0 0 0 0 0 0 9 3 5 0 0 0 6 10 6 0 0 0 0 0 0 0 0 24 1 4 5 11 0 1 14 17 3 0 11 7 0 0 0 7 10
ath-miR156d-5p UGACAGAAGAGAGUGAGCAC 20 813,609 15,067 156,589 427    13,781 18,006 11,525 8,739 689 773 6,614 3,546 19,921 3,103 814 2,579 796 507 83,803 156,589 125,785 9,540 16,377 1,879 875 427 493 515 519 1,960 1,211 27,030 23,996 27,341 20,997 16,494 16,959 27,314 33,681 26,745 4,751 1,365 3,632 1,416 4,996 2,406 1,593 10,914 13,210 3,384 4,851 11,029 14,472 2,876 3,193 7,367 7,463 2,768
ath-miR156e UGACAGAAGAGAGUGAGCAC 20 813,609 15,067 156,589 427    13,781 18,006 11,525 8,739 689 773 6,614 3,546 19,921 3,103 814 2,579 796 507 83,803 156,589 125,785 9,540 16,377 1,879 875 427 493 515 519 1,960 1,211 27,030 23,996 27,341 20,997 16,494 16,959 27,314 33,681 26,745 4,751 1,365 3,632 1,416 4,996 2,406 1,593 10,914 13,210 3,384 4,851 11,029 14,472 2,876 3,193 7,367 7,463 2,768
ath-miR156f-3p GCUCACUCUCUAUCCGUCACC 21 509 15 75 1    0 0 75 5 1 3 0 0 28 0 0 0 2 0 1 1 0 0 11 0 0 5 2 22 0 0 1 24 49 53 40 17 12 35 7 26 5 0 1 1 1 0 3 0 34 5 0 11 0 0 3 7 18 0
ath-miR156f-5p UGACAGAAGAGAGUGAGCAC 20 813,609 15,067 156,589 427    13,781 18,006 11,525 8,739 689 773 6,614 3,546 19,921 3,103 814 2,579 796 507 83,803 156,589 125,785 9,540 16,377 1,879 875 427 493 515 519 1,960 1,211 27,030 23,996 27,341 20,997 16,494 16,959 27,314 33,681 26,745 4,751 1,365 3,632 1,416 4,996 2,406 1,593 10,914 13,210 3,384 4,851 11,029 14,472 2,876 3,193 7,367 7,463 2,768
ath-miR156g CGACAGAAGAGAGUGAGCAC 20 623 16 70 1    70 33 0 33 1 5 0 0 9 7 0 0 1 0 35 60 42 53 5 0 2 0 2 0 0 3 2 6 6 18 0 0 0 28 41 32 3 2 4 1 4 4 0 18 23 3 3 5 7 12 10 7 18 5
ath-miR156h UGACAGAAGAAAGAGAGCAC 20 7,414 190 769 4    0 0 0 0 57 154 5 4 18 7 69 0 0 0 8 6 10 0 5 18 64 105 83 88 76 147 189 0 0 0 0 0 0 0 7 5 351 92 273 105 334 149 91 714 609 177 182 735 769 201 200 578 572 157
ath-miR156i UGACAGAAGAGAGAGAGCAG 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR156j UGACAGAAGAGAGAGAGCAC 20 1,299 34 492 1    492 25 32 23 1 0 19 4 9 0 0 0 4 0 37 103 51 301 27 0 2 0 0 0 0 1 1 12 0 18 0 0 12 14 21 11 3 3 5 1 14 1 0 0 11 2 3 5 7 4 0 13 4 3
ath-miR157a-3p GCUCUCUAGCCUUCUGUCAUC 21 3,551 79 402 1    47 261 75 136 9 16 159 48 166 78 6 98 39 85 5 1 5 0 131 82 9 0 0 0 5 11 15 175 210 285 109 121 120 402 276 290 16 1 0 1 1 1 1 9 0 2 3 0 0 0 3 20 15 3
ath-miR157a-5p UUGACAGAAGAUAGAGAGCAC 21 1,141,346 21,136 262,128 734    15,211 24,815 19,299 13,705 793 964 36,167 13,296 51,009 44,192 897 12,317 7,077 6,195 140,405 262,128 157,029 11,806 35,713 24,402 734 862 751 985 796 1,307 1,075 23,947 22,344 23,175 17,991 14,328 15,565 21,250 25,656 21,627 4,023 1,051 2,895 1,216 3,305 1,187 1,149 7,923 6,909 1,691 2,118 7,244 8,453 2,597 3,241 7,295 6,741 2,495
ath-miR157b-3p GCUCUCUAGCCUUCUGUCAUC 21 3,551 79 402 1    47 261 75 136 9 16 159 48 166 78 6 98 39 85 5 1 5 0 131 82 9 0 0 0 5 11 15 175 210 285 109 121 120 402 276 290 16 1 0 1 1 1 1 9 0 2 3 0 0 0 3 20 15 3
ath-miR157b-5p UUGACAGAAGAUAGAGAGCAC 21 1,141,346 21,136 262,128 734    15,211 24,815 19,299 13,705 793 964 36,167 13,296 51,009 44,192 897 12,317 7,077 6,195 140,405 262,128 157,029 11,806 35,713 24,402 734 862 751 985 796 1,307 1,075 23,947 22,344 23,175 17,991 14,328 15,565 21,250 25,656 21,627 4,023 1,051 2,895 1,216 3,305 1,187 1,149 7,923 6,909 1,691 2,118 7,244 8,453 2,597 3,241 7,295 6,741 2,495
ath-miR157c-3p GCUCUCUAUACUUCUGUCACC 21 7,830 145 728 1    23 338 151 168 18 10 520 199 665 728 37 195 392 476 28 51 33 18 164 593 15 41 35 22 15 36 13 265 327 547 258 121 156 284 269 206 68 4 7 6 14 1 8 27 46 14 3 38 35 16 10 33 37 46
ath-miR157c-5p UUGACAGAAGAUAGAGAGCAC 21 1,141,346 21,136 262,128 734    15,211 24,815 19,299 13,705 793 964 36,167 13,296 51,009 44,192 897 12,317 7,077 6,195 140,405 262,128 157,029 11,806 35,713 24,402 734 862 751 985 796 1,307 1,075 23,947 22,344 23,175 17,991 14,328 15,565 21,250 25,656 21,627 4,023 1,051 2,895 1,216 3,305 1,187 1,149 7,923 6,909 1,691 2,118 7,244 8,453 2,597 3,241 7,295 6,741 2,495
ath-miR157d UGACAGAAGAUAGAGAGCAC 20 28,111 521 2,911 8    773 683 333 206 47 80 314 108 600 2,558 67 33 18 8 1,153 2,911 2,375 531 246 1,286 67 18 10 22 45 130 108 398 425 333 407 364 336 673 711 634 420 128 352 173 381 150 135 1,005 1,051 274 278 1,043 1,200 271 280 874 756 329
ath-miR158a-3p UCCCAAAUGUAGACAAAGCA 20 12,985,236 240,467 1,455,275 32,210    91,851 239,510 186,190 218,917 59,976 103,802 254,617 187,197 278,326 202,480 151,260 42,133 32,210 44,558 1,123,192 1,455,275 1,316,450 74,623 369,520 129,785 103,982 129,008 140,296 141,918 117,330 148,091 111,442 241,554 182,849 234,440 197,044 112,063 144,846 158,102 176,725 167,173 377,570 204,655 378,077 215,071 418,339 58,203 44,392 310,987 240,889 78,023 77,671 281,777 311,491 96,735 104,888 242,239 293,049 182,445
ath-miR158a-5p CUUUGUCUACAAUUUUGGAAA 21 19,204 356 2,406 2    117 69 11 126 191 155 70 121 46 49 24 16 2 5 2 3 5 106 5 55 28 97 83 449 277 138 345 66 18 59 10 35 24 28 28 37 448 61 196 46 255 278 293 2,027 1,344 430 517 2,211 2,406 960 1,098 2,044 1,567 123
ath-miR158b CCCCAAAUGUAGACAAAGCA 20 60,754 1,125 11,050 36    281 734 366 973 159 280 1,081 864 961 49 586 212 136 204 9,286 8,885 11,050 283 1,668 36 684 350 336 471 458 216 290 265 277 327 486 156 324 250 449 380 1,598 799 1,572 652 1,735 328 360 1,077 821 330 437 1,189 1,383 652 734 1,321 1,287 666
ath-miR159a UUUGGAUUGAAGGGAGCUCUA 21 11,073,503 205,065 699,928 10,752    27,047 346,336 369,617 35,299 191,239 97,034 279,648 22,065 241,808 305,529 90,804 33,282 22,369 15,952 699,928 589,344 632,683 32,391 199,415 412,507 87,262 15,176 13,427 10,752 19,467 102,882 36,601 238,796 206,542 312,025 174,489 144,029 138,732 136,103 143,563 137,723 288,554 87,703 217,997 103,430 303,451 64,249 96,211 304,287 462,847 89,070 76,873 332,299 392,662 284,964 255,865 522,259 488,380 140,536
ath-miR159b-3p UUUGGAUUGAAGGGAGCUCUU 21 9,144,062 169,334 1,277,229 1,916    205,944 116,475 67,410 19,251 109,382 43,207 73,133 12,259 59,653 75,691 49,654 45,819 60,180 48,715 808,060 977,157 1,277,229 282,473 74,991 92,474 44,069 11,761 6,059 1,916 2,987 47,960 19,687 107,009 84,635 142,071 78,065 55,148 54,719 54,932 56,505 55,075 108,353 36,673 86,909 44,756 112,520 76,912 110,987 365,313 365,580 81,119 83,007 296,044 366,329 352,668 262,238 501,223 498,882 72,794
ath-miR159b-5p GAGCUCCUUGAAGUUCAAUGG 21 297 9 22 1    0 0 22 14 2 1 14 17 9 0 16 0 1 0 0 1 0 0 16 18 9 5 2 11 5 0 2 0 0 0 10 0 0 0 14 0 5 1 0 0 0 4 4 9 11 7 0 11 0 8 3 20 15 10
ath-miR159c UUUGGAUUGAAGGGAGCUCCU 21 6,010 111 619 10    328 40 86 42 57 50 56 35 148 28 87 33 32 13 334 441 351 619 98 91 72 33 31 11 15 35 24 54 49 59 40 52 36 21 28 26 28 10 25 16 42 51 42 273 333 158 55 270 332 185 145 171 247 72
ath-miR160a-3p GCGUAUGAGGAGCCAUGCAUA 21 307 10 42 1    0 0 11 0 6 14 0 0 0 7 10 0 0 0 0 0 0 0 5 0 6 3 8 0 0 2 1 0 0 0 0 0 24 14 0 5 5 1 2 0 3 8 3 14 34 9 3 11 42 4 13 20 11 8
ath-miR160a-5p UGCCUGGCUCCCUGUAUGCCA 21 29,383 544 4,319 10    3,891 131 140 33 89 99 80 22 129 120 53 2,986 707 532 2,918 1,989 3,952 4,319 71 164 109 146 128 44 10 113 25 48 74 101 50 52 36 21 14 42 462 166 366 230 382 60 76 509 747 69 75 416 684 217 290 559 498 139
ath-miR160b UGCCUGGCUCCCUGUAUGCCA 21 29,383 544 4,319 10    3,891 131 140 33 89 99 80 22 129 120 53 2,986 707 532 2,918 1,989 3,952 4,319 71 164 109 146 128 44 10 113 25 48 74 101 50 52 36 21 14 42 462 166 366 230 382 60 76 509 747 69 75 416 684 217 290 559 498 139
ath-miR160c-3p CGUACAAGGAGUCAAGCAUGA 21 234 7 24 1    0 11 0 5 8 5 9 0 0 7 4 8 4 0 22 3 2 0 11 9 3 3 2 11 10 6 2 24 12 0 0 0 0 0 7 11 16 1 2 0 3 0 1 5 0 2 0 0 0 0 0 0 0 5
ath-miR160c-5p UGCCUGGCUCCCUGUAUGCCA 21 29,383 544 4,319 10    3,891 131 140 33 89 99 80 22 129 120 53 2,986 707 532 2,918 1,989 3,952 4,319 71 164 109 146 128 44 10 113 25 48 74 101 50 52 36 21 14 42 462 166 366 230 382 60 76 509 747 69 75 416 684 217 290 559 498 139
ath-miR161.1 UGAAAGUGACUACAUCGGGGU 21 420,184 7,781 81,839 339    3,422 7,942 2,871 1,351 6,451 5,149 3,712 743 4,452 4,318 2,465 2,587 3,919 3,249 63,649 81,839 39,422 2,407 4,626 3,886 2,836 670 553 339 342 5,132 3,448 6,058 6,139 7,571 5,765 3,656 4,396 7,826 6,160 5,799 11,369 4,827 8,729 5,300 11,238 2,282 2,014 6,155 6,502 1,275 1,863 6,158 5,278 4,464 5,060 10,285 7,913 4,322
ath-miR161.2 UCAAUGCAUUGAAAGUGACUA 21 139,550 2,584 11,257 178    2,016 2,379 2,623 926 1,446 2,043 2,017 747 2,715 1,979 2,071 350 178 514 6,839 8,867 11,257 1,628 2,630 1,624 1,865 1,000 921 471 463 1,498 1,133 6,021 4,691 6,745 4,972 3,950 3,279 2,484 2,396 2,736 1,758 797 960 840 1,696 713 872 3,414 3,297 1,870 1,151 3,790 4,036 1,842 1,629 3,549 5,151 2,711
ath-miR162a-3p UCGAUAAACCUCUGCAUCCAG 21 612,081 11,335 96,328 814    3,820 4,238 3,634 3,769 4,140 3,641 3,487 2,618 6,964 5,527 14,287 3,043 6,509 5,206 81,436 96,328 84,878 2,584 21,140 3,786 10,655 22,325 19,444 14,168 9,046 3,988 3,431 1,713 1,430 1,717 1,240 814 817 950 1,354 972 13,465 9,371 14,175 8,771 18,976 3,529 2,611 8,528 9,425 2,761 3,687 11,607 11,628 3,906 4,232 9,798 13,219 7,293
ath-miR162a-5p UGGAGGCAGCGGUUCAUCGAUC 22 276 10 40 1    0 0 11 9 0 1 0 0 0 7 4 0 0 0 35 40 31 35 0 9 3 3 0 0 0 3 1 0 0 0 0 0 0 0 0 0 7 2 1 0 1 3 1 5 17 3 0 0 14 0 3 13 11 3
ath-miR162b-3p UCGAUAAACCUCUGCAUCCAG 21 612,081 11,335 96,328 814    3,820 4,238 3,634 3,769 4,140 3,641 3,487 2,618 6,964 5,527 14,287 3,043 6,509 5,206 81,436 96,328 84,878 2,584 21,140 3,786 10,655 22,325 19,444 14,168 9,046 3,988 3,431 1,713 1,430 1,717 1,240 814 817 950 1,354 972 13,465 9,371 14,175 8,771 18,976 3,529 2,611 8,528 9,425 2,761 3,687 11,607 11,628 3,906 4,232 9,798 13,219 7,293
ath-miR162b-5p UGGAGGCAGCGGUUCAUCGAUC 22 276 10 40 1    0 0 11 9 0 1 0 0 0 7 4 0 0 0 35 40 31 35 0 9 3 3 0 0 0 3 1 0 0 0 0 0 0 0 0 0 7 2 1 0 1 3 1 5 17 3 0 0 14 0 3 13 11 3
ath-miR163 UUGAAGAGGACUUGGAACUUCGAU 24 996,956 18,462 88,277 307    1,570 3,058 3,075 823 21,863 10,907 1,549 475 5,190 14,283 10,770 2,115 2,328 1,504 38,206 51,171 41,721 2,053 2,483 13,784 9,815 494 438 307 418 7,832 8,088 2,033 1,633 2,959 1,756 1,057 829 1,159 932 1,104 13,497 6,428 10,764 8,136 12,107 15,318 20,289 88,277 77,405 27,796 23,117 75,802 86,767 60,425 38,018 78,420 71,747 12,861
ath-miR164a UGGAGAAGCAGGGCACGUGCA 21 10,888 253 2,486 1    1,406 62 258 23 37 27 84 17 332 594 358 16 9 3 1,089 2,486 1,206 920 197 684 248 13 8 11 15 39 10 30 0 59 30 0 0 14 21 16 108 57 129 74 152 1 1 0 0 0 0 5 0 0 3 0 0 36
ath-miR164b-3p CAUGUGCCCAUCUUCACCAUC 21 2,492 48 197 3    0 102 65 37 9 15 197 26 111 120 59 49 22 24 69 33 68 0 126 137 41 143 50 22 35 12 15 60 74 95 10 35 12 28 48 11 92 16 31 16 82 13 3 23 23 7 3 43 28 12 19 46 18 57
ath-miR164b-5p UGGAGAAGCAGGGCACGUGCA 21 10,888 253 2,486 1    1,406 62 258 23 37 27 84 17 332 594 358 16 9 3 1,089 2,486 1,206 920 197 684 248 13 8 11 15 39 10 30 0 59 30 0 0 14 21 16 108 57 129 74 152 1 1 0 0 0 0 5 0 0 3 0 0 36
ath-miR164c-3p CACGUGUUCUACUACUCCAAC 21 431 12 37 1    0 25 11 0 3 2 5 4 37 0 4 0 2 0 1 1 1 0 27 9 11 33 19 0 0 10 0 18 6 0 30 0 12 0 7 16 14 1 4 1 6 0 3 9 34 0 0 22 28 12 0 0 0 3
ath-miR164c-5p UGGAGAAGCAGGGCACGUGCG 21 552 22 164 1    164 0 0 9 0 0 9 0 0 7 2 0 9 10 46 126 83 18 5 18 5 3 2 11 0 1 0 0 0 6 0 0 0 0 7 0 2 1 1 2 0 0 0 0 0 0 0 0 0 0 0 0 0 5
ath-miR165a-3p UCGGACCAGGCUUCAUCCCCC 21 12,495,161 231,392 1,761,122 4,187    10,828 50,052 11,300 30,137 117,125 143,985 19,850 11,788 10,972 10,877 14,153 361,350 1,710,124 1,761,122 503,718 181,626 188,134 12,956 8,837 10,728 54,419 4,187 5,177 26,463 8,719 121,098 165,934 33,015 29,407 41,169 26,376 11,885 14,184 26,044 30,683 27,717 882,705 430,986 1,035,327 457,386 956,708 80,723 88,427 398,705 382,461 87,836 124,224 346,112 333,668 157,311 222,489 319,240 308,827 85,887
ath-miR165a-5p GGAAUGUUGUCUGGAUCGAGG 21 7,818 156 564 1    0 109 54 150 80 56 187 108 55 99 37 49 2 0 1 3 0 0 60 109 41 171 126 307 131 26 54 145 142 184 149 104 132 125 221 180 164 22 45 22 150 90 124 564 448 134 143 546 466 263 286 506 376 72
ath-miR165b UCGGACCAGGCUUCAUCCCCC 21 12,495,161 231,392 1,761,122 4,187    10,828 50,052 11,300 30,137 117,125 143,985 19,850 11,788 10,972 10,877 14,153 361,350 1,710,124 1,761,122 503,718 181,626 188,134 12,956 8,837 10,728 54,419 4,187 5,177 26,463 8,719 121,098 165,934 33,015 29,407 41,169 26,376 11,885 14,184 26,044 30,683 27,717 882,705 430,986 1,035,327 457,386 956,708 80,723 88,427 398,705 382,461 87,836 124,224 346,112 333,668 157,311 222,489 319,240 308,827 85,887
ath-miR166a-3p UCGGACCAGGCUUCAUUCCCC 21 43,597,604 807,363 4,272,763 19,055    19,055 207,929 49,241 101,666 578,571 659,644 95,071 44,281 42,890 65,967 88,887 865,874 4,272,763 4,234,106 932,937 264,446 339,199 20,019 41,247 73,007 337,847 31,613 45,947 140,506 35,504 756,965 728,873 173,991 169,171 197,336 100,184 43,886 57,230 161,224 183,693 166,005 3,228,514 1,929,972 4,017,934 1,794,022 3,736,204 421,457 467,223 1,572,638 1,513,250 312,439 544,502 1,271,575 1,363,734 723,965 1,207,182 1,368,069 1,445,265 352,884
ath-miR166a-5p GGACUGUUGUCUGGCUCGAGG 21 118,864 2,286 11,082 1    0 1,333 753 1,160 1,375 1,017 1,498 829 887 1,781 1,080 33 10 8 1 1 1 0 744 1,359 684 1,402 997 1,401 952 996 1,048 1,255 1,412 1,337 625 364 492 1,457 1,436 1,495 4,329 571 1,149 520 3,648 2,705 2,037 11,082 9,109 2,144 3,679 8,899 10,083 3,344 4,467 8,339 9,665 1,871
ath-miR166b-3p UCGGACCAGGCUUCAUUCCCC 21 43,597,604 807,363 4,272,763 19,055    19,055 207,929 49,241 101,666 578,571 659,644 95,071 44,281 42,890 65,967 88,887 865,874 4,272,763 4,234,106 932,937 264,446 339,199 20,019 41,247 73,007 337,847 31,613 45,947 140,506 35,504 756,965 728,873 173,991 169,171 197,336 100,184 43,886 57,230 161,224 183,693 166,005 3,228,514 1,929,972 4,017,934 1,794,022 3,736,204 421,457 467,223 1,572,638 1,513,250 312,439 544,502 1,271,575 1,363,734 723,965 1,207,182 1,368,069 1,445,265 352,884
ath-miR166b-5p GGACUGUUGUCUGGCUCGAGG 21 118,864 2,286 11,082 1    0 1,333 753 1,160 1,375 1,017 1,498 829 887 1,781 1,080 33 10 8 1 1 1 0 744 1,359 684 1,402 997 1,401 952 996 1,048 1,255 1,412 1,337 625 364 492 1,457 1,436 1,495 4,329 571 1,149 520 3,648 2,705 2,037 11,082 9,109 2,144 3,679 8,899 10,083 3,344 4,467 8,339 9,665 1,871
ath-miR166c UCGGACCAGGCUUCAUUCCCC 21 43,597,604 807,363 4,272,763 19,055    19,055 207,929 49,241 101,666 578,571 659,644 95,071 44,281 42,890 65,967 88,887 865,874 4,272,763 4,234,106 932,937 264,446 339,199 20,019 41,247 73,007 337,847 31,613 45,947 140,506 35,504 756,965 728,873 173,991 169,171 197,336 100,184 43,886 57,230 161,224 183,693 166,005 3,228,514 1,929,972 4,017,934 1,794,022 3,736,204 421,457 467,223 1,572,638 1,513,250 312,439 544,502 1,271,575 1,363,734 723,965 1,207,182 1,368,069 1,445,265 352,884
ath-miR166d UCGGACCAGGCUUCAUUCCCC 21 43,597,604 807,363 4,272,763 19,055    19,055 207,929 49,241 101,666 578,571 659,644 95,071 44,281 42,890 65,967 88,887 865,874 4,272,763 4,234,106 932,937 264,446 339,199 20,019 41,247 73,007 337,847 31,613 45,947 140,506 35,504 756,965 728,873 173,991 169,171 197,336 100,184 43,886 57,230 161,224 183,693 166,005 3,228,514 1,929,972 4,017,934 1,794,022 3,736,204 421,457 467,223 1,572,638 1,513,250 312,439 544,502 1,271,575 1,363,734 723,965 1,207,182 1,368,069 1,445,265 352,884
ath-miR166e-3p UCGGACCAGGCUUCAUUCCCC 21 43,597,604 807,363 4,272,763 19,055    19,055 207,929 49,241 101,666 578,571 659,644 95,071 44,281 42,890 65,967 88,887 865,874 4,272,763 4,234,106 932,937 264,446 339,199 20,019 41,247 73,007 337,847 31,613 45,947 140,506 35,504 756,965 728,873 173,991 169,171 197,336 100,184 43,886 57,230 161,224 183,693 166,005 3,228,514 1,929,972 4,017,934 1,794,022 3,736,204 421,457 467,223 1,572,638 1,513,250 312,439 544,502 1,271,575 1,363,734 723,965 1,207,182 1,368,069 1,445,265 352,884
ath-miR166e-5p GGAAUGUUGUCUGGCACGAGG 21 1,556 35 184 1    0 33 86 70 51 28 28 26 74 184 16 0 0 0 0 0 1 0 44 109 8 43 19 11 20 30 17 42 80 59 10 0 36 49 28 16 21 4 4 1 11 13 2 23 34 12 5 16 120 0 23 13 26 10
ath-miR166f UCGGACCAGGCUUCAUUCCCC 21 43,597,604 807,363 4,272,763 19,055    19,055 207,929 49,241 101,666 578,571 659,644 95,071 44,281 42,890 65,967 88,887 865,874 4,272,763 4,234,106 932,937 264,446 339,199 20,019 41,247 73,007 337,847 31,613 45,947 140,506 35,504 756,965 728,873 173,991 169,171 197,336 100,184 43,886 57,230 161,224 183,693 166,005 3,228,514 1,929,972 4,017,934 1,794,022 3,736,204 421,457 467,223 1,572,638 1,513,250 312,439 544,502 1,271,575 1,363,734 723,965 1,207,182 1,368,069 1,445,265 352,884
ath-miR166g UCGGACCAGGCUUCAUUCCCC 21 43,597,604 807,363 4,272,763 19,055    19,055 207,929 49,241 101,666 578,571 659,644 95,071 44,281 42,890 65,967 88,887 865,874 4,272,763 4,234,106 932,937 264,446 339,199 20,019 41,247 73,007 337,847 31,613 45,947 140,506 35,504 756,965 728,873 173,991 169,171 197,336 100,184 43,886 57,230 161,224 183,693 166,005 3,228,514 1,929,972 4,017,934 1,794,022 3,736,204 421,457 467,223 1,572,638 1,513,250 312,439 544,502 1,271,575 1,363,734 723,965 1,207,182 1,368,069 1,445,265 352,884
ath-miR167a-3p GAUCAUGUUCGCAGUUUCACC 21 6,389 123 830 5    0 131 290 75 22 28 56 26 296 537 85 57 8 5 6 6 10 0 49 830 110 118 109 55 60 17 35 169 191 202 456 156 168 118 193 217 225 10 70 15 109 26 20 159 121 31 44 97 162 41 87 99 118 64
ath-miR167a-5p UGAAGCUGCCAGCAUGAUCUA 21 131,379 2,433 29,976 108    29,976 839 1,054 131 849 684 449 108 2,161 1,873 1,851 2,107 728 648 6,003 11,344 5,799 17,222 1,526 1,633 1,967 473 351 120 136 769 289 1,201 1,011 1,599 1,121 658 673 1,131 1,070 977 2,473 1,261 2,022 1,376 2,468 289 345 2,132 1,752 591 548 4,206 2,074 771 892 2,353 2,507 2,788
ath-miR167b UGAAGCUGCCAGCAUGAUCUA 21 131,379 2,433 29,976 108    29,976 839 1,054 131 849 684 449 108 2,161 1,873 1,851 2,107 728 648 6,003 11,344 5,799 17,222 1,526 1,633 1,967 473 351 120 136 769 289 1,201 1,011 1,599 1,121 658 673 1,131 1,070 977 2,473 1,261 2,022 1,376 2,468 289 345 2,132 1,752 591 548 4,206 2,074 771 892 2,353 2,507 2,788
ath-miR167c-3p UAGGUCAUGCUGGUAGUUUCACC 23 3,508 75 547 1    47 94 161 28 6 5 89 35 453 14 6 89 112 178 527 254 547 88 115 18 5 0 0 0 0 8 4 42 49 59 60 69 60 49 76 48 7 1 11 0 6 3 2 5 6 3 0 22 21 4 13 0 4 5
ath-miR167c-5p UAAGCUGCCAGCAUGAUCUUG 21 1,181 30 164 1    164 44 11 0 1 0 37 9 18 14 0 41 27 65 132 141 124 106 22 0 0 3 2 11 0 1 1 30 0 36 40 35 12 7 0 5 2 1 2 1 4 0 1 5 6 0 3 5 0 4 0 0 0 8
ath-miR167d UGAAGCUGCCAGCAUGAUCUGG 22 64,726 1,245 19,735 3    7,172 537 6,042 70 1,221 133 84 22 2,475 5,965 108 334 894 406 190 461 124 19,735 3,658 4,607 69 3 10 0 0 1,027 94 712 512 1,486 655 260 396 597 753 570 338 126 296 193 314 31 30 291 310 24 31 157 289 45 48 158 203 460
ath-miR168a-3p CCCGCCUUGCAUCAACUGAAU 21 59,844 1,151 13,138 21    0 429 323 70 885 554 94 35 767 184 1,288 106 78 52 29 42 21 0 782 137 1,288 320 184 109 35 408 465 290 357 618 198 104 60 229 276 95 2,909 174 546 226 1,126 1,786 701 2,909 4,348 2,374 2,183 11,661 13,138 993 692 1,005 1,364 797
ath-miR168a-5p UCGCUUGGUGCAGGUCGGGAA 21 602,751 11,162 186,468 328    97,476 2,422 1,462 734 11,885 6,362 2,336 328 4,452 5,421 5,569 1,196 3,468 2,152 9,983 19,791 26,542 186,468 10,472 4,643 6,298 770 1,014 996 539 3,623 3,739 1,894 1,997 2,787 1,310 849 673 1,290 1,430 1,146 13,010 4,049 8,637 4,587 12,101 4,851 2,199 9,537 14,675 2,142 2,050 20,322 30,700 4,764 9,344 10,725 10,255 5,286
ath-miR168b-3p CCCGUCUUGUAUCAACUGAAU 21 2,294 46 219 3    0 138 75 126 24 22 80 35 74 219 28 0 12 11 3 6 5 0 44 128 26 20 10 22 10 19 16 6 18 24 0 17 12 42 14 63 77 6 16 7 10 25 18 118 69 43 39 76 113 37 35 99 100 57
ath-miR168b-5p UCGCUUGGUGCAGGUCGGGAA 21 602,751 11,162 186,468 328    97,476 2,422 1,462 734 11,885 6,362 2,336 328 4,452 5,421 5,569 1,196 3,468 2,152 9,983 19,791 26,542 186,468 10,472 4,643 6,298 770 1,014 996 539 3,623 3,739 1,894 1,997 2,787 1,310 849 673 1,290 1,430 1,146 13,010 4,049 8,637 4,587 12,101 4,851 2,199 9,537 14,675 2,142 2,050 20,322 30,700 4,764 9,344 10,725 10,255 5,286
ath-miR169a-3p GGCAAGUUGUCCUUGGCUAC 20 1,002 30 160 1    0 7 32 23 0 0 19 13 18 21 0 8 3 0 0 0 0 0 5 9 2 0 6 0 10 1 1 103 111 160 40 52 36 118 83 85 2 1 0 1 0 1 0 5 0 0 0 11 7 0 0 0 0 8
ath-miR169a-5p CAGCCAAGGAUGACUUGCCGA 21 5,123 114 839 1    375 62 839 5 0 0 28 17 212 71 10 33 37 47 18 26 51 442 787 146 52 0 2 0 5 0 0 193 185 333 318 139 144 139 131 148 21 10 1 5 3 1 2 14 11 5 3 0 14 0 3 20 0 15
ath-miR169b-3p GGCAAGUUGUCCUUCGGCUACA 22 38 5 8 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5 0 0 0 0 0 0 0 0 0 6 0 0 0 0 0 7 5 2 1 0 0 0 0 0 0 0 0 0 0 0 8 0 0 4 0
ath-miR169b-5p CAGCCAAGGAUGACUUGCCGG 21 349 11 70 1    70 0 22 0 0 1 5 4 18 7 6 8 2 7 1 2 3 18 16 0 9 3 0 0 0 2 1 6 18 18 20 0 12 14 21 11 5 1 0 0 1 0 0 0 0 0 0 0 14 0 0 0 0 3
ath-miR169c CAGCCAAGGAUGACUUGCCGG 21 349 11 70 1    70 0 22 0 0 1 5 4 18 7 6 8 2 7 1 2 3 18 16 0 9 3 0 0 0 2 1 6 18 18 20 0 12 14 21 11 5 1 0 0 1 0 0 0 0 0 0 0 14 0 0 0 0 3
ath-miR169d UGAGCCAAGGAUGACUUGCCG 21 162 8 47 1    47 0 0 0 0 1 0 0 0 0 2 0 5 0 1 2 1 0 0 18 2 0 6 0 0 1 1 0 0 0 0 17 0 0 0 0 0 1 1 3 1 0 0 23 0 0 0 0 0 0 0 7 7 15
ath-miR169e UGAGCCAAGGAUGACUUGCCG 21 162 8 47 1    47 0 0 0 0 1 0 0 0 0 2 0 5 0 1 2 1 0 0 18 2 0 6 0 0 1 1 0 0 0 0 17 0 0 0 0 0 1 1 3 1 0 0 23 0 0 0 0 0 0 0 7 7 15
ath-miR169f-3p GCAAGUUGACCUUGGCUCUGC 21 2,378 57 283 1    0 51 204 84 0 5 19 22 55 219 12 0 0 0 1 0 0 0 126 283 47 0 10 44 20 2 6 48 62 48 109 17 108 229 214 222 5 6 0 1 0 1 3 18 34 3 5 5 0 4 3 7 11 5
ath-miR169f-5p UGAGCCAAGGAUGACUUGCCG 21 162 8 47 1    47 0 0 0 0 1 0 0 0 0 2 0 5 0 1 2 1 0 0 18 2 0 6 0 0 1 1 0 0 0 0 17 0 0 0 0 0 1 1 3 1 0 0 23 0 0 0 0 0 0 0 7 7 15
ath-miR169g-3p UCCGGCAAGUUGACCUUGGCU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR169g-5p UGAGCCAAGGAUGACUUGCCG 21 162 8 47 1    47 0 0 0 0 1 0 0 0 0 2 0 5 0 1 2 1 0 0 18 2 0 6 0 0 1 1 0 0 0 0 17 0 0 0 0 0 1 1 3 1 0 0 23 0 0 0 0 0 0 0 7 7 15
ath-miR169h UAGCCAAGGAUGACUUGCCUG 21 3,232 70 502 1    70 25 237 5 0 10 51 13 74 466 18 81 28 44 57 29 64 106 131 502 38 0 0 0 0 1 4 78 99 160 89 69 36 139 124 106 14 20 4 6 0 0 4 27 46 2 5 38 21 12 6 0 11 62
ath-miR169i UAGCCAAGGAUGACUUGCCUG 21 3,232 70 502 1    70 25 237 5 0 10 51 13 74 466 18 81 28 44 57 29 64 106 131 502 38 0 0 0 0 1 4 78 99 160 89 69 36 139 124 106 14 20 4 6 0 0 4 27 46 2 5 38 21 12 6 0 11 62
ath-miR169j UAGCCAAGGAUGACUUGCCUG 21 3,232 70 502 1    70 25 237 5 0 10 51 13 74 466 18 81 28 44 57 29 64 106 131 502 38 0 0 0 0 1 4 78 99 160 89 69 36 139 124 106 14 20 4 6 0 0 4 27 46 2 5 38 21 12 6 0 11 62
ath-miR169k UAGCCAAGGAUGACUUGCCUG 21 3,232 70 502 1    70 25 237 5 0 10 51 13 74 466 18 81 28 44 57 29 64 106 131 502 38 0 0 0 0 1 4 78 99 160 89 69 36 139 124 106 14 20 4 6 0 0 4 27 46 2 5 38 21 12 6 0 11 62
ath-miR169l UAGCCAAGGAUGACUUGCCUG 21 3,232 70 502 1    70 25 237 5 0 10 51 13 74 466 18 81 28 44 57 29 64 106 131 502 38 0 0 0 0 1 4 78 99 160 89 69 36 139 124 106 14 20 4 6 0 0 4 27 46 2 5 38 21 12 6 0 11 62
ath-miR169m UAGCCAAGGAUGACUUGCCUG 21 3,232 70 502 1    70 25 237 5 0 10 51 13 74 466 18 81 28 44 57 29 64 106 131 502 38 0 0 0 0 1 4 78 99 160 89 69 36 139 124 106 14 20 4 6 0 0 4 27 46 2 5 38 21 12 6 0 11 62
ath-miR169n UAGCCAAGGAUGACUUGCCUG 21 3,232 70 502 1    70 25 237 5 0 10 51 13 74 466 18 81 28 44 57 29 64 106 131 502 38 0 0 0 0 1 4 78 99 160 89 69 36 139 124 106 14 20 4 6 0 0 4 27 46 2 5 38 21 12 6 0 11 62
ath-miR170-3p UGAUUGAGCCGUGUCAAUAUC 21 3,245 61 332 5    0 18 43 5 7 23 23 9 37 57 43 49 10 18 97 119 87 53 60 18 60 41 31 33 25 8 21 12 49 48 60 17 48 49 28 53 33 21 47 36 32 29 24 218 235 16 36 130 332 107 80 322 144 44
ath-miR170-5p UAUUGGCCUGGUUCACUCAGA 21 23,839 441 2,836 26    2,836 131 54 98 150 212 103 30 92 85 207 65 26 42 97 100 102 1,805 164 173 259 223 254 274 65 83 204 253 216 267 129 104 108 298 228 158 839 350 728 423 837 331 207 1,391 1,373 265 452 1,768 2,180 427 605 756 970 242
ath-miR171a-3p UGAUUGAGCCGCGCCAAUAUC 21 30,793 570 1,799 74    937 349 366 159 91 295 393 104 240 318 496 1,041 1,383 1,185 310 521 187 673 273 319 587 205 151 109 247 74 163 422 524 505 437 173 408 506 511 412 1,141 424 853 629 1,060 170 233 1,400 1,556 241 247 1,033 1,799 611 892 1,669 1,283 478
ath-miR171a-5p UAUUGGCCUGGUUCACUCAGA 21 23,839 441 2,836 26    2,836 131 54 98 150 212 103 30 92 85 207 65 26 42 97 100 102 1,805 164 173 259 223 254 274 65 83 204 253 216 267 129 104 108 298 228 158 839 350 728 423 837 331 207 1,391 1,373 265 452 1,768 2,180 427 605 756 970 242
ath-miR171b-3p UUGAGCCGUGCCAAUAUCACG 21 7,875 146 658 24    586 51 86 42 93 70 80 69 83 177 230 366 658 581 80 127 68 513 77 100 115 102 72 131 101 64 54 36 31 24 40 52 24 42 55 32 256 117 258 114 258 43 34 205 155 33 31 184 198 86 109 230 262 190
ath-miR171b-5p AGAUAUUAGUGCGGUUCAAUC 21 13,014 255 835 9    0 189 75 131 157 138 140 73 83 120 96 0 9 24 9 18 16 0 60 155 119 657 646 449 327 185 202 314 333 250 189 191 240 340 325 354 579 40 241 52 450 100 92 682 678 170 104 535 529 140 241 835 708 224
ath-miR171c-3p UUGAGCCGUGCCAAUAUCACG 21 7,875 146 658 24    586 51 86 42 93 70 80 69 83 177 230 366 658 581 80 127 68 513 77 100 115 102 72 131 101 64 54 36 31 24 40 52 24 42 55 32 256 117 258 114 258 43 34 205 155 33 31 184 198 86 109 230 262 190
ath-miR171c-5p AGAUAUUGGUGCGGUUCAAUC 21 1,290 27 92 2    0 47 22 9 18 16 5 9 9 14 6 24 23 41 4 2 3 0 0 9 8 92 72 33 5 32 48 42 37 12 30 0 0 35 0 32 49 8 14 10 27 13 13 59 40 16 10 32 28 16 13 85 59 59
ath-miR172a AGAAUCUUGAUGAUGCUGCAU 21 5,985 146 545 1    47 0 43 0 296 92 9 0 46 353 478 8 1 2 65 70 72 35 27 328 347 38 23 44 0 142 87 0 0 0 0 0 0 0 0 0 129 70 92 72 99 56 58 250 287 90 101 232 310 107 138 545 442 254
ath-miR172b-3p AGAAUCUUGAUGAUGCUGCAU 21 5,985 146 545 1    47 0 43 0 296 92 9 0 46 353 478 8 1 2 65 70 72 35 27 328 347 38 23 44 0 142 87 0 0 0 0 0 0 0 0 0 129 70 92 72 99 56 58 250 287 90 101 232 310 107 138 545 442 254
ath-miR172b-5p GCAGCACCAUUAAGAUUCAC 20 278 11 36 2    0 4 0 0 36 9 0 0 0 7 8 0 0 0 0 0 0 0 0 27 9 23 27 22 0 15 17 0 0 0 0 0 0 0 0 0 17 2 0 2 0 0 4 0 6 2 3 5 7 4 3 7 7 5
ath-miR172c AGAAUCUUGAUGAUGCUGCAG 21 5,217 141 552 1    94 0 22 0 181 132 5 0 0 64 529 0 0 0 1 3 0 71 5 55 341 43 33 44 60 217 113 0 0 0 0 0 0 0 0 0 167 112 165 131 173 40 33 259 149 114 78 249 318 66 93 276 229 552
ath-miR172d-3p AGAAUCUUGAUGAUGCUGCAG 21 5,217 141 552 1    94 0 22 0 181 132 5 0 0 64 529 0 0 0 1 3 0 71 5 55 341 43 33 44 60 217 113 0 0 0 0 0 0 0 0 0 167 112 165 131 173 40 33 259 149 114 78 249 318 66 93 276 229 552
ath-miR172d-5p GCAACAUCUUCAAGAUUCAGA 21 962 33 86 4    0 0 0 0 65 29 0 0 0 7 4 0 0 0 0 0 0 0 0 0 12 13 8 11 10 54 21 0 0 0 0 0 0 0 0 0 66 19 28 9 74 18 12 86 57 17 34 59 64 12 16 66 70 21
ath-miR172e-3p GGAAUCUUGAUGAUGCUGCAU 21 146 6 18 1    0 0 0 0 6 6 0 0 9 0 12 0 0 0 8 5 1 18 0 0 9 5 2 0 0 2 4 0 0 0 0 0 0 0 0 0 12 2 2 0 1 0 2 0 6 2 0 5 14 0 3 7 0 3
ath-miR172e-5p GCAGCACCAUUAAGAUUCAC 20 278 11 36 2    0 4 0 0 36 9 0 0 0 7 8 0 0 0 0 0 0 0 0 27 9 23 27 22 0 15 17 0 0 0 0 0 0 0 0 0 17 2 0 2 0 0 4 0 6 2 3 5 7 4 3 7 7 5
ath-miR173-3p UGAUUCUCUGUGUAAGCGAAA 21 395 13 88 1    47 0 11 0 0 0 5 0 18 14 4 0 1 0 10 13 15 88 0 0 6 0 2 0 0 0 3 0 0 0 0 0 0 0 0 0 3 1 4 3 4 7 0 14 23 10 3 5 14 16 13 7 26 5
ath-miR173-5p UUCGCUUGCAGAGAGAAAUCAC 22 24,202 457 7,232 20    1,031 163 215 56 79 70 37 43 194 99 134 7,232 790 1,703 3,277 644 1,136 1,735 175 55 83 125 107 0 20 150 50 247 203 279 327 69 96 201 173 206 176 97 161 108 193 61 50 300 356 80 78 232 381 62 61 315 218 69
ath-miR1886.1 UGAGAGAAGUGAGAUGAAAUC 21 659 18 103 2    0 4 0 5 7 13 5 0 0 21 4 0 37 46 12 24 13 0 0 0 2 3 8 0 0 7 6 0 0 0 10 0 0 0 0 0 19 3 11 8 29 10 7 36 103 7 3 70 42 16 6 20 37 5
ath-miR1886.2 UGAGAUGAAAUCUUUGAUUGG 21 12,512 291 750 7    0 174 462 122 72 97 154 104 453 233 384 0 7 10 227 571 278 0 634 201 280 509 502 77 136 66 116 12 0 0 0 0 0 0 0 0 469 248 389 262 451 190 113 750 534 213 242 481 713 230 225 368 568 185
ath-miR1886.3 AAUUAAAGAUUUCAUCUUACU 21 127 7 21 1    0 0 0 0 0 0 0 0 18 7 8 0 0 0 1 0 0 0 0 0 3 0 4 0 10 0 0 0 0 0 0 0 0 0 0 0 9 1 6 1 10 0 0 0 0 0 0 11 21 0 3 7 7 0
ath-miR1887 UACUAAGUAGAGUCUAAGAGA 21 463 17 56 1    0 0 0 0 2 1 0 0 0 0 6 0 0 0 0 0 0 0 0 0 8 3 4 11 5 2 3 0 0 0 0 0 0 0 0 0 7 10 16 9 13 4 8 50 34 56 39 22 7 29 32 26 41 15
ath-miR1888a UAAGUUAAGAUUUGUGAAGAA 21 414 13 43 1    0 7 0 19 2 5 5 0 18 7 14 0 1 0 12 33 21 0 33 18 5 23 10 0 0 2 7 0 0 0 0 0 0 0 0 0 5 14 13 11 14 1 0 0 0 5 0 43 0 0 6 26 11 23
ath-miR1888b UUAGGCUAAGAUUUGUGAAGA 21 103 5 20 1    0 0 0 0 0 1 5 0 0 0 2 0 0 0 3 4 1 0 0 0 2 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 5 3 4 1 0 0 2 14 6 7 3 11 0 4 0 20 0 3
ath-miR2111a-3p GUCCUCGGGAUGCGGAUUACC 21 236 9 41 1    0 11 0 0 4 0 5 0 0 0 6 0 0 0 17 13 20 0 0 0 3 3 6 0 0 0 1 0 0 0 0 0 0 0 0 11 5 0 1 0 4 3 0 18 11 2 5 11 21 4 3 7 41 0
ath-miR2111a-5p UAAUCUGCAUCCUGAGGUUUA 21 2,828 94 822 1    187 29 11 14 1 2 23 9 0 7 12 822 192 423 339 114 329 88 142 0 9 0 0 0 0 0 0 0 6 6 0 0 0 7 7 0 0 2 7 2 6 1 0 0 0 0 0 0 0 0 16 0 15 0
ath-miR2111b-3p AUCCUCGGGAUACAGUUUACC 21 446 13 60 1    0 4 11 0 4 2 5 4 9 0 39 0 0 0 8 4 8 18 60 0 14 0 2 0 0 3 3 6 0 0 30 0 0 0 0 11 9 2 19 6 17 0 1 27 11 0 3 16 14 0 3 53 15 5
ath-miR2111b-5p UAAUCUGCAUCCUGAGGUUUA 21 2,828 94 822 1    187 29 11 14 1 2 23 9 0 7 12 822 192 423 339 114 329 88 142 0 9 0 0 0 0 0 0 0 6 6 0 0 0 7 7 0 0 2 7 2 6 1 0 0 0 0 0 0 0 0 16 0 15 0
ath-miR2112-3p CUUUAUAUCCGCAUUUGCGCA 21 214 7 21 1    0 4 0 5 1 1 5 0 9 14 16 0 0 0 7 1 5 0 5 9 11 3 2 0 0 0 1 0 18 12 0 0 0 0 0 0 7 1 6 1 7 1 1 14 6 0 0 11 21 0 0 0 4 5
ath-miR2112-5p CGCAAAUGCGGAUAUCAAUGU 21 780 19 60 1    0 11 11 19 4 15 0 9 9 0 37 0 0 0 0 0 0 0 5 9 29 15 21 22 60 6 14 18 6 24 10 0 24 14 0 0 35 5 7 6 19 3 1 27 57 10 16 32 49 21 23 33 26 18
ath-miR2933a GAAAUCGGAGAGGAAAUUCGCC 22 20 4 10 1    0 0 0 0 0 0 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 10 2 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0
ath-miR2933b GAAAUCGGAGAGGAAAUUCGCC 22 20 4 10 1    0 0 0 0 0 0 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 10 2 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0
ath-miR2934-3p CAUCCAAGGUGUUUGUAGAAA 21 151 6 29 1    0 0 0 0 2 2 0 0 0 0 4 0 0 0 1 0 2 0 0 9 5 0 2 0 0 0 1 0 0 0 0 0 0 0 0 0 0 2 6 1 1 1 1 5 6 5 3 11 21 8 6 7 29 10
ath-miR2934-5p UCUUUCUGCAAACGCCUUGGA 21 2,957 74 303 1    117 4 0 0 20 19 0 0 9 0 98 0 1 0 10 17 14 124 0 0 92 0 0 0 0 17 18 30 68 30 10 0 12 42 28 21 94 48 89 56 59 96 84 168 190 73 112 222 303 41 71 145 192 113
ath-miR2936 CUUGAGAGAGAGAACACAGACG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR2937 AUAAGAGCUGUUGAAGGAGUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR2938 GAUCUUUUGAGAGGGUUCCAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR2939 UAACGCACAACACUAAGCCAU 21 2 2 2 2    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR319a UUGGACUGAAGGGAGCUCCCU 21 5,256,614 97,345 469,147 1,922    1,922 12,508 16,492 8,426 153,383 39,520 20,108 8,497 20,402 23,605 98,496 8,973 4,559 5,844 72,099 70,492 112,810 7,682 20,145 20,681 81,843 23,315 22,397 28,861 24,715 67,533 16,154 14,203 12,925 19,509 9,635 6,393 6,678 6,133 6,499 6,375 127,079 54,055 108,718 61,524 130,873 89,482 121,278 403,505 396,079 108,781 117,435 402,840 428,972 358,700 249,946 469,147 465,780 82,608
ath-miR319b UUGGACUGAAGGGAGCUCCCU 21 5,256,614 97,345 469,147 1,922    1,922 12,508 16,492 8,426 153,383 39,520 20,108 8,497 20,402 23,605 98,496 8,973 4,559 5,844 72,099 70,492 112,810 7,682 20,145 20,681 81,843 23,315 22,397 28,861 24,715 67,533 16,154 14,203 12,925 19,509 9,635 6,393 6,678 6,133 6,499 6,375 127,079 54,055 108,718 61,524 130,873 89,482 121,278 403,505 396,079 108,781 117,435 402,840 428,972 358,700 249,946 469,147 465,780 82,608
ath-miR319c UUGGACUGAAGGGAGCUCCUU 21 168,051 3,112 15,668 108    1,500 537 1,129 136 2,781 1,138 393 108 877 417 3,596 374 467 504 2,655 3,921 6,985 3,823 995 502 2,977 501 564 197 292 1,339 634 640 604 921 615 520 528 264 380 359 1,721 757 1,466 852 1,632 3,151 3,795 13,814 14,043 3,920 3,866 11,315 13,639 9,622 6,949 15,319 15,668 2,349
ath-miR3434-3p UCAGAGUAUCAGCCAUGUGA 20 33 6 10 3    0 4 0 0 0 0 0 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5 0 0 0 0 0 10 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 7 0 0
ath-miR3434-5p ACUUGGCUGAUUCUAUUAUU 20 524 15 81 1    0 25 0 9 4 8 5 13 28 0 14 0 0 0 0 0 0 0 11 9 14 3 2 0 5 2 4 0 0 0 0 0 0 0 21 5 3 1 1 1 4 17 0 27 52 16 21 81 56 8 10 26 18 0
ath-miR3440b-3p UGGAUUGGUCAAGGGAAGCGU 21 30 3 11 1    0 0 11 0 0 1 0 0 0 0 2 0 0 0 3 6 3 0 0 0 2 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0
ath-miR3440b-5p UUUUCUUGGCCCAUCCACUUC 21 204 7 16 1    0 0 0 5 3 3 0 0 0 0 4 8 9 16 14 15 8 0 0 0 2 3 2 0 5 2 1 0 0 0 0 0 0 0 0 0 9 2 6 3 7 0 2 14 11 0 5 11 0 4 3 13 11 3
ath-miR390a-3p CGCUAUCCAUCCUGAGUUUCA 21 2,132 44 248 4    23 15 11 23 58 70 5 4 18 0 81 0 0 0 58 94 63 0 16 27 66 31 21 33 55 103 56 36 55 48 40 35 12 7 7 11 248 47 94 42 152 13 11 23 52 9 8 22 21 21 16 59 55 57
ath-miR390a-5p AAGCUCAGGAGGGAUAGCGCC 21 148,194 2,744 18,256 57    422 2,208 1,355 818 2,673 4,139 3,768 631 2,900 5,661 4,662 1,611 178 121 5,283 4,453 3,915 496 3,314 4,735 4,814 1,742 2,071 1,204 735 2,591 4,351 2,263 2,441 2,745 1,498 866 913 1,408 1,575 1,077 18,256 3,798 10,977 5,092 14,259 74 94 355 396 83 57 287 1,270 439 1,802 874 487 3,957
ath-miR390b-3p CGCUAUCCAUCCUGAGUUCC 20 1,437 34 109 1    0 29 11 33 8 14 33 48 9 14 79 0 0 0 0 1 0 0 11 18 78 38 33 109 76 9 9 18 6 12 0 0 0 0 7 0 59 6 5 7 20 13 13 91 46 19 16 65 85 49 42 85 74 39
ath-miR390b-5p AAGCUCAGGAGGGAUAGCGCC 21 148,194 2,744 18,256 57    422 2,208 1,355 818 2,673 4,139 3,768 631 2,900 5,661 4,662 1,611 178 121 5,283 4,453 3,915 496 3,314 4,735 4,814 1,742 2,071 1,204 735 2,591 4,351 2,263 2,441 2,745 1,498 866 913 1,408 1,575 1,077 18,256 3,798 10,977 5,092 14,259 74 94 355 396 83 57 287 1,270 439 1,802 874 487 3,957
ath-miR391-3p ACGGUAUCUCUCCUACGUAGC 21 5,463 116 2,156 1    0 236 0 182 30 13 257 238 28 2,156 31 33 2 2 1 1 4 0 5 912 46 10 31 66 86 60 16 18 37 24 0 0 12 14 0 0 150 24 64 37 59 1 14 59 86 3 8 16 14 33 35 138 55 116
ath-miR391-5p UUCGCAGGAGAGAUAGCGCCA 21 3,473 76 456 4    47 36 11 5 26 33 5 0 28 177 87 456 54 103 260 90 271 18 16 246 121 8 12 109 45 168 28 0 0 24 0 17 12 0 0 0 148 108 105 116 36 4 5 23 63 7 0 32 42 12 13 59 15 172
ath-miR3932a AACUUUGUGAUGACAACGAAG 21 7 7 7 7    0 0 0 0 0 0 0 0 0 7 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR3932b-3p AACUUUGUGAUGACAACGAAG 21 7 7 7 7    0 0 0 0 0 0 0 0 0 7 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR3932b-5p UUUGACGUGCUCGAUCUGCUC 21 332 14 36 1    23 36 11 19 3 0 14 26 0 14 0 16 10 5 21 21 27 0 5 0 0 0 0 0 0 2 0 0 0 12 10 0 24 7 14 11 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR3933 AGAAGCAAAAUGACGACUCGG 21 533 21 112 3    0 0 0 0 0 12 0 0 0 7 22 0 0 0 0 0 0 0 0 0 3 26 19 0 5 0 6 0 0 0 0 0 0 0 0 0 44 8 27 27 30 4 4 23 11 0 3 16 7 12 29 112 63 13
ath-miR393a-3p AUCAUGCUAUCUCUUUGGAUU 21 3,049 62 325 4    0 142 108 28 40 20 94 39 203 325 14 8 0 0 4 5 7 0 66 137 11 38 60 0 15 19 10 60 68 71 60 17 24 76 76 32 99 8 57 18 85 21 11 64 75 40 10 92 148 29 32 197 147 39
ath-miR393a-5p UCCAAAGGGAUCGCAUUGAUCC 22 8,774 162 859 13    234 62 172 37 145 138 33 13 166 184 399 41 13 23 226 157 335 619 859 128 343 496 436 44 25 101 68 115 99 155 60 69 72 76 48 100 183 96 213 126 244 33 46 232 98 75 47 162 191 74 93 171 173 226
ath-miR393b-3p AUCAUGCGAUCUCUUUGGAUU 21 166,655 3,086 16,791 11    47 1,536 1,064 393 2,818 1,271 2,373 367 3,454 5,117 3,063 146 11 15 100 153 152 18 727 3,156 1,683 1,138 848 339 428 1,709 1,366 1,919 1,843 2,959 1,141 936 757 1,138 1,050 956 4,215 806 3,621 1,503 6,069 1,746 2,089 12,914 10,068 2,758 2,661 10,640 12,672 9,544 6,057 16,791 13,573 2,737
ath-miR393b-5p UCCAAAGGGAUCGCAUUGAUCC 22 8,774 162 859 13    234 62 172 37 145 138 33 13 166 184 399 41 13 23 226 157 335 619 859 128 343 496 436 44 25 101 68 115 99 155 60 69 72 76 48 100 183 96 213 126 244 33 46 232 98 75 47 162 191 74 93 171 173 226
ath-miR394a UUGGCAUUCUGUCCACCUCC 20 76,220 1,411 6,071 78    1,172 501 505 150 577 380 286 78 600 926 2,282 464 252 317 1,605 2,086 2,216 1,611 509 985 1,230 1,509 1,245 383 937 939 187 235 253 220 278 485 324 215 262 206 3,532 1,354 2,176 1,749 3,744 1,761 749 4,387 6,071 1,048 974 3,876 4,918 1,354 1,490 4,594 4,491 1,542
ath-miR394b-3p AGGUGGGCAUACUGCCAAUAG 21 8 3 4 1    0 0 0 0 0 1 0 0 0 0 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 0 0
ath-miR394b-5p UUGGCAUUCUGUCCACCUCC 20 76,220 1,411 6,071 78    1,172 501 505 150 577 380 286 78 600 926 2,282 464 252 317 1,605 2,086 2,216 1,611 509 985 1,230 1,509 1,245 383 937 939 187 235 253 220 278 485 324 215 262 206 3,532 1,354 2,176 1,749 3,744 1,761 749 4,387 6,071 1,048 974 3,876 4,918 1,354 1,490 4,594 4,491 1,542
ath-miR395a CUGAAGUGUUUGGGGGAACUC 21 10,441 205 1,638 9    422 156 54 112 31 47 23 56 0 78 153 203 1,638 341 136 640 227 478 77 328 78 51 17 0 0 29 10 103 68 83 20 35 12 49 55 63 47 9 35 29 36 54 52 382 385 66 109 287 713 501 425 565 804 69
ath-miR395b CUGAAGUGUUUGGGGGGACUC 21 32,171 607 11,955 5    258 781 108 253 95 49 173 69 28 184 73 2,148 11,955 4,425 773 2,564 1,482 372 202 255 75 59 37 11 5 81 6 97 99 107 79 0 60 208 297 190 44 25 31 34 42 19 49 309 448 71 122 227 699 792 412 453 697 39
ath-miR395c CUGAAGUGUUUGGGGGGACUC 21 32,171 607 11,955 5    258 781 108 253 95 49 173 69 28 184 73 2,148 11,955 4,425 773 2,564 1,482 372 202 255 75 59 37 11 5 81 6 97 99 107 79 0 60 208 297 190 44 25 31 34 42 19 49 309 448 71 122 227 699 792 412 453 697 39
ath-miR395d CUGAAGUGUUUGGGGGAACUC 21 10,441 205 1,638 9    422 156 54 112 31 47 23 56 0 78 153 203 1,638 341 136 640 227 478 77 328 78 51 17 0 0 29 10 103 68 83 20 35 12 49 55 63 47 9 35 29 36 54 52 382 385 66 109 287 713 501 425 565 804 69
ath-miR395e CUGAAGUGUUUGGGGGAACUC 21 10,441 205 1,638 9    422 156 54 112 31 47 23 56 0 78 153 203 1,638 341 136 640 227 478 77 328 78 51 17 0 0 29 10 103 68 83 20 35 12 49 55 63 47 9 35 29 36 54 52 382 385 66 109 287 713 501 425 565 804 69
ath-miR395f CUGAAGUGUUUGGGGGGACUC 21 32,171 607 11,955 5    258 781 108 253 95 49 173 69 28 184 73 2,148 11,955 4,425 773 2,564 1,482 372 202 255 75 59 37 11 5 81 6 97 99 107 79 0 60 208 297 190 44 25 31 34 42 19 49 309 448 71 122 227 699 792 412 453 697 39
ath-miR396a-3p GUUCAAUAAAGCUGUGGGAAG 21 13,908 258 863 3    70 479 312 154 349 154 276 43 139 424 92 89 8 3 53 21 22 106 131 629 61 396 320 44 71 323 151 863 616 660 466 347 492 333 601 470 274 75 122 59 394 92 76 305 218 179 179 470 572 164 177 348 269 167
ath-miR396a-5p UUCCACAGCUUUCUUGAACUG 21 559,486 10,361 63,182 372    3,047 8,037 32,748 1,075 16,792 4,151 3,674 894 35,308 63,182 14,275 3,555 2,628 13,164 11,040 17,520 29,627 2,372 34,488 39,017 7,520 1,553 2,180 372 609 8,564 2,211 4,429 4,124 7,274 4,962 2,218 1,886 1,977 3,004 2,540 9,868 5,846 13,323 6,701 18,689 3,451 2,815 8,969 10,333 3,587 3,469 10,829 11,212 5,002 5,288 14,596 16,254 17,237
ath-miR396b-3p GCUCAAGAAAGCUGUGGGAAA 21 7,255 145 619 4    492 76 86 9 206 61 47 4 74 219 185 0 0 0 50 24 57 619 33 228 167 128 83 11 0 84 122 97 74 113 69 35 36 76 69 58 234 37 86 38 229 81 54 341 310 99 112 308 360 164 158 388 428 136
ath-miR396b-5p UUCCACAGCUUUCUUGAACUU 21 1,189,069 22,020 207,985 539    16,383 4,975 3,731 1,978 7,426 4,455 1,816 1,257 7,573 6,134 6,578 2,758 6,637 6,740 82,710 207,985 125,981 10,248 9,805 4,798 6,225 10,030 11,585 963 539 15,388 4,937 3,638 3,199 5,188 3,126 1,178 1,381 2,345 3,474 3,058 57,430 30,657 64,562 33,574 88,017 9,756 7,670 42,484 32,905 12,906 16,426 39,017 45,518 15,469 15,787 30,972 35,204 14,493
ath-miR397a UCAUUGAGUGCAGCGUUGAUG 21 9,627 193 1,222 1    539 153 140 215 12 51 192 268 37 141 1,222 130 46 132 283 407 1,069 301 153 46 678 276 72 471 151 10 78 42 68 101 40 17 36 319 311 280 0 1 11 3 3 0 25 241 437 12 0 27 7 0 26 85 85 177
ath-miR397b UCAUUGAGUGCAUCGUUGAUG 21 73,843 1,605 21,380 4    0 3,664 2,505 641 247 316 1,896 661 388 714 2,624 1,944 1,577 7,455 7,884 5,513 21,380 0 1,799 328 2,084 890 318 120 40 105 546 54 0 42 0 0 0 0 0 5 7 6 23 11 14 8 106 1,864 3,325 14 5 341 35 4 116 762 347 1,115
ath-miR398a-3p UGUGUUCUCAGGUCACCCCUU 21 347 15 54 1    47 0 0 0 0 1 5 4 0 0 2 41 54 36 16 31 22 35 5 0 2 10 4 0 5 7 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 9 6 0 0 0 0 0 0 0 0 3
ath-miR398a-5p AAGGAGUGGCAUGUGAACACA 21 5,863 122 1,095 1    0 22 11 0 15 12 47 9 65 1,095 16 0 2 0 2 1 1 0 153 383 8 5 2 0 5 41 14 42 37 36 10 69 24 56 21 53 68 11 76 22 130 28 28 591 448 24 18 427 579 103 80 460 505 8
ath-miR398b-3p UGUGUUCUCAGGUCACCCCUG 21 1,047,527 19,399 254,935 56    469 23,279 4,214 12,232 6,843 3,731 11,860 6,251 4,110 11,124 2,701 81,175 240,902 254,935 48,275 96,151 105,167 708 7,781 7,681 5,518 4,512 1,441 1,303 312 6,076 5,489 2,800 2,965 4,403 3,076 1,265 1,946 11,683 12,569 9,971 228 266 2,733 638 1,856 56 583 9,155 13,388 116 153 1,503 395 82 2,224 2,300 1,984 4,949
ath-miR398b-5p AGGGUUGAUAUGAGAACACAC 21 5,429 113 458 1    0 374 108 164 72 22 426 177 111 247 98 16 7 7 10 2 23 0 273 146 58 115 27 33 10 82 49 115 86 149 159 104 84 458 421 449 0 0 0 1 9 0 15 168 218 7 3 54 14 4 19 53 100 82
ath-miR398c-3p UGUGUUCUCAGGUCACCCCUG 21 1,047,527 19,399 254,935 56    469 23,279 4,214 12,232 6,843 3,731 11,860 6,251 4,110 11,124 2,701 81,175 240,902 254,935 48,275 96,151 105,167 708 7,781 7,681 5,518 4,512 1,441 1,303 312 6,076 5,489 2,800 2,965 4,403 3,076 1,265 1,946 11,683 12,569 9,971 228 266 2,733 638 1,856 56 583 9,155 13,388 116 153 1,503 395 82 2,224 2,300 1,984 4,949
ath-miR398c-5p AGGGUUGAUAUGAGAACACAC 21 5,429 113 458 1    0 374 108 164 72 22 426 177 111 247 98 16 7 7 10 2 23 0 273 146 58 115 27 33 10 82 49 115 86 149 159 104 84 458 421 449 0 0 0 1 9 0 15 168 218 7 3 54 14 4 19 53 100 82
ath-miR399a UGCCAAAGGAGAUUUGCCCUG 21 14,976 294 3,340 10    0 665 226 89 25 16 730 30 55 148 126 1,253 1,327 3,340 707 454 1,278 0 1,044 109 64 31 56 0 10 20 23 193 185 202 179 139 72 201 242 137 72 31 246 61 57 35 33 214 98 29 26 103 134 66 71 105 170 49
ath-miR399b UGCCAAAGGAGAGUUGCCCUG 21 55,152 1,021 5,162 30    70 1,297 591 253 559 556 1,044 86 212 445 596 1,887 2,792 5,162 1,856 1,159 2,928 53 623 547 493 550 541 99 30 372 298 507 629 630 298 139 144 326 311 296 1,081 520 2,576 874 1,140 516 759 2,623 2,160 659 587 3,195 1,736 1,440 1,275 2,169 2,024 1,439
ath-miR399c-3p UGCCAAAGGAGAGUUGCCCUG 21 55,152 1,021 5,162 30    70 1,297 591 253 559 556 1,044 86 212 445 596 1,887 2,792 5,162 1,856 1,159 2,928 53 623 547 493 550 541 99 30 372 298 507 629 630 298 139 144 326 311 296 1,081 520 2,576 874 1,140 516 759 2,623 2,160 659 587 3,195 1,736 1,440 1,275 2,169 2,024 1,439
ath-miR399c-5p GGGCAUCUUUCUAUUGGCAGG 21 130 8 24 1    0 0 0 0 0 0 0 0 0 0 0 16 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 18 18 24 10 0 0 0 7 5 3 2 5 1 4 0 0 0 0 0 0 0 7 0 3 0 0 5
ath-miR399d UGCCAAAGGAGAUUUGCCCCG 21 392 28 98 1    0 7 11 0 0 0 28 0 0 0 0 98 31 86 23 24 26 18 22 0 0 0 0 0 0 0 0 6 0 0 0 0 0 0 0 11 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR399e UGCCAAAGGAGAUUUGCCUCG 21 14 5 7 1    0 7 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 6 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR399f UGCCAAAGGAGAUUUGCCCGG 21 1,044 27 177 1    164 44 32 14 0 1 66 9 9 0 2 57 45 69 34 35 73 177 87 0 5 5 12 0 0 0 1 6 0 12 0 0 0 7 21 0 0 1 7 1 1 1 2 5 6 3 3 5 7 0 0 0 15 0
ath-miR400 UAUGAGAGUAUUAUAAGUCAC 21 3,979 77 277 2    23 174 194 51 5 9 117 39 277 113 31 49 41 65 137 261 269 35 273 91 17 31 12 11 35 12 13 187 86 155 129 69 132 132 90 127 66 22 72 35 63 0 2 32 29 9 16 32 49 0 6 13 26 15
ath-miR401 CGAAACUGGUGUCGACCGACA 21 5 1 2 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 1 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR402 UUCGAGGCCUAUUAAACCUCUG 22 95 4 18 1    0 0 0 0 5 8 5 0 0 0 6 0 0 0 1 1 4 0 0 9 3 0 4 0 0 3 1 0 0 0 0 0 0 0 0 0 2 1 2 1 4 4 0 18 0 0 0 5 0 0 3 0 0 5
ath-miR403-3p UUAGAUUCACGCACAAACUCG 21 1,199,903 22,220 96,580 1,204    3,000 11,498 10,579 6,504 11,500 9,940 13,625 5,810 18,961 15,138 10,123 14,798 28,468 48,583 72,419 87,963 96,580 1,204 16,159 9,670 10,392 11,488 11,189 11,113 8,996 23,127 6,073 16,972 14,115 16,817 13,575 8,143 9,344 13,376 17,583 14,999 44,776 20,609 42,917 20,191 53,394 6,961 5,689 38,856 31,233 15,114 12,937 48,246 42,046 13,779 13,335 36,900 33,559 19,537
ath-miR403-5p UGUUUUGUGCUUGAAUCUAAUU 22 3,559 67 319 8    117 25 32 9 14 29 23 9 83 106 53 8 11 16 125 242 208 319 268 128 64 38 33 0 10 30 19 18 37 36 30 17 60 14 69 16 120 31 58 31 79 21 18 105 69 43 36 97 191 53 48 125 77 41
ath-miR404 AUUAACGCUGGCGGUUGCGGCAGC 24 3 3 3 3    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR405a AUGAGUUGGGUCUAACCCAUAACU 24 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR405b AUGAGUUGGGUCUAACCCAUAACU 24 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR405d AUGAGUUGGGUCUAACCCAUAACU 24 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR406 UAGAAUGCUAUUGUAAUCCAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR407 UUUAAAUCAUAUACUUUUGGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR408-3p AUGCACUGCCUCUUCCCUGGC 21 90,091 1,668 15,817 19    1,828 4,471 2,053 1,870 296 364 3,347 1,149 1,939 4,127 3,267 504 2,102 1,423 5,589 9,491 15,817 1,558 4,096 2,463 4,695 253 142 164 25 336 431 374 401 440 347 104 192 1,110 1,388 1,014 253 226 1,442 404 928 19 107 1,505 2,441 29 23 519 183 45 502 762 487 1,046
ath-miR408-5p ACAGGGAACAAGCAGAGCAUG 21 10,418 213 3,047 1    3,047 105 32 33 40 52 61 30 28 64 83 16 25 13 1,056 1,443 1,524 1,752 55 27 138 5 12 0 0 39 71 30 18 30 20 0 24 69 83 90 0 2 20 3 9 1 4 23 98 3 3 38 14 4 16 0 11 54
ath-miR413 AUAGUUUCUCUUGUUCUGCAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR414 UCAUCUUCAUCAUCAUCGUCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR415 AACAGAGCAGAAACAGAACAU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR416 GGUUCGUACGUACACUGUUCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR417 GAAGGUAGUGAAUUUGUUCGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR418 UAAUGUGAUGAUGAACUGACC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR419 UUAUGAAUGCUGAGGAUGUUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR420 UAAACUAAUCACGGAAAUGCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR4221 UUUUCCUCUGUUGAAUUCUUGC 22 310 13 49 1    0 4 0 0 0 0 0 0 0 0 2 0 0 0 10 14 18 0 0 0 2 0 6 0 5 0 4 0 0 6 0 0 0 0 0 0 0 0 7 1 1 0 9 41 11 3 0 32 49 16 10 26 33 0
ath-miR4227 UCACUGGUACCAAUCAUUCCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR4228-3p UCGGAUGCGAAACGGUGGUGU 21 145 6 14 1    0 4 0 0 1 0 0 0 0 14 0 0 9 3 6 9 3 0 0 0 2 0 0 0 10 1 0 12 0 6 0 0 12 0 0 0 9 4 7 1 7 1 0 0 0 3 0 5 0 0 3 13 0 0
ath-miR4228-5p AUAGCCUUGAACGCCGUCGUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR4239 UUUGUUAUUUUCGCAUGCUCC 21 20 3 7 1    0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 3 0 0 0 1 0 0 0 0 0 0 0 0 0 0 5 1 0 0 0 1 0 0 0 0 0 0 7 0 0 0 0 0
ath-miR4240 UGACUAGACCCGUAACAUUAC 21 3 3 3 3    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 0 0
ath-miR4243 UUGAAAUUGUAGAUUUCGUAC 21 827 31 127 1    0 0 0 0 7 23 0 0 0 0 10 0 0 0 0 0 0 0 0 0 20 31 19 22 10 3 28 0 0 0 0 0 0 0 0 0 14 1 0 4 1 11 16 68 103 38 31 38 127 41 42 59 52 8
ath-miR4245 ACAAAGUUUUAUACUGACAAU 21 95 5 20 1    0 7 0 0 0 1 0 0 9 0 6 0 0 0 0 1 1 0 0 0 0 3 2 0 0 0 1 0 0 0 0 0 0 0 0 0 7 1 5 0 1 0 1 5 6 3 0 5 0 0 3 20 7 0
ath-miR426 UUUUGGAAAUUUGUCCUUACG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR447a-3p UUGGGGACGAGAUGUUUUGUUG 22 1,622 41 138 3    0 15 11 0 12 28 5 0 0 14 37 0 3 0 32 59 40 35 0 0 23 51 39 0 10 25 15 0 18 12 0 0 0 0 14 11 56 12 40 29 34 32 13 105 80 43 44 97 127 57 51 138 129 26
ath-miR447a.2-3p UAUGGAAGAAAUUGUAGUAUU 21 155,701 2,883 10,876 98    656 585 613 131 2,704 3,953 505 143 683 445 3,627 98 117 189 1,348 3,017 2,076 478 798 483 2,816 4,162 3,662 449 715 2,019 3,170 2,015 1,325 2,312 1,776 1,178 937 950 967 861 9,911 2,700 8,137 4,383 6,479 1,154 1,407 7,641 7,001 3,394 1,850 7,401 8,848 6,475 4,319 10,876 9,056 2,706
ath-miR447b UUGGGGACGAGAUGUUUUGUUG 22 1,622 41 138 3    0 15 11 0 12 28 5 0 0 14 37 0 3 0 32 59 40 35 0 0 23 51 39 0 10 25 15 0 18 12 0 0 0 0 14 11 56 12 40 29 34 32 13 105 80 43 44 97 127 57 51 138 129 26
ath-miR447c-3p UUGGGGACGACAUCUUUUGUUG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR447c-5p CCCCUUACAAUGUCGAGUAAA 21 125 7 20 1    0 0 0 0 1 1 0 0 0 0 4 0 0 0 0 0 0 0 5 0 3 0 0 11 5 1 1 0 0 0 0 0 0 0 0 0 9 2 16 7 13 0 1 5 0 0 0 0 0 0 16 20 4 0
ath-miR472-3p UUUUUCCUACUCCGCCCAUACC 22 13,765 255 3,487 6    281 94 54 56 62 33 61 43 92 92 35 553 1,211 775 1,595 3,487 2,813 283 71 64 60 26 10 55 10 40 14 54 25 71 40 35 48 35 35 26 223 90 178 90 222 6 11 77 57 23 10 59 92 41 77 85 59 26
ath-miR472-5p AUGGUCGAAGUAGGCAAAAUC 21 8,224 158 979 2    0 149 43 61 100 58 136 35 92 233 51 16 2 3 11 9 7 0 77 128 47 258 266 55 15 58 101 139 123 131 149 52 72 49 76 69 119 12 99 22 139 61 82 564 500 102 94 454 543 291 248 979 962 82
ath-miR5012 UUUUACUGCUACUUGUGUUCC 21 2,688 53 324 5    47 58 11 33 10 17 37 35 83 28 39 33 35 36 184 324 137 35 104 9 20 59 54 77 20 10 19 12 6 24 0 0 12 7 0 5 85 35 80 49 96 21 18 95 63 26 29 87 92 41 23 85 122 21
ath-miR5013 UUUGUGACAUCUAGGUGCUUU 21 9 2 3 1    0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 0
ath-miR5014a-3p UUGUACAAAUUUAAGUGUACG 21 57 4 11 1    0 0 0 0 1 1 0 0 0 0 2 0 0 0 1 1 3 0 0 0 0 8 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 9 6 0 0 5 0 0 0 7 11 0
ath-miR5014a-5p ACACUUAGUUUUGUACAACAU 21 2 2 2 2    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR5014b AUUUGUACACCUAGAUCUGUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR5015 UUGGUGUUAUGUGUAGUCUUC 21 41 4 11 1    0 0 0 0 2 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 1 5 0 0 5 11 0 0 0 7 4 0
ath-miR5016 UUCUUGUGGAUUCCUUGGAAA 21 20 3 7 2    0 0 0 0 3 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 0 2 0 0 0 0 0 7 0 0
ath-miR5017-3p UUAUACCAAAUUAAUAGCAAA 21 9 3 5 1    0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5 0 0 0 0 0 0 0 0 0 0
ath-miR5017-5p AUUUGUUACUAAUUUGGAAUG 21 25,231 901 2,968 83    0 0 0 0 216 184 0 0 0 0 167 0 0 0 0 0 0 0 0 0 187 261 266 996 745 83 150 0 0 0 0 0 0 0 0 0 387 153 349 154 370 374 518 2,118 1,591 1,174 704 2,211 2,731 1,945 1,268 2,524 2,968 437
ath-miR5018 UUAAAGCUCCACCAUGAGUCCAAU 24 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR5019 UGUUGGGAAAGAAAAACUCUU 21 387 15 78 1    0 0 0 0 3 3 0 0 0 0 6 0 0 0 3 2 0 0 0 0 3 0 0 0 0 2 3 0 0 0 0 0 0 0 0 0 5 1 0 1 4 10 6 41 17 19 34 16 78 21 23 20 63 3
ath-miR5020a UGGAAGAAGGUGAGACUUGCA 21 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR5020b AUGGCAUGAAAGAAGGUGAGA 21 61 4 11 1    0 7 0 0 2 1 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 3 0 0 0 0 0 0 0 0 0 0 0 1 1 0 1 3 0 5 6 3 3 11 7 0 0 0 0 0
ath-miR5020c UGGCAUGGAAGAAGGUGAGAC 21 15 3 7 1    0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 3 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 7 0 0
ath-miR5021 UGAGAAGAAGAAGAAGAAAA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR5022 GUCAUGGGGUAUGAUCGAAUG 21 32 4 11 1    0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 11 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 3 0 5 0 0 0 7 0 0
ath-miR5023 AUUGGUAGUGGAUAAGGGGGC 21 85 5 12 1    0 0 0 0 0 1 9 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 12 0 7 11 2 1 1 0 0 1 2 9 6 0 0 5 0 4 0 0 7 5
ath-miR5024-3p CCGUAUCUUGGCCUUGUCAUU 21 610 20 161 1    0 4 11 0 1 2 0 0 0 28 4 24 0 2 96 119 161 0 27 0 2 3 0 0 0 2 0 0 0 0 0 0 0 0 0 0 2 2 12 3 16 4 1 5 6 2 0 0 14 8 10 13 26 0
ath-miR5024-5p AUGACAAGGCCAAGAUAUAACA 22 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR5025 ACUGUAUAUAUGUAAGUGACA 21 3 3 3 3    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3
ath-miR5026 ACUCAUAAGAUCGUGACACGU 21 29,536 557 3,005 2    70 1,169 290 444 45 22 3,005 501 914 1,703 47 81 2 0 189 194 219 35 623 1,232 46 67 43 44 65 34 23 1,665 2,361 2,353 2,342 2,148 2,186 1,325 1,202 1,225 127 19 42 19 60 21 12 136 92 33 10 189 92 53 84 276 262 95
ath-miR5027 ACCGGUUGGAACUUGCCUUAA 21 241 10 32 1    0 0 0 0 1 0 0 0 0 7 4 0 0 0 0 2 0 0 0 9 0 3 2 0 0 2 0 0 0 0 0 0 0 0 0 0 10 2 18 3 10 0 4 32 23 5 0 27 14 12 6 20 22 3
ath-miR5028 AAUUGGGUUUAUGCUAGAGUU 21 425 12 49 2    0 4 0 0 5 6 9 0 9 0 14 0 0 0 5 15 12 0 11 9 18 3 2 0 0 6 3 0 0 0 0 0 0 0 7 5 21 14 22 11 10 0 4 14 40 7 5 16 49 8 13 26 7 15
ath-miR5029 AAUGAGAGAGAACACUGCAAA 21 457 17 52 1    0 4 0 0 7 13 0 0 0 0 8 0 0 0 0 1 0 0 0 0 8 0 0 11 0 9 27 0 0 0 0 0 0 0 0 0 16 28 5 12 42 19 12 50 52 19 26 16 7 8 13 7 11 26
ath-miR5595a ACAUAUGAUCUGCAUCUUUGC 21 331 9 37 1    0 7 0 5 10 5 9 9 9 0 12 8 0 0 0 0 0 0 0 0 11 10 14 0 10 6 1 6 6 6 0 0 0 14 14 21 7 4 8 4 9 3 2 5 6 0 5 0 14 0 3 13 37 18
ath-miR5628 GAAAUAGCGAAGAUAUGAUUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR5629 UUAGGGUAGUUAACGGAAGUUA 22 46 6 18 1    0 0 0 0 1 0 0 0 0 0 0 0 2 0 3 10 7 18 0 0