Asparagus Small RNA miRNA Abundances

The data below are based on the microRNAs listed in the Sanger registry. Adjust libraries/reads to display on the control panel.


        miRNA         miRNA sequence Len Sum (norm) Average Max Min (>0)  leaf_r1ant1_07mm_r1ant2_11mm_r1ant3_15mm_r1ant4_18mm_r1ant5_20mm_r1pis_ma1_05mm_r1pis_ma2_07mm_r1pis_ma3_11mm_r1pis_ma4_15mm_r1pis_ma5_18mm_r1pis_fe1_15mm_r1pis_fe2_20mm_r1pis_fe3_28mm_r1pis_fe4_35mm_r1pis_fe5_42mm_r1pis_fe6_45mm_r1shoot_old_r1shoot_you_r18A_Fs8A_Ms8A_SMs8B_Fs8B_Ms8B_SMs10_Fs10_MsSt_AspaLf_AspaRt_AspaMFE_AspaMFM_AspaFeFE_AspaFeFM_AspaAsp_0_5_ant_budAsp_1_ant_budAsp_1_5_ant_budAsp_1_0_antAsp_1_5_ant
aof-miR12137 CAUCCUUCAAGAUCGAGGUCU 21 3,278 84 686 6    36 23 25 23 31 20 19 17 12 40 77 30 28 35 70 45 84 61 100 26 61 27 74 58 88 221 34 158 467 686 115 166 97 67 28 37 6 8 78
aof-miR12138 UUCCACCAUCUCGUGUCCCCC 21 4,191 107 732 2    0 25 43 31 16 25 90 298 58 7 14 30 12 12 13 6 10 0 0 491 488 443 168 145 121 181 128 732 6 6 88 193 157 126 2 5 0 5 16
aof-miR12139 CGAAUCAAACACAUUGUCGAG 21 737 19 180 1    74 0 1 2 6 0 4 4 2 6 5 6 2 2 1 0 1 3 48 11 22 8 0 6 2 3 5 104 173 180 11 5 28 3 3 3 0 0 3
aof-miR12140 UUGGCAGCGGCUGUAGAGCUGC 22 639 16 72 1    6 11 6 6 5 1 2 5 13 5 7 4 1 0 16 3 6 0 0 72 72 66 23 51 18 1 0 48 1 25 23 37 35 1 12 15 0 38 4
aof-miR12141 CACCUUAACUCGUACCUGUUAG 22 5,086 130 417 9    85 162 95 123 30 19 143 200 63 115 112 125 83 86 91 122 104 69 57 222 87 164 116 238 78 199 246 417 90 48 360 221 275 161 79 77 9 46 69
aof-miR12142 UAUUUUCGAGACAGUUGUAAC 21 1,986 51 176 10    22 34 43 75 176 136 30 47 32 29 39 23 18 35 25 61 25 36 10 0 0 0 0 43 76 78 55 63 140 41 82 92 88 58 85 41 37 78 33
aof-miR12143 UCGGGUGCAGUUGGAUCUGCG 21 851 22 262 1    25 7 3 2 16 20 2 8 5 262 1 1 1 5 1 23 2 4 23 28 16 20 7 15 4 15 4 59 55 68 34 29 32 17 14 4 2 10 7
aof-miR12144 UUCACGGCGUUCUCGAACUCC 21 6,473 166 466 6    113 49 39 48 51 28 63 105 85 118 99 172 68 103 125 164 138 157 78 405 369 460 230 238 166 444 301 466 463 6 219 113 144 113 98 161 55 114 105
aof-miR12145 AGAGAAGUCGGUCUAAAUGCUC 22 1,799 46 154 7    48 16 17 21 21 17 22 10 17 22 25 15 17 21 14 7 12 71 60 112 90 121 154 64 51 87 42 75 86 23 40 44 97 40 59 51 26 44 40
aof-miR12146 UCUGCAGUAGAUACACACUG 20 172 4 65 1    0 6 5 9 1 4 0 0 0 0 0 2 3 7 3 0 0 0 0 0 0 0 0 0 0 0 3 0 1 0 0 0 0 65 27 17 0 13 6
aof-miR12147 UCGAGAUGUGAAGGACUUUGU 21 2,723 70 277 3    17 10 7 11 16 8 41 74 129 80 93 30 10 22 3 23 7 23 8 42 72 66 88 172 119 277 224 71 148 12 197 186 136 90 62 75 10 7 57
aof-miR12148 UGAUUUUAGGAGAAAACGGUC 21 7,328 188 3,732 6    24 41 51 54 16 18 15 29 25 12 14 54 10 24 25 18 26 29 17 92 128 66 84 153 43 3,732 1,548 155 68 6 96 58 174 60 69 85 56 126 27
aof-miR12149 UGCUUCUUUGAUCGAUACGUCU 22 671 17 62 2    23 25 26 19 20 27 23 14 12 15 22 13 6 9 7 7 14 39 16 16 20 25 31 0 30 29 0 62 2 0 3 0 20 6 8 14 29 14 25
aof-miR12150 UUAACAGCAUUGUCGAAAAGC 21 1,373 35 166 5    49 12 13 23 16 8 6 8 5 19 54 8 9 15 13 22 25 21 12 45 142 104 35 55 39 0 35 18 147 166 32 68 36 27 14 22 10 7 33
aof-miR12151 UAACUUAAGAAUUGGGGAACC 21 555 14 95 2    18 17 14 12 20 5 6 12 3 7 8 7 9 12 7 9 7 10 11 3 6 2 4 6 2 4 20 15 95 4 34 27 19 32 32 10 11 18 17
aof-miR12152 UUGGCCGAGACACUCUGGGGU 21 9,427 242 585 54    309 246 197 226 219 144 123 202 336 450 472 382 261 384 215 139 257 585 480 54 87 63 129 145 102 110 151 184 152 87 201 245 240 154 306 442 201 510 237
aof-miR12153 GGCCAAAAUGGACGUAGUGUC 21 3,253 83 498 1    13 5 3 7 11 1 7 25 4 14 8 7 2 24 23 18 9 0 0 50 147 100 118 194 166 498 357 50 113 6 87 83 105 69 329 315 12 15 258
aof-miR12154 UUGUGGAUUCUUCAAAUGAGU 21 2,026 52 127 9    23 30 34 38 29 17 43 59 50 48 51 42 22 42 16 10 25 38 46 27 35 32 44 59 58 127 102 94 97 83 124 94 115 44 105 35 9 29 50
aof-miR12155 UGUGUAUGGACGAGAACCGGC 21 986 25 109 2    20 20 18 36 42 19 7 4 3 2 10 11 8 9 4 9 13 16 21 20 16 14 31 22 16 33 29 39 109 2 77 46 63 26 19 54 22 44 32
aof-miR12156 CUCUGUAGAUGUCGCGAUGGA 21 962 25 207 2    7 2 2 2 4 2 23 56 32 13 24 16 11 19 11 4 25 16 16 0 0 0 0 0 0 207 183 25 13 29 79 45 30 20 18 15 3 5 5
aof-miR12157 UAUUAGAGUUAGGUGAUUACU 21 1,616 41 210 4    8 25 12 11 12 7 23 37 17 16 14 25 23 20 27 17 31 10 6 26 23 19 27 39 50 37 45 59 208 0 210 152 177 102 31 22 4 28 16
aof-miR12158 UUGGUAUCUGGAUUGUAUAGC 21 2,846 73 179 4    28 48 39 64 42 52 74 144 114 100 108 68 71 65 47 44 55 155 21 30 0 47 65 116 59 127 137 104 51 4 74 109 179 84 71 91 38 84 37
aof-miR12159 UUCCGAGUGAAGAAUCGUUGCU 22 33,985 871 2,263 3    476 531 400 492 282 255 564 1,161 560 651 613 885 447 552 714 612 887 659 359 1,653 1,474 2,093 4 0 3 1,350 2,263 2,247 1,972 23 1,047 1,105 995 1,020 1,001 1,345 735 1,686 869
aof-miR12160 UUUCCAGACAUCUUCGUCAAGC 22 17,587 451 6,177 2    146 110 170 172 132 90 45 58 24 41 96 39 63 114 50 39 94 126 64 405 377 500 2,385 1,092 6,177 2,063 2 169 377 1,386 130 39 87 95 191 91 43 62 243
aof-miR12161 CGAGUUUUCACGUUUGGGCGA 21 14,880 382 1,538 1    176 101 175 201 86 31 297 243 745 59 369 374 1,144 1,311 421 495 544 605 1 0 0 0 0 0 0 1 419 0 1,329 0 1,324 1,318 1,538 75 602 505 78 226 87
aof-miR12162 UUUAGUCUGAUUUAGUAAAAU 21 951 24 75 1    1 30 32 31 16 20 20 22 7 10 19 12 10 17 10 12 6 10 2 12 17 9 19 75 42 29 11 21 40 10 37 46 46 40 48 55 30 61 16
aof-miR12163 AUUCCGCUCGUUUGACUCUAG 21 2,017 52 215 18    215 20 32 40 18 18 25 33 47 59 78 98 50 50 25 34 32 166 144 20 22 21 55 32 47 35 31 54 69 33 59 51 53 24 55 49 18 65 40
aof-miR12164 UCCCGAAACUCCGCAUGCCCAC 22 15,286 392 1,095 70    417 228 226 243 248 287 227 270 89 139 151 195 541 461 255 901 366 434 343 229 335 387 446 348 211 94 70 747 884 284 923 1,095 616 534 351 680 176 332 523
aof-miR12165 UGCACUUGGUCGCUCAAUGAC 21 431 11 68 1    22 14 11 11 4 0 2 4 2 3 7 2 3 9 2 2 3 26 11 1 4 5 6 9 7 9 22 19 68 4 24 30 25 22 9 5 3 12 9
aof-miR12166 UGAUUUCUAGCUGUCUAACCC 21 20,691 531 3,876 5    2,647 111 96 128 16 5 70 94 72 155 116 149 44 68 130 528 172 213 358 3,876 912 1,789 250 1,077 73 1,517 887 2,874 45 95 222 213 580 98 266 266 17 59 403
aof-miR12167 UUUAGUAAAAUUAGUCGUCACU 22 631 16 53 1    23 10 14 11 8 7 0 4 5 3 14 10 7 5 4 1 6 16 10 21 50 53 30 25 50 24 29 9 25 25 26 26 23 16 4 9 6 15 7
aof-miR12168 UUUGAUUAUUGGAUUGUUGCCU 22 2,502 64 267 1    13 18 15 14 4 5 14 70 52 44 18 62 24 27 50 32 50 54 17 207 176 244 120 139 74 245 113 267 90 2 29 1 1 14 23 42 32 69 31
aof-miR12169 UAGGAGUUAUUGGAUUGGGUU 21 1,810 46 602 1    61 28 32 71 37 14 30 162 152 6 6 11 6 4 7 0 8 34 45 2 1 4 2 2 0 77 25 8 9 43 88 72 51 602 31 22 27 24 6
aof-miR12170 UAAGAACUCAUGAAUAAAUGCA 22 823 21 52 3    3 21 18 20 19 9 6 18 16 23 26 18 7 15 9 10 16 9 5 52 37 38 24 39 19 32 30 35 6 8 25 29 24 22 10 30 27 42 26
aof-miR12171 UCCUUGUAGAUGAGUUGUGCA 21 8,163 209 1,043 47    1,043 113 98 151 222 255 162 152 145 239 201 156 124 173 115 85 213 663 586 47 148 125 183 180 179 58 146 241 395 129 153 150 75 115 230 227 78 92 316
aof-miR12172 CACGUGACUGUUCCUUUCAAA 21 2,659 68 235 3    14 42 19 31 25 17 29 16 40 42 29 88 72 144 78 90 81 71 85 95 118 93 31 125 141 149 88 0 158 37 148 235 3 72 57 40 26 30 0
aof-miR12173 UAUGAAUUUCCGCUGUAGUUU 21 33,123 849 3,616 193    514 318 447 470 1,631 1,233 413 548 711 871 1,135 929 279 669 853 294 1,138 1,024 509 193 317 216 330 378 412 989 682 1,899 799 462 2,922 3,616 1,569 966 631 675 222 513 1,346
aof-miR12174 CGUUUUCUUGGAUUGAUAGAGA 22 270 7 65 1    0 0 1 2 2 1 0 1 1 2 2 0 0 1 2 0 2 1 0 15 12 17 65 7 50 58 1 7 1 2 2 1 3 1 3 1 1 2 3
aof-miR12175 UUGGAUCAGUUUCAUCAGAAG 21 3,155 81 186 19    56 55 57 64 120 81 57 106 83 122 113 69 32 63 52 28 107 37 41 50 99 60 53 127 104 66 87 104 116 60 178 186 161 138 63 50 19 33 58
aof-miR12176 UUCUAGUAGCAUUGCAUGGAC 21 1,507 39 988 1    0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 1 512 988 0 1 0 0 0 0 1 0 0 0 0 0
aof-miR12177 CCAGAACAGAUGGUACACCUC 21 1,708 44 176 2    44 15 8 28 13 2 6 6 12 22 24 24 42 60 52 64 71 70 51 4 6 10 26 22 32 9 21 76 135 0 40 42 20 35 110 176 75 97 158
aof-miR156a UGACAGAAGAGAGUGAGCAC 20 18,349 470 4,135 1    2,817 594 873 1,559 4,135 2,455 100 127 79 142 118 70 85 128 102 102 48 214 442 7 79 18 48 47 104 1 14 51 1,767 73 153 503 47 60 202 203 221 206 355
aof-miR156b UUGACAGAAGAUAGAGAGCAC 21 29,290 751 7,354 11    643 2,866 2,999 2,243 415 447 137 134 67 30 57 63 33 35 71 38 66 354 997 80 234 91 427 471 342 61 137 11 2,258 7,354 143 1,541 81 100 133 403 1,569 1,088 1,071
aof-miR156c UGACAGAAGAGAGAGAGCAC 20 3,135 80 601 1    1 2 3 16 94 63 126 139 37 12 10 400 554 601 222 398 404 0 0 0 0 0 0 2 2 0 1 0 2 0 0 9 0 26 0 3 1 0 7
aof-miR159 UUUGGAUUGAAGGGAGCUCUA 21 2,806,155 71,953 207,682 1,962    77,186 4,574 6,044 7,275 15,249 19,296 57,388 59,596 47,416 49,648 62,739 46,921 51,688 57,535 37,387 11,876 53,788 58,713 67,340 150,495 99,607 146,823 130,401 127,770 90,830 188,730 140,411 207,682 146,352 51,709 162,041 76,316 153,381 79,785 23,713 14,536 2,154 1,962 19,798
aof-miR160a UGCCUGGCUCCCUGAAUGCCA 21 59 2 29 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 1 0 2 0 0 0 5 29 15 0 1 2 0 0 0 1 0 0
aof-miR160b UGCCUGGUUCCCUGUAUGCCA 21 26,951 691 1,508 71    177 332 279 261 327 403 1,258 1,419 432 771 949 700 772 1,144 655 1,298 1,037 301 197 327 421 421 716 883 731 1,071 1,097 693 1,328 131 1,508 737 1,091 932 890 499 71 189 503
aof-miR160c UGCCUGGCUCCCUGUAUGCCA 21 11,513 295 1,676 1    5 32 17 16 13 15 80 80 21 33 42 22 46 91 52 65 99 1 3 245 381 274 501 512 358 790 1,174 646 1,676 41 1,183 947 852 881 89 107 14 40 69
aof-miR164 UGGAGAAGCAGGGCACGUGCA 21 2,545 65 916 1    11 2 3 4 3 2 10 5 5 16 8 5 2 4 5 0 9 100 53 20 23 23 40 47 50 64 79 187 303 916 158 150 112 122 1 0 0 0 3
aof-miR166a UCUCGGACCAGGCUUCAUUCC 21 12,352,782 316,738 2,205,573 39,727    497,291 54,761 57,671 112,505 162,406 131,051 104,266 136,710 200,581 350,586 319,788 223,994 113,737 174,282 115,134 145,394 140,721 415,962 644,157 277,888 406,333 422,855 350,413 325,858 288,720 438,229 309,027 497,010 331,159 2,205,573 417,972 524,087 532,658 265,522 132,658 167,358 39,727 76,141 242,597
aof-miR166b UCUCGGACCAGGCUUCAUUCU 21 492,398 12,626 57,069 789    8,858 1,833 1,584 2,103 1,321 789 5,617 4,811 4,830 5,546 5,895 2,382 971 1,767 1,520 1,823 1,510 17,901 8,973 18,223 14,522 25,630 27,696 36,729 34,490 40,286 18,359 57,069 12,154 1,318 29,435 18,386 32,386 11,440 16,669 9,018 847 1,289 6,418
aof-miR166c UCGGACCAGGCUUCAUCCCCC 21 2,102,912 53,921 706,256 491    11,632 15,348 18,276 49,693 706,256 381,557 33,981 43,987 10,899 15,212 13,321 26,888 12,300 15,560 12,814 29,472 14,928 4,185 4,300 18,399 16,310 28,001 58,954 52,741 39,006 34,868 44,179 14,315 23,152 491 78,301 20,158 63,725 15,998 86,455 38,353 6,153 10,557 32,187
aof-miR166d UCGGACCAGGCUUCAUUCCCC 21 35,005,990 897,589 3,243,153 178,471    3,243,153 403,703 458,529 785,531 2,405,994 1,709,236 991,777 1,661,656 515,759 857,758 658,100 690,528 363,398 480,007 311,204 711,228 421,038 1,389,178 2,395,375 278,945 376,783 454,765 744,336 744,380 779,983 831,458 848,403 647,859 1,454,235 645,225 890,580 710,776 748,538 524,930 1,192,456 880,307 178,471 315,572 1,304,836
aof-miR167a UGAAGCUGCCAGCAUGAUCUA 21 4,777 122 630 1    30 55 51 39 74 63 36 34 5 6 6 17 28 29 16 3 20 1 7 101 247 126 149 251 230 442 571 121 471 8 630 168 421 178 67 19 11 28 18
aof-miR167b UGAAGCUGCCAGCAUGAUCUGA 22 436,307 11,187 80,797 97    36,418 31,341 32,921 47,503 80,797 41,877 2,356 2,892 432 175 176 4,071 4,578 5,646 2,874 4,248 3,492 11,983 22,510 97 619 176 682 2,256 1,475 484 1,703 211 20,261 850 1,916 10,312 2,901 4,423 11,237 6,799 9,266 15,074 9,275
aof-miR167c UGAAGCUGCCAGCAUGAUCUG 21 53,450 1,371 5,174 56    5,174 3,235 3,569 4,136 2,380 1,986 450 544 184 92 88 258 85 77 71 56 75 2,402 4,303 577 859 629 893 1,326 1,220 1,309 1,095 1,445 2,396 4,545 676 1,527 754 386 880 547 1,349 804 1,068
aof-miR168a UCGCUUGGUGCAGGUCGGGAA 21 60,949 1,563 4,596 456    3,485 2,640 1,975 1,950 1,097 592 865 1,030 456 799 759 461 906 1,694 992 1,636 1,095 2,573 3,459 743 967 947 937 941 608 911 1,565 1,804 4,314 4,596 2,016 2,688 1,766 1,615 1,563 1,295 537 628 2,044
aof-miR168b UCGCUUGGUGCAGGUCGGGUC 21 183,844 4,714 14,699 1,310    4,474 4,045 4,601 4,805 1,310 1,334 3,267 4,611 3,572 5,641 14,699 3,643 1,526 2,467 3,294 8,935 3,612 7,006 3,398 7,029 6,654 6,382 4,251 5,032 3,508 6,190 5,137 10,294 4,261 2,271 3,991 7,905 3,666 4,172 3,013 3,720 1,984 2,131 6,013
aof-miR169a UAGCCAAGGAUGAUUUGCCUA 21 428 11 63 1    1 12 27 4 10 11 0 0 0 0 4 2 4 6 3 3 4 6 2 7 27 10 6 3 10 3 8 5 32 46 23 63 32 39 1 4 2 6 2
aof-miR169b UAAGCCAAGGAUGACUUGCCU 21 349 9 41 1    3 16 13 3 12 6 1 1 0 1 7 0 3 24 4 22 3 0 12 0 4 2 9 2 1 1 6 18 37 12 21 41 14 23 5 6 4 1 11
aof-miR169c UAGCCAAGGAUGACUUGCCU 20 12,226 313 903 24    55 513 796 413 457 367 77 62 30 24 147 52 58 213 133 339 133 156 122 233 456 375 292 150 492 49 350 180 795 178 588 903 566 455 327 432 267 377 614
aof-miR171a UGAUUGAGCCGUGCCAAUAUC 21 3,612 93 338 3    15 71 66 47 89 43 63 66 26 57 86 46 64 86 74 66 110 0 3 89 91 92 146 152 63 149 338 88 288 4 282 155 241 149 73 39 20 44 31
aof-miR171b UUGAGCCGCGCCAAUAUCACU 21 1,712 44 170 1    0 31 14 20 10 2 17 11 0 1 0 12 13 16 13 1 25 24 40 99 43 78 116 168 50 94 129 170 68 2 148 38 90 30 27 21 28 20 43
aof-miR171c UUGAGCCGCGUCAAUAUCUCC 21 15,000 385 1,205 17    231 498 554 527 461 269 400 467 102 112 149 138 167 192 209 168 300 63 81 180 342 227 381 483 401 356 623 273 1,058 17 949 1,117 827 1,205 531 308 100 93 441
aof-miR172 AGAAUCUUGAUGAUGCUGCAU 21 4,239 109 376 2    11 55 91 98 203 166 8 6 4 2 2 8 19 35 13 31 16 35 20 202 179 173 127 162 115 310 208 308 376 222 302 207 235 169 38 12 27 18 26
aof-miR2118a CUCCCGAUGCCACCUAAUCCUU 22 91,134 2,337 12,383 1    1 1,428 1,145 877 476 507 687 513 133 94 82 243 324 214 196 81 137 17 5 122 1,008 456 1,584 3,760 1,829 727 3,152 394 82 274 7,721 6,963 12,134 5,743 6,007 12,383 2,719 12,129 4,787
aof-miR2118b UUCCCGAAGCCUCCCAUUUCUA 22 1,352 35 218 1    0 52 42 33 11 24 17 13 2 1 4 13 0 1 2 0 1 0 0 5 69 28 69 194 77 47 50 3 1 0 155 57 218 69 14 21 22 31 6
aof-miR2118c UUUCCGAUGCCACCCAAUCCUU 22 505 13 71 1    0 40 29 14 3 7 10 11 0 2 4 2 6 2 2 1 1 1 0 1 7 1 13 18 12 8 22 0 0 2 68 51 71 61 5 6 6 12 6
aof-miR2275a UUCGGUUUCCUCCAACAUCUCA 22 2,162 55 270 1    0 243 175 134 3 1 4 1 0 1 0 2 0 2 1 0 0 0 0 0 17 3 18 92 13 7 117 0 1 0 193 165 270 118 103 134 90 181 73
aof-miR2275b UCUGGUUUCCUCCAAUAUCUCA 22 720 18 250 1    0 97 80 37 0 0 1 4 0 0 0 0 0 0 0 0 0 0 0 0 7 0 4 15 1 0 24 0 1 2 31 250 45 12 5 9 57 29 9
aof-miR2275c UUUGAUUUCCUCCAAUAUCUCA 22 195 5 94 1    0 13 18 13 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5 0 1 6 2 0 2 0 0 0 12 94 13 7 1 3 3 1 1
aof-miR2275d AGAAUUAGAGGAUUGCAAACC 21 296 8 68 1    0 24 1 1 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 15 0 17 12 0 0 12 0 0 0 27 3 56 1 40 68 2 9 6
aof-miR319a UUGGACUGAAGGGAGCUCCCU 21 869,571 22,297 104,724 233    233 1,204 882 1,332 1,260 1,543 11,300 15,470 21,455 38,544 39,613 8,965 8,282 12,883 13,641 6,339 13,605 3,649 4,607 42,148 37,608 34,984 31,398 34,710 36,314 59,804 57,227 104,724 5,966 37,309 41,868 28,083 46,508 27,837 16,383 10,248 869 1,943 8,833
aof-miR319b UUUGGACUGAAGGGAGCUCCU 21 67,458 1,730 3,191 162    1,050 343 397 300 311 220 610 533 1,051 1,511 2,686 2,786 1,650 2,947 2,937 2,975 3,191 734 1,109 2,471 2,584 2,148 1,583 2,079 2,024 2,620 3,117 1,474 2,815 162 2,093 2,434 2,058 3,052 2,760 1,560 348 676 2,059
aof-miR390 AAGCUCAGGAGGGAUAGCGCC 21 22,350 573 1,331 16    137 378 429 424 222 102 990 1,326 317 176 122 430 259 198 371 923 338 41 16 636 873 800 1,179 1,093 573 722 922 521 883 33 962 800 765 1,088 1,331 757 113 282 818
aof-miR391 UACGCAGGAGAGAUGAUGCCA 21 625 16 130 1    2 1 1 0 0 0 2 4 1 2 5 1 0 0 7 1 4 16 8 52 55 51 40 27 32 45 24 130 31 2 28 11 25 2 6 1 1 0 7
aof-miR393a UCCAAAGGGAUCGCAUUGAUUC 22 4,306 110 1,082 3    3 151 128 152 483 306 23 34 16 23 52 19 33 50 26 81 70 86 5 68 34 53 29 35 21 31 51 550 63 1,082 59 120 49 65 19 27 88 46 75
aof-miR393b UCCAAAGGGAUCGCAUUGAUCU 22 314,447 8,063 32,764 463    853 25,905 32,764 31,151 30,638 16,009 851 1,365 634 549 463 1,917 2,213 2,769 3,159 6,980 4,154 1,106 1,043 1,728 4,654 1,994 539 855 612 646 3,064 4,382 19,137 617 3,869 22,832 13,885 18,411 1,898 6,121 16,908 11,104 16,668
aof-miR394 UUGGCAUUCUGUCCACCUCC 20 7,737 198 581 7    53 156 13 129 124 83 110 150 90 121 178 12 225 284 223 21 100 7 32 268 294 180 208 257 172 419 474 308 250 99 581 328 408 383 413 155 59 106 264
aof-miR395a UGAAGUGUUUGGGGGAACUCU 21 3,324 85 580 1    69 147 79 45 23 20 42 7 2 30 42 1 20 57 2 33 2 3 156 9 4 5 14 27 137 70 9 353 130 414 280 332 104 580 29 15 1 3 28
aof-miR395b AUGAAGUGUAUGGGGGAACUC 21 360 9 74 1    14 8 10 2 3 5 6 0 0 2 1 0 0 2 0 3 0 4 32 0 1 1 3 0 2 1 0 34 13 2 42 49 19 74 13 6 0 0 8
aof-miR396a UUCCACGGCUUUCUUGAACUG 21 2,084,147 53,440 293,600 2,307    285,902 42,403 64,095 119,358 293,600 202,043 22,773 31,124 25,933 43,003 53,048 34,563 29,552 47,685 35,039 80,787 55,980 163,314 170,908 2,307 3,167 2,733 3,369 4,852 4,780 2,413 5,622 30,983 73,134 13,725 8,272 34,816 9,793 14,329 3,431 9,048 19,167 13,248 23,848
aof-miR396b UUCCACAGCUUUCUUGAACUG 21 398,543 10,219 85,062 528    29,848 3,163 3,236 3,018 6,371 10,683 951 1,223 2,804 9,969 18,033 4,860 6,849 13,705 5,164 14,673 11,546 85,062 68,651 528 1,856 906 1,317 1,072 1,220 779 1,449 4,220 12,771 36,994 2,639 7,261 2,906 3,881 2,097 3,813 3,063 4,097 5,865
aof-miR398 UGUGUUCUCAGGUCGCCCCUG 21 25,851 663 10,618 4    8,362 26 142 285 352 138 16 13 49 260 125 33 4 6 12 34 18 897 399 9 344 40 724 35 333 385 623 390 10,618 33 56 135 184 548 23 41 86 25 48
aof-miR399a UGCCAAAGGAGAGUUGCCCUG 21 14,533 373 3,870 8    163 208 181 126 117 105 43 52 44 181 343 24 8 44 29 59 31 519 217 115 19 25 52 715 38 31 42 449 3,870 27 935 2,815 904 1,827 39 35 15 10 76
aof-miR399b GUGCAACUCUCCUUUGGCACC 21 8,454 217 2,049 5    121 86 98 49 111 46 10 12 13 91 246 5 13 37 10 271 9 126 472 479 56 171 10 48 8 100 57 745 1,054 72 534 2,049 362 708 8 53 25 6 83
aof-miR399c GGGCACCUCGUCAUUGGCAGG 21 447 11 92 1    18 21 7 4 10 1 1 0 0 1 7 0 1 6 1 12 0 0 24 15 1 8 0 16 0 9 16 37 42 4 23 92 22 26 6 4 2 5 5
aof-miR408 UGCACUGCCUCUUCCCUGGCU 21 3,325 85 1,015 5    258 40 83 122 123 84 22 11 11 50 73 21 11 24 16 30 25 574 135 5 37 10 49 9 32 21 63 40 1,015 8 20 64 28 120 16 8 11 12 44
aof-miR477a ACUCUCCCUCAAGGGCUUCCG 21 4,162 107 727 2    45 103 156 82 73 73 17 18 14 2 29 10 13 29 33 21 35 65 57 164 198 99 69 172 63 72 158 242 87 727 146 302 169 211 143 55 30 37 143
aof-miR477b AUCUCUCUCCCUCAAAGGCUCU 22 153 4 139 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 5 139 2 4 0 1 1 0 0 0 0 0 0 0
aof-miR479 UGAGCCGAACCAAUAUCACUC 21 27,647 709 9,035 33    47 716 899 756 98 100 477 624 173 132 107 132 45 47 76 33 101 198 110 836 1,410 918 726 713 869 2,324 962 2,587 36 9,035 227 411 249 364 311 222 222 125 229
aof-miR482a UUUCCAAUGCCUCCCAUUCCGG 22 192,940 4,947 26,307 13    330 1,451 1,896 1,616 1,175 1,183 1,910 2,619 486 321 285 478 414 303 364 345 637 494 161 8,459 6,234 8,297 4,274 7,971 13 22,391 22,761 26,307 11,689 4,211 19,408 8,053 16,008 6,813 1,090 481 278 571 1,163
aof-miR482b UUUCCAAAACCUCCCAUUCCGA 22 29,762 763 12,324 1    25 209 393 551 181 96 61 47 10 12 14 15 15 24 20 25 16 74 28 2,355 1,694 1,682 968 1,110 1,756 1 3 2,682 204 12,324 587 899 705 672 54 27 66 31 126
aof-miR482c UUGCCUACUCCGCCCAUUCCCC 22 56,570 1,451 7,084 158    626 744 881 1,109 657 677 583 667 330 426 449 378 467 490 425 443 602 659 673 1,348 1,647 1,548 1,818 1,735 1,020 1,125 1,705 4,552 7,084 5,954 3,893 2,978 4,081 3,630 386 158 208 166 248
aof-miR5139a GAAACCUGGCUCUGAUACCA 20 23,267 597 4,441 37    185 884 673 237 184 515 449 198 266 288 353 398 662 837 1,279 905 1,261 220 204 85 38 76 113 92 37 82 128 72 110 87 90 72 105 104 1,574 1,502 4,441 2,936 1,525
aof-miR5139b AUCAACCUGGCUCUGAUACCA 21 1,431 37 380 1    3 9 7 3 1 2 7 1 1 2 0 2 8 7 32 15 15 5 2 17 6 8 21 14 2 9 16 9 13 4 12 8 11 12 161 173 380 265 168
aof-miR535 UGACAACGAGAGAGAGCACGC 21 31,919 818 6,666 103    1,221 115 103 114 246 411 335 275 218 246 199 340 870 764 585 460 626 3,150 2,164 186 810 488 942 561 790 141 331 598 2,332 6,666 1,010 663 572 431 786 881 114 166 1,009
aof-miR536 UCGUGCCACGCUGUGUGCGUC 21 468 12 120 1    9 0 1 2 1 1 0 0 1 0 5 0 0 2 1 1 1 0 0 36 14 7 2 7 7 8 3 120 96 0 42 46 19 22 3 4 0 1 6
aof-miR8155 GUAACCUGGCUCUGAUACCA 20 6,386 164 617 8    31 123 67 15 8 63 70 17 55 50 81 65 242 287 579 298 489 37 43 172 54 140 258 155 66 156 220 139 193 73 164 93 190 148 174 218 617 361 175
aof-miR827 UUAGAUGACCAUCAACAAACA 21 33,493 859 10,423 1    43 8 6 4 3 1 34 36 28 103 95 70 222 323 154 89 222 20 31 697 571 666 122 405 60 199 104 2,511 4,715 66 10,423 2,199 5,811 3,055 270 68 0 1 58
aof-miR828 UCUUGCUUAGAUGAGUGUUCCU 22 103 3 43 1    6 0 0 3 8 1 0 0 0 0 0 0 0 0 0 0 0 3 3 0 0 3 0 0 0 0 0 1 23 43 0 5 0 4 0 0 0 0 0