Arabidopsis Small RNA miRNA Abundances

The data below are based on the microRNAs listed in the Sanger registry. Adjust libraries/reads to display on the control panel.


        miRNA         miRNA sequence Len Sum (norm) Average Max Min (>0)  C0F1C0F2d1F1d1F2d234F1d234F2r2F1r2F2r2FSbr2FNaSbr2FNa1r2FNa2r2FLr2FDC0FCSbC0FSbr2SC1r2SHr2SNa1r2SC3r2SNa2r2SSbr2SNaSbr2SC2r2SPC0RC1C0RNiAtCMAT_LeafAt_miR1507OX_1At_miR1507OX_2At_miR2109OX_1At_miR2109OX_2At_miR2118aOX_1At_miR2118aOX_2At_miR2118bOX_1At_miR2118bOX_2At_miR2118cOX_1At_miR2118cOX_2At_miROX_controlAt_miROX_ck_2hen1-8hen1-8 ntp2-1hen1-8 urt1-1hen1-8 ntp4-1hen1-8 ntp5-1hen1-8 ntp6-1hen1-8 ntp7-1hen1-8 ntp8-1hen1-8 ntp10-1hen1-8 r2hen1-8 heso1-1hen1-8 mee44Wt_dCol_d
ath-miR10515 ACCCCGAUGGUUAUCCUCACC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR156a-3p GCUCACUGCUCUUUCUGUCAGA 22 1,171 21 321 1    1 0 0 0 0 2 3 1 12 5 2 3 0 7 1 1 49 321 10 30 41 165 20 273 29 107 64 7 2 0 0 0 1 0 0 0 0 0 0 0 0 0 1 0 0 1 2 0 0 1 0 0 0 7 2
ath-miR156a-5p UGACAGAAGAGAGUGAGCAC 20 5,237,151 95,221 828,426 142    15,905 16,805 6,125 8,564 35,365 59,030 55,888 31,016 72,236 116,623 46,656 142,220 27,069 104,393 278 8,198 612,282 429,425 563,645 742,119 828,426 481,630 681,500 5,747 74,782 1,356 2,272 10,267 35,490 205 268 165 233 171 385 200 167 245 180 251 142 432 482 863 676 1,060 4,521 702 614 503 418 754 534 6,275 1,393
ath-miR156b-3p UGCUCACCUCUCUUUCUGUCAGU 23 8,426 153 4,395 1    0 1 0 0 4 12 12 25 5 5 8 2 10 10 1 1 33 15 0 4 20 21 9 546 29 4,395 1,598 9 1,339 14 21 15 29 12 22 28 19 22 25 17 10 2 1 0 0 2 21 0 1 2 2 0 0 13 34
ath-miR156b-5p UGACAGAAGAGAGUGAGCAC 20 5,237,151 95,221 828,426 142    15,905 16,805 6,125 8,564 35,365 59,030 55,888 31,016 72,236 116,623 46,656 142,220 27,069 104,393 278 8,198 612,282 429,425 563,645 742,119 828,426 481,630 681,500 5,747 74,782 1,356 2,272 10,267 35,490 205 268 165 233 171 385 200 167 245 180 251 142 432 482 863 676 1,060 4,521 702 614 503 418 754 534 6,275 1,393
ath-miR156c-3p GCUCACUGCUCUAUCUGUCAGA 22 4,308 78 1,909 1    2 0 0 0 4 3 16 6 21 15 7 11 10 14 1 1 178 1,909 31 132 146 706 125 626 29 53 21 24 160 5 5 3 4 2 8 2 5 6 2 3 3 2 1 0 0 0 1 0 1 0 0 0 0 3 1
ath-miR156c-5p UGACAGAAGAGAGUGAGCAC 20 5,237,151 95,221 828,426 142    15,905 16,805 6,125 8,564 35,365 59,030 55,888 31,016 72,236 116,623 46,656 142,220 27,069 104,393 278 8,198 612,282 429,425 563,645 742,119 828,426 481,630 681,500 5,747 74,782 1,356 2,272 10,267 35,490 205 268 165 233 171 385 200 167 245 180 251 142 432 482 863 676 1,060 4,521 702 614 503 418 754 534 6,275 1,393
ath-miR156d-3p GCUCACUCUCUUUUUGUCAUAAC 23 298 5 173 1    0 0 0 1 0 1 0 4 1 2 0 0 0 1 0 0 1 1 0 1 0 3 1 21 0 3 3 0 173 2 4 2 3 0 6 1 2 9 1 1 1 0 0 2 2 1 12 0 2 1 2 2 1 0 24
ath-miR156d-5p UGACAGAAGAGAGUGAGCAC 20 5,237,151 95,221 828,426 142    15,905 16,805 6,125 8,564 35,365 59,030 55,888 31,016 72,236 116,623 46,656 142,220 27,069 104,393 278 8,198 612,282 429,425 563,645 742,119 828,426 481,630 681,500 5,747 74,782 1,356 2,272 10,267 35,490 205 268 165 233 171 385 200 167 245 180 251 142 432 482 863 676 1,060 4,521 702 614 503 418 754 534 6,275 1,393
ath-miR156e UGACAGAAGAGAGUGAGCAC 20 5,237,151 95,221 828,426 142    15,905 16,805 6,125 8,564 35,365 59,030 55,888 31,016 72,236 116,623 46,656 142,220 27,069 104,393 278 8,198 612,282 429,425 563,645 742,119 828,426 481,630 681,500 5,747 74,782 1,356 2,272 10,267 35,490 205 268 165 233 171 385 200 167 245 180 251 142 432 482 863 676 1,060 4,521 702 614 503 418 754 534 6,275 1,393
ath-miR156f-3p GCUCACUCUCUAUCCGUCACC 21 608 11 412 1    0 1 0 0 1 3 0 2 3 1 2 1 2 3 0 1 25 4 5 1 13 4 3 412 18 64 17 1 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 5 1 0 3 0 1 0 2 8
ath-miR156f-5p UGACAGAAGAGAGUGAGCAC 20 5,237,151 95,221 828,426 142    15,905 16,805 6,125 8,564 35,365 59,030 55,888 31,016 72,236 116,623 46,656 142,220 27,069 104,393 278 8,198 612,282 429,425 563,645 742,119 828,426 481,630 681,500 5,747 74,782 1,356 2,272 10,267 35,490 205 268 165 233 171 385 200 167 245 180 251 142 432 482 863 676 1,060 4,521 702 614 503 418 754 534 6,275 1,393
ath-miR156g CGACAGAAGAGAGUGAGCAC 20 6,898 125 1,052 1    19 12 8 8 42 62 65 35 91 147 36 206 26 181 1 10 695 888 859 685 1,052 702 615 13 215 43 68 56 29 0 0 0 0 0 0 0 0 0 0 1 0 1 3 1 0 2 9 2 2 1 0 1 1 3 2
ath-miR156h UGACAGAAGAAAGAGAGCAC 20 109,661 1,994 26,223 1    2,155 2,138 410 763 3,391 6,328 7,651 3,873 11,433 19,266 4,932 26,223 4,079 12,037 43 1,602 29 728 28 37 62 15 25 0 133 0 0 449 45 0 1 0 1 0 1 0 0 0 0 0 0 48 34 58 59 67 681 67 50 53 47 50 66 417 86
ath-miR156i UGACAGAAGAGAGAGAGCAG 20 53 1 24 1    0 2 0 0 0 1 0 0 0 0 0 0 2 0 0 0 3 24 13 1 0 2 1 0 0 0 2 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR156j UGACAGAAGAGAGAGAGCAC 20 26,842 488 7,744 1    21 126 9 21 16 211 56 79 66 166 24 136 40 89 1 6 5,091 3,778 7,744 1,981 611 1,889 1,167 59 3,274 3 17 111 27 0 1 0 1 0 1 1 0 1 1 1 1 0 0 1 0 3 6 1 0 0 0 0 0 1 3
ath-miR157a-3p GCUCUCUAGCCUUCUGUCAUC 21 55,782 1,014 23,907 1    7 16 3 16 11 61 26 249 141 62 47 51 16 50 1 6 4,923 3,849 702 706 5,448 2,278 694 10,624 37 23,907 743 806 111 6 11 5 5 5 13 2 4 21 4 14 4 2 2 0 3 2 40 1 2 2 3 3 13 11 13
ath-miR157a-5p UUGACAGAAGAUAGAGAGCAC 21 4,015,977 73,018 904,856 489    4,795 2,598 2,754 3,280 27,785 42,530 28,321 26,027 25,057 46,497 22,917 52,937 17,563 31,915 1,165 6,820 714,030 312,939 904,856 422,602 258,670 236,299 400,760 20,327 166,873 1,891 2,022 2,438 199,582 998 1,668 798 1,112 868 1,827 1,167 703 1,506 1,038 1,259 898 610 489 668 695 1,076 4,822 835 571 499 498 523 769 3,188 642
ath-miR157b-3p GCUCUCUAGCCUUCUGUCAUC 21 55,782 1,014 23,907 1    7 16 3 16 11 61 26 249 141 62 47 51 16 50 1 6 4,923 3,849 702 706 5,448 2,278 694 10,624 37 23,907 743 806 111 6 11 5 5 5 13 2 4 21 4 14 4 2 2 0 3 2 40 1 2 2 3 3 13 11 13
ath-miR157b-5p UUGACAGAAGAUAGAGAGCAC 21 4,015,977 73,018 904,856 489    4,795 2,598 2,754 3,280 27,785 42,530 28,321 26,027 25,057 46,497 22,917 52,937 17,563 31,915 1,165 6,820 714,030 312,939 904,856 422,602 258,670 236,299 400,760 20,327 166,873 1,891 2,022 2,438 199,582 998 1,668 798 1,112 868 1,827 1,167 703 1,506 1,038 1,259 898 610 489 668 695 1,076 4,822 835 571 499 498 523 769 3,188 642
ath-miR157c-3p GCUCUCUAUACUUCUGUCACC 21 5,369 98 2,014 1    0 2 0 1 1 1 4 5 6 5 4 1 3 2 0 0 13 8 5 5 25 12 8 651 14 0 0 63 2,014 93 183 113 118 99 230 63 72 289 82 42 57 64 46 54 90 80 441 50 64 44 19 18 29 1 75
ath-miR157c-5p UUGACAGAAGAUAGAGAGCAC 21 4,015,977 73,018 904,856 489    4,795 2,598 2,754 3,280 27,785 42,530 28,321 26,027 25,057 46,497 22,917 52,937 17,563 31,915 1,165 6,820 714,030 312,939 904,856 422,602 258,670 236,299 400,760 20,327 166,873 1,891 2,022 2,438 199,582 998 1,668 798 1,112 868 1,827 1,167 703 1,506 1,038 1,259 898 610 489 668 695 1,076 4,822 835 571 499 498 523 769 3,188 642
ath-miR157d UGACAGAAGAUAGAGAGCAC 20 175,931 3,199 20,482 9    685 771 144 222 2,807 4,015 3,716 2,048 5,086 6,764 3,407 9,330 1,901 5,409 20 502 20,124 20,482 18,465 16,636 16,261 8,245 14,846 130 2,973 61 43 327 8,692 81 126 43 72 38 120 75 51 95 70 65 54 13 14 19 18 26 132 24 21 13 10 9 10 519 101
ath-miR158a-3p UCCCAAAUGUAGACAAAGCA 20 4,477,818 81,415 354,930 77    11,688 94,199 95 311 27,086 134,152 88,875 203,680 126,871 199,586 76,880 354,930 90,390 195,805 77 2,112 23,726 47,394 20,801 190,027 83,005 111,538 276,197 46,507 123,115 3,583 10,438 124 325,616 10,835 16,698 9,328 17,778 10,191 17,196 17,404 9,962 15,713 11,010 18,500 16,197 69,129 55,291 56,259 71,397 103,856 348,133 73,459 71,442 77,222 152,863 99,386 118,225 77,072 64,464
ath-miR158a-5p CUUUGUCUACAAUUUUGGAAA 21 2,963 54 1,031 1    2 0 0 0 25 8 21 176 22 18 9 5 30 19 0 1 4 4 12 1 2 0 1 46 10 24 7 3 311 9 27 20 11 9 16 9 9 23 10 13 13 61 50 47 55 109 1,031 59 52 54 26 10 45 54 380
ath-miR158b CCCCAAAUGUAGACAAAGCA 20 8,733 159 827 1    27 171 1 1 41 274 138 299 258 454 88 688 80 387 1 3 32 69 37 199 142 201 259 101 270 45 106 1 152 7 5 18 19 15 17 30 2 21 11 11 11 171 174 244 228 202 827 187 181 191 418 427 217 186 388
ath-miR159a UUUGGAUUGAAGGGAGCUCUA 21 871,396 15,844 429,282 24    181 24 40 35 329 497 933 1,497 1,117 1,308 1,668 872 1,585 1,344 34 127 209 304 356 638 797 730 503 3,814 1,313 351 439 360 429,282 20,616 25,795 15,143 24,244 17,679 28,173 26,261 17,705 22,229 18,644 31,187 23,257 7,414 8,907 7,672 5,859 8,373 49,680 6,681 6,649 5,371 5,763 5,460 5,750 613 25,584
ath-miR159b-3p UUUGGAUUGAAGGGAGCUCUU 21 1,102,563 20,047 784,657 1    15 6 1 1 31 67 72 177 62 86 161 71 120 99 7 13 21 35 59 86 77 79 40 487 96 40 43 31 784,657 8,214 10,929 7,057 10,750 7,381 11,906 11,352 7,073 9,677 7,969 11,338 10,117 9,176 10,768 11,232 8,587 13,005 81,447 9,550 9,860 8,631 7,727 10,623 6,789 45 14,620
ath-miR159b-5p GAGCUCCUUGAAGUUCAAUGG 21 574 10 182 1    7 2 1 0 11 1 40 4 20 8 45 10 14 6 1 1 3 1 0 2 2 10 1 0 0 0 0 182 139 0 2 1 1 0 2 0 1 1 2 2 2 0 2 1 2 2 18 2 3 2 3 0 1 9 4
ath-miR159c UUUGGAUUGAAGGGAGCUCCU 21 546 10 153 1    0 0 0 0 0 0 0 1 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 1 153 3 5 3 5 5 4 6 2 6 4 5 2 20 25 31 16 21 99 27 14 31 14 17 20 0 4
ath-miR160a-3p GCGUAUGAGGAGCCAUGCAUA 21 83,835 1,524 13,128 1    779 81 825 354 3,271 1,363 6,635 381 12,385 5,881 8,537 3,491 13,128 6,644 75 215 1,556 1,320 740 1,266 5,996 3,474 1,811 752 195 704 754 142 16 2 2 3 1 0 2 0 2 0 2 2 1 4 2 2 3 3 42 2 5 3 0 2 3 972 4
ath-miR160a-5p UGCCUGGCUCCCUGUAUGCCA 21 36,995 673 9,364 3    57 19 15 61 127 199 331 112 638 699 204 398 134 771 0 3 43 508 16 406 238 819 385 668 10 7,592 9,364 48 969 605 746 580 942 450 800 847 442 765 492 829 743 139 102 76 111 139 665 116 99 76 78 51 83 1,621 564
ath-miR160b UGCCUGGCUCCCUGUAUGCCA 21 36,995 673 9,364 3    57 19 15 61 127 199 331 112 638 699 204 398 134 771 0 3 43 508 16 406 238 819 385 668 10 7,592 9,364 48 969 605 746 580 942 450 800 847 442 765 492 829 743 139 102 76 111 139 665 116 99 76 78 51 83 1,621 564
ath-miR160c-3p CGUACAAGGAGUCAAGCAUGA 21 4,391 80 3,219 1    6 0 0 1 16 26 20 47 79 61 13 54 10 125 1 1 15 45 21 26 51 192 56 4 25 19 94 1 3,219 2 2 1 1 0 2 1 2 2 1 1 2 5 6 4 5 8 73 1 0 2 7 3 4 25 3
ath-miR160c-5p UGCCUGGCUCCCUGUAUGCCA 21 36,995 673 9,364 3    57 19 15 61 127 199 331 112 638 699 204 398 134 771 0 3 43 508 16 406 238 819 385 668 10 7,592 9,364 48 969 605 746 580 942 450 800 847 442 765 492 829 743 139 102 76 111 139 665 116 99 76 78 51 83 1,621 564
ath-miR161.1 UGAAAGUGACUACAUCGGGGU 21 79,692 1,449 15,867 5    270 5 248 59 947 284 1,913 175 2,123 2,283 1,983 1,602 1,169 2,095 31 106 430 1,173 72 1,227 1,648 3,547 1,021 3,054 1,108 3,987 8,606 21 15,867 816 1,277 656 970 722 1,149 1,061 669 922 781 1,287 1,071 248 288 216 417 464 3,157 288 278 211 122 1,395 275 1,135 2,763
ath-miR161.2 UCAAUGCAUUGAAAGUGACUA 21 127,102 2,311 15,723 24    740 263 512 369 2,212 2,153 5,013 11,156 2,448 2,813 5,603 3,484 9,491 2,771 24 102 597 1,886 252 1,483 873 1,275 2,612 11,506 15,723 2,386 4,759 55 12,375 271 422 270 304 205 417 356 266 304 232 284 322 580 618 646 550 714 2,707 652 517 520 579 575 553 9,080 222
ath-miR162a-3p UCGAUAAACCUCUGCAUCCAG 21 180,620 3,284 48,171 11    203 572 29 37 474 887 1,257 485 2,081 2,933 3,170 3,079 2,436 2,015 11 81 304 367 189 927 1,404 1,170 693 2,037 2,664 43 512 745 6,029 192 254 164 258 171 234 239 165 245 206 243 221 8,263 8,627 7,282 8,291 9,875 48,171 8,394 7,512 8,228 8,275 5,144 9,297 1,842 1,993
ath-miR162a-5p UGGAGGCAGCGGUUCAUCGAUC 22 1,443 26 168 1    17 2 5 9 76 103 89 62 87 84 106 42 65 168 14 16 29 18 1 31 51 57 43 21 66 34 25 5 25 1 2 1 3 0 4 4 1 3 3 1 1 1 2 2 2 5 20 0 2 0 0 0 0 28 6
ath-miR162b-3p UCGAUAAACCUCUGCAUCCAG 21 180,620 3,284 48,171 11    203 572 29 37 474 887 1,257 485 2,081 2,933 3,170 3,079 2,436 2,015 11 81 304 367 189 927 1,404 1,170 693 2,037 2,664 43 512 745 6,029 192 254 164 258 171 234 239 165 245 206 243 221 8,263 8,627 7,282 8,291 9,875 48,171 8,394 7,512 8,228 8,275 5,144 9,297 1,842 1,993
ath-miR162b-5p UGGAGGCAGCGGUUCAUCGAUC 22 1,443 26 168 1    17 2 5 9 76 103 89 62 87 84 106 42 65 168 14 16 29 18 1 31 51 57 43 21 66 34 25 5 25 1 2 1 3 0 4 4 1 3 3 1 1 1 2 2 2 5 20 0 2 0 0 0 0 28 6
ath-miR163 UUGAAGAGGACUUGGAACUUCGAU 24 66,068 1,201 7,731 1    120 51 1 1 203 209 709 2,196 524 506 1,133 297 2,044 648 115 73 41 69 142 163 128 57 181 248 244 78 94 205 5,109 2,470 1,837 1,727 3,704 2,152 2,109 2,639 2,322 3,420 3,100 3,727 1,987 491 573 1,659 694 1,175 7,731 551 686 537 889 756 632 185 2,726
ath-miR164a UGGAGAAGCAGGGCACGUGCA 21 120,726 2,195 13,949 5    802 825 314 346 6,448 5,939 4,912 2,202 9,203 11,170 1,465 11,142 2,663 13,949 91 673 4,019 9,843 1,016 3,861 8,580 10,180 3,592 92 1,132 508 480 430 1,512 22 56 24 27 26 58 51 29 31 35 36 60 8 7 10 11 11 79 5 6 17 0 5 6 2,617 100
ath-miR164b-3p CAUGUGCCCAUCUUCACCAUC 21 1,274 23 591 1    0 1 0 0 0 3 3 3 4 2 7 3 2 6 0 0 1 1 0 6 0 12 2 4 0 5 12 1 14 5 12 10 3 8 13 5 11 8 3 7 7 32 34 27 42 68 591 48 45 28 33 27 49 11 55
ath-miR164b-5p UGGAGAAGCAGGGCACGUGCA 21 120,726 2,195 13,949 5    802 825 314 346 6,448 5,939 4,912 2,202 9,203 11,170 1,465 11,142 2,663 13,949 91 673 4,019 9,843 1,016 3,861 8,580 10,180 3,592 92 1,132 508 480 430 1,512 22 56 24 27 26 58 51 29 31 35 36 60 8 7 10 11 11 79 5 6 17 0 5 6 2,617 100
ath-miR164c-3p CACGUGUUCUACUACUCCAAC 21 330 6 85 1    0 0 0 0 1 1 1 1 10 11 1 11 0 12 0 0 3 0 1 4 4 9 10 29 0 0 0 2 14 7 4 1 5 2 1 3 1 4 2 2 0 6 4 3 12 12 85 8 5 8 7 2 7 12 2
ath-miR164c-5p UGGAGAAGCAGGGCACGUGCG 21 8,332 151 1,509 1    31 22 24 31 131 192 216 60 296 422 95 448 75 844 4 24 549 904 77 432 873 1,509 416 13 250 8 2 18 158 1 2 1 2 1 2 1 1 2 2 1 0 0 1 0 0 2 7 1 0 0 0 0 0 178 3
ath-miR165a-3p UCGGACCAGGCUUCAUCCCCC 21 1,079,928 19,635 189,699 277    4,799 2,133 2,315 4,245 17,492 17,903 26,735 47,083 24,624 18,623 41,162 11,221 17,610 20,587 277 2,186 4,253 4,130 468 16,186 14,202 7,365 10,878 82,608 63,061 36,365 93,171 8,488 13,152 7,021 13,398 6,500 12,207 7,590 13,126 14,249 8,386 9,040 8,379 13,336 12,859 4,646 3,286 3,665 3,964 5,562 30,231 4,265 5,685 6,016 4,379 13,136 3,895 62,086 189,699
ath-miR165a-5p GGAAUGUUGUCUGGAUCGAGG 21 7,739 141 1,453 1    29 0 11 11 34 59 128 64 98 69 149 160 47 200 12 11 21 4 1 128 132 386 52 1,285 53 150 368 40 1,054 7 16 14 10 7 14 11 14 12 6 18 25 160 139 89 150 190 1,453 84 143 138 49 53 84 19 78
ath-miR165b UCGGACCAGGCUUCAUCCCCC 21 1,079,928 19,635 189,699 277    4,799 2,133 2,315 4,245 17,492 17,903 26,735 47,083 24,624 18,623 41,162 11,221 17,610 20,587 277 2,186 4,253 4,130 468 16,186 14,202 7,365 10,878 82,608 63,061 36,365 93,171 8,488 13,152 7,021 13,398 6,500 12,207 7,590 13,126 14,249 8,386 9,040 8,379 13,336 12,859 4,646 3,286 3,665 3,964 5,562 30,231 4,265 5,685 6,016 4,379 13,136 3,895 62,086 189,699
ath-miR166a-3p UCGGACCAGGCUUCAUUCCCC 21 5,461,167 99,294 919,007 1,501    19,413 12,655 1,833 5,669 64,962 112,973 89,653 360,067 121,691 152,527 127,907 92,609 47,709 165,445 1,845 12,131 18,723 12,751 1,501 56,509 48,933 47,185 36,710 919,007 539,399 126,201 239,799 15,505 85,893 41,520 56,002 27,038 60,977 31,254 58,536 53,339 28,750 53,315 40,088 70,892 41,963 31,440 22,510 26,212 31,379 40,125 239,880 30,597 42,038 40,016 40,070 61,982 38,615 143,793 571,631
ath-miR166a-5p GGACUGUUGUCUGGCUCGAGG 21 60,888 1,107 19,215 3    89 19 7 8 138 123 530 215 1,434 490 983 727 1,024 1,287 58 88 74 109 3 98 1,014 1,662 237 55 203 94 33 348 12,268 139 200 121 156 107 218 101 106 254 106 113 105 1,216 1,116 1,475 1,436 2,946 19,215 1,236 1,320 1,509 920 770 1,771 43 771
ath-miR166b-3p UCGGACCAGGCUUCAUUCCCC 21 5,461,167 99,294 919,007 1,501    19,413 12,655 1,833 5,669 64,962 112,973 89,653 360,067 121,691 152,527 127,907 92,609 47,709 165,445 1,845 12,131 18,723 12,751 1,501 56,509 48,933 47,185 36,710 919,007 539,399 126,201 239,799 15,505 85,893 41,520 56,002 27,038 60,977 31,254 58,536 53,339 28,750 53,315 40,088 70,892 41,963 31,440 22,510 26,212 31,379 40,125 239,880 30,597 42,038 40,016 40,070 61,982 38,615 143,793 571,631
ath-miR166b-5p GGACUGUUGUCUGGCUCGAGG 21 60,888 1,107 19,215 3    89 19 7 8 138 123 530 215 1,434 490 983 727 1,024 1,287 58 88 74 109 3 98 1,014 1,662 237 55 203 94 33 348 12,268 139 200 121 156 107 218 101 106 254 106 113 105 1,216 1,116 1,475 1,436 2,946 19,215 1,236 1,320 1,509 920 770 1,771 43 771
ath-miR166c UCGGACCAGGCUUCAUUCCCC 21 5,461,167 99,294 919,007 1,501    19,413 12,655 1,833 5,669 64,962 112,973 89,653 360,067 121,691 152,527 127,907 92,609 47,709 165,445 1,845 12,131 18,723 12,751 1,501 56,509 48,933 47,185 36,710 919,007 539,399 126,201 239,799 15,505 85,893 41,520 56,002 27,038 60,977 31,254 58,536 53,339 28,750 53,315 40,088 70,892 41,963 31,440 22,510 26,212 31,379 40,125 239,880 30,597 42,038 40,016 40,070 61,982 38,615 143,793 571,631
ath-miR166d UCGGACCAGGCUUCAUUCCCC 21 5,461,167 99,294 919,007 1,501    19,413 12,655 1,833 5,669 64,962 112,973 89,653 360,067 121,691 152,527 127,907 92,609 47,709 165,445 1,845 12,131 18,723 12,751 1,501 56,509 48,933 47,185 36,710 919,007 539,399 126,201 239,799 15,505 85,893 41,520 56,002 27,038 60,977 31,254 58,536 53,339 28,750 53,315 40,088 70,892 41,963 31,440 22,510 26,212 31,379 40,125 239,880 30,597 42,038 40,016 40,070 61,982 38,615 143,793 571,631
ath-miR166e-3p UCGGACCAGGCUUCAUUCCCC 21 5,461,167 99,294 919,007 1,501    19,413 12,655 1,833 5,669 64,962 112,973 89,653 360,067 121,691 152,527 127,907 92,609 47,709 165,445 1,845 12,131 18,723 12,751 1,501 56,509 48,933 47,185 36,710 919,007 539,399 126,201 239,799 15,505 85,893 41,520 56,002 27,038 60,977 31,254 58,536 53,339 28,750 53,315 40,088 70,892 41,963 31,440 22,510 26,212 31,379 40,125 239,880 30,597 42,038 40,016 40,070 61,982 38,615 143,793 571,631
ath-miR166e-5p GGAAUGUUGUCUGGCACGAGG 21 8,946 163 5,538 1    24 1 4 4 20 36 150 13 194 87 185 107 253 194 6 7 76 30 21 179 486 744 178 34 35 2 7 18 5,538 13 10 4 7 8 9 7 6 18 8 6 2 8 5 10 11 8 129 8 3 10 3 1 3 13 3
ath-miR166f UCGGACCAGGCUUCAUUCCCC 21 5,461,167 99,294 919,007 1,501    19,413 12,655 1,833 5,669 64,962 112,973 89,653 360,067 121,691 152,527 127,907 92,609 47,709 165,445 1,845 12,131 18,723 12,751 1,501 56,509 48,933 47,185 36,710 919,007 539,399 126,201 239,799 15,505 85,893 41,520 56,002 27,038 60,977 31,254 58,536 53,339 28,750 53,315 40,088 70,892 41,963 31,440 22,510 26,212 31,379 40,125 239,880 30,597 42,038 40,016 40,070 61,982 38,615 143,793 571,631
ath-miR166g UCGGACCAGGCUUCAUUCCCC 21 5,461,167 99,294 919,007 1,501    19,413 12,655 1,833 5,669 64,962 112,973 89,653 360,067 121,691 152,527 127,907 92,609 47,709 165,445 1,845 12,131 18,723 12,751 1,501 56,509 48,933 47,185 36,710 919,007 539,399 126,201 239,799 15,505 85,893 41,520 56,002 27,038 60,977 31,254 58,536 53,339 28,750 53,315 40,088 70,892 41,963 31,440 22,510 26,212 31,379 40,125 239,880 30,597 42,038 40,016 40,070 61,982 38,615 143,793 571,631
ath-miR167a-3p GAUCAUGUUCGCAGUUUCACC 21 43,065 783 7,697 1    13 3 0 0 55 46 53 17 75 31 33 16 47 25 1 13 52 13 6 21 87 229 19 1,235 172 237 234 1 1,804 3,531 3,150 2,656 3,536 1,702 4,412 1,410 1,597 7,697 1,743 1,304 1,065 119 87 113 110 169 1,265 99 108 123 52 69 98 49 2,263
ath-miR167a-5p UGAAGCUGCCAGCAUGAUCUA 21 4,694,392 85,353 574,758 210    43,630 8,846 242 424 162,228 106,581 226,773 14,021 341,073 378,360 147,514 378,435 100,448 284,042 2,515 21,826 117,983 286,964 10,075 120,919 191,808 574,758 154,226 117,361 192,100 33,733 45,503 2,264 500,413 1,220 1,510 839 1,689 960 1,787 1,505 786 1,523 1,269 1,834 1,268 282 291 352 351 424 2,438 415 292 210 351 273 394 105,928 1,136
ath-miR167b UGAAGCUGCCAGCAUGAUCUA 21 4,694,392 85,353 574,758 210    43,630 8,846 242 424 162,228 106,581 226,773 14,021 341,073 378,360 147,514 378,435 100,448 284,042 2,515 21,826 117,983 286,964 10,075 120,919 191,808 574,758 154,226 117,361 192,100 33,733 45,503 2,264 500,413 1,220 1,510 839 1,689 960 1,787 1,505 786 1,523 1,269 1,834 1,268 282 291 352 351 424 2,438 415 292 210 351 273 394 105,928 1,136
ath-miR167c-3p UAGGUCAUGCUGGUAGUUUCACC 23 4,089 74 3,642 1    1 1 0 0 0 1 1 2 2 3 0 1 2 1 0 0 2 1 0 3 10 1 0 13 78 3,642 239 0 27 3 2 2 6 2 4 2 4 6 5 4 1 1 2 0 0 1 6 2 1 1 0 1 0 0 2
ath-miR167c-5p UAAGCUGCCAGCAUGAUCUUG 21 2,695 49 855 1    1 0 0 0 1 1 0 0 4 7 3 3 2 4 0 1 10 7 1 23 49 59 22 76 698 855 812 1 19 1 1 0 1 1 1 1 1 1 1 1 0 1 1 5 4 2 5 0 2 2 0 2 0 1 1
ath-miR167d UGAAGCUGCCAGCAUGAUCUGG 22 63,256 1,150 35,500 1    33 1 1 1 75 9 324 8 348 180 61 91 145 239 1 6 1,030 9,714 186 1,209 854 3,337 1,747 155 47 53 125 897 35,500 507 488 605 741 495 670 549 381 575 463 442 503 4 6 12 3 9 31 8 2 3 16 46 10 253 57
ath-miR168a-3p CCCGCCUUGCAUCAACUGAAU 21 16,192 294 3,965 1    43 35 45 44 316 411 290 243 346 352 436 208 223 276 1 10 270 78 287 119 359 647 591 332 203 75 294 12 1,148 149 135 160 217 110 303 81 69 395 74 50 63 112 81 215 148 283 3,965 93 130 128 129 81 221 150 956
ath-miR168a-5p UCGCUUGGUGCAGGUCGGGAA 21 894,071 16,256 274,767 34    9,390 852 6,801 7,045 43,862 29,850 51,120 6,278 29,334 27,492 43,534 27,782 20,146 34,054 442 2,359 25,878 13,633 2,225 26,030 47,507 24,076 26,554 22,625 34,575 6,230 17,030 34 274,767 354 412 377 510 388 612 451 313 683 302 367 433 463 587 573 495 825 5,994 422 444 393 461 283 508 12,456 3,460
ath-miR168b-3p CCCGUCUUGUAUCAACUGAAU 21 767 14 201 1    1 3 0 0 0 1 0 1 1 1 0 0 0 0 0 0 0 0 0 2 0 4 1 4 4 2 2 0 178 10 9 7 10 5 11 4 7 25 4 2 2 16 20 38 14 32 201 17 19 20 37 19 17 0 16
ath-miR168b-5p UCGCUUGGUGCAGGUCGGGAA 21 894,071 16,256 274,767 34    9,390 852 6,801 7,045 43,862 29,850 51,120 6,278 29,334 27,492 43,534 27,782 20,146 34,054 442 2,359 25,878 13,633 2,225 26,030 47,507 24,076 26,554 22,625 34,575 6,230 17,030 34 274,767 354 412 377 510 388 612 451 313 683 302 367 433 463 587 573 495 825 5,994 422 444 393 461 283 508 12,456 3,460
ath-miR169a-3p GGCAAGUUGUCCUUGGCUAC 20 2,076 38 1,167 1    5 0 1 0 11 3 30 12 17 14 49 4 51 49 0 1 6 1,167 0 10 49 154 58 34 29 42 38 100 11 8 5 2 4 4 7 1 3 8 3 2 2 7 0 6 2 4 18 3 2 5 5 4 6 19 1
ath-miR169a-5p CAGCCAAGGAUGACUUGCCGA 21 46,634 848 5,919 1    230 1 16 2 1,231 139 2,486 599 576 777 5,349 340 2,045 1,993 25 83 531 5,919 190 641 1,542 1,577 2,170 899 522 2,944 2,435 5,911 2,827 35 56 47 35 27 52 45 37 48 24 16 24 3 2 2 1 2 7 1 2 1 0 1 1 2,161 4
ath-miR169b-3p GGCAAGUUGUCCUUCGGCUACA 22 2,889 53 2,647 1    1 0 0 0 1 6 2 4 27 4 1 2 3 4 1 1 7 39 0 2 13 18 0 25 4 30 43 1 2,647 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1
ath-miR169b-5p CAGCCAAGGAUGACUUGCCGG 21 13,114 238 9,952 1    17 0 3 1 209 22 135 37 284 168 235 105 129 123 2 17 94 526 9 34 148 142 93 29 16 136 191 152 9,952 0 0 0 1 0 0 1 0 0 0 0 0 0 1 0 1 0 3 0 2 0 0 1 0 94 1
ath-miR169c CAGCCAAGGAUGACUUGCCGG 21 13,114 238 9,952 1    17 0 3 1 209 22 135 37 284 168 235 105 129 123 2 17 94 526 9 34 148 142 93 29 16 136 191 152 9,952 0 0 0 1 0 0 1 0 0 0 0 0 0 1 0 1 0 3 0 2 0 0 1 0 94 1
ath-miR169d UGAGCCAAGGAUGACUUGCCG 21 136,722 2,486 64,009 1    794 8 470 51 7,481 194 6,040 2,452 4,490 4,082 12,599 4,477 4,670 8,640 249 960 178 6,477 12 148 872 622 472 298 2,052 440 629 64,009 22 11 12 5 7 4 15 5 11 10 7 7 7 0 0 0 0 3 7 1 1 1 3 10 1 2,704 2
ath-miR169e UGAGCCAAGGAUGACUUGCCG 21 136,722 2,486 64,009 1    794 8 470 51 7,481 194 6,040 2,452 4,490 4,082 12,599 4,477 4,670 8,640 249 960 178 6,477 12 148 872 622 472 298 2,052 440 629 64,009 22 11 12 5 7 4 15 5 11 10 7 7 7 0 0 0 0 3 7 1 1 1 3 10 1 2,704 2
ath-miR169f-3p GCAAGUUGACCUUGGCUCUGC 21 1,521 28 395 1    4 0 1 1 1 2 6 39 5 12 39 3 68 15 0 1 5 6 0 16 31 13 10 395 137 56 5 223 225 7 11 14 6 8 13 6 7 13 4 11 13 1 9 5 3 4 25 1 7 2 9 9 6 5 3
ath-miR169f-5p UGAGCCAAGGAUGACUUGCCG 21 136,722 2,486 64,009 1    794 8 470 51 7,481 194 6,040 2,452 4,490 4,082 12,599 4,477 4,670 8,640 249 960 178 6,477 12 148 872 622 472 298 2,052 440 629 64,009 22 11 12 5 7 4 15 5 11 10 7 7 7 0 0 0 0 3 7 1 1 1 3 10 1 2,704 2
ath-miR169g-3p UCCGGCAAGUUGACCUUGGCU 21 16 0 8 1    0 0 0 0 0 0 2 0 0 0 1 0 2 0 0 1 2 0 0 0 0 0 0 0 0 0 0 8 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR169g-5p UGAGCCAAGGAUGACUUGCCG 21 136,722 2,486 64,009 1    794 8 470 51 7,481 194 6,040 2,452 4,490 4,082 12,599 4,477 4,670 8,640 249 960 178 6,477 12 148 872 622 472 298 2,052 440 629 64,009 22 11 12 5 7 4 15 5 11 10 7 7 7 0 0 0 0 3 7 1 1 1 3 10 1 2,704 2
ath-miR169h UAGCCAAGGAUGACUUGCCUG 21 37,320 679 20,676 1    88 0 8 1 152 15 933 142 265 351 3,047 81 2,499 862 6 28 64 1,285 12 113 358 277 284 2,205 524 506 1,103 20,676 22 77 98 68 69 62 94 57 73 85 56 28 39 0 2 1 2 1 1 0 1 1 7 3 4 583 1
ath-miR169i UAGCCAAGGAUGACUUGCCUG 21 37,320 679 20,676 1    88 0 8 1 152 15 933 142 265 351 3,047 81 2,499 862 6 28 64 1,285 12 113 358 277 284 2,205 524 506 1,103 20,676 22 77 98 68 69 62 94 57 73 85 56 28 39 0 2 1 2 1 1 0 1 1 7 3 4 583 1
ath-miR169j UAGCCAAGGAUGACUUGCCUG 21 37,320 679 20,676 1    88 0 8 1 152 15 933 142 265 351 3,047 81 2,499 862 6 28 64 1,285 12 113 358 277 284 2,205 524 506 1,103 20,676 22 77 98 68 69 62 94 57 73 85 56 28 39 0 2 1 2 1 1 0 1 1 7 3 4 583 1
ath-miR169k UAGCCAAGGAUGACUUGCCUG 21 37,320 679 20,676 1    88 0 8 1 152 15 933 142 265 351 3,047 81 2,499 862 6 28 64 1,285 12 113 358 277 284 2,205 524 506 1,103 20,676 22 77 98 68 69 62 94 57 73 85 56 28 39 0 2 1 2 1 1 0 1 1 7 3 4 583 1
ath-miR169l UAGCCAAGGAUGACUUGCCUG 21 37,320 679 20,676 1    88 0 8 1 152 15 933 142 265 351 3,047 81 2,499 862 6 28 64 1,285 12 113 358 277 284 2,205 524 506 1,103 20,676 22 77 98 68 69 62 94 57 73 85 56 28 39 0 2 1 2 1 1 0 1 1 7 3 4 583 1
ath-miR169m UAGCCAAGGAUGACUUGCCUG 21 37,320 679 20,676 1    88 0 8 1 152 15 933 142 265 351 3,047 81 2,499 862 6 28 64 1,285 12 113 358 277 284 2,205 524 506 1,103 20,676 22 77 98 68 69 62 94 57 73 85 56 28 39 0 2 1 2 1 1 0 1 1 7 3 4 583 1
ath-miR169n UAGCCAAGGAUGACUUGCCUG 21 37,320 679 20,676 1    88 0 8 1 152 15 933 142 265 351 3,047 81 2,499 862 6 28 64 1,285 12 113 358 277 284 2,205 524 506 1,103 20,676 22 77 98 68 69 62 94 57 73 85 56 28 39 0 2 1 2 1 1 0 1 1 7 3 4 583 1
ath-miR170-3p UGAUUGAGCCGUGUCAAUAUC 21 2,722 49 487 1    21 2 1 0 4 3 125 8 127 78 46 53 133 93 3 7 6 111 0 22 25 75 51 323 487 35 17 6 70 5 4 4 7 6 6 6 3 8 6 7 7 17 10 55 27 23 171 26 22 14 42 15 20 261 18
ath-miR170-5p UAUUGGCCUGGUUCACUCAGA 21 6,430 117 2,187 1    6 0 1 0 3 3 16 42 69 69 24 85 16 33 1 5 7 0 2 13 11 20 8 126 18 0 2 16 1,429 5 5 3 5 7 6 6 5 9 3 4 10 135 163 155 160 288 2,187 164 173 164 144 73 172 92 267
ath-miR171a-3p UGAUUGAGCCGCGCCAAUAUC 21 61,958 1,127 15,869 3    528 27 27 16 1,178 312 3,059 97 3,045 1,949 4,189 749 2,407 2,103 20 160 122 618 22 483 883 1,197 765 1,445 15,869 8 3 614 422 40 88 40 60 46 60 83 59 48 48 84 99 134 102 474 166 240 1,547 178 174 124 132 114 121 14,917 463
ath-miR171a-5p UAUUGGCCUGGUUCACUCAGA 21 6,430 117 2,187 1    6 0 1 0 3 3 16 42 69 69 24 85 16 33 1 5 7 0 2 13 11 20 8 126 18 0 2 16 1,429 5 5 3 5 7 6 6 5 9 3 4 10 135 163 155 160 288 2,187 164 173 164 144 73 172 92 267
ath-miR171b-3p UUGAGCCGUGCCAAUAUCACG 21 3,818 69 1,098 1    5 2 3 3 11 20 38 16 90 127 89 85 63 123 1 1 4 9 0 20 8 10 60 8 2 27 46 76 1,098 5 11 9 13 12 19 10 9 12 11 12 19 48 41 58 58 103 513 53 64 49 115 133 77 214 105
ath-miR171b-5p AGAUAUUAGUGCGGUUCAAUC 21 28,235 513 12,469 4    58 4 91 45 182 350 983 1,183 446 272 497 420 489 344 6 16 241 974 149 131 177 442 56 1,264 993 56 30 0 27 30 27 17 22 12 29 16 16 24 16 11 18 330 287 465 617 1,238 12,469 481 390 367 466 261 521 49 130
ath-miR171c-3p UUGAGCCGUGCCAAUAUCACG 21 3,818 69 1,098 1    5 2 3 3 11 20 38 16 90 127 89 85 63 123 1 1 4 9 0 20 8 10 60 8 2 27 46 76 1,098 5 11 9 13 12 19 10 9 12 11 12 19 48 41 58 58 103 513 53 64 49 115 133 77 214 105
ath-miR171c-5p AGAUAUUGGUGCGGUUCAAUC 21 8,408 153 1,525 1    33 1 86 36 205 103 302 400 280 288 287 459 309 304 2 14 167 791 65 101 139 390 132 151 371 170 150 0 19 24 16 13 17 17 20 16 9 25 15 15 14 50 44 47 110 95 1,525 76 64 34 94 66 131 67 49
ath-miR172a AGAAUCUUGAUGAUGCUGCAU 21 3,143,724 57,159 675,732 25    40,703 1,296 2,755 104 273,692 27,288 310,178 89,387 263,102 119,619 527,325 77,493 675,732 250,527 2,592 10,670 12,613 52,345 4,845 6,137 11,311 7,686 15,413 3,130 1,919 36,554 23,011 246,997 870 76 85 74 112 66 91 108 69 113 74 114 100 26 27 25 28 51 151 32 25 25 31 34 36 46,764 93
ath-miR172b-3p AGAAUCUUGAUGAUGCUGCAU 21 3,143,724 57,159 675,732 25    40,703 1,296 2,755 104 273,692 27,288 310,178 89,387 263,102 119,619 527,325 77,493 675,732 250,527 2,592 10,670 12,613 52,345 4,845 6,137 11,311 7,686 15,413 3,130 1,919 36,554 23,011 246,997 870 76 85 74 112 66 91 108 69 113 74 114 100 26 27 25 28 51 151 32 25 25 31 34 36 46,764 93
ath-miR172b-5p GCAGCACCAUUAAGAUUCAC 20 1,444 26 393 1    5 11 2 1 16 127 23 4 37 34 40 12 126 44 0 1 5 19 5 12 10 26 23 29 6 6 0 1 393 22 17 13 15 15 23 10 7 32 10 11 4 11 6 11 16 9 54 10 11 10 19 3 29 4 54
ath-miR172c AGAAUCUUGAUGAUGCUGCAG 21 250,400 4,553 40,875 1    5,818 39 1,832 98 15,759 1,297 40,875 7,671 34,931 15,260 33,055 9,471 39,140 17,993 377 1,299 65 1,167 36 38 72 95 89 25 41 2,696 3,326 5,713 0 0 0 1 0 0 0 0 0 1 1 0 0 28 26 32 27 43 289 23 27 24 40 96 32 11,384 48
ath-miR172d-3p AGAAUCUUGAUGAUGCUGCAG 21 250,400 4,553 40,875 1    5,818 39 1,832 98 15,759 1,297 40,875 7,671 34,931 15,260 33,055 9,471 39,140 17,993 377 1,299 65 1,167 36 38 72 95 89 25 41 2,696 3,326 5,713 0 0 0 1 0 0 0 0 0 1 1 0 0 28 26 32 27 43 289 23 27 24 40 96 32 11,384 48
ath-miR172d-5p GCAACAUCUUCAAGAUUCAGA 21 240 4 30 1    2 1 2 2 4 21 18 22 13 9 13 10 30 4 0 1 1 1 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 3 2 1 5 12 5 5 2 7 3 12 1 25
ath-miR172e-3p GGAAUCUUGAUGAUGCUGCAU 21 60,289 1,096 8,775 1    583 12 72 6 2,348 88 3,304 749 8,378 2,660 3,495 2,047 6,632 2,524 91 279 42 447 26 72 184 170 177 172 1,112 8,775 7,630 6,458 12 2 1 0 1 2 0 0 1 2 2 2 1 0 1 0 0 1 14 0 1 0 0 2 0 1,705 6
ath-miR172e-5p GCAGCACCAUUAAGAUUCAC 20 1,444 26 393 1    5 11 2 1 16 127 23 4 37 34 40 12 126 44 0 1 5 19 5 12 10 26 23 29 6 6 0 1 393 22 17 13 15 15 23 10 7 32 10 11 4 11 6 11 16 9 54 10 11 10 19 3 29 4 54
ath-miR173-3p UGAUUCUCUGUGUAAGCGAAA 21 4,640 84 457 1    57 2 1 1 168 56 389 101 285 160 315 213 457 223 8 27 83 406 31 51 35 83 50 311 31 432 388 5 67 1 1 0 1 0 2 1 0 1 0 0 1 0 0 0 2 2 7 1 0 0 0 1 0 180 3
ath-miR173-5p UUCGCUUGCAGAGAGAAAUCAC 22 366,997 6,673 49,721 2    7,294 72 17 2 17,601 4,470 49,721 15,797 20,681 14,064 41,482 10,508 28,000 9,952 2,576 4,628 21,530 25,448 8,853 5,344 4,432 8,008 10,260 5,852 17,255 6,345 15,358 1,400 1,086 20 34 23 53 37 29 58 32 43 34 60 50 73 60 165 65 107 677 79 62 57 82 57 73 6,829 102
ath-miR1886.1 UGAGAGAAGUGAGAUGAAAUC 21 187 3 32 1    1 0 0 0 0 4 4 9 12 11 2 9 2 12 0 1 1 6 0 8 3 2 3 0 23 0 0 0 6 0 1 1 1 1 2 0 0 1 1 1 1 0 0 2 1 6 32 5 2 2 2 0 0 1 5
ath-miR1886.2 UGAGAUGAAAUCUUUGAUUGG 21 6,536 119 1,019 2    43 2 26 16 130 93 255 88 118 90 207 124 213 123 7 14 27 47 9 61 13 18 67 25 0 51 64 13 783 16 26 20 24 19 33 21 18 29 18 32 17 170 224 265 184 337 1,019 219 163 181 217 152 143 175 87
ath-miR1886.3 AAUUAAAGAUUUCAUCUUACU 21 217 4 54 1    0 1 2 2 3 3 5 54 2 2 10 2 28 3 1 0 1 8 0 0 1 2 1 0 0 13 3 3 5 5 2 0 2 1 2 2 3 1 0 1 2 1 2 2 1 1 18 0 0 2 0 0 0 13 1
ath-miR1887 UACUAAGUAGAGUCUAAGAGA 21 124 2 47 1    1 1 0 0 3 47 5 17 1 3 1 3 2 2 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 4 2 16 1 2 1 3 1 1 1 2
ath-miR1888a UAAGUUAAGAUUUGUGAAGAA 21 2,999 55 2,346 1    1 1 2 2 4 20 15 178 16 8 2 9 3 15 0 1 3 31 3 3 2 2 1 38 37 0 0 0 2,346 4 4 7 3 5 9 5 3 6 8 4 7 6 9 7 13 18 49 5 5 9 19 2 25 19 5
ath-miR1888b UUAGGCUAAGAUUUGUGAAGA 21 67 1 9 1    1 0 1 0 3 5 2 8 2 2 3 2 0 4 1 1 0 0 0 1 0 0 1 0 2 2 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 2 2 2 0 3 9 0 0 2 0 0 1 3 1
ath-miR2111a-3p GUCCUCGGGAUGCGGAUUACC 21 28,831 524 27,228 1    6 4 1 0 25 17 84 7 115 52 71 97 31 107 1 1 35 14 5 42 171 322 100 101 27,228 46 64 1 0 0 0 0 0 0 0 0 0 0 0 0 0 7 2 5 4 5 33 1 2 5 2 0 10 5 2
ath-miR2111a-5p UAAUCUGCAUCCUGAGGUUUA 21 3,117 57 1,739 1    2 3 1 0 7 18 32 10 36 19 27 21 16 59 1 1 12 15 2 25 56 153 63 105 1,739 482 162 4 0 1 0 0 2 0 0 0 0 0 0 0 1 0 1 0 0 0 16 2 1 0 0 0 0 16 6
ath-miR2111b-3p AUCCUCGGGAUACAGUUUACC 21 2,574 47 1,364 1    1 3 0 0 11 21 26 69 57 63 13 103 10 114 0 1 42 55 21 48 43 215 67 122 1,364 48 12 0 2 0 0 0 1 1 0 0 0 1 0 1 0 0 0 0 0 0 13 0 2 0 3 1 0 19 1
ath-miR2111b-5p UAAUCUGCAUCCUGAGGUUUA 21 3,117 57 1,739 1    2 3 1 0 7 18 32 10 36 19 27 21 16 59 1 1 12 15 2 25 56 153 63 105 1,739 482 162 4 0 1 0 0 2 0 0 0 0 0 0 0 1 0 1 0 0 0 16 2 1 0 0 0 0 16 6
ath-miR2112-3p CUUUAUAUCCGCAUUUGCGCA 21 478 9 98 1    2 0 1 0 6 8 13 61 19 20 23 18 12 9 0 0 2 26 4 3 3 3 7 0 0 45 13 1 29 0 1 0 0 1 0 0 0 2 0 1 2 4 2 5 4 4 13 1 1 0 5 4 0 98 2
ath-miR2112-5p CGCAAAUGCGGAUAUCAAUGU 21 366 7 83 1    2 0 0 1 3 3 15 6 7 9 11 13 3 5 0 1 2 0 0 1 2 2 3 0 4 0 0 1 57 1 1 1 1 0 0 1 1 0 1 0 2 15 14 5 10 26 83 8 5 5 7 8 10 9 1
ath-miR2933a GAAAUCGGAGAGGAAAUUCGCC 22 18 0 3 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 1 0 0 0 2 2 2 0 3 0 2 1 1 0 2 1 0 0
ath-miR2933b GAAAUCGGAGAGGAAAUUCGCC 22 18 0 3 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 1 0 0 0 2 2 2 0 3 0 2 1 1 0 2 1 0 0
ath-miR2934-3p CAUCCAAGGUGUUUGUAGAAA 21 162 3 24 1    6 0 0 0 1 3 24 8 22 14 16 9 17 9 1 2 0 0 0 0 1 1 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 2 1 1 20 2
ath-miR2934-5p UCUUUCUGCAAACGCCUUGGA 21 140 3 72 1    1 1 0 0 0 2 0 1 0 4 0 2 0 1 0 0 0 0 0 0 0 1 0 0 0 0 0 0 4 0 1 0 1 0 1 1 0 0 0 0 0 4 4 0 3 3 13 3 2 2 2 6 3 2 72
ath-miR2936 CUUGAGAGAGAGAACACAGACG 22 10 0 2 1    0 0 0 0 0 0 0 0 1 2 0 2 0 1 0 0 0 0 0 1 1 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR2937 AUAAGAGCUGUUGAAGGAGUC 21 2 0 1 1    0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0
ath-miR2938 GAUCUUUUGAGAGGGUUCCAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR2939 UAACGCACAACACUAAGCCAU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR319a UUGGACUGAAGGGAGCUCCCU 21 297,084 5,402 90,023 1    44 22 6 1 93 85 235 83 235 293 435 276 293 499 1 2 3 5 0 20 11 5 21 17 6 3 18 55 2,587 101 290 122 162 96 182 225 108 186 84 122 183 18,598 24,056 16,849 15,563 21,364 90,023 14,604 17,272 14,452 13,906 15,428 14,381 80 13,293
ath-miR319b UUGGACUGAAGGGAGCUCCCU 21 297,084 5,402 90,023 1    44 22 6 1 93 85 235 83 235 293 435 276 293 499 1 2 3 5 0 20 11 5 21 17 6 3 18 55 2,587 101 290 122 162 96 182 225 108 186 84 122 183 18,598 24,056 16,849 15,563 21,364 90,023 14,604 17,272 14,452 13,906 15,428 14,381 80 13,293
ath-miR319c UUGGACUGAAGGGAGCUCCUU 21 9,096 165 2,613 1    1 0 0 0 3 2 5 5 5 3 11 4 10 4 0 1 0 0 0 2 0 0 0 0 0 0 0 2 1,000 24 43 19 32 26 48 27 20 36 37 28 21 432 420 526 367 556 2,613 431 481 385 367 517 316 1 265
ath-miR3434-3p UCAGAGUAUCAGCCAUGUGA 20 18 0 12 1    0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 12 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 1 0 0 0
ath-miR3434-5p ACUUGGCUGAUUCUAUUAUU 20 89 2 34 1    0 0 0 0 0 1 2 7 1 1 0 1 2 1 0 0 1 0 9 2 0 0 1 4 0 6 2 0 34 0 0 0 0 0 0 0 0 0 0 0 0 0 2 2 0 0 1 1 1 1 0 0 3 2 1
ath-miR3440b-3p UGGAUUGGUCAAGGGAAGCGU 21 1,196 22 235 1    16 4 3 6 78 133 61 235 64 74 31 113 16 85 8 15 33 19 12 27 32 29 12 21 53 2 2 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 9 0
ath-miR3440b-5p UUUUCUUGGCCCAUCCACUUC 21 49 1 24 1    0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 24 7 0 1 0 0 1 0 2 1 1 0 1 1 0 0 0 0 1 0 2 1 0 1 0 0 0 0 0 1
ath-miR390a-3p CGCUAUCCAUCCUGAGUUUCA 21 5,350 97 800 1    20 17 1 4 55 239 107 124 252 337 90 402 115 164 1 6 6 13 0 18 17 158 15 361 59 170 101 9 800 14 13 11 25 9 21 9 8 28 9 5 11 19 11 16 16 40 613 26 15 7 21 10 23 380 329
ath-miR390a-5p AAGCUCAGGAGGGAUAGCGCC 21 352,044 6,401 63,543 175    1,835 556 242 714 8,207 20,993 15,520 7,037 63,543 38,374 25,067 24,855 21,434 30,879 282 1,323 1,018 6,484 175 2,459 8,677 16,286 3,345 899 952 845 551 467 3,205 675 777 500 729 531 899 645 487 768 522 621 570 1,194 998 903 1,265 2,139 15,875 1,353 1,063 1,011 1,032 1,017 1,694 4,281 4,271
ath-miR390b-3p CGCUAUCCAUCCUGAGUUCC 20 980 18 402 1    1 1 0 2 3 9 5 12 11 12 4 10 3 6 0 1 1 0 0 3 3 16 3 34 0 3 0 2 20 0 0 1 1 1 0 0 2 1 1 0 1 28 23 32 26 61 402 50 35 38 19 4 35 20 34
ath-miR390b-5p AAGCUCAGGAGGGAUAGCGCC 21 352,044 6,401 63,543 175    1,835 556 242 714 8,207 20,993 15,520 7,037 63,543 38,374 25,067 24,855 21,434 30,879 282 1,323 1,018 6,484 175 2,459 8,677 16,286 3,345 899 952 845 551 467 3,205 675 777 500 729 531 899 645 487 768 522 621 570 1,194 998 903 1,265 2,139 15,875 1,353 1,063 1,011 1,032 1,017 1,694 4,281 4,271
ath-miR391-3p ACGGUAUCUCUCCUACGUAGC 21 9,721 177 1,425 1    8 2 6 6 69 131 116 515 516 402 85 318 110 414 0 7 16 84 4 40 72 73 57 29 29 3 2 19 1,425 535 347 154 676 345 473 378 298 753 419 317 272 4 6 6 1 11 23 3 1 2 2 13 13 85 26
ath-miR391-5p UUCGCAGGAGAGAUAGCGCCA 21 229,675 4,176 41,474 1    7,199 434 275 88 19,332 4,069 41,474 1,598 19,640 16,028 28,048 11,429 31,450 15,705 409 2,027 1,832 2,877 372 1,716 2,697 734 1,811 101 860 2 5 486 3,726 49 54 41 78 59 96 74 81 80 54 62 56 1 2 3 2 3 13 1 1 1 5 6 6 12,380 43
ath-miR3932a AACUUUGUGAUGACAACGAAG 21 75 1 52 1    0 0 0 0 0 0 1 0 1 0 0 0 0 1 0 0 0 6 0 0 2 1 2 0 0 0 0 2 52 1 1 1 1 0 0 0 0 1 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR3932b-3p AACUUUGUGAUGACAACGAAG 21 75 1 52 1    0 0 0 0 0 0 1 0 1 0 0 0 0 1 0 0 0 6 0 0 2 1 2 0 0 0 0 2 52 1 1 1 1 0 0 0 0 1 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR3932b-5p UUUGACGUGCUCGAUCUGCUC 21 485 9 307 1    0 0 0 0 0 0 1 0 0 0 1 0 0 1 0 0 4 0 2 8 1 5 6 55 14 0 0 2 307 6 10 6 9 4 4 11 4 4 8 4 8 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR3933 AGAAGCAAAAUGACGACUCGG 21 4,488 82 763 1    48 1 51 58 353 459 321 208 763 411 202 459 426 420 6 25 4 5 0 0 2 2 0 0 2 0 0 0 5 0 0 0 0 0 0 0 0 0 0 0 0 9 9 8 10 18 81 8 11 5 21 17 23 35 2
ath-miR393a-3p AUCAUGCUAUCUCUUUGGAUU 21 2,568 47 614 1    1 1 1 0 4 4 4 43 8 7 3 16 10 8 1 0 7 15 11 13 6 24 11 59 29 72 58 0 614 100 77 20 72 48 68 46 32 109 57 59 33 26 33 30 23 66 437 36 34 30 28 23 42 3 6
ath-miR393a-5p UCCAAAGGGAUCGCAUUGAUCC 22 6,160 112 670 1    14 0 1 0 28 9 85 25 68 50 101 52 80 62 0 0 11 86 12 17 8 16 31 8 6 13 2 96 159 156 175 135 230 143 215 181 112 210 142 177 166 148 177 86 155 199 670 136 140 82 278 269 265 360 113
ath-miR393b-3p AUCAUGCGAUCUCUUUGGAUU 21 72,598 1,320 20,300 1    16 13 1 3 92 203 156 1,534 434 900 438 993 838 604 1 6 64 63 59 254 138 267 192 1,630 322 173 129 1 17,048 1,471 920 508 856 716 963 703 549 1,007 717 956 656 1,030 814 1,483 1,176 2,391 20,300 1,213 1,506 1,192 972 1,396 1,726 126 679
ath-miR393b-5p UCCAAAGGGAUCGCAUUGAUCC 22 6,160 112 670 1    14 0 1 0 28 9 85 25 68 50 101 52 80 62 0 0 11 86 12 17 8 16 31 8 6 13 2 96 159 156 175 135 230 143 215 181 112 210 142 177 166 148 177 86 155 199 670 136 140 82 278 269 265 360 113
ath-miR394a UUGGCAUUCUGUCCACCUCC 20 48,561 883 26,643 1    48 32 16 12 162 133 240 600 257 497 941 401 558 321 0 2 5 25 1 43 13 40 81 181 6 27 54 26,643 65 45 95 33 60 45 70 86 59 49 54 60 74 891 913 710 822 1,148 5,045 871 794 744 663 830 559 1,743 694
ath-miR394b-3p AGGUGGGCAUACUGCCAAUAG 21 880 16 143 1    3 1 15 1 61 5 128 61 85 67 143 81 113 61 0 1 2 20 0 2 1 2 2 4 0 0 2 7 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 11 0
ath-miR394b-5p UUGGCAUUCUGUCCACCUCC 20 48,561 883 26,643 1    48 32 16 12 162 133 240 600 257 497 941 401 558 321 0 2 5 25 1 43 13 40 81 181 6 27 54 26,643 65 45 95 33 60 45 70 86 59 49 54 60 74 891 913 710 822 1,148 5,045 871 794 744 663 830 559 1,743 694
ath-miR395a CUGAAGUGUUUGGGGGAACUC 21 1,636 30 724 1    5 0 0 0 11 12 9 13 17 26 23 54 26 26 1 1 1 8 7 11 11 27 19 21 0 38 8 1 724 5 1 1 2 5 3 1 1 3 1 3 2 10 18 5 35 62 134 15 36 40 30 14 32 21 56
ath-miR395b CUGAAGUGUUUGGGGGGACUC 21 1,146 21 216 1    5 0 2 0 17 20 28 12 14 26 48 58 35 24 1 1 4 4 2 12 21 33 17 17 4 13 17 1 216 16 4 9 7 9 24 3 1 22 11 15 9 11 22 11 24 46 55 19 9 9 35 29 35 27 32
ath-miR395c CUGAAGUGUUUGGGGGGACUC 21 1,146 21 216 1    5 0 2 0 17 20 28 12 14 26 48 58 35 24 1 1 4 4 2 12 21 33 17 17 4 13 17 1 216 16 4 9 7 9 24 3 1 22 11 15 9 11 22 11 24 46 55 19 9 9 35 29 35 27 32
ath-miR395d CUGAAGUGUUUGGGGGAACUC 21 1,636 30 724 1    5 0 0 0 11 12 9 13 17 26 23 54 26 26 1 1 1 8 7 11 11 27 19 21 0 38 8 1 724 5 1 1 2 5 3 1 1 3 1 3 2 10 18 5 35 62 134 15 36 40 30 14 32 21 56
ath-miR395e CUGAAGUGUUUGGGGGAACUC 21 1,636 30 724 1    5 0 0 0 11 12 9 13 17 26 23 54 26 26 1 1 1 8 7 11 11 27 19 21 0 38 8 1 724 5 1 1 2 5 3 1 1 3 1 3 2 10 18 5 35 62 134 15 36 40 30 14 32 21 56
ath-miR395f CUGAAGUGUUUGGGGGGACUC 21 1,146 21 216 1    5 0 2 0 17 20 28 12 14 26 48 58 35 24 1 1 4 4 2 12 21 33 17 17 4 13 17 1 216 16 4 9 7 9 24 3 1 22 11 15 9 11 22 11 24 46 55 19 9 9 35 29 35 27 32
ath-miR396a-3p GUUCAAUAAAGCUGUGGGAAG 21 75,930 1,381 63,715 1    10 5 6 15 40 45 60 119 71 62 118 50 157 60 2 9 25 18 12 50 119 77 49 4 31 0 0 1 63,715 131 180 75 95 57 120 120 111 126 77 105 140 229 157 224 313 624 6,762 229 193 253 134 203 229 39 74
ath-miR396a-5p UUCCACAGCUUUCUUGAACUG 21 75,223 1,368 9,876 2    48 24 30 52 128 174 209 598 578 859 539 862 424 696 2 10 165 325 123 500 158 486 706 1,962 205 5,480 3,820 169 9,876 2,390 3,264 1,723 3,327 1,800 3,583 2,514 1,595 3,822 2,312 3,784 2,642 473 621 405 627 597 3,845 458 524 423 795 490 598 2,029 1,374
ath-miR396b-3p GCUCAAGAAAGCUGUGGGAAA 21 33,934 617 5,735 4    494 407 101 154 1,249 1,335 3,434 701 3,743 1,568 3,610 650 5,735 1,237 73 188 404 1,220 231 357 1,297 773 364 84 20 5 15 4 2,008 36 41 22 30 25 45 22 22 61 20 19 27 46 34 30 50 78 453 37 40 37 75 51 87 1,015 70
ath-miR396b-5p UUCCACAGCUUUCUUGAACUU 21 296,324 5,388 98,176 1    13 474 3 15 23 235 41 436 99 156 170 146 286 115 1 2 20 19 11 35 20 68 72 1,416 219 1,476 213 8 98,176 1,312 1,666 1,172 2,209 1,220 2,400 1,481 829 2,018 1,496 2,255 1,835 7,656 5,387 5,751 8,992 10,971 50,754 8,188 9,112 7,510 14,289 9,490 13,911 183 20,269
ath-miR397a UCAUUGAGUGCAGCGUUGAUG 21 1,620 29 318 1    1 0 3 0 85 42 6 13 1 5 104 0 49 101 0 1 13 103 1 2 1 0 2 67 113 0 0 1 0 1 1 0 1 0 0 0 0 1 1 0 0 19 115 36 80 76 318 15 27 60 59 41 52 0 3
ath-miR397b UCAUUGAGUGCAUCGUUGAUG 21 7,490 136 2,308 1    12 0 8 0 375 52 203 4 10 23 566 0 393 282 1 6 267 2,308 1 4 5 9 5 386 268 2 0 1 250 13 4 3 13 12 12 6 3 11 8 2 1 49 337 62 95 189 464 23 43 135 174 165 204 19 2
ath-miR398a-3p UGUGUUCUCAGGUCACCCCUU 21 214 4 94 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 94 8 1 2 4 3 12 2 2 5 5 1 0 1 2 2 3 5 47 0 1 4 5 1 1 0 3
ath-miR398a-5p AAGGAGUGGCAUGUGAACACA 21 5,038 92 586 1    8 1 13 3 62 20 173 82 226 209 303 332 250 230 1 10 44 263 53 220 159 412 295 21 55 14 7 1 586 115 75 38 110 49 89 37 39 183 84 13 16 3 7 3 2 10 55 5 4 5 2 3 0 12 26
ath-miR398b-3p UGUGUUCUCAGGUCACCCCUG 21 95,852 1,743 35,308 1    0 0 0 0 0 3 1 1 1 1 15 0 7 34 0 0 2 4 0 6 1 6 6 399 45 0 2 4 1,844 3,214 1,253 1,327 3,849 1,785 4,656 2,012 1,292 3,172 2,674 489 780 1,835 2,916 1,386 3,332 5,922 35,308 1,298 1,960 2,919 2,752 3,258 3,780 3 298
ath-miR398b-5p AGGGUUGAUAUGAGAACACAC 21 3,280 60 1,759 1    0 0 0 0 1 8 5 7 1 1 14 0 23 15 0 0 11 13 0 1 3 1 4 4 6 0 0 1 1,759 79 20 16 40 21 64 28 22 43 49 5 7 21 45 35 61 121 498 39 32 61 38 21 35 0 1
ath-miR398c-3p UGUGUUCUCAGGUCACCCCUG 21 95,852 1,743 35,308 1    0 0 0 0 0 3 1 1 1 1 15 0 7 34 0 0 2 4 0 6 1 6 6 399 45 0 2 4 1,844 3,214 1,253 1,327 3,849 1,785 4,656 2,012 1,292 3,172 2,674 489 780 1,835 2,916 1,386 3,332 5,922 35,308 1,298 1,960 2,919 2,752 3,258 3,780 3 298
ath-miR398c-5p AGGGUUGAUAUGAGAACACAC 21 3,280 60 1,759 1    0 0 0 0 1 8 5 7 1 1 14 0 23 15 0 0 11 13 0 1 3 1 4 4 6 0 0 1 1,759 79 20 16 40 21 64 28 22 43 49 5 7 21 45 35 61 121 498 39 32 61 38 21 35 0 1
ath-miR399a UGCCAAAGGAGAUUUGCCCUG 21 2,818 51 1,364 1    1 0 0 1 1 1 2 3 3 3 5 5 2 6 0 1 18 3 0 33 30 84 36 21 1,364 18 79 2 1 1 2 3 2 3 2 1 3 3 1 1 2 72 121 101 59 33 192 62 44 31 90 144 98 5 19
ath-miR399b UGCCAAAGGAGAGUUGCCCUG 21 16,052 292 4,766 1    10 2 2 0 13 21 47 17 115 177 70 69 31 146 1 2 41 7 3 53 120 102 52 151 1,794 64 201 33 221 65 50 36 66 30 79 58 48 71 62 24 40 495 814 635 442 639 4,766 555 413 325 581 1,010 675 222 286
ath-miR399c-3p UGCCAAAGGAGAGUUGCCCUG 21 16,052 292 4,766 1    10 2 2 0 13 21 47 17 115 177 70 69 31 146 1 2 41 7 3 53 120 102 52 151 1,794 64 201 33 221 65 50 36 66 30 79 58 48 71 62 24 40 495 814 635 442 639 4,766 555 413 325 581 1,010 675 222 286
ath-miR399c-5p GGGCAUCUUUCUAUUGGCAGG 21 1,583 29 1,184 1    1 0 0 0 0 0 0 0 0 2 1 0 0 1 0 0 5 0 0 1 3 16 1 8 1,184 2 7 0 260 0 0 1 1 0 0 1 0 0 1 1 1 1 1 4 5 4 50 1 3 3 7 2 4 0 0
ath-miR399d UGCCAAAGGAGAUUUGCCCCG 21 7,465 136 7,241 1    1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 5 0 0 12 17 40 21 25 7,241 32 64 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 1 2 0 0 1 0
ath-miR399e UGCCAAAGGAGAUUUGCCUCG 21 36 1 33 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 33 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR399f UGCCAAAGGAGAUUUGCCCGG 21 42,458 772 41,579 1    1 0 0 1 6 1 9 2 3 4 4 1 0 1 1 1 50 6 0 36 51 93 37 88 41,579 62 178 1 205 0 0 0 0 0 0 0 0 0 1 0 1 0 6 3 2 1 0 0 0 0 7 7 4 5 0
ath-miR400 UAUGAGAGUAUUAUAAGUCAC 21 3,436 62 879 1    2 3 2 4 7 20 32 60 13 18 11 12 19 9 1 1 18 181 22 48 18 22 40 416 879 234 124 0 598 16 32 18 25 15 29 32 13 19 18 34 29 10 8 23 15 25 118 16 10 15 16 23 15 35 13
ath-miR401 CGAAACUGGUGUCGACCGACA 21 6 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 1 0 1 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR402 UUCGAGGCCUAUUAAACCUCUG 22 1,538 28 429 1    14 1 0 0 48 2 87 15 24 24 186 28 199 61 1 2 5 15 0 8 1 7 9 50 6 50 31 429 0 0 1 0 1 0 0 1 0 2 1 0 0 3 3 2 3 2 17 0 1 0 0 9 6 182 1
ath-miR403-3p UUAGAUUCACGCACAAACUCG 21 105,597 1,920 16,925 1    46 118 3 1 147 403 290 209 277 461 341 481 511 498 1 9 63 97 16 299 68 439 203 67 168 2,826 2,244 90 2,181 1,483 2,195 1,091 2,332 1,332 1,906 2,067 1,231 2,202 1,771 2,537 1,639 3,737 4,255 2,777 4,114 4,665 16,925 3,348 3,362 3,198 3,996 5,925 5,345 952 8,655
ath-miR403-5p UGUUUUGUGCUUGAAUCUAAUU 22 1,230 22 335 1    1 0 0 0 0 8 3 9 3 2 1 1 7 6 1 1 3 3 0 1 1 1 2 59 35 86 17 1 189 20 15 10 16 16 23 11 12 21 9 20 10 19 16 11 21 34 335 18 17 24 28 12 29 9 33
ath-miR404 AUUAACGCUGGCGGUUGCGGCAGC 24 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0
ath-miR405a AUGAGUUGGGUCUAACCCAUAACU 24 3 0 1 1    0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1
ath-miR405b AUGAGUUGGGUCUAACCCAUAACU 24 3 0 1 1    0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1
ath-miR405d AUGAGUUGGGUCUAACCCAUAACU 24 3 0 1 1    0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1
ath-miR406 UAGAAUGCUAUUGUAAUCCAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR407 UUUAAAUCAUAUACUUUUGGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR408-3p AUGCACUGCCUCUUCCCUGGC 21 13,094 238 2,601 1    1 0 17 3 145 880 22 497 37 107 102 16 77 807 0 3 219 986 64 33 49 298 65 1,008 2,601 8 2 1 537 181 63 67 178 115 198 97 65 148 144 44 37 78 149 63 140 247 1,532 94 104 152 158 155 211 33 56
ath-miR408-5p ACAGGGAACAAGCAGAGCAUG 21 92,342 1,679 16,030 1    57 4 1,708 59 8,100 9,159 1,809 1,249 634 1,468 7,934 143 8,164 16,030 43 207 13,340 12,058 3,854 883 2,630 1,409 506 147 467 0 0 6 62 9 2 3 5 3 5 6 3 2 6 1 2 5 3 0 8 8 57 1 2 5 9 7 20 39 1
ath-miR413 AUAGUUUCUCUUGUUCUGCAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR414 UCAUCUUCAUCAUCAUCGUCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR415 AACAGAGCAGAAACAGAACAU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR416 GGUUCGUACGUACACUGUUCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR417 GAAGGUAGUGAAUUUGUUCGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR418 UAAUGUGAUGAUGAACUGACC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR419 UUAUGAAUGCUGAGGAUGUUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR420 UAAACUAAUCACGGAAAUGCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR4221 UUUUCCUCUGUUGAAUUCUUGC 22 44 1 17 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 0 0 0 0 0 0 0 0 0 0 0 0 3 1 3 2 5 17 0 0 0 0 2 7 0 0
ath-miR4227 UCACUGGUACCAAUCAUUCCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR4228-3p UCGGAUGCGAAACGGUGGUGU 21 270 5 47 1    3 1 1 2 8 12 18 47 5 11 23 19 3 9 1 2 5 4 3 5 7 2 6 0 4 6 15 0 26 1 2 1 1 2 2 0 1 1 1 1 0 0 0 0 0 1 3 0 1 0 0 0 0 3 1
ath-miR4228-5p AUAGCCUUGAACGCCGUCGUU 21 60 1 22 1    0 0 0 0 0 0 2 1 13 8 22 1 2 6 0 0 0 0 0 1 2 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR4239 UUUGUUAUUUUCGCAUGCUCC 21 15 0 4 1    0 0 0 0 0 0 0 4 1 1 1 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 1 0 1 0 1 0
ath-miR4240 UGACUAGACCCGUAACAUUAC 21 6 0 2 1    0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 0 1 0 0 0 0 0 1
ath-miR4243 UUGAAAUUGUAGAUUUCGUAC 21 737 13 220 1    14 4 2 1 28 13 93 35 4 5 41 9 24 9 2 5 0 0 0 0 0 0 0 0 0 0 0 16 0 0 0 0 0 0 0 0 0 0 0 0 0 11 14 27 10 12 47 12 13 13 14 23 13 220 3
ath-miR4245 ACAAAGUUUUAUACUGACAAU 21 419 8 103 1    1 0 1 1 11 15 26 50 7 4 17 3 63 7 0 1 5 18 12 1 1 0 1 21 0 5 7 1 0 0 0 0 0 0 0 0 0 1 0 0 1 0 1 2 2 4 13 1 4 1 3 0 3 103 1
ath-miR426 UUUUGGAAAUUUGUCCUUACG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR447a-3p UUGGGGACGAGAUGUUUUGUUG 22 5,067 92 466 1    68 30 1 2 167 237 219 209 297 415 325 385 309 319 23 26 23 11 11 53 34 49 30 176 285 42 96 12 416 0 1 1 2 0 0 3 2 2 1 3 4 16 14 9 11 33 129 15 11 8 7 9 17 466 33
ath-miR447a.2-3p UAUGGAAGAAAUUGUAGUAUU 21 45,875 834 13,749 1    14 70 0 5 24 447 70 2,888 46 31 36 28 126 43 1 4 0 5 0 5 1 2 2 17 23 3 2 0 7,034 62 95 76 107 76 111 115 99 94 74 97 99 1,458 1,541 2,665 1,650 3,026 13,749 1,509 1,390 1,595 1,602 1,115 1,431 65 1,047
ath-miR447b UUGGGGACGAGAUGUUUUGUUG 22 5,067 92 466 1    68 30 1 2 167 237 219 209 297 415 325 385 309 319 23 26 23 11 11 53 34 49 30 176 285 42 96 12 416 0 1 1 2 0 0 3 2 2 1 3 4 16 14 9 11 33 129 15 11 8 7 9 17 466 33
ath-miR447c-3p UUGGGGACGACAUCUUUUGUUG 22 6 0 3 1    1 0 0 0 3 0 0 0 1 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR447c-5p CCCCUUACAAUGUCGAGUAAA 21 30 1 9 1    0 0 0 0 0 1 0 0 1 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 1 0 1 0 2 9 1 1 0 2 1 1 0 5
ath-miR472-3p UUUUUCCUACUCCGCCCAUACC 22 1,724 31 281 1    0 2 0 0 3 2 6 2 5 3 11 1 16 2 0 1 2 2 0 3 1 9 4 38 6 48 33 0 155 51 77 46 84 68 64 76 53 79 64 83 62 9 9 7 6 15 174 11 7 13 10 7 0 13 281
ath-miR472-5p AUGGUCGAAGUAGGCAAAAUC 21 21,543 392 2,843 1    83 40 45 59 519 902 1,363 2,768 1,044 940 1,013 1,057 1,166 996 14 63 222 241 229 488 542 468 698 223 518 72 249 1 253 39 25 14 30 19 22 21 15 41 28 28 16 130 136 178 150 326 2,843 211 163 157 181 150 229 93 22
ath-miR5012 UUUUACUGCUACUUGUGUUCC 21 824 15 229 1    0 4 2 0 6 6 5 27 8 9 7 3 3 7 0 1 1 4 0 1 1 2 1 25 4 0 0 0 30 0 2 1 0 0 2 2 1 0 1 1 1 33 36 20 36 45 229 34 31 31 70 26 41 9 15
ath-miR5013 UUUGUGACAUCUAGGUGCUUU 21 27 0 5 1    1 1 2 0 1 0 1 1 5 2 0 1 5 1 0 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 3 0
ath-miR5014a-3p UUGUACAAAUUUAAGUGUACG 21 1,617 29 396 1    3 4 7 2 55 9 46 52 20 18 189 21 396 64 0 2 1 28 0 4 1 1 5 46 0 62 74 62 0 1 0 0 1 0 0 1 1 0 0 0 0 4 4 4 3 4 18 3 2 3 5 3 1 386 1
ath-miR5014a-5p ACACUUAGUUUUGUACAACAU 21 193 4 34 1    1 0 0 1 4 5 4 15 3 3 17 4 33 6 0 0 1 5 0 3 2 4 3 34 0 2 18 0 2 0 0 0 1 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 19 1
ath-miR5014b AUUUGUACACCUAGAUCUGUA 21 92 2 71 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 71 0 1 1 2 2 2 3 0 3 1 3 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR5015 UUGGUGUUAUGUGUAGUCUUC 21 5 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 1 0 1 1 0 0 0 0 0
ath-miR5016 UUCUUGUGGAUUCCUUGGAAA 21 17 0 3 1    1 0 0 0 3 1 1 0 3 1 2 1 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0
ath-miR5017-3p UUAUACCAAAUUAAUAGCAAA 21 35 1 15 1    0 1 1 1 0 6 2 15 1 0 0 1 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 0
ath-miR5017-5p AUUUGUUACUAAUUUGGAAUG 21 2,939 53 1,026 1    1 0 0 0 1 5 2 8 3 2 4 1 3 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 178 159 229 183 189 1,026 138 179 160 130 102 140 11 83
ath-miR5018 UUAAAGCUCCACCAUGAGUCCAAU 24 15 0 4 1    1 0 0 0 0 0 4 0 1 1 3 0 3 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR5019 UGUUGGGAAAGAAAAACUCUU 21 31 1 15 1    0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 2 15 1 1 2 2 0 1 0 3
ath-miR5020a UGGAAGAAGGUGAGACUUGCA 21 19,306 351 4,824 1    14 0 1 0 23 27 91 47 105 108 47 56 75 140 3 19 1,855 4,824 2,342 1,294 3,165 1,178 1,519 798 1,571 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0
ath-miR5020b AUGGCAUGAAAGAAGGUGAGA 21 6,188 113 3,251 1    3 0 0 0 10 3 12 6 32 59 4 24 2 18 1 2 571 1,163 3,251 219 420 257 78 25 2 0 0 0 4 2 2 1 0 1 2 1 0 2 2 1 0 0 0 1 0 0 0 0 1 0 0 0 0 6 0
ath-miR5020c UGGCAUGGAAGAAGGUGAGAC 21 264 5 39 1    1 1 0 0 1 7 5 4 14 29 2 9 2 14 1 5 24 18 17 30 39 16 16 4 4 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR5021 UGAGAAGAAGAAGAAGAAAA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR5022 GUCAUGGGGUAUGAUCGAAUG 21 35 1 10 1    1 0 0 0 0 0 4 0 3 1 2 2 2 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 1 0 0 10 2 0 0 0 0 1 1 1
ath-miR5023 AUUGGUAGUGGAUAAGGGGGC 21 78 1 16 1    0 0 1 0 6 1 0 1 3 6 2 5 2 4 1 1 0 0 0 1 4 0 1 0 0 2 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 3 1 1 4 16 2 3 4 0 0 1 0 1
ath-miR5024-3p CCGUAUCUUGGCCUUGUCAUU 21 47 1 9 1    0 0 0 0 0 0 0 1 1 1 0 1 0 0 0 0 0 0 0 1 1 0 1 8 2 5 2 0 9 1 0 0 1 0 1 0 1 1 1 2 1 0 0 1 1 1 0 0 0 0 0 0 0 0 2
ath-miR5024-5p AUGACAAGGCCAAGAUAUAACA 22 22 0 4 1    0 0 0 1 3 1 0 1 1 1 0 1 0 1 0 0 0 4 0 1 1 4 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0
ath-miR5025 ACUGUAUAUAUGUAAGUGACA 21 5 0 2 1    0 0 0 0 0 0 2 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0
ath-miR5026 ACUCAUAAGAUCGUGACACGU 21 72,902 1,325 16,299 1    65 37 62 337 313 1,026 568 636 1,006 946 341 798 337 887 2 14 4,738 8,557 3,642 3,187 4,590 6,315 4,445 16,299 6,508 88 193 1 5,051 100 144 59 68 60 116 115 93 111 98 90 120 31 45 17 11 37 316 41 21 16 23 21 39 118 3
ath-miR5027 ACCGGUUGGAACUUGCCUUAA 21 53 1 5 1    0 0 0 0 0 1 1 4 2 2 0 2 0 2 0 0 0 0 0 1 1 1 1 0 2 0 0 0 5 1 0 0 0 0 0 0 0 0 0 0 1 3 1 5 1 2 3 1 2 3 2 1 0 0 2
ath-miR5028 AAUUGGGUUUAUGCUAGAGUU 21 983 18 797 1    0 0 0 0 3 1 1 2 2 3 1 1 5 3 0 0 0 1 0 0 0 1 1 17 4 797 91 0 6 0 0 1 1 0 0 1 1 1 0 0 2 0 1 0 2 0 2 1 2 0 0 7 0 9 12
ath-miR5029 AAUGAGAGAGAACACUGCAAA 21 84 2 18 1    1 0 0 0 0 2 0 1 1 2 0 1 2 0 0 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 0 0 0 0 0 0 5 4 7 4 4 10 2 2 2 0 4 4 5 18
ath-miR5595a ACAUAUGAUCUGCAUCUUUGC 21 469 9 187 1    1 0 0 0 1 0 5 8 6 5 2 4 7 4 0 1 1 9 0 1 2 0 1 13 4 77 187 1 2 1 0 1 1 0 1 2 1 1 0 0 0 5 6 12 4 9 39 3 7 3 10 5 1 9 6
ath-miR5628 GAAAUAGCGAAGAUAUGAUUA 21 6 0 2 1    0 0 0 1 0 0 0 1 1 0 0 0 0 1 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR5629 UUAGGGUAGUUAACGGAAGUUA 22 56 1 16 1    1 0 0 0 0 0 3 2 0 0 1 1 0 0 1 1 0 5 0 1 0 3 0 0 0 3 2 0 16 0 0 0 1 0 0 0 0 0 0 0 0 0 1 0 0 1 5 1 0 2 2 0 1 2 0
ath-miR5630a GCUAAGAGCGGUUCUGAUGGA 21 18 0 10 1    0 0 0 0 0 0 0 0 1 0 2 0 0 0 0 0 1 0 0 0 0 1 0 0 0 3 10 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR5630b GCUAAGAGCGGUUCUGAUGGA 21 18 0 10 1    0 0 0 0 0 0 0 0 1 0 2 0 0 0 0 0 1 0 0 0 0 1 0 0 0 3 10 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR5631 UGGCAGGAAAGACAUAAUUUU 21 50 1 14 1    1 1 0 0 1 2 5 2 1 1 5 1 0 1 1 1 0 8 0 2 2 1 0 0 14 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR5632-3p UUGGAUUUAUAGUUGGAUAAG 21 29 1 4 1    0 0 0 0 1 4 0 4 0 0 0 1 2 1 0 0 0 0 4 1 0 0 0 0 0 0 0 0 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 1 0 1 0 0 0 0 0 0 2 1
ath-miR5632-5p UUGAUUCUCUUAUCCAACUGU 21 24 0 11 1    0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 11 2 0 0 0 0 0 0 0 0 0 0 1 0 0 1 2 0 0 0 0 5 0 0 0 0 0 0 0 1
ath-miR5633 UAUGAUCAUCAGAAAACAGUG 21 24 0 4 1    0 0 0 0 1 4 0 3 1 1 0 2 0 0 0 0 2 0