Arabidopsis Small RNA miRNA Abundances

The data below are based on the microRNAs listed in the miRBase registry. Adjust libraries/reads to display on the control panel.


        miRNA         miRNA sequence Len Sum (norm) Average Max Min (>0)  160a_WT_1160a_WT_2160a_9_1160a_9_2
ath-miR10515 ACCCCGAUGGUUAUCCUCACC 21 0 0 0 0    0 0 0 0
ath-miR156a-3p GCUCACUGCUCUUUCUGUCAGA 22 0 0 0 0    0 0 0 0
ath-miR156a-5p UGACAGAAGAGAGUGAGCAC 20 10,179 2,545 3,308 1,870    1,870 1,954 3,047 3,308
ath-miR156b-3p UGCUCACCUCUCUUUCUGUCAGU 23 73 18 23 14    14 20 16 23
ath-miR156b-5p UGACAGAAGAGAGUGAGCAC 20 10,179 2,545 3,308 1,870    1,870 1,954 3,047 3,308
ath-miR156c-3p GCUCACUGCUCUAUCUGUCAGA 22 52 13 18 3    3 15 16 18
ath-miR156c-5p UGACAGAAGAGAGUGAGCAC 20 10,179 2,545 3,308 1,870    1,870 1,954 3,047 3,308
ath-miR156d-3p GCUCACUCUCUUUUUGUCAUAAC 23 46 12 19 3    3 15 9 19
ath-miR156d-5p UGACAGAAGAGAGUGAGCAC 20 10,179 2,545 3,308 1,870    1,870 1,954 3,047 3,308
ath-miR156e UGACAGAAGAGAGUGAGCAC 20 10,179 2,545 3,308 1,870    1,870 1,954 3,047 3,308
ath-miR156f-3p GCUCACUCUCUAUCCGUCACC 21 0 0 0 0    0 0 0 0
ath-miR156f-5p UGACAGAAGAGAGUGAGCAC 20 10,179 2,545 3,308 1,870    1,870 1,954 3,047 3,308
ath-miR156g CGACAGAAGAGAGUGAGCAC 20 12 3 5 2    2 2 3 5
ath-miR156h UGACAGAAGAAAGAGAGCAC 20 5 1 3 2    0 2 0 3
ath-miR156i UGACAGAAGAGAGAGAGCAG 20 0 0 0 0    0 0 0 0
ath-miR156j UGACAGAAGAGAGAGAGCAC 20 8 2 5 1    2 0 5 1
ath-miR157a-3p GCUCUCUAGCCUUCUGUCAUC 21 295 74 128 35    42 35 90 128
ath-miR157a-5p UUGACAGAAGAUAGAGAGCAC 21 37,388 9,347 11,266 7,975    7,975 8,117 10,030 11,266
ath-miR157b-3p GCUCUCUAGCCUUCUGUCAUC 21 295 74 128 35    42 35 90 128
ath-miR157b-5p UUGACAGAAGAUAGAGAGCAC 21 37,388 9,347 11,266 7,975    7,975 8,117 10,030 11,266
ath-miR157c-3p GCUCUCUAUACUUCUGUCACC 21 934 234 317 167    167 178 272 317
ath-miR157c-5p UUGACAGAAGAUAGAGAGCAC 21 37,388 9,347 11,266 7,975    7,975 8,117 10,030 11,266
ath-miR157d UGACAGAAGAUAGAGAGCAC 20 1,641 410 513 321    390 321 417 513
ath-miR158a-3p UCCCAAAUGUAGACAAAGCA 20 656,456 164,114 176,038 153,832    176,038 170,224 153,832 156,362
ath-miR158a-5p CUUUGUCUACAAUUUUGGAAA 21 257 64 84 56    59 84 58 56
ath-miR158b CCCCAAAUGUAGACAAAGCA 20 298 75 87 55    87 55 77 79
ath-miR159a UUUGGAUUGAAGGGAGCUCUA 21 391,201 97,800 117,650 82,244    83,234 82,244 108,073 117,650
ath-miR159b-3p UUUGGAUUGAAGGGAGCUCUU 21 190,607 47,652 56,611 40,192    40,192 40,812 52,992 56,611
ath-miR159b-5p GAGCUCCUUGAAGUUCAAUGG 21 5 1 3 2    0 0 2 3
ath-miR159c UUUGGAUUGAAGGGAGCUCCU 21 32 8 15 8    0 9 8 15
ath-miR160a-3p GCGUAUGAGGAGCCAUGCAUA 21 0 0 0 0    0 0 0 0
ath-miR160a-5p UGCCUGGCUCCCUGUAUGCCA 21 255 64 73 47    47 66 69 73
ath-miR160b UGCCUGGCUCCCUGUAUGCCA 21 255 64 73 47    47 66 69 73
ath-miR160c-3p CGUACAAGGAGUCAAGCAUGA 21 41 10 14 9    14 9 9 9
ath-miR160c-5p UGCCUGGCUCCCUGUAUGCCA 21 255 64 73 47    47 66 69 73
ath-miR161.1 UGAAAGUGACUACAUCGGGGU 21 24,230 6,058 7,105 5,468    7,105 6,071 5,468 5,586
ath-miR161.2 UCAAUGCAUUGAAAGUGACUA 21 4,007 1,002 1,185 757    1,128 1,185 937 757
ath-miR162a-3p UCGAUAAACCUCUGCAUCCAG 21 19,744 4,936 6,471 3,359    3,545 3,359 6,471 6,369
ath-miR162a-5p UGGAGGCAGCGGUUCAUCGAUC 22 0 0 0 0    0 0 0 0
ath-miR162b-3p UCGAUAAACCUCUGCAUCCAG 21 19,744 4,936 6,471 3,359    3,545 3,359 6,471 6,369
ath-miR162b-5p UGGAGGCAGCGGUUCAUCGAUC 22 0 0 0 0    0 0 0 0
ath-miR163 UUGAAGAGGACUUGGAACUUCGAU 24 39,606 9,902 13,865 6,300    6,300 6,392 13,865 13,049
ath-miR164a UGGAGAAGCAGGGCACGUGCA 21 37 9 11 7    7 11 11 8
ath-miR164b-3p CAUGUGCCCAUCUUCACCAUC 21 101 25 31 16    30 24 16 31
ath-miR164b-5p UGGAGAAGCAGGGCACGUGCA 21 37 9 11 7    7 11 11 8
ath-miR164c-3p CACGUGUUCUACUACUCCAAC 21 91 23 28 13    26 13 24 28
ath-miR164c-5p UGGAGAAGCAGGGCACGUGCG 21 14 4 7 2    0 7 2 5
ath-miR165a-3p UCGGACCAGGCUUCAUCCCCC 21 320,549 80,137 88,574 70,057    77,013 70,057 84,905 88,574
ath-miR165a-5p GGAAUGUUGUCUGGAUCGAGG 21 47 12 25 3    3 5 25 14
ath-miR165b UCGGACCAGGCUUCAUCCCCC 21 320,549 80,137 88,574 70,057    77,013 70,057 84,905 88,574
ath-miR166a-3p UCGGACCAGGCUUCAUUCCCC 21 2,590,789 647,697 913,985 413,647    436,822 413,647 826,335 913,985
ath-miR166a-5p GGACUGUUGUCUGGCUCGAGG 21 3,537 884 1,351 422    422 425 1,339 1,351
ath-miR166b-3p UCGGACCAGGCUUCAUUCCCC 21 2,590,789 647,697 913,985 413,647    436,822 413,647 826,335 913,985
ath-miR166b-5p GGACUGUUGUCUGGCUCGAGG 21 3,537 884 1,351 422    422 425 1,339 1,351
ath-miR166c UCGGACCAGGCUUCAUUCCCC 21 2,590,789 647,697 913,985 413,647    436,822 413,647 826,335 913,985
ath-miR166d UCGGACCAGGCUUCAUUCCCC 21 2,590,789 647,697 913,985 413,647    436,822 413,647 826,335 913,985
ath-miR166e-3p UCGGACCAGGCUUCAUUCCCC 21 2,590,789 647,697 913,985 413,647    436,822 413,647 826,335 913,985
ath-miR166e-5p GGAAUGUUGUCUGGCACGAGG 21 75 19 33 9    17 9 16 33
ath-miR166f UCGGACCAGGCUUCAUUCCCC 21 2,590,789 647,697 913,985 413,647    436,822 413,647 826,335 913,985
ath-miR166g UCGGACCAGGCUUCAUUCCCC 21 2,590,789 647,697 913,985 413,647    436,822 413,647 826,335 913,985
ath-miR167a-3p GAUCAUGUUCGCAGUUUCACC 21 1,331 333 482 166    166 216 482 467
ath-miR167a-5p UGAAGCUGCCAGCAUGAUCUA 21 4,361 1,090 1,325 835    896 835 1,325 1,305
ath-miR167b UGAAGCUGCCAGCAUGAUCUA 21 4,361 1,090 1,325 835    896 835 1,325 1,305
ath-miR167c-3p UAGGUCAUGCUGGUAGUUUCACC 23 23 6 9 3    3 7 9 4
ath-miR167c-5p UAAGCUGCCAGCAUGAUCUUG 21 4 1 3 1    0 0 3 1
ath-miR167d UGAAGCUGCCAGCAUGAUCUGG 22 4,423 1,106 1,276 934    1,074 934 1,276 1,139
ath-miR168a-3p CCCGCCUUGCAUCAACUGAAU 21 3,173 793 860 765    765 782 766 860
ath-miR168a-5p UCGCUUGGUGCAGGUCGGGAA 21 17,515 4,379 5,481 3,220    3,515 3,220 5,481 5,299
ath-miR168b-3p CCCGUCUUGUAUCAACUGAAU 21 411 103 155 62    68 62 155 126
ath-miR168b-5p UCGCUUGGUGCAGGUCGGGAA 21 17,515 4,379 5,481 3,220    3,515 3,220 5,481 5,299
ath-miR169a-3p GGCAAGUUGUCCUUGGCUAC 20 51 13 16 8    12 16 8 15
ath-miR169a-5p CAGCCAAGGAUGACUUGCCGA 21 48 12 19 4    19 16 9 4
ath-miR169b-3p GGCAAGUUGUCCUUCGGCUACA 22 4 1 4 4    0 4 0 0
ath-miR169b-5p CAGCCAAGGAUGACUUGCCGG 21 0 0 0 0    0 0 0 0
ath-miR169c CAGCCAAGGAUGACUUGCCGG 21 0 0 0 0    0 0 0 0
ath-miR169d UGAGCCAAGGAUGACUUGCCG 21 3 1 2 1    0 2 0 1
ath-miR169e UGAGCCAAGGAUGACUUGCCG 21 3 1 2 1    0 2 0 1
ath-miR169f-3p GCAAGUUGACCUUGGCUCUGC 21 77 19 26 9    26 9 22 20
ath-miR169f-5p UGAGCCAAGGAUGACUUGCCG 21 3 1 2 1    0 2 0 1
ath-miR169g-3p UCCGGCAAGUUGACCUUGGCU 21 0 0 0 0    0 0 0 0
ath-miR169g-5p UGAGCCAAGGAUGACUUGCCG 21 3 1 2 1    0 2 0 1
ath-miR169h UAGCCAAGGAUGACUUGCCUG 21 268 67 81 42    71 81 74 42
ath-miR169i UAGCCAAGGAUGACUUGCCUG 21 268 67 81 42    71 81 74 42
ath-miR169j UAGCCAAGGAUGACUUGCCUG 21 268 67 81 42    71 81 74 42
ath-miR169k UAGCCAAGGAUGACUUGCCUG 21 268 67 81 42    71 81 74 42
ath-miR169l UAGCCAAGGAUGACUUGCCUG 21 268 67 81 42    71 81 74 42
ath-miR169m UAGCCAAGGAUGACUUGCCUG 21 268 67 81 42    71 81 74 42
ath-miR169n UAGCCAAGGAUGACUUGCCUG 21 268 67 81 42    71 81 74 42
ath-miR170-3p UGAUUGAGCCGUGUCAAUAUC 21 38 10 13 7    10 7 13 8
ath-miR170-5p UAUUGGCCUGGUUCACUCAGA 21 235 59 60 57    58 57 60 60
ath-miR171a-3p UGAUUGAGCCGCGCCAAUAUC 21 185 46 66 22    61 66 22 36
ath-miR171a-5p UAUUGGCCUGGUUCACUCAGA 21 235 59 60 57    58 57 60 60
ath-miR171b-3p UUGAGCCGUGCCAAUAUCACG 21 165 41 54 32    54 40 39 32
ath-miR171b-5p AGAUAUUAGUGCGGUUCAAUC 21 593 148 171 119    171 159 144 119
ath-miR171c-3p UUGAGCCGUGCCAAUAUCACG 21 165 41 54 32    54 40 39 32
ath-miR171c-5p AGAUAUUGGUGCGGUUCAAUC 21 150 38 45 31    31 35 39 45
ath-miR172a AGAAUCUUGAUGAUGCUGCAU 21 135 34 52 23    23 31 52 29
ath-miR172b-3p AGAAUCUUGAUGAUGCUGCAU 21 135 34 52 23    23 31 52 29
ath-miR172b-5p GCAGCACCAUUAAGAUUCAC 20 21 5 10 2    5 4 2 10
ath-miR172c AGAAUCUUGAUGAUGCUGCAG 21 0 0 0 0    0 0 0 0
ath-miR172d-3p AGAAUCUUGAUGAUGCUGCAG 21 0 0 0 0    0 0 0 0
ath-miR172d-5p GCAACAUCUUCAAGAUUCAGA 21 0 0 0 0    0 0 0 0
ath-miR172e-3p GGAAUCUUGAUGAUGCUGCAU 21 0 0 0 0    0 0 0 0
ath-miR172e-5p GCAGCACCAUUAAGAUUCAC 20 21 5 10 2    5 4 2 10
ath-miR173-3p UGAUUCUCUGUGUAAGCGAAA 21 3 1 2 1    0 0 2 1
ath-miR173-5p UUCGCUUGCAGAGAGAAAUCAC 22 177 44 62 28    28 35 62 52
ath-miR1886.1 UGAGAGAAGUGAGAUGAAAUC 21 47 12 14 7    7 13 14 13
ath-miR1886.2 UGAGAUGAAAUCUUUGAUUGG 21 452 113 125 93    115 93 125 119
ath-miR1886.3 AAUUAAAGAUUUCAUCUUACU 21 2 1 2 2    0 2 0 0
ath-miR1887 UACUAAGUAGAGUCUAAGAGA 21 0 0 0 0    0 0 0 0
ath-miR1888a UAAGUUAAGAUUUGUGAAGAA 21 26 7 9 3    3 9 8 6
ath-miR1888b UUAGGCUAAGAUUUGUGAAGA 21 2 1 2 2    0 2 0 0
ath-miR2111a-3p GUCCUCGGGAUGCGGAUUACC 21 0 0 0 0    0 0 0 0
ath-miR2111a-5p UAAUCUGCAUCCUGAGGUUUA 21 0 0 0 0    0 0 0 0
ath-miR2111b-3p AUCCUCGGGAUACAGUUUACC 21 0 0 0 0    0 0 0 0
ath-miR2111b-5p UAAUCUGCAUCCUGAGGUUUA 21 0 0 0 0    0 0 0 0
ath-miR2112-3p CUUUAUAUCCGCAUUUGCGCA 21 3 1 2 1    2 0 0 1
ath-miR2112-5p CGCAAAUGCGGAUAUCAAUGU 21 15 4 9 3    3 9 0 3
ath-miR2933a GAAAUCGGAGAGGAAAUUCGCC 22 0 0 0 0    0 0 0 0
ath-miR2933b GAAAUCGGAGAGGAAAUUCGCC 22 0 0 0 0    0 0 0 0
ath-miR2934-3p CAUCCAAGGUGUUUGUAGAAA 21 0 0 0 0    0 0 0 0
ath-miR2934-5p UCUUUCUGCAAACGCCUUGGA 21 11 3 4 3    0 4 3 4
ath-miR2936 CUUGAGAGAGAGAACACAGACG 22 0 0 0 0    0 0 0 0
ath-miR2937 AUAAGAGCUGUUGAAGGAGUC 21 0 0 0 0    0 0 0 0
ath-miR2938 GAUCUUUUGAGAGGGUUCCAG 21 0 0 0 0    0 0 0 0
ath-miR2939 UAACGCACAACACUAAGCCAU 21 0 0 0 0    0 0 0 0
ath-miR319a UUGGACUGAAGGGAGCUCCCU 21 2,655 664 699 614    669 614 673 699
ath-miR319b UUGGACUGAAGGGAGCUCCCU 21 2,655 664 699 614    669 614 673 699
ath-miR319c UUGGACUGAAGGGAGCUCCUU 21 256 64 92 37    37 59 92 68
ath-miR3434-3p UCAGAGUAUCAGCCAUGUGA 20 0 0 0 0    0 0 0 0
ath-miR3434-5p ACUUGGCUGAUUCUAUUAUU 20 2 1 2 2    2 0 0 0
ath-miR3440b-3p UGGAUUGGUCAAGGGAAGCGU 21 0 0 0 0    0 0 0 0
ath-miR3440b-5p UUUUCUUGGCCCAUCCACUUC 21 3 1 3 3    0 0 3 0
ath-miR390a-3p CGCUAUCCAUCCUGAGUUUCA 21 103 26 37 9    31 37 9 26
ath-miR390a-5p AAGCUCAGGAGGGAUAGCGCC 21 10,332 2,583 2,858 2,319    2,400 2,319 2,755 2,858
ath-miR390b-3p CGCUAUCCAUCCUGAGUUCC 20 6 2 2 2    2 2 2 0
ath-miR390b-5p AAGCUCAGGAGGGAUAGCGCC 21 10,332 2,583 2,858 2,319    2,400 2,319 2,755 2,858
ath-miR391-3p ACGGUAUCUCUCCUACGUAGC 21 1,491 373 607 159    167 159 558 607
ath-miR391-5p UUCGCAGGAGAGAUAGCGCCA 21 381 95 142 54    54 64 142 121
ath-miR3932a AACUUUGUGAUGACAACGAAG 21 8 2 5 3    0 0 5 3
ath-miR3932b-3p AACUUUGUGAUGACAACGAAG 21 8 2 5 3    0 0 5 3
ath-miR3932b-5p UUUGACGUGCUCGAUCUGCUC 21 128 32 42 22    42 37 27 22
ath-miR3933 AGAAGCAAAAUGACGACUCGG 21 0 0 0 0    0 0 0 0
ath-miR393a-3p AUCAUGCUAUCUCUUUGGAUU 21 1,342 336 602 105    105 117 518 602
ath-miR393a-5p UCCAAAGGGAUCGCAUUGAUCC 22 583 146 193 92    92 106 193 192
ath-miR393b-3p AUCAUGCGAUCUCUUUGGAUU 21 9,303 2,326 3,249 1,480    1,480 1,502 3,249 3,072
ath-miR393b-5p UCCAAAGGGAUCGCAUUGAUCC 22 583 146 193 92    92 106 193 192
ath-miR394a UUGGCAUUCUGUCCACCUCC 20 388 97 136 57    110 136 85 57
ath-miR394b-3p AGGUGGGCAUACUGCCAAUAG 21 0 0 0 0    0 0 0 0
ath-miR394b-5p UUGGCAUUCUGUCCACCUCC 20 388 97 136 57    110 136 85 57
ath-miR395a CUGAAGUGUUUGGGGGAACUC 21 131 33 78 2    7 2 44 78
ath-miR395b CUGAAGUGUUUGGGGGGACUC 21 699 175 261 103    103 108 227 261
ath-miR395c CUGAAGUGUUUGGGGGGACUC 21 699 175 261 103    103 108 227 261
ath-miR395d CUGAAGUGUUUGGGGGAACUC 21 131 33 78 2    7 2 44 78
ath-miR395e CUGAAGUGUUUGGGGGAACUC 21 131 33 78 2    7 2 44 78
ath-miR395f CUGAAGUGUUUGGGGGGACUC 21 699 175 261 103    103 108 227 261
ath-miR396a-3p GUUCAAUAAAGCUGUGGGAAG 21 1,175 294 395 200    202 200 395 378
ath-miR396a-5p UUCCACAGCUUUCUUGAACUG 21 49,802 12,451 16,778 7,635    8,735 7,635 16,654 16,778
ath-miR396b-3p GCUCAAGAAAGCUGUGGGAAA 21 599 150 229 66    66 97 207 229
ath-miR396b-5p UUCCACAGCUUUCUUGAACUU 21 147,166 36,792 50,636 23,492    23,510 23,492 49,528 50,636
ath-miR397a UCAUUGAGUGCAGCGUUGAUG 21 3 1 2 1    0 2 0 1
ath-miR397b UCAUUGAGUGCAUCGUUGAUG 21 102 26 52 2    3 2 52 45
ath-miR398a-3p UGUGUUCUCAGGUCACCCCUU 21 16 4 8 2    2 0 6 8
ath-miR398a-5p AAGGAGUGGCAUGUGAACACA 21 3,052 763 1,410 169    169 198 1,275 1,410
ath-miR398b-3p UGUGUUCUCAGGUCACCCCUG 21 84,642 21,161 41,052 2,320    2,482 2,320 41,052 38,788
ath-miR398b-5p AGGGUUGAUAUGAGAACACAC 21 320 80 153 11    17 11 153 139
ath-miR398c-3p UGUGUUCUCAGGUCACCCCUG 21 84,642 21,161 41,052 2,320    2,482 2,320 41,052 38,788
ath-miR398c-5p AGGGUUGAUAUGAGAACACAC 21 320 80 153 11    17 11 153 139
ath-miR399a UGCCAAAGGAGAUUUGCCCUG 21 121 30 33 28    28 31 33 29
ath-miR399b UGCCAAAGGAGAGUUGCCCUG 21 703 176 215 137    152 137 199 215
ath-miR399c-3p UGCCAAAGGAGAGUUGCCCUG 21 703 176 215 137    152 137 199 215
ath-miR399c-5p GGGCAUCUUUCUAUUGGCAGG 21 15 4 5 3    5 4 3 3
ath-miR399d UGCCAAAGGAGAUUUGCCCCG 21 0 0 0 0    0 0 0 0
ath-miR399e UGCCAAAGGAGAUUUGCCUCG 21 0 0 0 0    0 0 0 0
ath-miR399f UGCCAAAGGAGAUUUGCCCGG 21 0 0 0 0    0 0 0 0
ath-miR400 UAUGAGAGUAUUAUAAGUCAC 21 493 123 148 92    125 92 128 148
ath-miR401 CGAAACUGGUGUCGACCGACA 21 0 0 0 0    0 0 0 0
ath-miR402 UUCGAGGCCUAUUAAACCUCUG 22 3 1 2 1    2 0 0 1
ath-miR403-3p UUAGAUUCACGCACAAACUCG 21 61,443 15,361 17,787 12,415    14,531 12,415 17,787 16,710
ath-miR403-5p UGUUUUGUGCUUGAAUCUAAUU 22 120 30 35 24    24 29 35 32
ath-miR404 AUUAACGCUGGCGGUUGCGGCAGC 24 0 0 0 0    0 0 0 0
ath-miR405a AUGAGUUGGGUCUAACCCAUAACU 24 0 0 0 0    0 0 0 0
ath-miR405b AUGAGUUGGGUCUAACCCAUAACU 24 0 0 0 0    0 0 0 0
ath-miR405d AUGAGUUGGGUCUAACCCAUAACU 24 0 0 0 0    0 0 0 0
ath-miR406 UAGAAUGCUAUUGUAAUCCAG 21 0 0 0 0    0 0 0 0
ath-miR407 UUUAAAUCAUAUACUUUUGGU 21 0 0 0 0    0 0 0 0
ath-miR408-3p AUGCACUGCCUCUUCCCUGGC 21 1,688 422 805 53    59 53 771 805
ath-miR408-5p ACAGGGAACAAGCAGAGCAUG 21 23 6 10 2    2 2 9 10
ath-miR413 AUAGUUUCUCUUGUUCUGCAC 21 0 0 0 0    0 0 0 0
ath-miR414 UCAUCUUCAUCAUCAUCGUCA 21 0 0 0 0    0 0 0 0
ath-miR415 AACAGAGCAGAAACAGAACAU 21 0 0 0 0    0 0 0 0
ath-miR416 GGUUCGUACGUACACUGUUCA 21 0 0 0 0    0 0 0 0
ath-miR417 GAAGGUAGUGAAUUUGUUCGA 21 0 0 0 0    0 0 0 0
ath-miR418 UAAUGUGAUGAUGAACUGACC 21 0 0 0 0    0 0 0 0
ath-miR419 UUAUGAAUGCUGAGGAUGUUG 21 0 0 0 0    0 0 0 0
ath-miR420 UAAACUAAUCACGGAAAUGCA 21 0 0 0 0    0 0 0 0
ath-miR4221 UUUUCCUCUGUUGAAUUCUUGC 22 5 1 3 2    0 0 2 3
ath-miR4227 UCACUGGUACCAAUCAUUCCA 21 0 0 0 0    0 0 0 0
ath-miR4228-3p UCGGAUGCGAAACGGUGGUGU 21 9 2 5 4    0 4 0 5
ath-miR4228-5p AUAGCCUUGAACGCCGUCGUU 21 0 0 0 0    0 0 0 0
ath-miR4239 UUUGUUAUUUUCGCAUGCUCC 21 0 0 0 0    0 0 0 0
ath-miR4240 UGACUAGACCCGUAACAUUAC 21 0 0 0 0    0 0 0 0
ath-miR4243 UUGAAAUUGUAGAUUUCGUAC 21 0 0 0 0    0 0 0 0
ath-miR4245 ACAAAGUUUUAUACUGACAAU 21 6 2 4 2    0 4 2 0
ath-miR426 UUUUGGAAAUUUGUCCUUACG 21 0 0 0 0    0 0 0 0
ath-miR447a-3p UUGGGGACGAGAUGUUUUGUUG 22 5 1 3 2    0 2 0 3
ath-miR447a.2-3p UAUGGAAGAAAUUGUAGUAUU 21 1,272 318 399 232    399 374 267 232
ath-miR447b UUGGGGACGAGAUGUUUUGUUG 22 5 1 3 2    0 2 0 3
ath-miR447c-3p UUGGGGACGACAUCUUUUGUUG 22 0 0 0 0    0 0 0 0
ath-miR447c-5p CCCCUUACAAUGUCGAGUAAA 21 1 0 1 1    0 0 0 1
ath-miR472-3p UUUUUCCUACUCCGCCCAUACC 22 286 72 92 58    58 92 66 70
ath-miR472-5p AUGGUCGAAGUAGGCAAAAUC 21 402 101 146 58    58 62 136 146
ath-miR5012 UUUUACUGCUACUUGUGUUCC 21 23 6 9 2    3 9 2 9
ath-miR5013 UUUGUGACAUCUAGGUGCUUU 21 0 0 0 0    0 0 0 0
ath-miR5014a-3p UUGUACAAAUUUAAGUGUACG 21 0 0 0 0    0 0 0 0
ath-miR5014a-5p ACACUUAGUUUUGUACAACAU 21 0 0 0 0    0 0 0 0
ath-miR5014b AUUUGUACACCUAGAUCUGUA 21 11 3 5 2    2 2 2 5
ath-miR5015 UUGGUGUUAUGUGUAGUCUUC 21 0 0 0 0    0 0 0 0
ath-miR5016 UUCUUGUGGAUUCCUUGGAAA 21 0 0 0 0    0 0 0 0
ath-miR5017-3p UUAUACCAAAUUAAUAGCAAA 21 0 0 0 0    0 0 0 0
ath-miR5017-5p AUUUGUUACUAAUUUGGAAUG 21 0 0 0 0    0 0 0 0
ath-miR5018 UUAAAGCUCCACCAUGAGUCCAAU 24 0 0 0 0    0 0 0 0
ath-miR5019 UGUUGGGAAAGAAAAACUCUU 21 0 0 0 0    0 0 0 0
ath-miR5020a UGGAAGAAGGUGAGACUUGCA 21 0 0 0 0    0 0 0 0
ath-miR5020b AUGGCAUGAAAGAAGGUGAGA 21 12 3 4 2    2 4 2 4
ath-miR5020c UGGCAUGGAAGAAGGUGAGAC 21 3 1 3 3    0 0 3 0
ath-miR5021 UGAGAAGAAGAAGAAGAAAA 20 0 0 0 0    0 0 0 0
ath-miR5022 GUCAUGGGGUAUGAUCGAAUG 21 0 0 0 0    0 0 0 0
ath-miR5023 AUUGGUAGUGGAUAAGGGGGC 21 2 1 2 2    0 2 0 0
ath-miR5024-3p CCGUAUCUUGGCCUUGUCAUU 21 28 7 10 4    9 4 5 10
ath-miR5024-5p AUGACAAGGCCAAGAUAUAACA 22 0 0 0 0    0 0 0 0
ath-miR5025 ACUGUAUAUAUGUAAGUGACA 21 0 0 0 0    0 0 0 0
ath-miR5026 ACUCAUAAGAUCGUGACACGU 21 1,006 252 277 237    277 247 237 245
ath-miR5027 ACCGGUUGGAACUUGCCUUAA 21 0 0 0 0    0 0 0 0
ath-miR5028 AAUUGGGUUUAUGCUAGAGUU 21 7 2 2 1    2 2 2 1
ath-miR5029 AAUGAGAGAGAACACUGCAAA 21 4 1 3 1    0 0 3 1
ath-miR5595a ACAUAUGAUCUGCAUCUUUGC 21 15 4 8 1    2 4 8 1
ath-miR5628 GAAAUAGCGAAGAUAUGAUUA 21 0 0 0 0    0 0 0 0
ath-miR5629 UUAGGGUAGUUAACGGAAGUUA 22 2 1 2 2    0 2 0 0
ath-miR5630a GCUAAGAGCGGUUCUGAUGGA 21 0 0 0 0    0 0 0 0
ath-miR5630b GCUAAGAGCGGUUCUGAUGGA 21 0 0 0 0    0 0 0 0
ath-miR5631 UGGCAGGAAAGACAUAAUUUU 21 0 0 0 0    0 0 0 0
ath-miR5632-3p UUGGAUUUAUAGUUGGAUAAG 21 0 0 0 0    0 0 0 0
ath-miR5632-5p UUGAUUCUCUUAUCCAACUGU 21 2 1 2 2    2 0 0 0
ath-miR5633 UAUGAUCAUCAGAAAACAGUG 21 0 0 0 0    0 0 0 0
ath-miR5634 AGGGACUUUGUGAAUUUAGGG 21 16 4 8 2    0 2 6 8
ath-miR5635a UGUUAAGGAGUGUUAACGGUG 21 0 0 0 0    0 0 0 0
ath-miR5635b UGUUAAGGAGUGUUAACGGUG 21 0 0 0 0    0 0 0 0
ath-miR5635c UGUUAAGGAGUGUUAACGGUG 21 0 0 0 0    0 0 0 0
ath-miR5635d UGUUAAGGAGUGUUAACGGUG 21 0 0 0 0    0 0 0 0
ath-miR5636 CGUAGUUGCAGAGCUUGACGG 21 0 0 0 0    0 0 0 0
ath-miR5637 AAUGCGCAACUCUAUAUUUCC 21 14 4 7 2    7 2 2 3
ath-miR5638a AUACCAAAACUCUCUCACUUU 21 0 0 0 0    0 0 0 0
ath-miR5638b ACAGUGGUCAUCUGGUGGGCU 21 0 0 0 0    0 0 0 0
ath-miR5639-3p UUUAGCCUCAGACCACGGUGGACU 24 0 0 0 0    0 0 0 0
ath-miR5639-5p UAGUCCACUGUGGUCUAAGGC 21 0 0 0 0    0 0 0 0
ath-miR5640 UGAGAGAAGGAAUUAGAUUCA 21 9 2 4 2    0 4 2 3
ath-miR5641 UGGAAGAAGAUGAUAGAAUUA 21 0 0 0 0    0 0 0 0
ath-miR5642a UCUCGCGCUUGUACGGCUUU 20 85 21 35 4    35 35 11 4
ath-miR5642b UCUCGCGCUUGUACGGCUUU 20 85 21 35 4    35 35 11 4
ath-miR5643a AGGCUUUUAAGAUCUGGUUGC 21 5 1 3 2    3 2 0 0
ath-miR5643b AGGCUUUUAAGAUCUGGUUGC 21 5 1 3 2    3 2 0 0
ath-miR5644 GUGGGUUGCGGAUAACGGUA 20 0 0 0 0    0 0 0 0
ath-miR5645a AUUUGAGUCAUGUCGUUAAG 20 0 0 0 0    0 0 0 0
ath-miR5645b AUUUGAGUCAUGUCGUUAAG 20 0 0 0 0    0 0 0 0
ath-miR5645c AACCUAUUUAACGACAUGACU 21 3 1 2 1    0 0 2 1
ath-miR5645d AUUUGAGUCAUGUCGUUAAG 20 0 0 0 0    0 0 0 0
ath-miR5645e AUUUGAGUCAUGUCGUUAAG 20 0 0 0 0    0 0 0 0
ath-miR5645f AUUUGAGUCAUGUCGUUAAG 20 0 0 0 0    0 0 0 0
ath-miR5646 GUUCGAGGCACGUUGGGAGG 20 3 1 3 3    0 0 3 0
ath-miR5647 UCAAGUUUGAUGACGAUUCCA 21 0 0 0 0    0 0 0 0
ath-miR5648-3p AUCUGAAGAAAAUAGCGGCAU 21 5 1 2 1    2 0 2 1
ath-miR5648-5p UUUGGAAAUAUUUGGCUUGACU 22 4 1 2 2    0 2 2 0
ath-miR5649a AUUGAAUAUGUUGGUUACUAU 21 0 0 0 0    0 0 0 0
ath-miR5649b AUUGAAUAUGUUGGUUACUAU 21 0 0 0 0    0 0 0 0
ath-miR5650 UUGUUUUGGAUCUUAGAUACA 21 0 0 0 0    0 0 0 0
ath-miR5651 UUGUGCGGUUCAAAUAGUAAC 21 344 86 120 52    52 55 117 120
ath-miR5652 UUGAAUGUGAAUGAAUCGGGC 21 9 2 4 1    2 4 2 1
ath-miR5653 UGGGUUGAGUUGAGUUGAGUUGGC 24 2 1 2 2    0 0 2 0
ath-miR5654-3p UGGAAGAUGCUUUGGGAUUUAUU 23 0 0 0 0    0 0 0 0
ath-miR5654-5p AUAAAUCCCAACAUCUUCCA 20 4 1 2 2    0 2 2 0
ath-miR5655 AAGUAGACACAUAAGAAGGAG 21 2 1 2 2    0 0 2 0
ath-miR5656 ACUGAAGUAGAGAUUGGGUUU 21 8 2 3 1    3 2 2 1
ath-miR5657 UGGACAAGGUUAGAUUUGGUG 21 0 0 0 0    0 0 0 0
ath-miR5658 AUGAUGAUGAUGAUGAUGAAA 21 0 0 0 0    0 0 0 0
ath-miR5659 CGAUGAAGGUCUUUGGAACGGUA 23 4 1 2 2    0 2 2 0
ath-miR5660 CAGGUGGUUAGUGCAAUGGAA 21 0 0 0 0    0 0 0 0
ath-miR5661 AGAGGUACAUCAUGUAGUCUG 21 0 0 0 0    0 0 0 0
ath-miR5662 AGAGGUGACCAUUGGAGAUG 20 0 0 0 0    0 0 0 0
ath-miR5663-3p UGAGAAUGCAAAUCCUUAGCU 21 14 4 6 1    3 4 6 1
ath-miR5663-5p AGCUAAGGAUUUGCAUUCUCA 21 4 1 2 2    0 2 2 0
ath-miR5664 AUAGUCAAUUUUAUCGGUCUG 21 0 0 0 0    0 0 0 0
ath-miR5665 UUGGUGGACAAGAUCUGGGAU 21 0 0 0 0    0 0 0 0
ath-miR5666 AUGGGACAUCGAGCAUUUAAU 21 0 0 0 0    0 0 0 0
ath-miR5995b ACAUAUGAUCUGCAUCUUUGC 21 15 4 8 1    2 4 8 1
ath-miR5996 UGACAUCCAGAUAGAAGCUUUG 22 17 4 9 3    9 0 5 3
ath-miR5997 UGAAACCAAGUAGCUAAAUAG 21 0 0 0 0    0 0 0 0
ath-miR5998a ACAGUUUGUGUUUUGUUUUGU 21 5 1 4 1    0 4 0 1
ath-miR5998b ACAGUUUGUGUUUUGUUUUGU 21 5 1 4 1    0 4 0 1
ath-miR5999 UCUUCACUAUUAGACGGACAA 21 0 0 0 0    0 0 0 0
ath-miR771 UGAGCCUCUGUGGUAGCCCUCA 22 1 0 1 1    0 0 0 1
ath-miR773a UUUGCUUCCAGCUUUUGUCUC 21 0 0 0 0    0 0 0 0
ath-miR773b-3p UUUGAUUCCAGCUUUUGUCUC 21 0 0 0 0    0 0 0 0
ath-miR773b-5p GGCAAUAACUUGAGCAAACA 20 0 0 0 0    0 0 0 0
ath-miR774a UUGGUUACCCAUAUGGCCAUC 21 0 0 0 0    0 0 0 0
ath-miR774b-3p CAUCCAUAUUUUCAUCUCGAA 21 0 0 0 0    0 0 0 0
ath-miR774b-5p UGAGAUGAAGAUAUGGGUGAU 21 0 0 0 0    0 0 0 0
ath-miR775 UUCGAUGUCUAGCAGUGCCA 20 456 114 141 92    141 125 92 98
ath-miR776 UCUAAGUCUUCUAUUGAUGUU 21 0 0 0 0    0 0 0 0
ath-miR777 UACGCAUUGAGUUUCGUUGCUU 22 33 8 14 3    5 11 14 3
ath-miR778 UGGCUUGGUUUAUGUACACCG 21 0 0 0 0    0 0 0 0
ath-miR779.1 UUCUGCUAUGUUGCUGCUCAU 21 0 0 0 0    0 0 0 0
ath-miR779.2 UGAUUGGAAAUUUCGUUGACU 21 184 46 63 29    37 29 63 55
ath-miR780.1 UCUAGCAGCUGUUGAGCAGGU 21 0 0 0 0    0 0 0 0
ath-miR780.2 UUCUUCGUGAAUAUCUGGCAU 21 0 0 0 0    0 0 0 0
ath-miR781a UUAGAGUUUUCUGGAUACUUA 21 491 123 153 97    98 97 153 143
ath-miR781b UUAGAGUUUUCUGGAUACUUA 21 491 123 153 97    98 97 153 143
ath-miR782 ACAAACACCUUGGAUGUUCUU 21 0 0 0 0    0 0 0 0
ath-miR8121 AAAGUAUAAUGGUUUAGUGGUUUG 24 3 1 2 1    0 0 2 1
ath-miR8165 AAUGGAGGCAAGUGUGAAGGA 21 0 0 0 0    0 0 0 0
ath-miR8166 AGAGAGUGUAGAAAGUUUCUCA 22 15 4 5 3    3 4 3 5
ath-miR8167a AGAUGUGGAGAUCGUGGGGAUG 22 0 0 0 0    0 0 0 0
ath-miR8167b AGAUGUGGAGAUCGUGGGGAUG 22 0 0 0 0    0 0 0 0
ath-miR8167c AGAUGUGGAGAUCGUGGGGAUG 22 0 0 0 0    0 0 0 0
ath-miR8167d AGAUGUGGAGAUCGUGGGGAUG 22 0 0 0 0    0 0 0 0
ath-miR8167e AGAUGUGGAGAUCGUGGGGAUG 22 0 0 0 0    0 0 0 0
ath-miR8167f AGAUGUGGAGAUCGUGGGGAUG 22 0 0 0 0    0 0 0 0
ath-miR8168 AGGUGCUGAGUGUGCUAGUGC 21 0 0 0 0    0 0 0 0
ath-miR8169 AUAGACAGAGUCACUCACAGA 21 1 0 1 1    0 0 0 1
ath-miR8170-3p UUGCUUAAAGAUUUUCUAUGU 21 8 2 3 2    2 0 3 3
ath-miR8170-5p AUAGCAAAUCGAUAAGCAAUG 21 5 1 3 2    0 0 2 3
ath-miR8171 AUAGGUGGGCCAGUGGUAGGA 21 0 0 0 0    0 0 0 0
ath-miR8172 AUGGAUCAUCUAGAUGGAGAU 21 2 1 2 2    0 0 2 0
ath-miR8173 AUGUGCUGAUUCGAGGUGGGA 21 0 0 0 0    0 0 0 0
ath-miR8174 AUGUGUAUAGGGAAGCUAAUC 21 1 0 1 1    0 0 0 1
ath-miR8175 GAUCCCCGGCAACGGCGCCA 20 2,934 734 934 383    824 934 793 383
ath-miR8176 GGCCGGUGGUCGCGAGAGGGA 21 0 0 0 0    0 0 0 0
ath-miR8177 GUGUGAUGAUGUGUCAUUUAUA 22 0 0 0 0    0 0 0 0
ath-miR8178 UAACAGAGUAAUUGUACAGUG 21 0 0 0 0    0 0 0 0
ath-miR8179 UGACUGCAUUAACUUGAUCGU 21 0 0 0 0    0 0 0 0
ath-miR8180 UGCGGUGCGGGAGAAGUGC 19 0 0 0 0    0 0 0 0
ath-miR8181 UGGGGGUGGGGGGGUGACAG 20 0 0 0 0    0 0 0 0
ath-miR8182 UUGUGUUGCGUUUCUGUUGAUU 22 0 0 0 0    0 0 0 0
ath-miR8183 UUUAGUUGACGGAAUUGUGGC 21 5 1 2 1    2 0 2 1
ath-miR8184 UUUGGUCUGAUUACGAAUGUA 21 0 0 0 0    0 0 0 0
ath-miR822-3p UGUGCAAAUGCUUUCUACAGG 21 17 4 7 3    7 4 3 3
ath-miR822-5p UGCGGGAAGCAUUUGCACAUG 21 1,016 254 281 227    254 227 281 254
ath-miR823 UGGGUGGUGAUCAUAUAAGAU 21 97 24 31 9    31 29 28 9
ath-miR824-3p CCUUCUCAUCGAUGGUCUAGA 21 4,760 1,190 1,526 854    854 927 1,453 1,526
ath-miR824-5p UAGACCAUUUGUGAGAAGGGA 21 97 24 30 17    17 26 30 24
ath-miR825 UUCUCAAGAAGGUGCAUGAAC 21 466 117 137 92    125 137 112 92
ath-miR826a UAGUCCGGUUUUGGAUACGUG 21 0 0 0 0    0 0 0 0
ath-miR826b UGGUUUUGGACACGUGAAAAU 21 0 0 0 0    0 0 0 0
ath-miR827 UUAGAUGACCAUCAACAAACU 21 438 110 217 18    23 18 180 217
ath-miR828 UCUUGCUUAAAUGAGUAUUCCA 22 0 0 0 0    0 0 0 0
ath-miR829-3p.1 AGCUCUGAUACCAAAUGAUGGAAU 24 8 2 3 2    2 0 3 3
ath-miR829-3p.2 CAAAUUAAAGCUUCAAGGUAG 21 0 0 0 0    0 0 0 0
ath-miR829-5p ACUUUGAAGCUUUGAUUUGAA 21 13 3 6 2    2 0 6 5
ath-miR830-3p UAACUAUUUUGAGAAGAAGUG 21 11 3 9 2    2 0 9 0
ath-miR830-5p UCUUCUCCAAAUAGUUUAGGUU 22 27 7 14 4    0 4 14 9
ath-miR831-3p UGAUCUCUUCGUACUCUUCUUG 22 3 1 3 3    3 0 0 0
ath-miR831-5p AGAAGCGUACAAGGAGAUGAGG 22 0 0 0 0    0 0 0 0
ath-miR832-3p UUGAUUCCCAAUCCAAGCAAG 21 0 0 0 0    0 0 0 0
ath-miR832-5p UGCUGGGAUCGGGAAUCGAAA 21 0 0 0 0    0 0 0 0
ath-miR833a-3p UAGACCGAUGUCAACAAACAAG 22 5 1 3 2    0 0 2 3
ath-miR833a-5p UGUUUGUUGUACUCGGUCUAGU 22 46 12 14 9    9 9 14 14
ath-miR833b UGUUUGUUGACAUCGGUCUAG 21 0 0 0 0    0 0 0 0
ath-miR834 UGGUAGCAGUAGCGGUGGUAA 21 0 0 0 0    0 0 0 0
ath-miR835-3p UGGAGAAGAUACGCAAGAAAG 21 0 0 0 0    0 0 0 0
ath-miR835-5p UUCUUGCAUAUGUUCUUUAUC 21 1 0 1 1    0 0 0 1
ath-miR836 UCCUGUGUUUCCUUUGAUGCGUGG 24 0 0 0 0    0 0 0 0
ath-miR837-3p AAACGAACAAAAAACUGAUGG 21 2 1 2 2    0 0 2 0
ath-miR837-5p AUCAGUUUCUUGUUCGUUUCA 21 2 1 2 2    0 2 0 0
ath-miR838 UUUUCUUCUACUUCUUGCACA 21 18 5 9 2    3 2 9 4
ath-miR839-5p UACCAACCUUUCAUCGUUCCC 21 31 8 15 3    3 4 9 15
ath-miR840-3p UUGUUUAGGUCCCUUAGUUUC 21 70 18 20 13    19 18 13 20
ath-miR840-5p ACACUGAAGGACCUAAACUAAC 22 372 93 123 61    61 66 122 123
ath-miR841a-3p AUUUCUAGUGGGUCGUAUUCA 21 68 17 22 14    14 16 16 22
ath-miR841a-5p UACGAGCCACUUGAAACUGAA 21 1,186 297 369 227    227 238 352 369
ath-miR841b-3p CAAUUUCUAGUGGGUCGUAUU 21 6 2 3 1    3 0 2 1
ath-miR841b-5p UACGAGCCACUGGAAACUGAA 21 30 8 13 5    5 7 13 5
ath-miR842 UCAUGGUCAGAUCCGUCAUCC 21 53 13 24 9    9 9 11 24
ath-miR843 UUUAGGUCGAGCUUCAUUGGA 21 501 125 163 88    98 88 152 163
ath-miR844-3p UUAUAAGCCAUCUUACUAGUU 21 25 6 11 2    2 11 6 6
ath-miR844-5p UGGUAAGAUUGCUUAUAAGCU 21 0 0 0 0    0 0 0 0
ath-miR845a CGGCUCUGAUACCAAUUGAUG 21 1 0 1 1    0 0 0 1
ath-miR845b UCGCUCUGAUACCAAAUUGAUG 22 0 0 0 0    0 0 0 0
ath-miR846-3p UUGAAUUGAAGUGCUUGAAUU 21 1,712 428 633 289    296 289 494 633
ath-miR846-5p CAUUCAAGGACUUCUAUUCAG 21 26 7 8 5    5 5 8 8
ath-miR847 UCACUCCUCUUCUUCUUGAUG 21 398 100 150 58    58 71 150 119
ath-miR848 UGACAUGGGACUGCCUAAGCUA 22 54 14 24 4    24 4 11 15
ath-miR849 UAACUAAACAUUGGUGUAGUA 21 2 1 2 2    2 0 0 0
ath-miR850 UAAGAUCCGGACUACAACAAAG 22 350 88 103 69    91 103 69 87
ath-miR851-3p UGGGUGGCAAACAAAGACGAC 21 0 0 0 0    0 0 0 0
ath-miR851-5p UCUCGGUUCGCGAUCCACAAG 21 1 0 1 1    0 0 0 1
ath-miR852 AAGAUAAGCGCCUUAGUUCUG 21 50 13 17 5    17 15 13 5
ath-miR853 UCCCCUCUUUAGCUUGGAGAAG 22 19 5 9 4    0 4 9 6
ath-miR854a GAUGAGGAUAGGGAGGAGGAG 21 0 0 0 0    0 0 0 0
ath-miR854b GAUGAGGAUAGGGAGGAGGAG 21 0 0 0 0    0 0 0 0
ath-miR854c GAUGAGGAUAGGGAGGAGGAG 21 0 0 0 0    0 0 0 0
ath-miR854d GAUGAGGAUAGGGAGGAGGAG 21 0 0 0 0    0 0 0 0
ath-miR854e GAUGAGGAUAGGGAGGAGGAG 21 0 0 0 0    0 0 0 0
ath-miR855 AGCAAAAGCUAAGGAAAAGGAA 22 0 0 0 0    0 0 0 0
ath-miR856 UAAUCCUACCAAUAACUUCAGC 22 0 0 0 0    0 0 0 0
ath-miR857 UUUUGUAUGUUGAAGGUGUAU 21 0 0 0 0    0 0 0 0
ath-miR858a UUUCGUUGUCUGUUCGACCUU 21 112 28 40 14    40 38 14 20
ath-miR858b UUCGUUGUCUGUUCGACCUUG 21 102 26 38 14    38 33 14 17
ath-miR859 UCUCUCUGUUGUGAAGUCAAA 21 2 1 2 2    0 2 0 0
ath-miR860 UCAAUAGAUUGGACUAUGUAU 21 52 13 18 9    12 18 13 9
ath-miR861-3p GAUGGAUAUGUCUUCAAGGAC 21 284 71 92 47    92 79 66 47
ath-miR861-5p CCUUGGAGAAAUAUGCGUCAA 21 0 0 0 0    0 0 0 0
ath-miR862-3p AUAUGCUGGAUCUACUUGAAG 21 0 0 0 0    0 0 0 0
ath-miR862-5p UCCAAUAGGUCGAGCAUGUGC 21 1 0 1 1    0 0 0 1
ath-miR863-3p UUGAGAGCAACAAGACAUAAU 21 149 37 52 26    52 26 39 32
ath-miR863-5p UUAUGUCUUGUUGAUCUCAAU 21 6 2 3 1    3 2 0 1
ath-miR864-3p UAAAGUCAAUAAUACCUUGAAG 22 3 1 2 1    0 0 2 1
ath-miR864-5p UCAGGUAUGAUUGACUUCAAA 21 6 2 5 1    5 0 0 1
ath-miR865-3p UUUUUCCUCAAAUUUAUCCAA 21 0 0 0 0    0 0 0 0
ath-miR865-5p AUGAAUUUGGAUCUAAUUGAG 21 8 2 5 1    5 0 2 1
ath-miR866-3p ACAAAAUCCGUCUUUGAAGA 20 40 10 13 7    12 7 13 8
ath-miR866-5p UCAAGGAACGGAUUUUGUUAA 21 0 0 0 0    0 0 0 0
ath-miR867 UUGAACAUGGUUUAUUAGGAA 21 0 0 0 0    0 0 0 0
ath-miR868-3p CUUCUUAAGUGCUGAUAAUGC 21 0 0 0 0    0 0 0 0
ath-miR868-5p UCAUGUCGUAAUAGUAGUCAC 21 2 1 2 2    2 0 0 0
ath-miR869.1 AUUGGUUCAAUUCUGGUGUUG 21 0 0 0 0    0 0 0 0
ath-miR869.2 UCUGGUGUUGAGAUAGUUGAC 21 78 20 27 9    24 18 9 27
ath-miR870-3p UAAUUUGGUGUUUCUUCGAUC 21 3 1 3 3    0 0 0 3
ath-miR870-5p AAGAACAUCAAAUUAGAAUGU 21 0 0 0 0    0 0 0 0