Arabidopsis Small RNA miRNA Abundances

The data below are based on the microRNAs listed in the miRBase registry. Adjust libraries/reads to display on the control panel.


        miRNA         miRNA sequence Len Sum (norm) Average Max Min (>0)  Col0ddcmet1rddCol0babh11ein56ein56abh11SUr2aSUr2bSWT1S234aS234bRMMT49RMKS02RMKS01RMKS03RMMT10RMMT11RMMT05RMMT12MTSRNA2MTSRNA1CxC5dCxL5dLxL5dLxC5dColaColbColcago1aago1bago1cCol7aCol7bCol7cCol10aCol10bCol10cdcl17adcl110adcl2347adcl23410adcl17bdcl17cdcl110bdcl110cdcl2347bCol7ddcl23410bdcl23410cTuMV7dpiATuMV7dpiBTuMV7dpiCTuMV10dpiATuMV10dpiBTuMV10dpiCVector_IPAGO1_DDH_IPAGO1_DAH_IPCol_1Col_2Col_3nrpe_1nrpe_2nrpe_3FRDR2apd1_bedtdms4AtD1AtS3AtS7Ath_ovuleZhuSaltAZhuSaltBFAtahen1_1bhen1_8_bcmLer_bControl_hen1Control_hen1hesoAGO1IP_hen1AGO1IP_hen1heso1hen1_2ago1_11wt_4_ago1hen1_ago1_dbJZ_Ler_rep1JZ_Ler_rep2JZ_Ler_rep3JZ_hen1_1_rep1JZ_hen1_1_rep2JZ_hen1_1_rep3JZ_Col_rep1JZ_Col_rep2JZ_Col_rep3JZ_hen1_8_rep1JZ_hen1_8_rep2JZ_hen1_8_rep3
ath-miR10515 ACCCCGAUGGUUAUCCUCACC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR156a-3p GCUCACUGCUCUUUCUGUCAGA 22 2,382 24 874 1    1 3 0 1 2 1 1 2 1 0 7 2 1 1 1 56 13 4 0 335 0 6 274 0 0 0 0 1 0 2 8 3 9 7 9 8 5 3 8 12 5 38 15 7 3 9 3 29 26 22 7 8 5 1 14 20 4 0 0 0 42 22 24 40 26 25 1 2 1 1 4 5 4 0 874 301 2 1 0 1 0 0 0 0 1 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR156a-5p UGACAGAAGAGAGUGAGCAC 20 449,242 4,492 80,587 4    10,261 10,516 7,411 13,914 5,564 1,561 2,791 897 41,134 39,384 8,642 39,715 40,028 654 752 80,587 30,511 6,835 3,652 0 0 995 5,557 1,293 2,659 7,271 10,369 17 28 5 4 8 10 32 46 27 20 22 15 48 15 4 5 37 50 25 8 10 21 18 5 17 15 76 55 43 6 26 10 8 94 138 160 306 201 221 9,213 12,516 2,369 4,029 3,681 2,783 3,054 554 782 279 13,993 180 188 1,723 27 33 197 315 9,127 2,458 2,254 2,167 373 264 333 253 196 186 168 209 311 81 73 64
ath-miR156b-3p UGCUCACCUCUCUUUCUGUCAGU 23 6,888 69 1,395 1    10 8 5 19 1 0 2 3 18 24 2 13 19 42 22 430 156 558 387 229 128 1,395 380 0 0 0 0 5 3 8 8 5 17 45 26 55 68 26 48 31 53 111 120 40 18 30 7 153 51 96 131 34 58 32 39 41 72 3 2 4 93 70 93 59 133 130 1 3 1 2 5 8 5 1 753 208 2 0 5 1 0 0 1 1 1 5 1 2 5 1 0 0 0 0 3 1 1 1 0 1
ath-miR156b-5p UGACAGAAGAGAGUGAGCAC 20 449,242 4,492 80,587 4    10,261 10,516 7,411 13,914 5,564 1,561 2,791 897 41,134 39,384 8,642 39,715 40,028 654 752 80,587 30,511 6,835 3,652 0 0 995 5,557 1,293 2,659 7,271 10,369 17 28 5 4 8 10 32 46 27 20 22 15 48 15 4 5 37 50 25 8 10 21 18 5 17 15 76 55 43 6 26 10 8 94 138 160 306 201 221 9,213 12,516 2,369 4,029 3,681 2,783 3,054 554 782 279 13,993 180 188 1,723 27 33 197 315 9,127 2,458 2,254 2,167 373 264 333 253 196 186 168 209 311 81 73 64
ath-miR156c-3p GCUCACUGCUCUAUCUGUCAGA 22 6,004 60 1,508 1    1 5 2 2 3 1 3 2 3 2 4 1 3 0 1 22 11 28 19 637 7 110 617 0 0 0 0 3 5 22 28 21 30 27 43 39 54 23 27 68 42 169 66 40 32 55 5 65 50 112 38 34 36 18 52 67 60 0 0 0 28 14 15 47 18 17 5 2 4 3 14 10 14 0 1,508 1,445 1 0 1 1 0 0 0 0 6 20 12 3 0 0 1 0 0 0 0 0 0 0 0 0
ath-miR156c-5p UGACAGAAGAGAGUGAGCAC 20 449,242 4,492 80,587 4    10,261 10,516 7,411 13,914 5,564 1,561 2,791 897 41,134 39,384 8,642 39,715 40,028 654 752 80,587 30,511 6,835 3,652 0 0 995 5,557 1,293 2,659 7,271 10,369 17 28 5 4 8 10 32 46 27 20 22 15 48 15 4 5 37 50 25 8 10 21 18 5 17 15 76 55 43 6 26 10 8 94 138 160 306 201 221 9,213 12,516 2,369 4,029 3,681 2,783 3,054 554 782 279 13,993 180 188 1,723 27 33 197 315 9,127 2,458 2,254 2,167 373 264 333 253 196 186 168 209 311 81 73 64
ath-miR156d-3p GCUCACUCUCUUUUUGUCAUAAC 23 1,097 11 87 1    0 1 0 1 2 1 1 0 1 0 2 1 0 10 3 0 0 26 1 28 0 3 29 0 0 0 0 1 2 3 4 2 8 37 37 78 67 27 28 15 12 76 62 10 12 14 4 84 48 87 39 12 42 39 9 22 9 0 0 0 6 2 4 11 6 5 0 0 0 0 0 0 1 0 41 13 0 0 1 1 0 0 0 0 1 1 0 0 0 1 0 0 0 0 0 1 0 0 1 1
ath-miR156d-5p UGACAGAAGAGAGUGAGCAC 20 449,242 4,492 80,587 4    10,261 10,516 7,411 13,914 5,564 1,561 2,791 897 41,134 39,384 8,642 39,715 40,028 654 752 80,587 30,511 6,835 3,652 0 0 995 5,557 1,293 2,659 7,271 10,369 17 28 5 4 8 10 32 46 27 20 22 15 48 15 4 5 37 50 25 8 10 21 18 5 17 15 76 55 43 6 26 10 8 94 138 160 306 201 221 9,213 12,516 2,369 4,029 3,681 2,783 3,054 554 782 279 13,993 180 188 1,723 27 33 197 315 9,127 2,458 2,254 2,167 373 264 333 253 196 186 168 209 311 81 73 64
ath-miR156e UGACAGAAGAGAGUGAGCAC 20 449,242 4,492 80,587 4    10,261 10,516 7,411 13,914 5,564 1,561 2,791 897 41,134 39,384 8,642 39,715 40,028 654 752 80,587 30,511 6,835 3,652 0 0 995 5,557 1,293 2,659 7,271 10,369 17 28 5 4 8 10 32 46 27 20 22 15 48 15 4 5 37 50 25 8 10 21 18 5 17 15 76 55 43 6 26 10 8 94 138 160 306 201 221 9,213 12,516 2,369 4,029 3,681 2,783 3,054 554 782 279 13,993 180 188 1,723 27 33 197 315 9,127 2,458 2,254 2,167 373 264 333 253 196 186 168 209 311 81 73 64
ath-miR156f-3p GCUCACUCUCUAUCCGUCACC 21 255 3 108 1    1 2 0 3 3 1 1 1 0 1 0 1 0 2 1 18 4 0 0 44 31 2 108 0 0 0 0 1 0 1 1 1 1 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 1 1 2 2 2 0 0 0 0 1 1 0 0 1 2 0 0 0 1 0 0 0 0 0 0 0 0 0 1 3 0 0 1 0 1 0 0 1 0
ath-miR156f-5p UGACAGAAGAGAGUGAGCAC 20 449,242 4,492 80,587 4    10,261 10,516 7,411 13,914 5,564 1,561 2,791 897 41,134 39,384 8,642 39,715 40,028 654 752 80,587 30,511 6,835 3,652 0 0 995 5,557 1,293 2,659 7,271 10,369 17 28 5 4 8 10 32 46 27 20 22 15 48 15 4 5 37 50 25 8 10 21 18 5 17 15 76 55 43 6 26 10 8 94 138 160 306 201 221 9,213 12,516 2,369 4,029 3,681 2,783 3,054 554 782 279 13,993 180 188 1,723 27 33 197 315 9,127 2,458 2,254 2,167 373 264 333 253 196 186 168 209 311 81 73 64
ath-miR156g CGACAGAAGAGAGUGAGCAC 20 1,018 10 348 1    5 2 3 5 11 1 10 2 24 23 6 25 31 2 2 348 116 21 9 0 0 8 42 18 6 79 22 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 1 0 0 1 1 1 2 1 1 24 7 3 2 19 11 24 1 1 1 16 1 2 2 0 0 0 1 37 17 1 8 0 0 1 3 0 1 0 1 0 0 1 1
ath-miR156h UGACAGAAGAAAGAGAGCAC 20 44,997 450 6,798 1    377 452 141 367 262 119 110 26 6,798 6,549 957 6,388 6,620 45 40 7 34 0 0 0 0 0 0 128 140 513 571 0 0 0 1 1 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 5 1 1 42 47 59 87 72 76 1,817 569 335 582 105 137 124 6,775 1 0 2,876 45 31 219 2 2 36 63 0 0 0 0 22 13 20 35 28 31 11 9 17 20 11 22
ath-miR156i UGACAGAAGAGAGAGAGCAG 20 12 0 2 1    1 0 0 1 2 2 1 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR156j UGACAGAAGAGAGAGAGCAC 20 1,529 15 151 1    39 46 64 124 151 31 90 41 101 47 12 97 58 2 1 140 42 47 11 0 0 2 25 18 47 79 82 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 2 1 1 6 7 1 1 19 29 30 5 1 0 14 0 1 1 0 0 1 0 3 3 1 1 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR157a-3p GCUCUCUAGCCUUCUGUCAUC 21 7,316 73 1,645 1    110 152 1,461 245 107 39 99 277 95 100 18 92 106 1 4 24 4 121 1 28 10 0 72 0 0 0 0 0 0 0 1 1 1 2 7 10 7 0 3 14 9 4 4 9 7 22 0 2 5 3 13 0 9 9 3 11 0 0 0 0 4 5 6 1 3 1 1,645 174 66 44 534 290 703 1 66 67 256 5 31 17 0 0 1 1 12 26 5 24 0 0 0 0 1 1 3 0 0 0 0 1
ath-miR157a-5p UUGACAGAAGAUAGAGAGCAC 21 245,913 2,459 32,699 1    7,084 7,037 10,125 7,863 5,211 2,456 3,994 2,608 32,699 29,455 4,442 31,340 28,381 252 368 1,039 867 6,562 46 6,824 92 245 19,464 248 408 796 882 3 2 0 1 1 2 3 15 8 7 7 1 26 2 4 1 13 30 3 4 10 44 10 0 3 4 27 15 10 0 19 7 6 221 182 186 427 269 290 1,500 1,528 1,112 1,456 956 1,036 688 627 6,576 1,774 3,873 192 83 677 20 17 195 70 3,827 1,041 1,734 1,929 290 242 316 221 192 251 89 128 379 82 73 88
ath-miR157b-3p GCUCUCUAGCCUUCUGUCAUC 21 7,316 73 1,645 1    110 152 1,461 245 107 39 99 277 95 100 18 92 106 1 4 24 4 121 1 28 10 0 72 0 0 0 0 0 0 0 1 1 1 2 7 10 7 0 3 14 9 4 4 9 7 22 0 2 5 3 13 0 9 9 3 11 0 0 0 0 4 5 6 1 3 1 1,645 174 66 44 534 290 703 1 66 67 256 5 31 17 0 0 1 1 12 26 5 24 0 0 0 0 1 1 3 0 0 0 0 1
ath-miR157b-5p UUGACAGAAGAUAGAGAGCAC 21 245,913 2,459 32,699 1    7,084 7,037 10,125 7,863 5,211 2,456 3,994 2,608 32,699 29,455 4,442 31,340 28,381 252 368 1,039 867 6,562 46 6,824 92 245 19,464 248 408 796 882 3 2 0 1 1 2 3 15 8 7 7 1 26 2 4 1 13 30 3 4 10 44 10 0 3 4 27 15 10 0 19 7 6 221 182 186 427 269 290 1,500 1,528 1,112 1,456 956 1,036 688 627 6,576 1,774 3,873 192 83 677 20 17 195 70 3,827 1,041 1,734 1,929 290 242 316 221 192 251 89 128 379 82 73 88
ath-miR157c-3p GCUCUCUAUACUUCUGUCACC 21 1,738 17 498 1    8 6 3 5 4 0 3 1 3 4 4 2 6 4 5 0 6 0 0 172 7 3 498 0 0 0 0 0 1 0 7 3 4 13 39 41 31 0 10 22 3 30 21 9 18 4 0 22 15 28 11 2 16 36 23 21 4 0 1 1 9 12 11 26 15 17 31 6 1 1 82 15 78 1 42 7 3 2 2 1 2 0 2 1 42 42 4 30 2 5 1 20 12 8 3 1 10 4 3 4
ath-miR157c-5p UUGACAGAAGAUAGAGAGCAC 21 245,913 2,459 32,699 1    7,084 7,037 10,125 7,863 5,211 2,456 3,994 2,608 32,699 29,455 4,442 31,340 28,381 252 368 1,039 867 6,562 46 6,824 92 245 19,464 248 408 796 882 3 2 0 1 1 2 3 15 8 7 7 1 26 2 4 1 13 30 3 4 10 44 10 0 3 4 27 15 10 0 19 7 6 221 182 186 427 269 290 1,500 1,528 1,112 1,456 956 1,036 688 627 6,576 1,774 3,873 192 83 677 20 17 195 70 3,827 1,041 1,734 1,929 290 242 316 221 192 251 89 128 379 82 73 88
ath-miR157d UGACAGAAGAUAGAGAGCAC 20 30,254 303 4,309 1    1,775 1,393 1,750 1,536 719 412 451 360 4,309 4,174 703 4,055 4,249 43 42 60 57 225 3 0 0 3 149 28 47 103 104 0 1 0 1 0 0 3 0 2 0 1 2 0 0 0 0 0 0 0 0 0 7 0 0 0 1 4 2 0 0 2 1 1 14 28 31 63 42 40 483 362 129 279 155 129 128 32 59 68 767 4 3 77 2 0 4 1 86 201 92 59 22 13 17 6 2 4 11 16 40 3 2 2
ath-miR158a-3p UCCCAAAUGUAGACAAAGCA 20 988,031 9,880 104,087 1    7,495 2,714 2,968 3,732 2,105 1,117 1,042 316 93,899 81,890 12,003 89,794 89,004 3,900 1,286 2,907 1,630 5,842 4,081 0 0 376 708 138 111 520 506 36 37 33 13 15 9 105 74 139 81 113 83 5 0 80 31 1 0 4 1 57 74 181 42 59 55 96 68 214 32 702 20,447 6,442 16,834 14,930 8,418 44,201 15,526 16,557 129 2,983 1,217 338 55 165 29 34,582 301 695 125 12,522 6,033 23,430 9,608 7,626 104,087 4,740 51,112 938 26,437 378 8,421 9,785 17,941 15,584 15,515 15,079 5,279 9,049 8,674 9,860 16,099 13,336
ath-miR158a-5p CUUUGUCUACAAUUUUGGAAA 21 17,072 171 1,641 1    7 11 6 3 5 1 3 1 52 57 7 56 58 61 75 89 132 26 501 533 225 1,342 285 9 0 0 0 75 38 41 100 117 195 196 337 307 257 232 380 5 11 299 388 1 3 1 7 525 496 421 510 1,250 663 1,038 1,370 1,274 1,641 5 1 0 62 100 174 105 219 223 2 3 1 1 1 1 1 1 6 4 1 22 98 26 14 6 1 1 37 12 20 12 15 5 6 46 13 25 16 5 26 16 7 9
ath-miR158b CCCCAAAUGUAGACAAAGCA 20 4,556 46 464 1    23 10 4 10 12 1 7 1 156 148 21 153 151 23 6 464 86 51 323 0 0 41 5 0 0 8 4 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 6 94 31 39 42 29 153 65 61 1 5 3 1 1 1 1 162 1 1 1 46 45 95 16 17 331 62 377 9 148 6 61 76 146 154 103 129 43 65 49 37 72 61
ath-miR159a UUUGGAUUGAAGGGAGCUCUA 21 9,395,580 93,956 648,632 5    64 42 29 39 10 12 10 5 481 412 90 456 322 46,278 30,107 7,089 31,020 50,096 39,201 239,326 66,039 81,899 147,433 431 397 710 981 229,266 292,143 319,882 119,905 133,872 118,918 168,488 216,469 183,441 259,004 280,797 208,883 52,561 83,103 521,769 457,530 69,227 69,986 60,274 50,522 456,376 341,752 524,669 527,532 214,393 187,188 185,065 282,684 201,233 187,421 648,632 298,664 435,169 17,716 19,718 20,264 28,288 22,357 25,371 274 889 39 29 406 191 434 1,065 9,903 14,198 46 42 71 65 1,561 1,252 3,898 8,212 2,816 1,522 6,790 958 17,226 11,115 9,940 2,347 1,544 1,480 12,925 7,721 9,813 1,387 970 940
ath-miR159b-3p UUUGGAUUGAAGGGAGCUCUU 21 1,892,843 18,928 126,575 1    4 4 3 3 2 1 1 0 35 43 16 37 28 10,414 8,505 2,160 8,295 4,487 339 49,436 27,975 1,147 47,767 28 17 103 91 39,175 51,377 78,882 31,132 32,156 37,269 26,850 34,009 25,839 34,550 47,546 30,706 2,701 3,832 94,533 97,263 3,560 3,866 2,543 2,795 88,247 66,751 92,211 126,575 38,799 30,687 33,243 43,441 24,002 28,708 56,174 40,554 42,683 23,250 35,443 45,324 41,428 48,414 55,781 22 82 3 2 34 19 46 188 5,440 7,861 7 15 18 5 1,527 1,467 5,936 20,243 2,257 1,583 3,092 875 7,454 4,988 3,911 2,443 1,190 1,451 6,712 3,394 3,644 1,861 967 866
ath-miR159b-5p GAGCUCCUUGAAGUUCAAUGG 21 14,803 148 3,310 1    1 1 1 1 1 0 0 0 2 0 0 0 1 7 4 0 4 0 0 6 94 0 14 0 0 0 0 962 697 815 190 186 202 213 1,132 18 33 18 539 3 51 34 440 22 171 1 3 362 1,979 23 18 17 425 1,946 3,310 24 26 0 1 1 7 16 26 8 23 31 77 21 16 10 79 94 180 4 9 26 33 17 113 5 0 0 1 1 0 0 1 0 0 0 1 0 2 0 0 1 0 0 1 1
ath-miR159c UUUGGAUUGAAGGGAGCUCCU 21 1,970 20 343 1    0 0 0 0 0 0 0 0 0 0 0 0 0 56 29 2 21 37 1 343 101 8 257 0 0 0 0 14 18 27 12 20 12 13 15 29 11 33 22 0 2 44 41 0 2 1 3 36 22 24 66 17 25 7 16 10 13 11 117 68 31 56 31 66 34 30 0 0 0 0 1 1 0 3 3 5 0 0 0 0 7 4 20 24 7 1 2 1 2 0 3 6 4 5 5 2 3 3 2 2
ath-miR160a-3p GCGUAUGAGGAGCCAUGCAUA 21 32,990 330 5,251 1    318 251 117 247 207 176 371 379 1,327 1,485 481 1,342 1,525 212 202 2,369 885 0 1 392 275 14 799 0 0 24 0 0 2 2 9 6 11 76 126 45 18 27 24 49 42 38 50 62 81 14 10 82 159 36 41 436 265 1,499 4,302 885 1,705 0 0 1 4 9 12 7 13 12 1,601 424 180 217 53 77 95 169 5 8 563 276 5,251 504 0 0 0 0 1 0 0 0 2 0 1 0 0 1 0 1 0 0 1 1
ath-miR160a-5p UGCCUGGCUCCCUGUAUGCCA 21 225,789 2,258 29,372 1    187 78 15 137 2 7 2 1 141 126 306 129 132 236 96 530 204 0 79 1,256 1,017 210 2,456 0 0 0 0 907 709 809 240 250 347 8,254 5,629 9,627 11,302 2,392 6,760 7,742 7,746 29,372 17,557 5,938 3,411 7,366 1,878 18,223 5,803 26,071 7,142 3,096 8,780 4,570 3,800 6,884 2,781 10 31 38 46 89 119 140 97 100 17 137 14 16 111 22 38 155 181 169 5 44 129 213 32 54 237 337 6 2 3 10 56 37 27 32 55 19 16 31 51 28 25 77
ath-miR160b UGCCUGGCUCCCUGUAUGCCA 21 225,789 2,258 29,372 1    187 78 15 137 2 7 2 1 141 126 306 129 132 236 96 530 204 0 79 1,256 1,017 210 2,456 0 0 0 0 907 709 809 240 250 347 8,254 5,629 9,627 11,302 2,392 6,760 7,742 7,746 29,372 17,557 5,938 3,411 7,366 1,878 18,223 5,803 26,071 7,142 3,096 8,780 4,570 3,800 6,884 2,781 10 31 38 46 89 119 140 97 100 17 137 14 16 111 22 38 155 181 169 5 44 129 213 32 54 237 337 6 2 3 10 56 37 27 32 55 19 16 31 51 28 25 77
ath-miR160c-3p CGUACAAGGAGUCAAGCAUGA 21 1,399 14 192 1    4 9 4 4 11 4 13 5 11 22 14 18 10 7 7 0 4 4 1 42 0 3 100 0 0 0 0 12 11 12 17 16 27 3 22 2 3 15 6 0 5 0 6 4 3 0 3 16 36 1 7 105 27 96 192 41 111 2 1 1 17 7 7 27 17 16 0 0 1 0 1 1 0 1 122 51 0 1 15 3 0 0 0 0 3 0 0 4 2 0 1 0 0 0 0 0 0 0 1 1
ath-miR160c-5p UGCCUGGCUCCCUGUAUGCCA 21 225,789 2,258 29,372 1    187 78 15 137 2 7 2 1 141 126 306 129 132 236 96 530 204 0 79 1,256 1,017 210 2,456 0 0 0 0 907 709 809 240 250 347 8,254 5,629 9,627 11,302 2,392 6,760 7,742 7,746 29,372 17,557 5,938 3,411 7,366 1,878 18,223 5,803 26,071 7,142 3,096 8,780 4,570 3,800 6,884 2,781 10 31 38 46 89 119 140 97 100 17 137 14 16 111 22 38 155 181 169 5 44 129 213 32 54 237 337 6 2 3 10 56 37 27 32 55 19 16 31 51 28 25 77
ath-miR161.1 UGAAAGUGACUACAUCGGGGU 21 135,406 1,354 11,895 3    156 185 113 127 41 15 35 3 802 803 450 772 748 3,469 2,795 6,507 5,304 0 3,513 6,383 11,654 8,687 11,895 9 17 32 43 1,953 2,158 2,058 1,654 1,246 1,424 2,512 2,385 1,727 975 176 1,737 1,440 2,197 1,469 1,635 2,418 2,267 892 133 2,073 1,842 1,211 189 248 2,203 2,021 2,011 822 303 621 509 680 1,358 1,020 1,088 2,322 1,681 1,774 26 45 54 31 29 26 42 237 5,976 2,962 7 45 412 192 29 58 83 719 376 288 608 178 353 208 224 44 31 64 268 222 415 72 40 52
ath-miR161.2 UCAAUGCAUUGAAAGUGACUA 21 279,868 2,799 34,603 8    1,204 404 542 770 247 168 255 45 3,241 2,618 687 3,235 2,409 4,069 2,461 3,134 3,331 0 14,063 27,018 1,249 10,775 34,603 0 0 0 9 553 314 327 331 353 384 12,307 1,648 2,184 1,305 1,056 7,385 3,815 21,604 2,194 15,219 22,115 4,842 2,455 3,073 15,897 3,473 2,721 2,578 1,116 10,972 2,573 1,112 1,044 654 9 27 19 1,143 697 389 1,511 745 717 13 131 131 18 22 51 19 1,983 461 408 11 273 1,005 4,390 215 114 124 8 424 86 1,374 55 88 208 199 64 119 110 57 71 81 39 59 59
ath-miR162a-3p UCGAUAAACCUCUGCAUCCAG 21 76,185 762 11,233 2    108 95 61 49 16 4 11 2 952 864 250 1,027 860 21 26 49 38 16 164 96 14 138 139 9 35 8 39 224 222 180 196 190 146 451 344 551 455 195 297 124 98 522 430 59 64 119 51 434 578 1,071 168 191 336 737 409 739 171 209 386 264 686 751 427 1,567 1,036 1,055 667 1,194 74 47 292 353 404 110 381 94 115 1,551 2,566 168 1,731 1,976 11,233 3,791 6,343 406 777 725 623 602 526 3,190 2,255 1,654 1,048 655 636 3,739 2,772 2,263
ath-miR162a-5p UGGAGGCAGCGGUUCAUCGAUC 22 886 9 120 1    23 44 21 20 9 2 10 1 103 117 22 101 120 2 4 4 4 4 42 6 10 5 5 0 6 0 4 0 0 1 1 1 1 2 0 0 0 3 1 0 0 0 5 0 3 0 0 5 2 0 7 5 2 1 0 0 4 4 1 4 0 2 3 0 1 2 7 2 3 3 6 3 5 1 8 4 4 3 71 2 2 0 1 1 1 0 0 0 2 0 1 0 0 0 3 1 0 0 1 1
ath-miR162b-3p UCGAUAAACCUCUGCAUCCAG 21 76,185 762 11,233 2    108 95 61 49 16 4 11 2 952 864 250 1,027 860 21 26 49 38 16 164 96 14 138 139 9 35 8 39 224 222 180 196 190 146 451 344 551 455 195 297 124 98 522 430 59 64 119 51 434 578 1,071 168 191 336 737 409 739 171 209 386 264 686 751 427 1,567 1,036 1,055 667 1,194 74 47 292 353 404 110 381 94 115 1,551 2,566 168 1,731 1,976 11,233 3,791 6,343 406 777 725 623 602 526 3,190 2,255 1,654 1,048 655 636 3,739 2,772 2,263
ath-miR162b-5p UGGAGGCAGCGGUUCAUCGAUC 22 886 9 120 1    23 44 21 20 9 2 10 1 103 117 22 101 120 2 4 4 4 4 42 6 10 5 5 0 6 0 4 0 0 1 1 1 1 2 0 0 0 3 1 0 0 0 5 0 3 0 0 5 2 0 7 5 2 1 0 0 4 4 1 4 0 2 3 0 1 2 7 2 3 3 6 3 5 1 8 4 4 3 71 2 2 0 1 1 1 0 0 0 2 0 1 0 0 0 3 1 0 0 1 1
ath-miR163 UUGAAGAGGACUUGGAACUUCGAU 24 125,816 1,258 12,194 3    30 12 21 41 24 10 14 3 88 86 40 95 79 1,518 1,003 201 726 1,481 488 5,401 39 1,094 939 28 35 71 164 594 561 1,656 952 472 1,782 2,053 1,798 1,697 2,858 2,281 4,792 53 78 7,179 7,014 44 49 107 106 6,696 3,574 6,948 7,103 3,155 2,810 2,114 2,285 4,437 3,922 260 12,194 3,702 1,207 988 1,287 412 1,123 1,095 506 1,547 37 24 300 140 342 3 1,187 1,393 96 19 100 48 50 39 145 143 450 395 531 175 361 530 601 55 45 80 376 396 472 16 22 23
ath-miR164a UGGAGAAGCAGGGCACGUGCA 21 160,659 1,607 10,416 1    729 741 260 739 29 16 29 7 7,655 8,225 2,962 7,827 7,405 2,936 2,806 602 2,299 356 19 3,526 3,840 463 5,776 2,118 2,525 4,266 5,783 109 96 72 51 37 46 1,593 7,270 3,141 3,454 10,416 1,516 478 270 1,603 860 276 1,143 668 809 1,124 4,522 1,808 6,195 8,514 1,330 5,044 6,556 2,317 7,677 42 56 103 365 175 246 854 254 241 404 512 233 346 222 232 256 171 591 240 290 52 611 1,001 25 46 7 6 10 4 35 12 7 7 11 0 4 1 16 15 11 4 3 4
ath-miR164b-3p CAUGUGCCCAUCUUCACCAUC 21 1,626 16 202 1    1 2 1 1 2 0 3 1 3 2 0 1 4 1 1 0 0 0 0 0 0 0 3 0 0 0 4 8 6 9 16 9 10 48 20 16 18 7 23 2 11 68 97 3 2 3 1 70 19 23 23 151 116 73 132 202 177 2 7 5 0 1 1 3 4 2 0 1 0 0 1 1 1 0 1 2 1 2 16 1 2 2 1 1 20 1 0 19 2 2 3 17 30 5 8 5 4 17 11 31
ath-miR164b-5p UGGAGAAGCAGGGCACGUGCA 21 160,659 1,607 10,416 1    729 741 260 739 29 16 29 7 7,655 8,225 2,962 7,827 7,405 2,936 2,806 602 2,299 356 19 3,526 3,840 463 5,776 2,118 2,525 4,266 5,783 109 96 72 51 37 46 1,593 7,270 3,141 3,454 10,416 1,516 478 270 1,603 860 276 1,143 668 809 1,124 4,522 1,808 6,195 8,514 1,330 5,044 6,556 2,317 7,677 42 56 103 365 175 246 854 254 241 404 512 233 346 222 232 256 171 591 240 290 52 611 1,001 25 46 7 6 10 4 35 12 7 7 11 0 4 1 16 15 11 4 3 4
ath-miR164c-3p CACGUGUUCUACUACUCCAAC 21 1,633 16 189 1    0 0 0 1 2 0 1 0 1 0 0 1 0 2 3 0 0 0 0 17 0 0 40 0 0 0 0 12 9 11 189 177 133 35 35 14 13 30 20 12 2 14 40 9 7 1 12 32 50 28 36 55 27 31 120 50 85 0 0 1 26 14 10 67 30 32 1 0 0 1 2 1 1 1 5 6 0 6 17 1 5 0 0 0 4 5 1 7 5 6 1 6 2 3 0 1 0 4 2 2
ath-miR164c-5p UGGAGAAGCAGGGCACGUGCG 21 4,243 42 521 1    56 335 46 49 38 17 57 4 229 269 79 208 242 72 53 7 42 6 0 521 143 3 345 18 23 32 39 2 1 1 9 4 13 12 67 25 36 96 16 22 6 22 3 4 30 16 26 8 32 15 29 79 4 46 76 60 124 2 1 3 9 6 9 11 7 11 8 29 7 22 13 9 12 9 80 28 7 26 48 32 0 2 1 1 3 6 5 11 2 2 1 0 0 1 0 0 0 0 1 1
ath-miR165a-3p UCGGACCAGGCUUCAUCCCCC 21 374,240 3,742 38,722 2    3,303 2,203 1,774 2,207 919 492 292 73 6,362 7,469 1,740 6,456 6,701 31 11 33 21 4 3 18 271 2 56 0 70 118 147 114 84 491 51 46 123 121 61 27 55 80 219 51 327 94 408 185 60 35 101 339 106 95 142 49 126 40 24 24 47 7,809 38,722 37,126 52 32 31 33 23 26 7,070 29,826 2,133 1,446 8,850 5,596 2,734 2,579 331 133 2,260 633 1,029 8,421 1,545 1,628 11,622 25,381 796 533 2,720 133 32,839 20,539 24,799 3,230 1,836 907 18,995 13,210 7,152 2,206 1,451 1,322
ath-miR165a-5p GGAAUGUUGUCUGGAUCGAGG 21 3,003 30 234 1    30 22 47 27 30 6 42 11 106 124 37 108 134 10 41 11 32 0 0 36 234 0 9 0 0 8 0 1 1 4 1 4 8 37 6 39 28 7 31 9 51 18 34 56 3 26 4 38 3 26 7 3 43 5 2 78 21 1 0 0 93 114 165 109 129 140 14 11 4 2 12 9 26 25 82 24 9 11 45 4 5 2 1 0 55 10 9 24 15 4 4 23 27 18 5 8 17 24 9 15
ath-miR165b UCGGACCAGGCUUCAUCCCCC 21 374,240 3,742 38,722 2    3,303 2,203 1,774 2,207 919 492 292 73 6,362 7,469 1,740 6,456 6,701 31 11 33 21 4 3 18 271 2 56 0 70 118 147 114 84 491 51 46 123 121 61 27 55 80 219 51 327 94 408 185 60 35 101 339 106 95 142 49 126 40 24 24 47 7,809 38,722 37,126 52 32 31 33 23 26 7,070 29,826 2,133 1,446 8,850 5,596 2,734 2,579 331 133 2,260 633 1,029 8,421 1,545 1,628 11,622 25,381 796 533 2,720 133 32,839 20,539 24,799 3,230 1,836 907 18,995 13,210 7,152 2,206 1,451 1,322
ath-miR166a-3p UCGGACCAGGCUUCAUUCCCC 21 1,198,803 11,988 120,823 15    23,919 27,851 15,692 20,547 2,587 1,668 896 432 38,624 40,284 10,079 39,762 35,400 100 41 15 31 16 30 249 1,588 36 478 138 420 1,049 977 750 617 2,983 512 472 1,226 1,278 603 295 371 729 1,290 97 572 1,093 4,597 397 109 126 146 3,837 749 809 1,917 1,225 1,469 596 995 514 2,012 9,606 28,790 34,368 215 142 156 151 107 93 14,842 43,794 6,560 6,089 12,035 9,724 3,648 6,166 2,094 1,004 6,335 5,698 7,242 23,616 6,435 5,779 84,869 69,600 5,964 4,923 7,358 1,925 120,823 68,451 85,117 22,661 11,141 5,837 76,012 44,507 27,773 14,520 9,232 8,106
ath-miR166a-5p GGACUGUUGUCUGGCUCGAGG 21 14,448 144 1,610 1    109 159 98 101 84 61 106 73 141 178 282 151 183 80 293 51 307 15 42 328 1,455 39 416 37 52 8 69 2 1 5 6 12 24 0 4 2 3 1 5 0 3 4 15 0 0 1 0 17 3 8 2 9 9 24 42 102 30 0 0 0 14 47 60 4 21 24 249 80 99 48 197 94 479 79 36 33 84 105 582 12 16 10 0 1 1,610 446 102 1,021 309 228 131 662 390 439 279 119 217 363 230 276
ath-miR166b-3p UCGGACCAGGCUUCAUUCCCC 21 1,198,803 11,988 120,823 15    23,919 27,851 15,692 20,547 2,587 1,668 896 432 38,624 40,284 10,079 39,762 35,400 100 41 15 31 16 30 249 1,588 36 478 138 420 1,049 977 750 617 2,983 512 472 1,226 1,278 603 295 371 729 1,290 97 572 1,093 4,597 397 109 126 146 3,837 749 809 1,917 1,225 1,469 596 995 514 2,012 9,606 28,790 34,368 215 142 156 151 107 93 14,842 43,794 6,560 6,089 12,035 9,724 3,648 6,166 2,094 1,004 6,335 5,698 7,242 23,616 6,435 5,779 84,869 69,600 5,964 4,923 7,358 1,925 120,823 68,451 85,117 22,661 11,141 5,837 76,012 44,507 27,773 14,520 9,232 8,106
ath-miR166b-5p GGACUGUUGUCUGGCUCGAGG 21 14,448 144 1,610 1    109 159 98 101 84 61 106 73 141 178 282 151 183 80 293 51 307 15 42 328 1,455 39 416 37 52 8 69 2 1 5 6 12 24 0 4 2 3 1 5 0 3 4 15 0 0 1 0 17 3 8 2 9 9 24 42 102 30 0 0 0 14 47 60 4 21 24 249 80 99 48 197 94 479 79 36 33 84 105 582 12 16 10 0 1 1,610 446 102 1,021 309 228 131 662 390 439 279 119 217 363 230 276
ath-miR166c UCGGACCAGGCUUCAUUCCCC 21 1,198,803 11,988 120,823 15    23,919 27,851 15,692 20,547 2,587 1,668 896 432 38,624 40,284 10,079 39,762 35,400 100 41 15 31 16 30 249 1,588 36 478 138 420 1,049 977 750 617 2,983 512 472 1,226 1,278 603 295 371 729 1,290 97 572 1,093 4,597 397 109 126 146 3,837 749 809 1,917 1,225 1,469 596 995 514 2,012 9,606 28,790 34,368 215 142 156 151 107 93 14,842 43,794 6,560 6,089 12,035 9,724 3,648 6,166 2,094 1,004 6,335 5,698 7,242 23,616 6,435 5,779 84,869 69,600 5,964 4,923 7,358 1,925 120,823 68,451 85,117 22,661 11,141 5,837 76,012 44,507 27,773 14,520 9,232 8,106
ath-miR166d UCGGACCAGGCUUCAUUCCCC 21 1,198,803 11,988 120,823 15    23,919 27,851 15,692 20,547 2,587 1,668 896 432 38,624 40,284 10,079 39,762 35,400 100 41 15 31 16 30 249 1,588 36 478 138 420 1,049 977 750 617 2,983 512 472 1,226 1,278 603 295 371 729 1,290 97 572 1,093 4,597 397 109 126 146 3,837 749 809 1,917 1,225 1,469 596 995 514 2,012 9,606 28,790 34,368 215 142 156 151 107 93 14,842 43,794 6,560 6,089 12,035 9,724 3,648 6,166 2,094 1,004 6,335 5,698 7,242 23,616 6,435 5,779 84,869 69,600 5,964 4,923 7,358 1,925 120,823 68,451 85,117 22,661 11,141 5,837 76,012 44,507 27,773 14,520 9,232 8,106
ath-miR166e-3p UCGGACCAGGCUUCAUUCCCC 21 1,198,803 11,988 120,823 15    23,919 27,851 15,692 20,547 2,587 1,668 896 432 38,624 40,284 10,079 39,762 35,400 100 41 15 31 16 30 249 1,588 36 478 138 420 1,049 977 750 617 2,983 512 472 1,226 1,278 603 295 371 729 1,290 97 572 1,093 4,597 397 109 126 146 3,837 749 809 1,917 1,225 1,469 596 995 514 2,012 9,606 28,790 34,368 215 142 156 151 107 93 14,842 43,794 6,560 6,089 12,035 9,724 3,648 6,166 2,094 1,004 6,335 5,698 7,242 23,616 6,435 5,779 84,869 69,600 5,964 4,923 7,358 1,925 120,823 68,451 85,117 22,661 11,141 5,837 76,012 44,507 27,773 14,520 9,232 8,106
ath-miR166e-5p GGAAUGUUGUCUGGCACGAGG 21 2,146 21 158 1    15 18 11 5 11 1 20 2 82 90 26 69 101 1 4 2 4 0 13 3 46 17 26 9 6 0 0 0 1 2 1 1 1 50 2 20 5 3 52 2 30 28 75 13 0 4 0 97 5 26 2 8 113 22 30 134 4 0 0 0 20 24 38 39 28 31 17 7 5 6 10 5 17 1 77 44 19 15 158 4 0 0 0 0 126 23 14 45 7 10 1 6 6 4 5 3 4 6 3 5
ath-miR166f UCGGACCAGGCUUCAUUCCCC 21 1,198,803 11,988 120,823 15    23,919 27,851 15,692 20,547 2,587 1,668 896 432 38,624 40,284 10,079 39,762 35,400 100 41 15 31 16 30 249 1,588 36 478 138 420 1,049 977 750 617 2,983 512 472 1,226 1,278 603 295 371 729 1,290 97 572 1,093 4,597 397 109 126 146 3,837 749 809 1,917 1,225 1,469 596 995 514 2,012 9,606 28,790 34,368 215 142 156 151 107 93 14,842 43,794 6,560 6,089 12,035 9,724 3,648 6,166 2,094 1,004 6,335 5,698 7,242 23,616 6,435 5,779 84,869 69,600 5,964 4,923 7,358 1,925 120,823 68,451 85,117 22,661 11,141 5,837 76,012 44,507 27,773 14,520 9,232 8,106
ath-miR166g UCGGACCAGGCUUCAUUCCCC 21 1,198,803 11,988 120,823 15    23,919 27,851 15,692 20,547 2,587 1,668 896 432 38,624 40,284 10,079 39,762 35,400 100 41 15 31 16 30 249 1,588 36 478 138 420 1,049 977 750 617 2,983 512 472 1,226 1,278 603 295 371 729 1,290 97 572 1,093 4,597 397 109 126 146 3,837 749 809 1,917 1,225 1,469 596 995 514 2,012 9,606 28,790 34,368 215 142 156 151 107 93 14,842 43,794 6,560 6,089 12,035 9,724 3,648 6,166 2,094 1,004 6,335 5,698 7,242 23,616 6,435 5,779 84,869 69,600 5,964 4,923 7,358 1,925 120,823 68,451 85,117 22,661 11,141 5,837 76,012 44,507 27,773 14,520 9,232 8,106
ath-miR167a-3p GAUCAUGUUCGCAGUUUCACC 21 2,486 25 474 1    15 19 22 11 35 4 28 7 15 19 9 18 24 12 20 2 13 6 1 140 474 6 365 9 12 16 0 1 1 3 8 8 28 3 4 4 3 0 1 0 0 0 3 0 0 0 0 0 0 3 1 11 2 3 40 64 60 0 0 1 6 19 40 17 23 30 0 2 1 1 1 1 1 26 173 102 0 11 70 7 14 8 2 2 37 41 10 83 7 8 10 32 31 22 3 8 6 18 19 40
ath-miR167a-5p UGAAGCUGCCAGCAUGAUCUA 21 1,351,309 13,513 126,974 23    29,149 42,744 12,511 24,820 6,632 1,928 3,536 1,311 125,779 109,634 91,579 126,974 106,761 9,229 7,119 1,525 5,595 3,118 384 35,788 34,202 1,141 60,998 468 840 1,711 1,712 6,878 6,241 7,111 3,681 2,980 3,479 14,027 10,090 9,043 8,231 4,259 10,364 156 273 22,418 32,840 310 198 127 50 33,790 19,064 23,605 9,441 3,751 13,328 8,966 6,737 6,214 3,342 167 832 422 7,455 8,494 8,479 26,679 13,665 14,324 6,321 3,556 4,215 4,711 917 1,987 1,285 47,919 27,082 7,331 5,826 731 11,612 26,961 29 23 153 47 79 67 123 46 196 290 242 93 77 59 173 137 136 67 53 66
ath-miR167b UGAAGCUGCCAGCAUGAUCUA 21 1,351,309 13,513 126,974 23    29,149 42,744 12,511 24,820 6,632 1,928 3,536 1,311 125,779 109,634 91,579 126,974 106,761 9,229 7,119 1,525 5,595 3,118 384 35,788 34,202 1,141 60,998 468 840 1,711 1,712 6,878 6,241 7,111 3,681 2,980 3,479 14,027 10,090 9,043 8,231 4,259 10,364 156 273 22,418 32,840 310 198 127 50 33,790 19,064 23,605 9,441 3,751 13,328 8,966 6,737 6,214 3,342 167 832 422 7,455 8,494 8,479 26,679 13,665 14,324 6,321 3,556 4,215 4,711 917 1,987 1,285 47,919 27,082 7,331 5,826 731 11,612 26,961 29 23 153 47 79 67 123 46 196 290 242 93 77 59 173 137 136 67 53 66
ath-miR167c-3p UAGGUCAUGCUGGUAGUUUCACC 23 96 1 22 1    0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 11 2 1 0 11 3 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 1 1 0 0 1 0 0 0 0 0 0 0 0 22 10 0 1 0 1 0 0 1 0 4 5 6 1 2 1 0 0 1 0 0 1 1 1 0 1
ath-miR167c-5p UAAGCUGCCAGCAUGAUCUUG 21 380 4 76 1    0 1 0 1 0 0 0 0 3 1 1 2 1 0 0 2 0 37 1 8 5 48 26 0 0 0 0 1 3 1 1 0 1 5 2 0 2 1 1 2 0 4 8 1 3 6 0 2 2 4 13 0 7 1 0 0 0 1 1 1 1 1 1 2 1 1 0 0 0 0 0 0 1 1 64 76 0 2 1 1 0 0 1 1 3 1 4 1 0 0 0 0 0 0 3 0 0 0 1 1
ath-miR167d UGAAGCUGCCAGCAUGAUCUGG 22 169,470 1,695 18,092 1    21 19 3 9 2 0 0 0 9 10 35 7 10 222 1,410 341 927 25 19 11,303 3,030 461 18,092 0 0 8 0 113 98 133 41 93 96 6,259 6,634 2,361 2,895 3,999 9,227 70 273 4,736 14,474 237 216 82 78 14,296 8,142 4,446 6,408 3,975 9,975 6,733 3,954 1,662 2,871 1 5 7 72 36 66 43 32 34 496 1,180 80 107 817 884 1,299 0 12,091 1,062 27 14 18 51 0 2 3 8 95 48 93 58 20 70 34 6 2 1 30 20 16 0 1 1
ath-miR168a-3p CCCGCCUUGCAUCAACUGAAU 21 40,022 400 3,832 1    182 253 102 129 206 136 587 364 732 670 284 776 578 200 41 33 27 33 215 305 97 502 631 46 0 24 9 266 214 456 374 281 624 357 335 379 309 272 175 328 333 1,055 769 378 352 266 194 775 711 1,110 847 1,678 768 2,113 3,205 2,924 3,832 0 1 1 94 49 53 252 76 83 15 13 28 13 6 16 4 19 54 22 16 12 387 57 2 2 2 1 1,049 415 248 218 910 377 185 688 244 68 607 165 81 455 128 64
ath-miR168a-5p UCGCUUGGUGCAGGUCGGGAA 21 513,873 5,139 21,045 8    3,682 1,844 1,221 4,277 1,530 1,737 3,788 1,561 17,455 19,706 5,983 18,150 20,080 5,073 5,784 7,702 8,814 3,498 14,810 7,544 19,440 15,645 8,491 55 35 39 82 14,298 18,781 20,831 9,266 7,409 14,305 4,703 4,112 1,463 3,111 5,119 3,443 3,351 8,722 6,789 9,784 8,058 4,732 3,231 2,615 12,019 5,372 5,994 8,962 10,973 5,101 7,703 16,469 9,560 21,045 4,640 3,305 14,088 847 1,007 1,462 1,491 1,487 1,578 49 141 189 92 8 16 8 549 3,005 321 27 698 5,599 2,604 18 19 45 59 1,637 439 714 412 3,356 1,789 814 674 380 243 2,061 767 990 455 215 228
ath-miR168b-3p CCCGUCUUGUAUCAACUGAAU 21 1,621 16 217 1    0 0 0 0 0 0 0 0 1 0 0 1 1 4 1 2 2 0 54 26 12 51 25 0 0 0 0 0 2 7 2 1 5 23 13 8 2 7 8 10 8 16 25 10 12 7 3 48 43 15 33 100 39 113 217 109 143 0 0 1 52 20 18 99 36 32 0 0 0 0 0 0 0 0 6 6 0 0 1 0 0 0 0 0 71 21 12 14 0 5 2 0 4 1 5 1 1 1 2 1
ath-miR168b-5p UCGCUUGGUGCAGGUCGGGAA 21 513,873 5,139 21,045 8    3,682 1,844 1,221 4,277 1,530 1,737 3,788 1,561 17,455 19,706 5,983 18,150 20,080 5,073 5,784 7,702 8,814 3,498 14,810 7,544 19,440 15,645 8,491 55 35 39 82 14,298 18,781 20,831 9,266 7,409 14,305 4,703 4,112 1,463 3,111 5,119 3,443 3,351 8,722 6,789 9,784 8,058 4,732 3,231 2,615 12,019 5,372 5,994 8,962 10,973 5,101 7,703 16,469 9,560 21,045 4,640 3,305 14,088 847 1,007 1,462 1,491 1,487 1,578 49 141 189 92 8 16 8 549 3,005 321 27 698 5,599 2,604 18 19 45 59 1,637 439 714 412 3,356 1,789 814 674 380 243 2,061 767 990 455 215 228
ath-miR169a-3p GGCAAGUUGUCCUUGGCUAC 20 1,250 13 219 1    4 8 3 3 1 2 1 0 0 1 7 1 0 2 1 4 2 0 0 0 0 0 3 0 0 0 0 2 1 3 8 13 10 125 50 6 3 5 135 0 18 2 219 16 8 0 0 152 56 4 12 14 102 31 40 8 6 0 0 1 0 0 1 0 0 0 1 13 5 3 33 30 50 0 1 5 3 1 0 1 0 0 1 0 1 3 0 1 0 0 0 0 0 1 0 0 1 0 1 1
ath-miR169a-5p CAGCCAAGGAUGACUUGCCGA 21 41,023 410 3,988 1    35 46 7 23 24 14 28 5 89 73 54 95 67 104 47 7 53 31 12 1,500 193 26 2,302 0 0 0 0 225 231 669 681 699 954 1,024 803 242 273 689 917 14 129 601 1,683 122 128 29 99 1,935 2,931 382 1,719 1,150 783 792 550 186 548 1 11 7 4 2 3 0 2 1 824 2,293 201 251 2,550 3,988 2,373 17 667 1,037 610 8 27 97 0 0 0 0 3 1 7 1 0 1 5 0 1 0 0 1 4 0 1 1
ath-miR169b-3p GGCAAGUUGUCCUUCGGCUACA 22 78 1 14 1    0 0 0 1 0 0 0 0 1 1 1 1 0 0 1 0 0 7 11 14 2 0 4 0 0 0 0 0 0 0 0 1 1 2 0 2 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 2 0 0 1 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 1 1 2 0 11 4 1 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR169b-5p CAGCCAAGGAUGACUUGCCGG 21 4,546 45 1,339 1    6 1 0 2 0 0 0 0 17 16 6 12 18 7 6 4 31 886 393 203 1,339 174 197 9 0 16 0 3 3 11 10 6 18 8 2 0 0 3 2 0 0 8 9 1 0 0 1 24 27 6 22 11 10 9 14 3 13 1 5 5 0 1 1 0 1 1 155 61 8 11 62 86 54 5 130 282 27 15 4 60 0 0 0 0 0 0 0 0 0 2 1 0 0 1 0 0 0 0 0 0
ath-miR169c CAGCCAAGGAUGACUUGCCGG 21 4,546 45 1,339 1    6 1 0 2 0 0 0 0 17 16 6 12 18 7 6 4 31 886 393 203 1,339 174 197 9 0 16 0 3 3 11 10 6 18 8 2 0 0 3 2 0 0 8 9 1 0 0 1 24 27 6 22 11 10 9 14 3 13 1 5 5 0 1 1 0 1 1 155 61 8 11 62 86 54 5 130 282 27 15 4 60 0 0 0 0 0 0 0 0 0 2 1 0 0 1 0 0 0 0 0 0
ath-miR169d UGAGCCAAGGAUGACUUGCCG 21 110,867 1,109 23,238 1    464 1,453 131 589 132 30 80 5 284 292 549 297 304 60 48 16 53 6 6 68 290 8 109 0 0 0 0 3 2 5 4 2 4 170 83 49 29 76 148 12 81 54 151 63 64 9 30 162 209 57 143 116 185 66 110 53 132 0 2 1 1 1 2 1 1 2 9,321 18,144 1,420 1,748 20,356 23,238 20,440 65 8 8 7,636 42 183 694 0 0 1 1 1 0 0 0 0 0 1 0 0 1 0 0 0 0 1 1
ath-miR169e UGAGCCAAGGAUGACUUGCCG 21 110,867 1,109 23,238 1    464 1,453 131 589 132 30 80 5 284 292 549 297 304 60 48 16 53 6 6 68 290 8 109 0 0 0 0 3 2 5 4 2 4 170 83 49 29 76 148 12 81 54 151 63 64 9 30 162 209 57 143 116 185 66 110 53 132 0 2 1 1 1 2 1 1 2 9,321 18,144 1,420 1,748 20,356 23,238 20,440 65 8 8 7,636 42 183 694 0 0 1 1 1 0 0 0 0 0 1 0 0 1 0 0 0 0 1 1
ath-miR169f-3p GCAAGUUGACCUUGGCUCUGC 21 1,337 13 129 1    1 0 1 1 0 0 1 0 2 1 1 1 0 0 0 0 0 1 0 1 5 2 1 0 0 0 0 2 1 3 50 45 60 32 28 29 7 14 3 10 5 32 21 1 7 3 4 21 14 39 13 60 20 12 25 31 36 0 0 1 22 17 14 5 8 11 9 112 1 1 107 62 129 1 32 28 22 10 5 1 0 0 0 0 15 15 3 19 10 1 5 3 13 4 0 0 0 2 1 1
ath-miR169f-5p UGAGCCAAGGAUGACUUGCCG 21 110,867 1,109 23,238 1    464 1,453 131 589 132 30 80 5 284 292 549 297 304 60 48 16 53 6 6 68 290 8 109 0 0 0 0 3 2 5 4 2 4 170 83 49 29 76 148 12 81 54 151 63 64 9 30 162 209 57 143 116 185 66 110 53 132 0 2 1 1 1 2 1 1 2 9,321 18,144 1,420 1,748 20,356 23,238 20,440 65 8 8 7,636 42 183 694 0 0 1 1 1 0 0 0 0 0 1 0 0 1 0 0 0 0 1 1
ath-miR169g-3p UCCGGCAAGUUGACCUUGGCU 21 24 0 6 1    0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 6 1 2 4 3 1 0 0 0 3 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR169g-5p UGAGCCAAGGAUGACUUGCCG 21 110,867 1,109 23,238 1    464 1,453 131 589 132 30 80 5 284 292 549 297 304 60 48 16 53 6 6 68 290 8 109 0 0 0 0 3 2 5 4 2 4 170 83 49 29 76 148 12 81 54 151 63 64 9 30 162 209 57 143 116 185 66 110 53 132 0 2 1 1 1 2 1 1 2 9,321 18,144 1,420 1,748 20,356 23,238 20,440 65 8 8 7,636 42 183 694 0 0 1 1 1 0 0 0 0 0 1 0 0 1 0 0 0 0 1 1
ath-miR169h UAGCCAAGGAUGACUUGCCUG 21 33,399 334 11,668 1    15 25 2 14 9 2 6 0 15 9 40 20 17 32 27 4 46 27 3 428 254 126 989 0 0 0 0 2 2 1 4 3 7 181 59 29 24 37 58 14 21 52 99 16 18 1 5 149 169 31 81 82 107 55 17 18 28 0 2 3 1 1 1 1 1 1 533 3,050 118 154 4,561 9,097 11,668 1 51 289 342 1 0 5 0 0 1 1 1 0 18 0 5 5 2 0 0 1 0 1 1 1 1 0
ath-miR169i UAGCCAAGGAUGACUUGCCUG 21 33,399 334 11,668 1    15 25 2 14 9 2 6 0 15 9 40 20 17 32 27 4 46 27 3 428 254 126 989 0 0 0 0 2 2 1 4 3 7 181 59 29 24 37 58 14 21 52 99 16 18 1 5 149 169 31 81 82 107 55 17 18 28 0 2 3 1 1 1 1 1 1 533 3,050 118 154 4,561 9,097 11,668 1 51 289 342 1 0 5 0 0 1 1 1 0 18 0 5 5 2 0 0 1 0 1 1 1 1 0
ath-miR169j UAGCCAAGGAUGACUUGCCUG 21 33,399 334 11,668 1    15 25 2 14 9 2 6 0 15 9 40 20 17 32 27 4 46 27 3 428 254 126 989 0 0 0 0 2 2 1 4 3 7 181 59 29 24 37 58 14 21 52 99 16 18 1 5 149 169 31 81 82 107 55 17 18 28 0 2 3 1 1 1 1 1 1 533 3,050 118 154 4,561 9,097 11,668 1 51 289 342 1 0 5 0 0 1 1 1 0 18 0 5 5 2 0 0 1 0 1 1 1 1 0
ath-miR169k UAGCCAAGGAUGACUUGCCUG 21 33,399 334 11,668 1    15 25 2 14 9 2 6 0 15 9 40 20 17 32 27 4 46 27 3 428 254 126 989 0 0 0 0 2 2 1 4 3 7 181 59 29 24 37 58 14 21 52 99 16 18 1 5 149 169 31 81 82 107 55 17 18 28 0 2 3 1 1 1 1 1 1 533 3,050 118 154 4,561 9,097 11,668 1 51 289 342 1 0 5 0 0 1 1 1 0 18 0 5 5 2 0 0 1 0 1 1 1 1 0
ath-miR169l UAGCCAAGGAUGACUUGCCUG 21 33,399 334 11,668 1    15 25 2 14 9 2 6 0 15 9 40 20 17 32 27 4 46 27 3 428 254 126 989 0 0 0 0 2 2 1 4 3 7 181 59 29 24 37 58 14 21 52 99 16 18 1 5 149 169 31 81 82 107 55 17 18 28 0 2 3 1 1 1 1 1 1 533 3,050 118 154 4,561 9,097 11,668 1 51 289 342 1 0 5 0 0 1 1 1 0 18 0 5 5 2 0 0 1 0 1 1 1 1 0
ath-miR169m UAGCCAAGGAUGACUUGCCUG 21 33,399 334 11,668 1    15 25 2 14 9 2 6 0 15 9 40 20 17 32 27 4 46 27 3 428 254 126 989 0 0 0 0 2 2 1 4 3 7 181 59 29 24 37 58 14 21 52 99 16 18 1 5 149 169 31 81 82 107 55 17 18 28 0 2 3 1 1 1 1 1 1 533 3,050 118 154 4,561 9,097 11,668 1 51 289 342 1 0 5 0 0 1 1 1 0 18 0 5 5 2 0 0 1 0 1 1 1 1 0
ath-miR169n UAGCCAAGGAUGACUUGCCUG 21 33,399 334 11,668 1    15 25 2 14 9 2 6 0 15 9 40 20 17 32 27 4 46 27 3 428 254 126 989 0 0 0 0 2 2 1 4 3 7 181 59 29 24 37 58 14 21 52 99 16 18 1 5 149 169 31 81 82 107 55 17 18 28 0 2 3 1 1 1 1 1 1 533 3,050 118 154 4,561 9,097 11,668 1 51 289 342 1 0 5 0 0 1 1 1 0 18 0 5 5 2 0 0 1 0 1 1 1 1 0
ath-miR170-3p UGAUUGAGCCGUGUCAAUAUC 21 19,467 195 5,407 1    17 21 5 8 3 2 2 1 7 9 7 5 3 1,426 870 198 703 0 15 1,138 2,168 38 5,407 0 0 0 4 97 39 53 27 22 26 710 76 459 416 45 374 5 0 639 866 0 0 12 0 870 55 555 81 89 862 46 30 356 32 1 8 6 2 12 13 14 22 19 16 22 1 2 8 7 11 18 11 31 3 20 236 25 0 0 10 8 2 0 1 0 7 2 4 0 2 4 0 3 6 4 2 5
ath-miR170-5p UAUUGGCCUGGUUCACUCAGA 21 13,091 131 1,612 1    0 1 1 1 1 0 0 0 4 4 4 4 3 5 8 0 0 0 0 6 60 2 19 0 0 0 0 72 87 90 53 45 113 62 65 41 72 76 70 3 15 139 120 6 3 6 7 150 161 119 199 163 54 88 667 542 1,119 1,453 136 497 699 722 197 1,612 1,073 1,088 21 17 3 2 8 7 13 5 80 122 4 23 242 15 2 4 16 2 53 26 17 51 22 13 25 58 33 20 35 15 16 55 29 30
ath-miR171a-3p UGAUUGAGCCGCGCCAAUAUC 21 147,117 1,471 27,273 2    473 531 221 315 62 37 35 14 358 393 281 350 387 11,138 7,216 1,473 6,816 30 97 8,137 23,019 271 27,273 9 6 0 17 976 670 569 864 578 577 4,705 1,306 2,063 1,658 547 3,447 148 464 1,802 5,630 387 129 191 71 5,701 1,050 2,287 631 698 4,531 1,204 526 1,442 286 9 126 56 142 183 329 685 289 289 1,442 906 178 153 490 462 493 409 111 244 392 637 3,460 849 20 15 96 77 11 4 10 2 42 47 47 29 39 23 43 45 71 17 18 30
ath-miR171a-5p UAUUGGCCUGGUUCACUCAGA 21 13,091 131 1,612 1    0 1 1 1 1 0 0 0 4 4 4 4 3 5 8 0 0 0 0 6 60 2 19 0 0 0 0 72 87 90 53 45 113 62 65 41 72 76 70 3 15 139 120 6 3 6 7 150 161 119 199 163 54 88 667 542 1,119 1,453 136 497 699 722 197 1,612 1,073 1,088 21 17 3 2 8 7 13 5 80 122 4 23 242 15 2 4 16 2 53 26 17 51 22 13 25 58 33 20 35 15 16 55 29 30
ath-miR171b-3p UUGAGCCGUGCCAAUAUCACG 21 10,347 103 1,385 1    6 3 2 4 0 1 0 1 53 63 18 64 47 919 337 109 379 7 26 479 1,385 32 1,228 0 0 0 0 15 10 13 2 3 2 357 107 125 76 52 176 39 237 98 489 248 79 129 47 473 82 184 118 74 293 61 58 144 47 1 18 14 57 23 27 141 47 43 60 287 5 4 52 45 55 15 39 33 11 4 22 24 14 17 48 54 21 1 4 13 5 19 23 12 15 8 5 13 16 4 11 16
ath-miR171b-5p AGAUAUUAGUGCGGUUCAAUC 21 7,560 76 1,327 1    41 84 53 22 24 13 29 20 248 269 248 242 303 97 114 13 92 2 25 81 193 54 203 64 29 110 52 7 3 8 23 20 17 138 30 14 11 62 47 36 179 24 85 231 35 32 188 101 15 15 72 322 152 50 93 71 435 0 1 1 5 5 9 25 15 20 0 1 1 1 1 1 1 12 8 7 0 5 1,327 16 0 0 2 1 172 85 22 248 12 18 13 32 30 43 5 8 7 55 52 52
ath-miR171c-3p UUGAGCCGUGCCAAUAUCACG 21 10,347 103 1,385 1    6 3 2 4 0 1 0 1 53 63 18 64 47 919 337 109 379 7 26 479 1,385 32 1,228 0 0 0 0 15 10 13 2 3 2 357 107 125 76 52 176 39 237 98 489 248 79 129 47 473 82 184 118 74 293 61 58 144 47 1 18 14 57 23 27 141 47 43 60 287 5 4 52 45 55 15 39 33 11 4 22 24 14 17 48 54 21 1 4 13 5 19 23 12 15 8 5 13 16 4 11 16
ath-miR171c-5p AGAUAUUGGUGCGGUUCAAUC 21 4,082 41 2,398 1    19 41 21 12 20 16 17 29 35 39 67 34 59 5 6 0 2 2 4 17 36 3 22 0 17 39 4 13 9 7 29 21 18 93 4 0 2 5 28 12 141 4 35 179 18 7 22 52 0 3 8 25 69 9 19 18 26 0 0 1 1 1 1 1 1 3 1 0 4 3 1 1 1 4 4 14 1 39 2,398 29 0 0 1 1 27 13 1 28 2 2 2 17 5 4 0 1 3 7 7 10
ath-miR172a AGAAUCUUGAUGAUGCUGCAU 21 2,500,267 25,003 516,243 1    1,757 2,218 593 997 1,271 1,405 928 839 41,490 42,723 13,312 41,082 44,291 1,421 3,194 3,943 3,043 0 722 9,619 22,301 1,867 12,527 83 0 24 4 1,469 985 1,140 815 760 728 88,723 29,523 12,331 6,775 6,352 30,827 180 1,679 15,691 76,988 1,902 718 319 245 74,500 23,584 13,815 14,700 9,609 83,794 21,135 7,136 4,369 3,939 8 125 211 528 786 871 1,042 1,265 1,394 516,243 378,543 27,722 28,001 193,861 161,663 176,415 138 38 111 96,170 1,507 47,836 79,287 0 0 2 2 15 9 3 6 10 23 17 6 5 2 0 4 6 4 1 2
ath-miR172b-3p AGAAUCUUGAUGAUGCUGCAU 21 2,500,267 25,003 516,243 1    1,757 2,218 593 997 1,271 1,405 928 839 41,490 42,723 13,312 41,082 44,291 1,421 3,194 3,943 3,043 0 722 9,619 22,301 1,867 12,527 83 0 24 4 1,469 985 1,140 815 760 728 88,723 29,523 12,331 6,775 6,352 30,827 180 1,679 15,691 76,988 1,902 718 319 245 74,500 23,584 13,815 14,700 9,609 83,794 21,135 7,136 4,369 3,939 8 125 211 528 786 871 1,042 1,265 1,394 516,243 378,543 27,722 28,001 193,861 161,663 176,415 138 38 111 96,170 1,507 47,836 79,287 0 0 2 2 15 9 3 6 10 23 17 6 5 2 0 4 6 4 1 2
ath-miR172b-5p GCAGCACCAUUAAGAUUCAC 20 2,532 25 284 1    113 228 86 43 37 25 24 8 180 146 284 185 103 70 45 33 42 0 2 0 0 0 8 0 6 0 0 3 1 5 19 15 15 30 41 27 16 4 8 5 5 44 9 3 3 7 1 8 21 28 4 3 27 124 153 60 23 1 0 1 4 3 7 17 4 3 0 0 2 0 1 0 1 1 2 1 0 11 20 1 0 0 1 1 11 3 0 27 0 0 0 12 4 1 0 1 0 3 3 5
ath-miR172c AGAAUCUUGAUGAUGCUGCAG 21 288,305 2,883 35,196 1    901 2,179 508 519 269 57 173 73 1,797 1,827 1,755 1,785 1,838 666 1,282 9,298 2,940 0 555 2,799 15,286 905 57 9 17 24 26 8 11 16 14 4 12 853 609 131 54 130 594 24 242 123 1,147 243 156 43 59 1,206 511 200 273 193 1,199 660 633 141 181 1 6 3 12,606 21,454 23,335 19,524 32,605 33,885 35,196 12,105 2,849 3,932 3,896 5,206 6,166 1,285 2 3 7,353 178 1,724 7,677 5 0 4 9 1 0 0 2 2 20 21 3 4 3 8 9 1 2 1 4
ath-miR172d-3p AGAAUCUUGAUGAUGCUGCAG 21 288,305 2,883 35,196 1    901 2,179 508 519 269 57 173 73 1,797 1,827 1,755 1,785 1,838 666 1,282 9,298 2,940 0 555 2,799 15,286 905 57 9 17 24 26 8 11 16 14 4 12 853 609 131 54 130 594 24 242 123 1,147 243 156 43 59 1,206 511 200 273 193 1,199 660 633 141 181 1 6 3 12,606 21,454 23,335 19,524 32,605 33,885 35,196 12,105 2,849 3,932 3,896 5,206 6,166 1,285 2 3 7,353 178 1,724 7,677 5 0 4 9 1 0 0 2 2 20 21 3 4 3 8 9 1 2 1 4
ath-miR172d-5p GCAACAUCUUCAAGAUUCAGA 21 5,066 51 1,516 1    1 5 1 2 1 1 4 1 11 12 16 7 10 19 22 5 25 2 1 34 94 2 0 0 6 0 0 31 25 36 227 165 175 55 68 23 11 21 63 19 36 14 39 46 25 6 18 45 46 15 14 276 168 486 1,516 468 420 0 0 0 31 21 23 49 40 41 0 0 0 0 0 0 0 2 1 0 0 1 1 1 0 0 0 0 0 1 0 0 2 4 3 0 1 2 0 1 1 0 1 0
ath-miR172e-3p GGAAUCUUGAUGAUGCUGCAU 21 89,119 891 49,408 1    11 11 3 12 21 12 8 6 158 171 67 172 165 142 299 100 206 0 16 271 6,505 59 183 0 0 8 0 5 4 3 4 1 1 437 1,944 158 117 18 402 7 29 64 729 19 69 13 1 589 621 112 97 23 622 1,069 833 64 40 1 22 22 73 56 62 145 101 113 49,408 2,735 422 508 3,777 3,138 4,678 3 1 4 2,115 86 2,956 1,985 2 0 0 1 0 0 0 0 0 1 1 0 0 1 0 0 0 0 0 1
ath-miR172e-5p GCAGCACCAUUAAGAUUCAC 20 2,532 25 284 1    113 228 86 43 37 25 24 8 180 146 284 185 103 70 45 33 42 0 2 0 0 0 8 0 6 0 0 3 1 5 19 15 15 30 41 27 16 4 8 5 5 44 9 3 3 7 1 8 21 28 4 3 27 124 153 60 23 1 0 1 4 3 7 17 4 3 0 0 2 0 1 0 1 1 2 1 0 11 20 1 0 0 1 1 11 3 0 27 0 0 0 12 4 1 0 1 0 3 3 5
ath-miR173-3p UGAUUCUCUGUGUAAGCGAAA 21 4,188 42 613 1    23 11 11 18 6 3 8 0 55 73 30 62 79 164 65 267 109 280 274 414 19 304 613 0 6 0 4 10 4 5 1 3 3 17 30 53 29 18 34 0 2 58 39 0 0 0 0 44 36 54 22 9 31 34 48 62 17 0 1 1 7 31 43 13 60 59 25 34 41 18 3 7 6 1 20 16 41 1 166 24 0 0 1 0 0 1 4 0 0 0 1 0 0 0 0 1 0 0 0 1
ath-miR173-5p UUCGCUUGCAGAGAGAAAUCAC 22 74,505 745 16,529 1    274 519 281 281 267 22 189 7 3,786 3,276 1,224 3,606 3,104 178 189 796 387 1,685 1,630 606 993 1,099 651 28 47 158 238 3 2 6 3 2 2 126 65 20 2 100 66 0 0 4 37 1 0 0 0 42 39 5 32 126 97 89 66 7 79 5 33 30 282 352 485 748 674 721 16,529 4,971 2,249 2,977 745 1,668 993 798 289 358 5,361 59 4,495 2,892 9 4 38 13 63 0 25 11 2 4 6 17 12 8 5 7 6 7 6 6
ath-miR1886.1 UGAGAGAAGUGAGAUGAAAUC 21 185 2 27 1    4 5 2 4 0 1 1 0 17 23 2 15 27 3 4 4 17 10 1 2 0 0 5 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 3 0 1 1 1 0 1 1 2 2 2 0 0 1 0 0 0 1 4 1 1 0 0 4 0 0 0 1 1 1 0 0 0 2 0 0 0 0 0 0 1 1 0 1 1
ath-miR1886.2 UGAGAUGAAAUCUUUGAUUGG 21 6,255 63 491 1    13 14 17 15 6 10 6 7 106 80 13 80 73 10 31 27 29 51 1 75 0 3 106 0 0 0 0 29 32 35 9 10 10 130 172 193 346 80 147 165 74 472 240 72 122 168 38 193 255 403 93 60 157 216 284 491 153 0 4 2 10 5 12 11 12 11 29 36 14 7 5 10 10 2 38 112 9 0 36 0 9 10 81 63 0 0 0 0 0 0 0 0 0 1 3 5 10 27 25 24
ath-miR1886.3 AAUUAAAGAUUUCAUCUUACU 21 324 3 163 1    1 0 1 2 0 1 1 2 3 1 0 1 1 0 0 0 0 0 1 0 0 0 2 0 0 0 0 0 1 0 0 0 0 0 2 0 0 0 0 5 2 0 0 1 3 4 4 0 0 1 0 0 0 1 5 10 0 0 0 0 0 0 0 0 1 0 163 38 2 3 2 4 1 1 0 1 1 1 42 3 0 0 1 0 2 0 0 0 0 0 0 0 0 1 0 0 0 0 0 1
ath-miR1887 UACUAAGUAGAGUCUAAGAGA 21 114 1 25 1    1 0 0 1 0 0 1 0 24 23 1 22 25 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 1 0 2 2 2 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 0 0 0 1 0 0 0 0 1 1 0 0 1
ath-miR1888a UAAGUUAAGAUUUGUGAAGAA 21 819 8 98 1    5 1 1 7 2 1 1 0 23 26 15 36 27 16 15 0 17 0 13 63 5 12 98 0 0 0 0 2 1 0 1 1 0 7 4 16 11 14 0 39 15 4 3 18 50 22 21 1 15 9 2 9 2 18 9 6 11 6 3 2 10 5 4 19 9 6 0 0 0 0 0 0 0 1 19 28 0 0 7 0 0 0 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0
ath-miR1888b UUAGGCUAAGAUUUGUGAAGA 21 49 0 4 1    0 0 0 0 0 0 0 0 1 2 1 3 3 1 0 2 0 0 1 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 4 0 0 0 0 3 0 1 0 3 0 0 0 0 0 0 0 0 0 2 3 0 0 2 1 0 1 1 1 0 1 0 1 0 1 0 0 0 1 1 0 0 1 1 1 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1
ath-miR2111a-3p GUCCUCGGGAUGCGGAUUACC 21 259 3 36 1    1 1 5 2 2 1 2 0 11 18 4 10 17 1 1 0 0 0 3 3 10 11 11 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 1 0 0 0 0 0 0 0 0 5 2 0 9 5 0 0 0 0 13 0 0 1 1 1 1 2 1 1 13 2 3 2 1 1 1 0 2 2 1 3 36 2 0 0 1 0 5 1 1 3 0 0 1 12 1 1 0 0 0 1 1 1
ath-miR2111a-5p UAAUCUGCAUCCUGAGGUUUA 21 456 5 78 1    1 4 1 2 1 1 1 0 4 7 2 7 14 3 2 11 2 1 1 14 17 6 18 0 0 0 0 7 4 5 1 1 2 0 0 6 3 0 1 0 0 8 6 0 0 0 0 7 2 9 9 6 2 4 2 6 9 0 1 1 8 6 4 78 14 7 14 8 2 1 3 4 9 0 26 20 4 2 14 4 0 0 1 0 1 0 0 0 0 0 1 0 0 1 0 1 0 0 1 0
ath-miR2111b-3p AUCCUCGGGAUACAGUUUACC 21 280 3 83 1    1 5 1 2 2 3 1 3 14 13 5 8 10 1 1 11 4 1 1 0 2 0 1 0 0 0 0 0 0 0 0 0 0 0 0 4 0 3 0 0 0 0 3 0 0 0 0 0 0 0 18 11 1 1 5 1 26 0 1 1 1 1 1 5 1 2 0 1 0 0 0 0 0 0 1 1 0 3 83 2 0 0 0 0 4 4 0 1 0 0 2 0 0 0 0 0 0 0 1 1
ath-miR2111b-5p UAAUCUGCAUCCUGAGGUUUA 21 456 5 78 1    1 4 1 2 1 1 1 0 4 7 2 7 14 3 2 11 2 1 1 14 17 6 18 0 0 0 0 7 4 5 1 1 2 0 0 6 3 0 1 0 0 8 6 0 0 0 0 7 2 9 9 6 2 4 2 6 9 0 1 1 8 6 4 78 14 7 14 8 2 1 3 4 9 0 26 20 4 2 14 4 0 0 1 0 1 0 0 0 0 0 1 0 0 1 0 1 0 0 1 0
ath-miR2112-3p CUUUAUAUCCGCAUUUGCGCA 21 774 8 176 1    1 0 0 1 0 0 0 0 0 0 0 2 1 4 2 0 2 10 9 2 0 5 14 0 0 0 0 2 2 8 1 0 2 10 6 4 2 4 6 10 9 24 12 7 20 22 20 13 10 10 21 40 23 26 53 71 51 1 6 2 0 1 2 1 2 3 0 1 1 1 1 1 1 0 1 1 0 3 176 16 0 2 1 0 1 0 1 0 0 0 1 0 1 0 0 1 0 1 1 1
ath-miR2112-5p CGCAAAUGCGGAUAUCAAUGU 21 1,506 15 458 1    2 0 0 1 1 0 1 0 1 2 0 1 1 4 2 5 15 10 7 0 0 3 14 0 0 0 0 3 4 5 9 24 59 0 4 0 0 3 1 0 0 0 0 0 3 0 1 4 5 0 15 116 33 158 458 41 396 1 0 1 1 4 1 2 3 3 1 1 1 1 1 1 1 1 1 2 1 6 38 3 0 0 0 1 3 1 1 3 0 1 1 3 0 1 0 1 1 0 1 1
ath-miR2933a GAAAUCGGAGAGGAAAUUCGCC 22 16 0 3 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 1 1 1 1 0 0 0 0 1 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 2 3 1 0 0 0 1
ath-miR2933b GAAAUCGGAGAGGAAAUUCGCC 22 16 0 3 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 1 1 1 1 0 0 0 0 1 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 2 3 1 0 0 0 1
ath-miR2934-3p CAUCCAAGGUGUUUGUAGAAA 21 1,126 11 392 1    1 0 0 1 0 0 0 0 2 2 0 3 1 6 3 392 101 1 23 5 0 9 2 0 0 0 0 1 0 0 1 0 0 3 4 0 0 5 2 0 0 0 4 0 0 0 0 4 5 3 0 2 0 1 3 0 2 0 1 1 132 40 26 208 52 61 0 1 0 1 0 0 0 0 0 0 0 1 3 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 1 3 0 1 0
ath-miR2934-5p UCUUUCUGCAAACGCCUUGGA 21 1,206 12 181 1    0 0 0 1 0 0 0 0 3 1 1 1 0 1 1 181 31 0 4 2 0 0 0 0 6 0 0 14 19 25 35 23 37 5 0 14 2 11 3 0 0 4 8 0 0 0 0 8 3 10 11 8 5 3 0 4 2 1 1 1 29 29 39 49 38 43 0 1 0 0 0 0 0 1 1 0 0 1 0 3 0 0 2 6 6 3 14 5 128 86 66 70 30 28 22 6 7 1 1 1
ath-miR2936 CUUGAGAGAGAGAACACAGACG 22 91 1 74 1    0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 74 15 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR2937 AUAAGAGCUGUUGAAGGAGUC 21 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR2938 GAUCUUUUGAGAGGGUUCCAG 21 4 0 4 4    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR2939 UAACGCACAACACUAAGCCAU 21 7 0 4 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR319a UUGGACUGAAGGGAGCUCCCU 21 675,681 6,757 51,745 1    38 5 4 24 0 8 1 0 67 55 18 64 48 3,777 4,116 963 4,741 1,715 227 6,317 51,745 41 635 0 0 0 30 13,801 15,099 13,486 10,896 11,760 12,809 13,130 13,362 10,571 13,002 12,293 9,215 1,137 1,914 50,233 47,637 1,655 1,455 1,621 1,268 41,409 31,220 42,679 50,976 14,663 13,151 10,664 10,487 9,709 9,598 3,613 4,823 10,440 1,062 1,240 1,956 990 504 495 48 218 9 3 48 31 40 23 593 163 14 14 16 6 1,475 2,121 2,007 11,285 1,113 452 884 672 8,683 9,791 10,916 2,652 2,728 2,935 4,415 5,600 10,294 1,756 1,996 2,018
ath-miR319b UUGGACUGAAGGGAGCUCCCU 21 675,681 6,757 51,745 1    38 5 4 24 0 8 1 0 67 55 18 64 48 3,777 4,116 963 4,741 1,715 227 6,317 51,745 41 635 0 0 0 30 13,801 15,099 13,486 10,896 11,760 12,809 13,130 13,362 10,571 13,002 12,293 9,215 1,137 1,914 50,233 47,637 1,655 1,455 1,621 1,268 41,409 31,220 42,679 50,976 14,663 13,151 10,664 10,487 9,709 9,598 3,613 4,823 10,440 1,062 1,240 1,956 990 504 495 48 218 9 3 48 31 40 23 593 163 14 14 16 6 1,475 2,121 2,007 11,285 1,113 452 884 672 8,683 9,791 10,916 2,652 2,728 2,935 4,415 5,600 10,294 1,756 1,996 2,018
ath-miR319c UUGGACUGAAGGGAGCUCCUU 21 30,672 307 3,627 1    0 0 0 0 1 0 0 0 1 1 0 2 0 80 185 44 219 59 18 354 3,627 6 299 0 0 0 0 731 844 1,036 603 667 699 188 313 209 307 387 264 5 8 838 1,048 10 10 16 5 672 664 700 989 262 269 225 250 197 228 304 1,018 1,619 713 1,632 3,050 848 1,000 1,025 2 7 1 1 2 1 2 1 205 220 1 1 3 1 20 29 36 359 33 6 36 23 88 101 144 23 24 40 116 136 174 24 34 29
ath-miR3434-3p UCAGAGUAUCAGCCAUGUGA 20 187 2 20 1    0 0 0 0 0 0 0 0 0 0 0 0 0 2 1 2 0 0 9 0 0 0 0 0 0 0 0 6 7 6 20 14 10 7 2 4 3 1 3 2 5 6 12 7 0 1 0 5 9 4 4 8 7 0 3 0 6 0 1 1 1 1 1 2 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0
ath-miR3434-5p ACUUGGCUGAUUCUAUUAUU 20 138 1 14 1    0 0 0 0 0 0 1 0 0 1 0 1 1 1 0 0 0 0 3 0 0 0 0 0 0 0 0 2 1 8 2 4 6 2 4 0 0 0 3 0 2 14 4 0 3 3 0 2 10 6 6 3 0 4 0 1 4 0 0 0 0 1 1 2 1 1 0 1 0 0 0 1 0 0 0 0 0 1 2 1 0 0 1 0 3 3 0 0 5 4 1 0 2 1 0 1 0 1 1 1
ath-miR3440b-3p UGGAUUGGUCAAGGGAAGCGU 21 358 4 68 1    3 7 1 3 2 1 1 0 63 68 13 59 62 1 1 2 2 0 1 0 0 0 0 0 0 0 4 0 1 0 0 0 1 2 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 3 2 0 0 1 2 1 1 4 4 5 4 4 0 0 1 1 0 1 1 18 1 0 1 0 2 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR3440b-5p UUUUCUUGGCCCAUCCACUUC 21 31 0 4 1    0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 1 0 0 0 0 0 2 0 0 2 0 2 0 0 2 0 0 0 0 0 1 0 0 0 0 0 0 1 0 0 2 4 3 1 0 0 0 1 0 0 0 0 0 0 0 1 0 1 0 0 0 1 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1
ath-miR390a-3p CGCUAUCCAUCCUGAGUUUCA 21 16,981 170 2,426 1    23 38 8 16 15 14 16 5 286 284 182 241 341 777 221 56 132 23 235 703 2,426 325 956 0 6 8 0 167 114 201 235 145 252 158 222 268 263 190 176 26 26 205 231 21 15 22 14 256 120 304 231 427 256 412 889 1,296 985 8 6 6 76 35 42 412 64 57 6 3 56 12 6 10 7 79 48 20 4 2 279 220 2 0 1 1 6 0 1 2 2 2 7 0 1 1 5 6 4 6 3 9
ath-miR390a-5p AAGCUCAGGAGGGAUAGCGCC 21 276,965 2,770 26,664 4    2,388 5,728 1,912 1,844 2,258 581 1,480 646 20,525 26,096 7,404 21,460 26,664 2,371 3,409 1,075 3,285 4 22,064 3,843 25,566 13,960 4,649 165 198 134 143 177 104 161 210 154 237 595 901 1,057 432 1,320 268 403 308 882 607 413 404 335 464 1,219 787 1,070 2,382 2,574 488 1,247 2,037 1,480 4,433 35 73 12 1,084 622 1,116 1,810 1,049 1,066 10,202 705 1,940 814 400 286 636 836 1,746 576 1,442 231 15,019 2,544 41 48 26 78 312 150 97 129 486 487 421 407 301 179 412 326 415 532 327 546
ath-miR390b-3p CGCUAUCCAUCCUGAGUUCC 20 1,630 16 97 1    6 11 1 2 4 1 1 1 14 7 12 11 12 48 25 5 19 0 0 0 0 0 2 0 0 0 0 37 28 53 50 41 71 28 30 20 20 12 13 37 44 54 19 43 45 16 8 56 97 41 40 40 25 54 60 46 77 0 1 1 11 18 30 44 26 26 0 0 3 1 1 1 1 1 1 0 1 1 5 9 0 0 1 0 1 0 0 1 10 2 4 0 9 4 0 4 7 3 5 10
ath-miR390b-5p AAGCUCAGGAGGGAUAGCGCC 21 276,965 2,770 26,664 4    2,388 5,728 1,912 1,844 2,258 581 1,480 646 20,525 26,096 7,404 21,460 26,664 2,371 3,409 1,075 3,285 4 22,064 3,843 25,566 13,960 4,649 165 198 134 143 177 104 161 210 154 237 595 901 1,057 432 1,320 268 403 308 882 607 413 404 335 464 1,219 787 1,070 2,382 2,574 488 1,247 2,037 1,480 4,433 35 73 12 1,084 622 1,116 1,810 1,049 1,066 10,202 705 1,940 814 400 286 636 836 1,746 576 1,442 231 15,019 2,544 41 48 26 78 312 150 97 129 486 487 421 407 301 179 412 326 415 532 327 546
ath-miR391-3p ACGGUAUCUCUCCUACGUAGC 21 9,023 90 1,829 1    17 49 11 7 24 23 24 18 115 103 23 123 109 1 1 0 0 0 5 13 0 6 8 0 0 0 0 7 7 5 18 15 32 145 224 412 364 77 95 304 105 1,191 347 84 133 199 38 349 178 1,829 307 94 158 434 216 538 77 1 0 1 34 7 10 58 21 21 5 6 1 1 36 15 12 1 26 63 5 4 4 4 2 0 1 0 7 0 0 1 0 2 4 0 1 1 0 3 1 0 1 1
ath-miR391-5p UUCGCAGGAGAGAUAGCGCCA 21 28,941 289 3,037 1    505 359 160 345 97 76 69 30 2,867 3,037 603 2,882 2,590 244 99 34 59 69 12 235 19 2 181 0 0 8 0 53 38 31 3 6 6 271 313 98 57 581 128 9 14 26 84 25 39 6 22 149 157 41 174 422 187 463 290 67 185 3 30 8 218 101 97 242 140 164 870 2,769 799 2,687 430 255 257 12 63 9 461 168 117 448 0 0 2 2 2 0 1 0 7 10 11 0 0 1 3 12 13 0 1 1
ath-miR3932a AACUUUGUGAUGACAACGAAG 21 72 1 53 1    0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 53 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 1 0 0 2 1 1 0 1 7 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR3932b-3p AACUUUGUGAUGACAACGAAG 21 72 1 53 1    0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 53 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 1 0 0 2 1 1 0 1 7 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR3932b-5p UUUGACGUGCUCGAUCUGCUC 21 44 0 14 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 10 0 0 14 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 2 0 0 0 0 0 0 1 0 1 1 0 1 0 0 0 0 1 0 0 3 1 1 0 2 1 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0
ath-miR3933 AGAAGCAAAAUGACGACUCGG 21 1,923 19 390 1    27 13 5 18 8 1 22 1 294 390 41 317 369 2 2 0 4 0 1 2 0 0 0 0 0 16 9 1 1 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 2 0 0 1 1 0 0 2 1 19 12 18 80 50 47 1 0 1 1 1 1 0 1 1 0 0 24 78 9 0 0 1 2 0 0 0 0 0 0 0 6 5 5 0 1 0 0 1 3
ath-miR393a-3p AUCAUGCUAUCUCUUUGGAUU 21 922 9 95 1    1 0 0 1 1 0 1 0 8 5 2 4 8 1 1 2 4 22 20 14 5 33 2 0 0 0 0 1 0 1 6 3 18 13 7 10 8 1 6 19 8 26 26 13 7 16 12 19 12 39 25 9 16 11 35 46 38 0 0 1 1 1 1 5 3 2 0 1 1 0 1 1 1 0 9 22 0 1 95 1 0 0 0 0 61 77 9 30 0 1 0 0 0 1 0 1 0 4 3 2
ath-miR393a-5p UCCAAAGGGAUCGCAUUGAUCC 22 4,758 48 718 1    9 9 3 9 2 1 0 0 6 7 7 4 9 105 12 13 23 5 5 400 440 35 718 0 0 0 0 1 7 3 1 8 4 2 4 10 24 144 45 0 0 14 67 0 0 0 9 92 32 63 368 2 2 3 2 10 79 1 359 135 36 12 6 34 14 16 44 94 12 3 77 66 60 15 39 3 4 17 96 83 59 83 133 40 147 0 11 4 7 10 13 17 34 21 5 8 13 17 34 58
ath-miR393b-3p AUCAUGCGAUCUCUUUGGAUU 21 18,618 186 3,475 1    10 9 19 14 7 12 12 9 237 214 23 256 227 35 21 5 46 6 262 116 1,402 358 168 18 6 24 4 28 19 33 351 305 544 45 76 49 39 74 49 20 29 201 191 24 15 23 18 143 39 146 318 259 106 185 729 676 980 4 2 3 208 185 178 555 346 393 6 12 1 1 1 1 1 6 120 178 1 59 3,475 52 20 29 2 2 630 1,131 194 791 66 61 78 78 84 79 49 62 78 53 58 51
ath-miR393b-5p UCCAAAGGGAUCGCAUUGAUCC 22 4,758 48 718 1    9 9 3 9 2 1 0 0 6 7 7 4 9 105 12 13 23 5 5 400 440 35 718 0 0 0 0 1 7 3 1 8 4 2 4 10 24 144 45 0 0 14 67 0 0 0 9 92 32 63 368 2 2 3 2