Arabidopsis miRNA Abundances

The data below are based on the microRNAs listed in the Sanger registry. Adjust libraries/reads to display on the control panel.

        

        miRNA         miRNA sequence Len Sum (norm) Average Max Min (>0)  AxIDTAxIRPAxSRPColein5TWFTx4F
ath-miR156a-3p GCUCACUGCUCUUUCUGUCAGA 22 0 0 0 0    0 0 0 0 0 0 0
ath-miR156a-5p UGACAGAAGAGAGUGAGCAC 20 252 36 119 4    4 30 119 15 15 20 49
ath-miR156b-3p UGCUCACCUCUCUUUCUGUCAGU 23 0 0 0 0    0 0 0 0 0 0 0
ath-miR156b-5p UGACAGAAGAGAGUGAGCAC 20 252 36 119 4    4 30 119 15 15 20 49
ath-miR156c-3p GCUCACUGCUCUAUCUGUCAGA 22 0 0 0 0    0 0 0 0 0 0 0
ath-miR156c-5p UGACAGAAGAGAGUGAGCAC 20 252 36 119 4    4 30 119 15 15 20 49
ath-miR156d-3p GCUCACUCUCUUUUUGUCAUAAC 23 0 0 0 0    0 0 0 0 0 0 0
ath-miR156d-5p UGACAGAAGAGAGUGAGCAC 20 252 36 119 4    4 30 119 15 15 20 49
ath-miR156e UGACAGAAGAGAGUGAGCAC 20 252 36 119 4    4 30 119 15 15 20 49
ath-miR156f-3p GCUCACUCUCUAUCCGUCACC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR156f-5p UGACAGAAGAGAGUGAGCAC 20 252 36 119 4    4 30 119 15 15 20 49
ath-miR156g CGACAGAAGAGAGUGAGCAC 20 1 1 1 1    0 0 1 0 0 0 0
ath-miR156h UGACAGAAGAAAGAGAGCAC 20 0 0 0 0    0 0 0 0 0 0 0
ath-miR156i UGACAGAAGAGAGAGAGCAG 20 0 0 0 0    0 0 0 0 0 0 0
ath-miR156j UGACAGAAGAGAGAGAGCAC 20 397 199 248 149    0 0 0 248 149 0 0
ath-miR157a-3p GCUCUCUAGCCUUCUGUCAUC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR157a-5p UUGACAGAAGAUAGAGAGCAC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR157b-3p GCUCUCUAGCCUUCUGUCAUC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR157b-5p UUGACAGAAGAUAGAGAGCAC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR157c-3p GCUCUCUAUACUUCUGUCACC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR157c-5p UUGACAGAAGAUAGAGAGCAC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR157d UGACAGAAGAUAGAGAGCAC 20 14 4 5 1    0 3 0 5 5 0 1
ath-miR158a-3p UCCCAAAUGUAGACAAAGCA 20 112 22 48 6    6 48 6 0 0 19 33
ath-miR158a-5p CUUUGUCUACAAUUUUGGAAA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR158b CCCCAAAUGUAGACAAAGCA 20 30 15 19 11    0 0 0 19 11 0 0
ath-miR159a UUUGGAUUGAAGGGAGCUCUA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR159b-3p UUUGGAUUGAAGGGAGCUCUU 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR159b-5p GAGCUCCUUGAAGUUCAAUGG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR159c UUUGGAUUGAAGGGAGCUCCU 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR160a-3p GCGUAUGAGGAGCCAUGCAUA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR160a-5p UGCCUGGCUCCCUGUAUGCCA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR160b UGCCUGGCUCCCUGUAUGCCA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR160c-3p CGUACAAGGAGUCAAGCAUGA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR160c-5p UGCCUGGCUCCCUGUAUGCCA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR161.1 UGAAAGUGACUACAUCGGGGU 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR161.2 UCAAUGCAUUGAAAGUGACUA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR162a-3p UCGAUAAACCUCUGCAUCCAG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR162a-5p UGGAGGCAGCGGUUCAUCGAUC 22 0 0 0 0    0 0 0 0 0 0 0
ath-miR162b-3p UCGAUAAACCUCUGCAUCCAG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR162b-5p UGGAGGCAGCGGUUCAUCGAUC 22 0 0 0 0    0 0 0 0 0 0 0
ath-miR163 UUGAAGAGGACUUGGAACUUCGAU 24 0 0 0 0    0 0 0 0 0 0 0
ath-miR164a UGGAGAAGCAGGGCACGUGCA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR164b-3p CAUGUGCCCAUCUUCACCAUC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR164b-5p UGGAGAAGCAGGGCACGUGCA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR164c-3p CACGUGUUCUACUACUCCAAC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR164c-5p UGGAGAAGCAGGGCACGUGCG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR165a-3p UCGGACCAGGCUUCAUCCCCC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR165a-5p GGAAUGUUGUCUGGAUCGAGG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR165b UCGGACCAGGCUUCAUCCCCC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR166a-3p UCGGACCAGGCUUCAUUCCCC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR166a-5p GGACUGUUGUCUGGCUCGAGG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR166b-3p UCGGACCAGGCUUCAUUCCCC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR166b-5p GGACUGUUGUCUGGCUCGAGG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR166c UCGGACCAGGCUUCAUUCCCC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR166d UCGGACCAGGCUUCAUUCCCC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR166e-3p UCGGACCAGGCUUCAUUCCCC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR166e-5p GGAAUGUUGUCUGGCACGAGG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR166f UCGGACCAGGCUUCAUUCCCC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR166g UCGGACCAGGCUUCAUUCCCC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR167a-3p GAUCAUGUUCGCAGUUUCACC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR167a-5p UGAAGCUGCCAGCAUGAUCUA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR167b UGAAGCUGCCAGCAUGAUCUA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR167c-3p UAGGUCAUGCUGGUAGUUUCACC 23 0 0 0 0    0 0 0 0 0 0 0
ath-miR167c-5p UAAGCUGCCAGCAUGAUCUUG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR167d UGAAGCUGCCAGCAUGAUCUGG 22 0 0 0 0    0 0 0 0 0 0 0
ath-miR168a-3p CCCGCCUUGCAUCAACUGAAU 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR168a-5p UCGCUUGGUGCAGGUCGGGAA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR168b-3p CCCGUCUUGUAUCAACUGAAU 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR168b-5p UCGCUUGGUGCAGGUCGGGAA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR169a-3p GGCAAGUUGUCCUUGGCUAC 20 0 0 0 0    0 0 0 0 0 0 0
ath-miR169a-5p CAGCCAAGGAUGACUUGCCGA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR169b-3p GGCAAGUUGUCCUUCGGCUACA 22 0 0 0 0    0 0 0 0 0 0 0
ath-miR169b-5p CAGCCAAGGAUGACUUGCCGG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR169c CAGCCAAGGAUGACUUGCCGG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR169d UGAGCCAAGGAUGACUUGCCG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR169e UGAGCCAAGGAUGACUUGCCG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR169f-3p GCAAGUUGACCUUGGCUCUGC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR169f-5p UGAGCCAAGGAUGACUUGCCG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR169g-3p UCCGGCAAGUUGACCUUGGCU 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR169g-5p UGAGCCAAGGAUGACUUGCCG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR169h UAGCCAAGGAUGACUUGCCUG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR169i UAGCCAAGGAUGACUUGCCUG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR169j UAGCCAAGGAUGACUUGCCUG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR169k UAGCCAAGGAUGACUUGCCUG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR169l UAGCCAAGGAUGACUUGCCUG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR169m UAGCCAAGGAUGACUUGCCUG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR169n UAGCCAAGGAUGACUUGCCUG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR170-3p UGAUUGAGCCGUGUCAAUAUC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR170-5p UAUUGGCCUGGUUCACUCAGA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR171a-3p UGAUUGAGCCGCGCCAAUAUC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR171a-5p UAUUGGCCUGGUUCACUCAGA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR171b-3p UUGAGCCGUGCCAAUAUCACG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR171b-5p AGAUAUUAGUGCGGUUCAAUC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR171c-3p UUGAGCCGUGCCAAUAUCACG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR171c-5p AGAUAUUGGUGCGGUUCAAUC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR172a AGAAUCUUGAUGAUGCUGCAU 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR172b-3p AGAAUCUUGAUGAUGCUGCAU 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR172b-5p GCAGCACCAUUAAGAUUCAC 20 74 11 38 2    2 6 6 3 3 16 38
ath-miR172c AGAAUCUUGAUGAUGCUGCAG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR172d-3p AGAAUCUUGAUGAUGCUGCAG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR172d-5p GCAACAUCUUCAAGAUUCAGA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR172e-3p GGAAUCUUGAUGAUGCUGCAU 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR172e-5p GCAGCACCAUUAAGAUUCAC 20 74 11 38 2    2 6 6 3 3 16 38
ath-miR173-3p UGAUUCUCUGUGUAAGCGAAA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR173-5p UUCGCUUGCAGAGAGAAAUCAC 22 0 0 0 0    0 0 0 0 0 0 0
ath-miR1886.1 UGAGAGAAGUGAGAUGAAAUC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR1886.2 UGAGAUGAAAUCUUUGAUUGG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR1886.3 AAUUAAAGAUUUCAUCUUACU 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR1887 UACUAAGUAGAGUCUAAGAGA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR1888a UAAGUUAAGAUUUGUGAAGAA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR1888b UUAGGCUAAGAUUUGUGAAGA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR2111a-3p GUCCUCGGGAUGCGGAUUACC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR2111a-5p UAAUCUGCAUCCUGAGGUUUA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR2111b-3p AUCCUCGGGAUACAGUUUACC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR2111b-5p UAAUCUGCAUCCUGAGGUUUA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR2112-3p CUUUAUAUCCGCAUUUGCGCA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR2112-5p CGCAAAUGCGGAUAUCAAUGU 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR2933a GAAAUCGGAGAGGAAAUUCGCC 22 0 0 0 0    0 0 0 0 0 0 0
ath-miR2933b GAAAUCGGAGAGGAAAUUCGCC 22 0 0 0 0    0 0 0 0 0 0 0
ath-miR2934-3p CAUCCAAGGUGUUUGUAGAAA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR2934-5p UCUUUCUGCAAACGCCUUGGA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR2936 CUUGAGAGAGAGAACACAGACG 22 0 0 0 0    0 0 0 0 0 0 0
ath-miR2937 AUAAGAGCUGUUGAAGGAGUC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR2938 GAUCUUUUGAGAGGGUUCCAG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR2939 UAACGCACAACACUAAGCCAU 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR319a UUGGACUGAAGGGAGCUCCCU 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR319b UUGGACUGAAGGGAGCUCCCU 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR319c UUGGACUGAAGGGAGCUCCUU 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR3434-3p UCAGAGUAUCAGCCAUGUGA 20 0 0 0 0    0 0 0 0 0 0 0
ath-miR3434-5p ACUUGGCUGAUUCUAUUAUU 20 0 0 0 0    0 0 0 0 0 0 0
ath-miR3440b-3p UGGAUUGGUCAAGGGAAGCGU 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR3440b-5p UUUUCUUGGCCCAUCCACUUC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR390a-3p CGCUAUCCAUCCUGAGUUUCA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR390a-5p AAGCUCAGGAGGGAUAGCGCC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR390b-3p CGCUAUCCAUCCUGAGUUCC 20 16 4 9 1    0 1 0 9 3 0 3
ath-miR390b-5p AAGCUCAGGAGGGAUAGCGCC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR391-3p ACGGUAUCUCUCCUACGUAGC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR391-5p UUCGCAGGAGAGAUAGCGCCA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR3932a AACUUUGUGAUGACAACGAAG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR3932b-3p AACUUUGUGAUGACAACGAAG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR3932b-5p UUUGACGUGCUCGAUCUGCUC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR3933 AGAAGCAAAAUGACGACUCGG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR393a-3p AUCAUGCUAUCUCUUUGGAUU 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR393a-5p UCCAAAGGGAUCGCAUUGAUCC 22 0 0 0 0    0 0 0 0 0 0 0
ath-miR393b-3p AUCAUGCGAUCUCUUUGGAUU 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR393b-5p UCCAAAGGGAUCGCAUUGAUCC 22 0 0 0 0    0 0 0 0 0 0 0
ath-miR394a UUGGCAUUCUGUCCACCUCC 20 14 4 5 2    0 0 0 2 2 5 5
ath-miR394b-3p AGGUGGGCAUACUGCCAAUAG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR394b-5p UUGGCAUUCUGUCCACCUCC 20 14 4 5 2    0 0 0 2 2 5 5
ath-miR395a CUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR395b CUGAAGUGUUUGGGGGGACUC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR395c CUGAAGUGUUUGGGGGGACUC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR395d CUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR395e CUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR395f CUGAAGUGUUUGGGGGGACUC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR396a-3p GUUCAAUAAAGCUGUGGGAAG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR396a-5p UUCCACAGCUUUCUUGAACUG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR396b-3p GCUCAAGAAAGCUGUGGGAAA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR396b-5p UUCCACAGCUUUCUUGAACUU 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR397a UCAUUGAGUGCAGCGUUGAUG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR397b UCAUUGAGUGCAUCGUUGAUG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR398a-3p UGUGUUCUCAGGUCACCCCUU 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR398a-5p AAGGAGUGGCAUGUGAACACA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR398b-3p UGUGUUCUCAGGUCACCCCUG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR398b-5p AGGGUUGAUAUGAGAACACAC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR398c-3p UGUGUUCUCAGGUCACCCCUG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR398c-5p AGGGUUGAUAUGAGAACACAC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR399a UGCCAAAGGAGAUUUGCCCUG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR399b UGCCAAAGGAGAGUUGCCCUG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR399c-3p UGCCAAAGGAGAGUUGCCCUG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR399c-5p GGGCAUCUUUCUAUUGGCAGG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR399d UGCCAAAGGAGAUUUGCCCCG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR399e UGCCAAAGGAGAUUUGCCUCG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR399f UGCCAAAGGAGAUUUGCCCGG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR400 UAUGAGAGUAUUAUAAGUCAC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR401 CGAAACUGGUGUCGACCGACA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR402 UUCGAGGCCUAUUAAACCUCUG 22 0 0 0 0    0 0 0 0 0 0 0
ath-miR403-3p UUAGAUUCACGCACAAACUCG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR403-5p UGUUUUGUGCUUGAAUCUAAUU 22 0 0 0 0    0 0 0 0 0 0 0
ath-miR404 AUUAACGCUGGCGGUUGCGGCAGC 24 0 0 0 0    0 0 0 0 0 0 0
ath-miR405a AUGAGUUGGGUCUAACCCAUAACU 24 0 0 0 0    0 0 0 0 0 0 0
ath-miR405b AUGAGUUGGGUCUAACCCAUAACU 24 0 0 0 0    0 0 0 0 0 0 0
ath-miR405d AUGAGUUGGGUCUAACCCAUAACU 24 0 0 0 0    0 0 0 0 0 0 0
ath-miR406 UAGAAUGCUAUUGUAAUCCAG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR407 UUUAAAUCAUAUACUUUUGGU 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR408-3p AUGCACUGCCUCUUCCCUGGC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR408-5p ACAGGGAACAAGCAGAGCAUG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR413 AUAGUUUCUCUUGUUCUGCAC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR414 UCAUCUUCAUCAUCAUCGUCA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR415 AACAGAGCAGAAACAGAACAU 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR416 GGUUCGUACGUACACUGUUCA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR417 GAAGGUAGUGAAUUUGUUCGA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR418 UAAUGUGAUGAUGAACUGACC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR419 UUAUGAAUGCUGAGGAUGUUG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR420 UAAACUAAUCACGGAAAUGCA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR4221 UUUUCCUCUGUUGAAUUCUUGC 22 0 0 0 0    0 0 0 0 0 0 0
ath-miR4227 UCACUGGUACCAAUCAUUCCA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR4228-3p UCGGAUGCGAAACGGUGGUGU 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR4228-5p AUAGCCUUGAACGCCGUCGUU 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR4239 UUUGUUAUUUUCGCAUGCUCC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR4240 UGACUAGACCCGUAACAUUAC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR4243 UUGAAAUUGUAGAUUUCGUAC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR4245 ACAAAGUUUUAUACUGACAAU 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR426 UUUUGGAAAUUUGUCCUUACG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR447a-3p UUGGGGACGAGAUGUUUUGUUG 22 0 0 0 0    0 0 0 0 0 0 0
ath-miR447a.2-3p UAUGGAAGAAAUUGUAGUAUU 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR447b UUGGGGACGAGAUGUUUUGUUG 22 0 0 0 0    0 0 0 0 0 0 0
ath-miR447c-3p UUGGGGACGACAUCUUUUGUUG 22 0 0 0 0    0 0 0 0 0 0 0
ath-miR447c-5p CCCCUUACAAUGUCGAGUAAA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR472-3p UUUUUCCUACUCCGCCCAUACC 22 0 0 0 0    0 0 0 0 0 0 0
ath-miR472-5p AUGGUCGAAGUAGGCAAAAUC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR5012 UUUUACUGCUACUUGUGUUCC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR5013 UUUGUGACAUCUAGGUGCUUU 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR5014a-3p UUGUACAAAUUUAAGUGUACG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR5014a-5p ACACUUAGUUUUGUACAACAU 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR5014b AUUUGUACACCUAGAUCUGUA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR5015 UUGGUGUUAUGUGUAGUCUUC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR5016 UUCUUGUGGAUUCCUUGGAAA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR5017-3p UUAUACCAAAUUAAUAGCAAA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR5017-5p AUUUGUUACUAAUUUGGAAUG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR5018 UUAAAGCUCCACCAUGAGUCCAAU 24 0 0 0 0    0 0 0 0 0 0 0
ath-miR5019 UGUUGGGAAAGAAAAACUCUU 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR5020a UGGAAGAAGGUGAGACUUGCA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR5020b AUGGCAUGAAAGAAGGUGAGA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR5020c UGGCAUGGAAGAAGGUGAGAC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR5021 UGAGAAGAAGAAGAAGAAAA 20 2 2 2 2    0 0 0 0 0 0 2
ath-miR5022 GUCAUGGGGUAUGAUCGAAUG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR5023 AUUGGUAGUGGAUAAGGGGGC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR5024-3p CCGUAUCUUGGCCUUGUCAUU 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR5024-5p AUGACAAGGCCAAGAUAUAACA 22 0 0 0 0    0 0 0 0 0 0 0
ath-miR5025 ACUGUAUAUAUGUAAGUGACA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR5026 ACUCAUAAGAUCGUGACACGU 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR5027 ACCGGUUGGAACUUGCCUUAA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR5028 AAUUGGGUUUAUGCUAGAGUU 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR5029 AAUGAGAGAGAACACUGCAAA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR5595a ACAUAUGAUCUGCAUCUUUGC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR5628 GAAAUAGCGAAGAUAUGAUUA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR5629 UUAGGGUAGUUAACGGAAGUUA 22 0 0 0 0    0 0 0 0 0 0 0
ath-miR5630a GCUAAGAGCGGUUCUGAUGGA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR5630b GCUAAGAGCGGUUCUGAUGGA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR5631 UGGCAGGAAAGACAUAAUUUU 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR5632-3p UUGGAUUUAUAGUUGGAUAAG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR5632-5p UUGAUUCUCUUAUCCAACUGU 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR5633 UAUGAUCAUCAGAAAACAGUG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR5634 AGGGACUUUGUGAAUUUAGGG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR5635a UGUUAAGGAGUGUUAACGGUG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR5635b UGUUAAGGAGUGUUAACGGUG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR5635c UGUUAAGGAGUGUUAACGGUG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR5635d UGUUAAGGAGUGUUAACGGUG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR5636 CGUAGUUGCAGAGCUUGACGG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR5637 AAUGCGCAACUCUAUAUUUCC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR5638a AUACCAAAACUCUCUCACUUU 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR5638b ACAGUGGUCAUCUGGUGGGCU 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR5639-3p UUUAGCCUCAGACCACGGUGGACU 24 0 0 0 0    0 0 0 0 0 0 0
ath-miR5639-5p UAGUCCACUGUGGUCUAAGGC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR5640 UGAGAGAAGGAAUUAGAUUCA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR5641 UGGAAGAAGAUGAUAGAAUUA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR5642a UCUCGCGCUUGUACGGCUUU 20 6,009 858 3,267 3    192 3,267 1,385 3 3 438 721
ath-miR5642b UCUCGCGCUUGUACGGCUUU 20 6,009 858 3,267 3    192 3,267 1,385 3 3 438 721
ath-miR5643a AGGCUUUUAAGAUCUGGUUGC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR5643b AGGCUUUUAAGAUCUGGUUGC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR5644 GUGGGUUGCGGAUAACGGUA 20 1 1 1 1    0 0 0 1 0 0 0
ath-miR5645a AUUUGAGUCAUGUCGUUAAG 20 8 4 4 4    0 0 0 4 4 0 0
ath-miR5645b AUUUGAGUCAUGUCGUUAAG 20 8 4 4 4    0 0 0 4 4 0 0
ath-miR5645c AACCUAUUUAACGACAUGACU 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR5645d AUUUGAGUCAUGUCGUUAAG 20 8 4 4 4    0 0 0 4 4 0 0
ath-miR5645e AUUUGAGUCAUGUCGUUAAG 20 8 4 4 4    0 0 0 4 4 0 0
ath-miR5645f AUUUGAGUCAUGUCGUUAAG 20 8 4 4 4    0 0 0 4 4 0 0
ath-miR5646 GUUCGAGGCACGUUGGGAGG 20 4 2 3 1    0 0 0 1 3 0 0
ath-miR5647 UCAAGUUUGAUGACGAUUCCA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR5648-3p AUCUGAAGAAAAUAGCGGCAU 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR5648-5p UUUGGAAAUAUUUGGCUUGACU 22 0 0 0 0    0 0 0 0 0 0 0
ath-miR5649a AUUGAAUAUGUUGGUUACUAU 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR5649b AUUGAAUAUGUUGGUUACUAU 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR5650 UUGUUUUGGAUCUUAGAUACA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR5651 UUGUGCGGUUCAAAUAGUAAC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR5652 UUGAAUGUGAAUGAAUCGGGC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR5653 UGGGUUGAGUUGAGUUGAGUUGGC 24 0 0 0 0    0 0 0 0 0 0 0
ath-miR5654-3p UGGAAGAUGCUUUGGGAUUUAUU 23 0 0 0 0    0 0 0 0 0 0 0
ath-miR5654-5p AUAAAUCCCAACAUCUUCCA 20 4 4 4 4    0 0 4 0 0 0 0
ath-miR5655 AAGUAGACACAUAAGAAGGAG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR5656 ACUGAAGUAGAGAUUGGGUUU 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR5657 UGGACAAGGUUAGAUUUGGUG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR5658 AUGAUGAUGAUGAUGAUGAAA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR5659 CGAUGAAGGUCUUUGGAACGGUA 23 0 0 0 0    0 0 0 0 0 0 0
ath-miR5660 CAGGUGGUUAGUGCAAUGGAA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR5661 AGAGGUACAUCAUGUAGUCUG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR5662 AGAGGUGACCAUUGGAGAUG 20 0 0 0 0    0 0 0 0 0 0 0
ath-miR5663-3p UGAGAAUGCAAAUCCUUAGCU 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR5663-5p AGCUAAGGAUUUGCAUUCUCA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR5664 AUAGUCAAUUUUAUCGGUCUG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR5665 UUGGUGGACAAGAUCUGGGAU 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR5666 AUGGGACAUCGAGCAUUUAAU 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR5995b ACAUAUGAUCUGCAUCUUUGC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR5996 UGACAUCCAGAUAGAAGCUUUG 22 0 0 0 0    0 0 0 0 0 0 0
ath-miR5997 UGAAACCAAGUAGCUAAAUAG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR5998a ACAGUUUGUGUUUUGUUUUGU 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR5998b ACAGUUUGUGUUUUGUUUUGU 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR5999 UCUUCACUAUUAGACGGACAA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR771 UGAGCCUCUGUGGUAGCCCUCA 22 0 0 0 0    0 0 0 0 0 0 0
ath-miR773a UUUGCUUCCAGCUUUUGUCUC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR773b-3p UUUGAUUCCAGCUUUUGUCUC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR773b-5p GGCAAUAACUUGAGCAAACA 20 0 0 0 0    0 0 0 0 0 0 0
ath-miR774a UUGGUUACCCAUAUGGCCAUC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR774b-3p CAUCCAUAUUUUCAUCUCGAA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR774b-5p UGAGAUGAAGAUAUGGGUGAU 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR775 UUCGAUGUCUAGCAGUGCCA 20 28 5 8 1    0 2 1 7 3 7 8
ath-miR776 UCUAAGUCUUCUAUUGAUGUU 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR777 UACGCAUUGAGUUUCGUUGCUU 22 0 0 0 0    0 0 0 0 0 0 0
ath-miR778 UGGCUUGGUUUAUGUACACCG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR779.1 UUCUGCUAUGUUGCUGCUCAU 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR779.2 UGAUUGGAAAUUUCGUUGACU 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR780.1 UCUAGCAGCUGUUGAGCAGGU 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR780.2 UUCUUCGUGAAUAUCUGGCAU 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR781a UUAGAGUUUUCUGGAUACUUA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR781b UUAGAGUUUUCUGGAUACUUA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR782 ACAAACACCUUGGAUGUUCUU 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR8121 AAAGUAUAAUGGUUUAGUGGUUUG 24 0 0 0 0    0 0 0 0 0 0 0
ath-miR8165 AAUGGAGGCAAGUGUGAAGGA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR8166 AGAGAGUGUAGAAAGUUUCUCA 22 0 0 0 0    0 0 0 0 0 0 0
ath-miR8167a AGAUGUGGAGAUCGUGGGGAUG 22 0 0 0 0    0 0 0 0 0 0 0
ath-miR8167b AGAUGUGGAGAUCGUGGGGAUG 22 0 0 0 0    0 0 0 0 0 0 0
ath-miR8167c AGAUGUGGAGAUCGUGGGGAUG 22 0 0 0 0    0 0 0 0 0 0 0
ath-miR8167d AGAUGUGGAGAUCGUGGGGAUG 22 0 0 0 0    0 0 0 0 0 0 0
ath-miR8167e AGAUGUGGAGAUCGUGGGGAUG 22 0 0 0 0    0 0 0 0 0 0 0
ath-miR8167f AGAUGUGGAGAUCGUGGGGAUG 22 0 0 0 0    0 0 0 0 0 0 0
ath-miR8168 AGGUGCUGAGUGUGCUAGUGC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR8169 AUAGACAGAGUCACUCACAGA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR8170-3p UUGCUUAAAGAUUUUCUAUGU 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR8170-5p AUAGCAAAUCGAUAAGCAAUG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR8171 AUAGGUGGGCCAGUGGUAGGA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR8172 AUGGAUCAUCUAGAUGGAGAU 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR8173 AUGUGCUGAUUCGAGGUGGGA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR8174 AUGUGUAUAGGGAAGCUAAUC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR8175 GAUCCCCGGCAACGGCGCCA 20 2 2 2 2    0 0 0 2 0 0 0
ath-miR8176 GGCCGGUGGUCGCGAGAGGGA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR8177 GUGUGAUGAUGUGUCAUUUAUA 22 0 0 0 0    0 0 0 0 0 0 0
ath-miR8178 UAACAGAGUAAUUGUACAGUG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR8179 UGACUGCAUUAACUUGAUCGU 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR8180 UGCGGUGCGGGAGAAGUGC 19 7 7 7 7    0 0 0 7 0 0 0
ath-miR8181 UGGGGGUGGGGGGGUGACAG 20 0 0 0 0    0 0 0 0 0 0 0
ath-miR8182 UUGUGUUGCGUUUCUGUUGAUU 22 0 0 0 0    0 0 0 0 0 0 0
ath-miR8183 UUUAGUUGACGGAAUUGUGGC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR8184 UUUGGUCUGAUUACGAAUGUA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR822-3p UGUGCAAAUGCUUUCUACAGG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR822-5p UGCGGGAAGCAUUUGCACAUG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR823 UGGGUGGUGAUCAUAUAAGAU 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR824-3p CCUUCUCAUCGAUGGUCUAGA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR824-5p UAGACCAUUUGUGAGAAGGGA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR825 UUCUCAAGAAGGUGCAUGAAC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR826a UAGUCCGGUUUUGGAUACGUG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR826b UGGUUUUGGACACGUGAAAAU 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR827 UUAGAUGACCAUCAACAAACU 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR828 UCUUGCUUAAAUGAGUAUUCCA 22 0 0 0 0    0 0 0 0 0 0 0
ath-miR829-3p.1 AGCUCUGAUACCAAAUGAUGGAAU 24 0 0 0 0    0 0 0 0 0 0 0
ath-miR829-3p.2 CAAAUUAAAGCUUCAAGGUAG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR829-5p ACUUUGAAGCUUUGAUUUGAA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR830-3p UAACUAUUUUGAGAAGAAGUG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR830-5p UCUUCUCCAAAUAGUUUAGGUU 22 0 0 0 0    0 0 0 0 0 0 0
ath-miR831-3p UGAUCUCUUCGUACUCUUCUUG 22 0 0 0 0    0 0 0 0 0 0 0
ath-miR831-5p AGAAGCGUACAAGGAGAUGAGG 22 0 0 0 0    0 0 0 0 0 0 0
ath-miR832-3p UUGAUUCCCAAUCCAAGCAAG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR832-5p UGCUGGGAUCGGGAAUCGAAA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR833a-3p UAGACCGAUGUCAACAAACAAG 22 0 0 0 0    0 0 0 0 0 0 0
ath-miR833a-5p UGUUUGUUGUACUCGGUCUAGU 22 0 0 0 0    0 0 0 0 0 0 0
ath-miR833b UGUUUGUUGACAUCGGUCUAG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR834 UGGUAGCAGUAGCGGUGGUAA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR835-3p UGGAGAAGAUACGCAAGAAAG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR835-5p UUCUUGCAUAUGUUCUUUAUC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR836 UCCUGUGUUUCCUUUGAUGCGUGG 24 0 0 0 0    0 0 0 0 0 0 0
ath-miR837-3p AAACGAACAAAAAACUGAUGG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR837-5p AUCAGUUUCUUGUUCGUUUCA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR838 UUUUCUUCUACUUCUUGCACA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR839-5p UACCAACCUUUCAUCGUUCCC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR840-3p UUGUUUAGGUCCCUUAGUUUC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR840-5p ACACUGAAGGACCUAAACUAAC 22 0 0 0 0    0 0 0 0 0 0 0
ath-miR841a-3p AUUUCUAGUGGGUCGUAUUCA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR841a-5p UACGAGCCACUUGAAACUGAA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR841b-3p CAAUUUCUAGUGGGUCGUAUU 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR841b-5p UACGAGCCACUGGAAACUGAA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR842 UCAUGGUCAGAUCCGUCAUCC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR843 UUUAGGUCGAGCUUCAUUGGA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR844-3p UUAUAAGCCAUCUUACUAGUU 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR844-5p UGGUAAGAUUGCUUAUAAGCU 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR845a CGGCUCUGAUACCAAUUGAUG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR845b UCGCUCUGAUACCAAAUUGAUG 22 0 0 0 0    0 0 0 0 0 0 0
ath-miR846-3p UUGAAUUGAAGUGCUUGAAUU 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR846-5p CAUUCAAGGACUUCUAUUCAG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR847 UCACUCCUCUUCUUCUUGAUG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR848 UGACAUGGGACUGCCUAAGCUA 22 0 0 0 0    0 0 0 0 0 0 0
ath-miR849 UAACUAAACAUUGGUGUAGUA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR850 UAAGAUCCGGACUACAACAAAG 22 0 0 0 0    0 0 0 0 0 0 0
ath-miR851-3p UGGGUGGCAAACAAAGACGAC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR851-5p UCUCGGUUCGCGAUCCACAAG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR852 AAGAUAAGCGCCUUAGUUCUG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR853 UCCCCUCUUUAGCUUGGAGAAG 22 0 0 0 0    0 0 0 0 0 0 0
ath-miR854a GAUGAGGAUAGGGAGGAGGAG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR854b GAUGAGGAUAGGGAGGAGGAG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR854c GAUGAGGAUAGGGAGGAGGAG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR854d GAUGAGGAUAGGGAGGAGGAG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR854e GAUGAGGAUAGGGAGGAGGAG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR855 AGCAAAAGCUAAGGAAAAGGAA 22 0 0 0 0    0 0 0 0 0 0 0
ath-miR856 UAAUCCUACCAAUAACUUCAGC 22 0 0 0 0    0 0 0 0 0 0 0
ath-miR857 UUUUGUAUGUUGAAGGUGUAU 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR858a UUUCGUUGUCUGUUCGACCUU 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR858b UUCGUUGUCUGUUCGACCUUG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR859 UCUCUCUGUUGUGAAGUCAAA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR860 UCAAUAGAUUGGACUAUGUAU 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR861-3p GAUGGAUAUGUCUUCAAGGAC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR861-5p CCUUGGAGAAAUAUGCGUCAA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR862-3p AUAUGCUGGAUCUACUUGAAG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR862-5p UCCAAUAGGUCGAGCAUGUGC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR863-3p UUGAGAGCAACAAGACAUAAU 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR863-5p UUAUGUCUUGUUGAUCUCAAU 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR864-3p UAAAGUCAAUAAUACCUUGAAG 22 0 0 0 0    0 0 0 0 0 0 0
ath-miR864-5p UCAGGUAUGAUUGACUUCAAA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR865-3p UUUUUCCUCAAAUUUAUCCAA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR865-5p AUGAAUUUGGAUCUAAUUGAG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR866-3p ACAAAAUCCGUCUUUGAAGA 20 0 0 0 0    0 0 0 0 0 0 0
ath-miR866-5p UCAAGGAACGGAUUUUGUUAA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR867 UUGAACAUGGUUUAUUAGGAA 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR868-3p CUUCUUAAGUGCUGAUAAUGC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR868-5p UCAUGUCGUAAUAGUAGUCAC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR869.1 AUUGGUUCAAUUCUGGUGUUG 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR869.2 UCUGGUGUUGAGAUAGUUGAC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR870-3p UAAUUUGGUGUUUCUUCGAUC 21 0 0 0 0    0 0 0 0 0 0 0
ath-miR870-5p AAGAACAUCAAAUUAGAAUGU 21 0 0 0 0    0 0 0 0 0 0 0