Asparagus miRNA Abundances

The data below are based on the microRNAs listed in the Sanger registry. Adjust libraries/reads to display on the control panel.

        

        miRNA         miRNA sequence Len Sum (norm) Average Max Min (>0)  8AF_d8AM_d8ASM_d8BF_d8BM_d8BSM_d10F_d10M_dAspM_midAspM_earAspFM_midAspFM_earAsp_shootAsp_Lf
aof-miR12137 CAUCCUUCAAGAUCGAGGUCU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR12138 UUCCACCAUCUCGUGUCCCCC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR12139 CGAAUCAAACACAUUGUCGAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR12140 UUGGCAGCGGCUGUAGAGCUGC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR12141 CACCUUAACUCGUACCUGUUAG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR12142 UAUUUUCGAGACAGUUGUAAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR12143 UCGGGUGCAGUUGGAUCUGCG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR12144 UUCACGGCGUUCUCGAACUCC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR12145 AGAGAAGUCGGUCUAAAUGCUC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR12146 UCUGCAGUAGAUACACACUG 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR12147 UCGAGAUGUGAAGGACUUUGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR12148 UGAUUUUAGGAGAAAACGGUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR12149 UGCUUCUUUGAUCGAUACGUCU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR12150 UUAACAGCAUUGUCGAAAAGC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR12151 UAACUUAAGAAUUGGGGAACC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR12152 UUGGCCGAGACACUCUGGGGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR12153 GGCCAAAAUGGACGUAGUGUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR12154 UUGUGGAUUCUUCAAAUGAGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR12155 UGUGUAUGGACGAGAACCGGC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR12156 CUCUGUAGAUGUCGCGAUGGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR12157 UAUUAGAGUUAGGUGAUUACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR12158 UUGGUAUCUGGAUUGUAUAGC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR12159 UUCCGAGUGAAGAAUCGUUGCU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR12160 UUUCCAGACAUCUUCGUCAAGC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR12161 CGAGUUUUCACGUUUGGGCGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR12162 UUUAGUCUGAUUUAGUAAAAU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR12163 AUUCCGCUCGUUUGACUCUAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR12164 UCCCGAAACUCCGCAUGCCCAC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR12165 UGCACUUGGUCGCUCAAUGAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR12166 UGAUUUCUAGCUGUCUAACCC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR12167 UUUAGUAAAAUUAGUCGUCACU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR12168 UUUGAUUAUUGGAUUGUUGCCU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR12169 UAGGAGUUAUUGGAUUGGGUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR12170 UAAGAACUCAUGAAUAAAUGCA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR12171 UCCUUGUAGAUGAGUUGUGCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR12172 CACGUGACUGUUCCUUUCAAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR12173 UAUGAAUUUCCGCUGUAGUUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR12174 CGUUUUCUUGGAUUGAUAGAGA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR12175 UUGGAUCAGUUUCAUCAGAAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR12176 UUCUAGUAGCAUUGCAUGGAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR12177 CCAGAACAGAUGGUACACCUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR156a UGACAGAAGAGAGUGAGCAC 20 49 7 29 1    0 0 0 0 0 1 1 0 12 3 0 2 1 29
aof-miR156b UUGACAGAAGAUAGAGAGCAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR156c UGACAGAAGAGAGAGAGCAC 20 15 4 9 1    0 0 0 0 1 0 0 0 4 0 9 1 0 0
aof-miR159 UUUGGAUUGAAGGGAGCUCUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR160a UGCCUGGCUCCCUGAAUGCCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR160b UGCCUGGUUCCCUGUAUGCCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR160c UGCCUGGCUCCCUGUAUGCCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR164 UGGAGAAGCAGGGCACGUGCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR166a UCUCGGACCAGGCUUCAUUCC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR166b UCUCGGACCAGGCUUCAUUCU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR166c UCGGACCAGGCUUCAUCCCCC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR166d UCGGACCAGGCUUCAUUCCCC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR167a UGAAGCUGCCAGCAUGAUCUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR167b UGAAGCUGCCAGCAUGAUCUGA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR167c UGAAGCUGCCAGCAUGAUCUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR168a UCGCUUGGUGCAGGUCGGGAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR168b UCGCUUGGUGCAGGUCGGGUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR169a UAGCCAAGGAUGAUUUGCCUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR169b UAAGCCAAGGAUGACUUGCCU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR169c UAGCCAAGGAUGACUUGCCU 20 1 1 1 1    0 0 0 0 0 0 0 0 0 0 1 0 0 0
aof-miR171a UGAUUGAGCCGUGCCAAUAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR171b UUGAGCCGCGCCAAUAUCACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR171c UUGAGCCGCGUCAAUAUCUCC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR172 AGAAUCUUGAUGAUGCUGCAU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR2118a CUCCCGAUGCCACCUAAUCCUU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR2118b UUCCCGAAGCCUCCCAUUUCUA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR2118c UUUCCGAUGCCACCCAAUCCUU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR2275a UUCGGUUUCCUCCAACAUCUCA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR2275b UCUGGUUUCCUCCAAUAUCUCA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR2275c UUUGAUUUCCUCCAAUAUCUCA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR2275d AGAAUUAGAGGAUUGCAAACC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR319a UUGGACUGAAGGGAGCUCCCU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR319b UUUGGACUGAAGGGAGCUCCU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR390 AAGCUCAGGAGGGAUAGCGCC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR391 UACGCAGGAGAGAUGAUGCCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR393a UCCAAAGGGAUCGCAUUGAUUC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR393b UCCAAAGGGAUCGCAUUGAUCU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR394 UUGGCAUUCUGUCCACCUCC 20 28 3 7 1    2 0 1 0 1 1 4 5 3 7 1 2 1 0
aof-miR395a UGAAGUGUUUGGGGGAACUCU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR395b AUGAAGUGUAUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR396a UUCCACGGCUUUCUUGAACUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR396b UUCCACAGCUUUCUUGAACUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR398 UGUGUUCUCAGGUCGCCCCUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR399a UGCCAAAGGAGAGUUGCCCUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR399b GUGCAACUCUCCUUUGGCACC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR399c GGGCACCUCGUCAUUGGCAGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR408 UGCACUGCCUCUUCCCUGGCU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR477a ACUCUCCCUCAAGGGCUUCCG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR477b AUCUCUCUCCCUCAAAGGCUCU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR479 UGAGCCGAACCAAUAUCACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR482a UUUCCAAUGCCUCCCAUUCCGG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR482b UUUCCAAAACCUCCCAUUCCGA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR482c UUGCCUACUCCGCCCAUUCCCC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR5139a GAAACCUGGCUCUGAUACCA 20 2 1 1 1    0 0 1 0 0 0 1 0 0 0 0 0 0 0
aof-miR5139b AUCAACCUGGCUCUGAUACCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR535 UGACAACGAGAGAGAGCACGC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR536 UCGUGCCACGCUGUGUGCGUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR8155 GUAACCUGGCUCUGAUACCA 20 6 1 1 1    1 1 0 1 0 0 0 1 0 1 0 0 0 1
aof-miR827 UUAGAUGACCAUCAACAAACA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0
aof-miR828 UCUUGCUUAGAUGAGUGUUCCU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0