Asparagus miRNA Abundances

The data below are based on the microRNAs listed in the Sanger registry. Adjust libraries/reads to display on the control panel.

        

        miRNA         miRNA sequence Len Sum (norm) Average Max Min (>0)  8A_Fs8A_Ms8A_SMs8B_Fs8B_Ms8B_SMs10_Fs10_MsSt_AspaLf_AspaRt_AspaMFE_AspaMFM_AspaFeFE_AspaFeFM_Aspa
aof-miR12137 CAUCCUUCAAGAUCGAGGUCU 21 2,345 156 686 26    26 61 27 74 58 88 221 34 158 467 686 115 166 97 67
aof-miR12138 UUCCACCAUCUCGUGUCCCCC 21 3,473 232 732 6    491 488 443 168 145 121 181 128 732 6 6 88 193 157 126
aof-miR12139 CGAAUCAAACACAUUGUCGAG 21 561 40 180 2    11 22 8 0 6 2 3 5 104 173 180 11 5 28 3
aof-miR12140 UUGGCAGCGGCUGUAGAGCUGC 22 473 34 72 1    72 72 66 23 51 18 1 0 48 1 25 23 37 35 1
aof-miR12141 CACCUUAACUCGUACCUGUUAG 22 2,922 195 417 48    222 87 164 116 238 78 199 246 417 90 48 360 221 275 161
aof-miR12142 UAUUUUCGAGACAGUUGUAAC 21 816 74 140 41    0 0 0 0 43 76 78 55 63 140 41 82 92 88 58
aof-miR12143 UCGGGUGCAGUUGGAUCUGCG 21 403 27 68 4    28 16 20 7 15 4 15 4 59 55 68 34 29 32 17
aof-miR12144 UUCACGGCGUUCUCGAACUCC 21 4,137 276 466 6    405 369 460 230 238 166 444 301 466 463 6 219 113 144 113
aof-miR12145 AGAGAAGUCGGUCUAAAUGCUC 22 1,126 75 154 23    112 90 121 154 64 51 87 42 75 86 23 40 44 97 40
aof-miR12146 UCUGCAGUAGAUACACACUG 20 69 23 65 1    0 0 0 0 0 0 0 3 0 1 0 0 0 0 65
aof-miR12147 UCGAGAUGUGAAGGACUUUGU 21 1,900 127 277 12    42 72 66 88 172 119 277 224 71 148 12 197 186 136 90
aof-miR12148 UGAUUUUAGGAGAAAACGGUC 21 6,463 431 3,732 6    92 128 66 84 153 43 3,732 1,548 155 68 6 96 58 174 60
aof-miR12149 UGCUUCUUUGAUCGAUACGUCU 22 244 22 62 2    16 20 25 31 0 30 29 0 62 2 0 3 0 20 6
aof-miR12150 UUAACAGCAUUGUCGAAAAGC 21 949 68 166 18    45 142 104 35 55 39 0 35 18 147 166 32 68 36 27
aof-miR12151 UAACUUAAGAAUUGGGGAACC 21 273 18 95 2    3 6 2 4 6 2 4 20 15 95 4 34 27 19 32
aof-miR12152 UUGGCCGAGACACUCUGGGGU 21 2,104 140 245 54    54 87 63 129 145 102 110 151 184 152 87 201 245 240 154
aof-miR12153 GGCCAAAAUGGACGUAGUGUC 21 2,143 143 498 6    50 147 100 118 194 166 498 357 50 113 6 87 83 105 69
aof-miR12154 UUGUGGAUUCUUCAAAUGAGU 21 1,135 76 127 27    27 35 32 44 59 58 127 102 94 97 83 124 94 115 44
aof-miR12155 UGUGUAUGGACGAGAACCGGC 21 543 36 109 2    20 16 14 31 22 16 33 29 39 109 2 77 46 63 26
aof-miR12156 CUCUGUAGAUGUCGCGAUGGA 21 631 70 207 13    0 0 0 0 0 0 207 183 25 13 29 79 45 30 20
aof-miR12157 UAUUAGAGUUAGGUGAUUACU 21 1,174 84 210 19    26 23 19 27 39 50 37 45 59 208 0 210 152 177 102
aof-miR12158 UUGGUAUCUGGAUUGUAUAGC 21 1,186 85 179 4    30 0 47 65 116 59 127 137 104 51 4 74 109 179 84
aof-miR12159 UUCCGAGUGAAGAAUCGUUGCU 22 17,249 1,232 2,263 3    1,653 1,474 2,093 4 0 3 1,350 2,263 2,247 1,972 23 1,047 1,105 995 1,020
aof-miR12160 UUUCCAGACAUCUUCGUCAAGC 22 15,284 1,019 6,177 2    405 377 500 2,385 1,092 6,177 2,063 2 169 377 1,386 130 39 87 95
aof-miR12161 CGAGUUUUCACGUUUGGGCGA 21 6,004 858 1,538 1    0 0 0 0 0 0 1 419 0 1,329 0 1,324 1,318 1,538 75
aof-miR12162 UUUAGUCUGAUUUAGUAAAAU 21 454 30 75 9    12 17 9 19 75 42 29 11 21 40 10 37 46 46 40
aof-miR12163 AUUCCGCUCGUUUGACUCUAG 21 606 40 69 20    20 22 21 55 32 47 35 31 54 69 33 59 51 53 24
aof-miR12164 UCCCGAAACUCCGCAUGCCCAC 22 7,203 480 1,095 70    229 335 387 446 348 211 94 70 747 884 284 923 1,095 616 534
aof-miR12165 UGCACUUGGUCGCUCAAUGAC 21 255 17 68 1    1 4 5 6 9 7 9 22 19 68 4 24 30 25 22
aof-miR12166 UGAUUUCUAGCUGUCUAACCC 21 14,508 967 3,876 45    3,876 912 1,789 250 1,077 73 1,517 887 2,874 45 95 222 213 580 98
aof-miR12167 UUUAGUAAAAUUAGUCGUCACU 22 432 29 53 9    21 50 53 30 25 50 24 29 9 25 25 26 26 23 16
aof-miR12168 UUUGAUUAUUGGAUUGUUGCCU 22 1,722 115 267 1    207 176 244 120 139 74 245 113 267 90 2 29 1 1 14
aof-miR12169 UAGGAGUUAUUGGAUUGGGUU 21 986 70 602 1    2 1 4 2 2 0 77 25 8 9 43 88 72 51 602
aof-miR12170 UAAGAACUCAUGAAUAAAUGCA 22 420 28 52 6    52 37 38 24 39 19 32 30 35 6 8 25 29 24 22
aof-miR12171 UCCUUGUAGAUGAGUUGUGCA 21 2,324 155 395 47    47 148 125 183 180 179 58 146 241 395 129 153 150 75 115
aof-miR12172 CACGUGACUGUUCCUUUCAAA 21 1,493 107 235 3    95 118 93 31 125 141 149 88 0 158 37 148 235 3 72
aof-miR12173 UAUGAAUUUCCGCUGUAGUUU 21 15,750 1,050 3,616 193    193 317 216 330 378 412 989 682 1,899 799 462 2,922 3,616 1,569 966
aof-miR12174 CGUUUUCUUGGAUUGAUAGAGA 22 242 16 65 1    15 12 17 65 7 50 58 1 7 1 2 2 1 3 1
aof-miR12175 UUGGAUCAGUUUCAUCAGAAG 21 1,589 106 186 50    50 99 60 53 127 104 66 87 104 116 60 178 186 161 138
aof-miR12176 UUCUAGUAGCAUUGCAUGGAC 21 1,505 251 988 1    2 0 0 0 0 1 512 988 0 1 0 0 0 0 1
aof-miR12177 CCAGAACAGAUGGUACACCUC 21 478 34 135 4    4 6 10 26 22 32 9 21 76 135 0 40 42 20 35
aof-miR156a UGACAGAAGAGAGUGAGCAC 20 2,972 198 1,767 1    7 79 18 48 47 104 1 14 51 1,767 73 153 503 47 60
aof-miR156b UUGACAGAAGAUAGAGAGCAC 21 13,331 889 7,354 11    80 234 91 427 471 342 61 137 11 2,258 7,354 143 1,541 81 100
aof-miR156c UGACAGAAGAGAGAGAGCAC 20 42 7 26 1    0 0 0 0 2 2 0 1 0 2 0 0 9 0 26
aof-miR159 UUUGGAUUGAAGGGAGCUCUA 21 1,952,333 130,156 207,682 51,709    150,495 99,607 146,823 130,401 127,770 90,830 188,730 140,411 207,682 146,352 51,709 162,041 76,316 153,381 79,785
aof-miR160a UGCCUGGCUCCCUGAAUGCCA 21 58 6 29 1    1 2 1 0 2 0 0 0 5 29 15 0 1 2 0
aof-miR160b UGCCUGGUUCCCUGUAUGCCA 21 12,087 806 1,508 131    327 421 421 716 883 731 1,071 1,097 693 1,328 131 1,508 737 1,091 932
aof-miR160c UGCCUGGCUCCCUGUAUGCCA 21 10,461 697 1,676 41    245 381 274 501 512 358 790 1,174 646 1,676 41 1,183 947 852 881
aof-miR164 UGGAGAAGCAGGGCACGUGCA 21 2,294 153 916 20    20 23 23 40 47 50 64 79 187 303 916 158 150 112 122
aof-miR166a UCUCGGACCAGGCUUCAUUCC 21 7,593,304 506,220 2,205,573 265,522    277,888 406,333 422,855 350,413 325,858 288,720 438,229 309,027 497,010 331,159 2,205,573 417,972 524,087 532,658 265,522
aof-miR166b UCUCGGACCAGGCUUCAUUCU 21 378,123 25,208 57,069 1,318    18,223 14,522 25,630 27,696 36,729 34,490 40,286 18,359 57,069 12,154 1,318 29,435 18,386 32,386 11,440
aof-miR166c UCGGACCAGGCUUCAUCCCCC 21 508,598 33,907 78,301 491    18,399 16,310 28,001 58,954 52,741 39,006 34,868 44,179 14,315 23,152 491 78,301 20,158 63,725 15,998
aof-miR166d UCGGACCAGGCUUCAUUCCCC 21 10,681,196 712,080 1,454,235 278,945    278,945 376,783 454,765 744,336 744,380 779,983 831,458 848,403 647,859 1,454,235 645,225 890,580 710,776 748,538 524,930
aof-miR167a UGAAGCUGCCAGCAUGAUCUA 21 4,114 274 630 8    101 247 126 149 251 230 442 571 121 471 8 630 168 421 178
aof-miR167b UGAAGCUGCCAGCAUGAUCUGA 22 48,366 3,224 20,261 97    97 619 176 682 2,256 1,475 484 1,703 211 20,261 850 1,916 10,312 2,901 4,423
aof-miR167c UGAAGCUGCCAGCAUGAUCUG 21 19,637 1,309 4,545 386    577 859 629 893 1,326 1,220 1,309 1,095 1,445 2,396 4,545 676 1,527 754 386
aof-miR168a UCGCUUGGUGCAGGUCGGGAA 21 26,418 1,761 4,596 608    743 967 947 937 941 608 911 1,565 1,804 4,314 4,596 2,016 2,688 1,766 1,615
aof-miR168b UCGCUUGGUGCAGGUCGGGUC 21 80,743 5,383 10,294 2,271    7,029 6,654 6,382 4,251 5,032 3,508 6,190 5,137 10,294 4,261 2,271 3,991 7,905 3,666 4,172
aof-miR169a UAGCCAAGGAUGAUUUGCCUA 21 314 21 63 3    7 27 10 6 3 10 3 8 5 32 46 23 63 32 39
aof-miR169b UAAGCCAAGGAUGACUUGCCU 21 191 14 41 1    0 4 2 9 2 1 1 6 18 37 12 21 41 14 23
aof-miR169c UAGCCAAGGAUGACUUGCCU 20 6,062 404 903 49    233 456 375 292 150 492 49 350 180 795 178 588 903 566 455
aof-miR171a UGAUUGAGCCGUGCCAAUAUC 21 2,327 155 338 4    89 91 92 146 152 63 149 338 88 288 4 282 155 241 149
aof-miR171b UUGAGCCGCGCCAAUAUCACU 21 1,323 88 170 2    99 43 78 116 168 50 94 129 170 68 2 148 38 90 30
aof-miR171c UUGAGCCGCGUCAAUAUCUCC 21 8,439 563 1,205 17    180 342 227 381 483 401 356 623 273 1,058 17 949 1,117 827 1,205
aof-miR172 AGAAUCUUGAUGAUGCUGCAU 21 3,295 220 376 115    202 179 173 127 162 115 310 208 308 376 222 302 207 235 169
aof-miR2118a CUCCCGAUGCCACCUAAUCCUU 22 45,949 3,063 12,134 82    122 1,008 456 1,584 3,760 1,829 727 3,152 394 82 274 7,721 6,963 12,134 5,743
aof-miR2118b UUCCCGAAGCCUCCCAUUUCUA 22 1,042 74 218 1    5 69 28 69 194 77 47 50 3 1 0 155 57 218 69
aof-miR2118c UUUCCGAUGCCACCCAAUCCUU 22 335 26 71 1    1 7 1 13 18 12 8 22 0 0 2 68 51 71 61
aof-miR2275a UUCGGUUUCCUCCAACAUCUCA 22 1,014 85 270 1    0 17 3 18 92 13 7 117 0 1 0 193 165 270 118
aof-miR2275b UCUGGUUUCCUCCAAUAUCUCA 22 392 36 250 1    0 7 0 4 15 1 0 24 0 1 2 31 250 45 12
aof-miR2275c UUUGAUUUCCUCCAAUAUCUCA 22 142 16 94 1    0 5 0 1 6 2 0 2 0 0 0 12 94 13 7
aof-miR2275d AGAAUUAGAGGAUUGCAAACC 21 143 18 56 1    0 15 0 17 12 0 0 12 0 0 0 27 3 56 1
aof-miR319a UUGGACUGAAGGGAGCUCCCU 21 626,488 41,766 104,724 5,966    42,148 37,608 34,984 31,398 34,710 36,314 59,804 57,227 104,724 5,966 37,309 41,868 28,083 46,508 27,837
aof-miR319b UUUGGACUGAAGGGAGCUCCU 21 32,714 2,181 3,117 162    2,471 2,584 2,148 1,583 2,079 2,024 2,620 3,117 1,474 2,815 162 2,093 2,434 2,058 3,052
aof-miR390 AAGCUCAGGAGGGAUAGCGCC 21 11,850 790 1,179 33    636 873 800 1,179 1,093 573 722 922 521 883 33 962 800 765 1,088
aof-miR391 UACGCAGGAGAGAUGAUGCCA 21 555 37 130 2    52 55 51 40 27 32 45 24 130 31 2 28 11 25 2
aof-miR393a UCCAAAGGGAUCGCAUUGAUUC 22 2,310 154 1,082 21    68 34 53 29 35 21 31 51 550 63 1,082 59 120 49 65
aof-miR393b UCCAAAGGGAUCGCAUUGAUCU 22 97,225 6,482 22,832 539    1,728 4,654 1,994 539 855 612 646 3,064 4,382 19,137 617 3,869 22,832 13,885 18,411
aof-miR394 UUGGCAUUCUGUCCACCUCC 20 4,629 309 581 99    268 294 180 208 257 172 419 474 308 250 99 581 328 408 383
aof-miR395a UGAAGUGUUUGGGGGAACUCU 21 2,468 165 580 4    9 4 5 14 27 137 70 9 353 130 414 280 332 104 580
aof-miR395b AUGAAGUGUAUGGGGGAACUC 21 241 20 74 1    0 1 1 3 0 2 1 0 34 13 2 42 49 19 74
aof-miR396a UUCCACGGCUUUCUUGAACUG 21 214,295 14,286 73,134 2,307    2,307 3,167 2,733 3,369 4,852 4,780 2,413 5,622 30,983 73,134 13,725 8,272 34,816 9,793 14,329
aof-miR396b UUCCACAGCUUUCUUGAACUG 21 79,799 5,320 36,994 528    528 1,856 906 1,317 1,072 1,220 779 1,449 4,220 12,771 36,994 2,639 7,261 2,906 3,881
aof-miR398 UGUGUUCUCAGGUCGCCCCUG 21 14,457 964 10,618 9    9 344 40 724 35 333 385 623 390 10,618 33 56 135 184 548
aof-miR399a UGCCAAAGGAGAGUUGCCCUG 21 11,864 791 3,870 19    115 19 25 52 715 38 31 42 449 3,870 27 935 2,815 904 1,827
aof-miR399b GUGCAACUCUCCUUUGGCACC 21 6,453 430 2,049 8    479 56 171 10 48 8 100 57 745 1,054 72 534 2,049 362 708
aof-miR399c GGGCACCUCGUCAUUGGCAGG 21 311 24 92 1    15 1 8 0 16 0 9 16 37 42 4 23 92 22 26
aof-miR408 UGCACUGCCUCUUCCCUGGCU 21 1,521 101 1,015 5    5 37 10 49 9 32 21 63 40 1,015 8 20 64 28 120
aof-miR477a ACUCUCCCUCAAGGGCUUCCG 21 2,879 192 727 63    164 198 99 69 172 63 72 158 242 87 727 146 302 169 211
aof-miR477b AUCUCUCUCCCUCAAAGGCUCU 22 153 22 139 1    0 0 1 0 0 0 5 139 2 4 0 1 1 0 0
aof-miR479 UGAGCCGAACCAAUAUCACUC 21 21,667 1,444 9,035 36    836 1,410 918 726 713 869 2,324 962 2,587 36 9,035 227 411 249 364
aof-miR482a UUUCCAAUGCCUCCCAUUCCGG 22 172,889 11,526 26,307 13    8,459 6,234 8,297 4,274 7,971 13 22,391 22,761 26,307 11,689 4,211 19,408 8,053 16,008 6,813
aof-miR482b UUUCCAAAACCUCCCAUUCCGA 22 27,642 1,843 12,324 1    2,355 1,694 1,682 968 1,110 1,756 1 3 2,682 204 12,324 587 899 705 672
aof-miR482c UUGCCUACUCCGCCCAUUCCCC 22 44,118 2,941 7,084 1,020    1,348 1,647 1,548 1,818 1,735 1,020 1,125 1,705 4,552 7,084 5,954 3,893 2,978 4,081 3,630
aof-miR5139a GAAACCUGGCUCUGAUACCA 20 1,291 86 128 37    85 38 76 113 92 37 82 128 72 110 87 90 72 105 104
aof-miR5139b AUCAACCUGGCUCUGAUACCA 21 162 11 21 2    17 6 8 21 14 2 9 16 9 13 4 12 8 11 12
aof-miR535 UGACAACGAGAGAGAGCACGC 21 16,521 1,101 6,666 141    186 810 488 942 561 790 141 331 598 2,332 6,666 1,010 663 572 431
aof-miR536 UCGUGCCACGCUGUGUGCGUC 21 429 31 120 2    36 14 7 2 7 7 8 3 120 96 0 42 46 19 22
aof-miR8155 GUAACCUGGCUCUGAUACCA 20 2,221 148 258 54    172 54 140 258 155 66 156 220 139 193 73 164 93 190 148
aof-miR827 UUAGAUGACCAUCAACAAACA 21 31,604 2,107 10,423 60    697 571 666 122 405 60 199 104 2,511 4,715 66 10,423 2,199 5,811 3,055
aof-miR828 UCUUGCUUAGAUGAGUGUUCCU 22 79 13 43 1    0 0 3 0 0 0 0 0 1 23 43 0 5 0 4