Apple Small RNA miRNA Abundances

The data below are based on the microRNAs listed in the Sanger registry. Adjust libraries/reads to display on the control panel.


        miRNA         miRNA sequence Len Sum (norm) Average Max Min (>0)  APL_FlAPL_FrtAPL_LfAPL_Rt
mdm-miR10978a GUUGGGAAUCGAAGCAUCACGA 22 3 1 3 3    0 3 0 0
mdm-miR10978b GUUGGGAAUCGAAGCAUCACGA 22 3 1 3 3    0 3 0 0
mdm-miR10979 CUUGCCGAUAGAUUUGGGGAG 21 0 0 0 0    0 0 0 0
mdm-miR10980a CACCUGGGACUUGCAGCCAUG 21 74 19 34 2    29 2 34 9
mdm-miR10980b CACCUGGGACUUGCAGCCAUG 21 74 19 34 2    29 2 34 9
mdm-miR10981a UGACCAACAUAUAUGGGCCGU 21 48 12 32 16    32 16 0 0
mdm-miR10981b UGACCAACAUAUAUGGGCCGU 21 48 12 32 16    32 16 0 0
mdm-miR10981c AGCCGUUUAAUCAAAAUCCAA 21 0 0 0 0    0 0 0 0
mdm-miR10981d AGCCGUUUAAUCAAAAUCCAA 21 0 0 0 0    0 0 0 0
mdm-miR10982a CGGAAUGAAGCUUACGAGAAUG 22 47 12 29 3    6 29 9 3
mdm-miR10982b CGGAAUGAAGCUUACGAGAAUG 22 47 12 29 3    6 29 9 3
mdm-miR10982c CGGAAUGAAGCUUACGAGAAUG 22 47 12 29 3    6 29 9 3
mdm-miR10982d CGGAAUGAAGCUUACGAGAAUG 22 47 12 29 3    6 29 9 3
mdm-miR10983 CAGAGCAAAACAGUCGUGGAA 21 228 57 128 36    0 64 128 36
mdm-miR10984a-3p AGUCAAUUACCUCAUAAACUC 21 0 0 0 0    0 0 0 0
mdm-miR10984a-5p GGUAAUUGACUGUGAAAUCGU 21 5 1 3 1    3 0 1 1
mdm-miR10984b-3p CUCACGUACGCUGUCCCGAGAA 22 131 33 70 5    70 49 7 5
mdm-miR10984b-5p GGUAAUUGACUGUGAAAUCGU 21 5 1 3 1    3 0 1 1
mdm-miR10985 CCACUCGUAGUGAAACAGUUG 21 44 11 28 2    3 28 2 11
mdm-miR10986 UGGCACCAAAGUCACCACCCG 21 157 39 76 5    6 76 5 70
mdm-miR10987 CCAUAUGUCCCUCCAUAUACU 21 1,022 256 930 92    930 92 0 0
mdm-miR10988 AGAGAAAAUUCAUUCCAACGC 21 161 40 115 1    115 45 1 0
mdm-miR10989a CAAAGCUUUUAAUAUCAGUCGA 22 145 36 69 5    60 69 11 5
mdm-miR10989b CAAAGCUUUUAAUAUCAGUCGA 22 145 36 69 5    60 69 11 5
mdm-miR10989c CAAAGCUUUUAAUAUCAGUCGA 22 145 36 69 5    60 69 11 5
mdm-miR10989d CAAAGCUUUUAAUAUCAGUCGA 22 145 36 69 5    60 69 11 5
mdm-miR10989e CAAAGCUUUUAAUAUCAGUCGA 22 145 36 69 5    60 69 11 5
mdm-miR10990 CCAAGGAAAAUUUUAUGACGA 21 74 19 64 3    0 64 7 3
mdm-miR10991a CGAGCCAUUGAAAUUCGAUCC 21 3 1 3 3    3 0 0 0
mdm-miR10991b CGAGCCAUUGAAAUUCGAUCC 21 3 1 3 3    3 0 0 0
mdm-miR10991c CGAGCCAUUGAAAUUCGAUCC 21 3 1 3 3    3 0 0 0
mdm-miR10991d CGAGCCAUUGAAAUUCGAUCC 21 3 1 3 3    3 0 0 0
mdm-miR10991e CGAGCCAUUGAAAUUCGAUCC 21 3 1 3 3    3 0 0 0
mdm-miR10992 CAUAACAAAUUAUUACUCAGU 21 1 0 1 1    0 0 1 0
mdm-miR10993a AUCCCACCAUUUAUAUAGCGA 21 0 0 0 0    0 0 0 0
mdm-miR10993b AUCCCACCAUUUAUAUAGCGA 21 0 0 0 0    0 0 0 0
mdm-miR10993c ACAUGUGGUGUACCAUCCUGU 21 3 1 3 3    0 3 0 0
mdm-miR10993d ACAUGUGGUGUACCAUCCUGU 21 3 1 3 3    0 3 0 0
mdm-miR10993e ACAUGUGGUGUACCAUCCUGU 21 3 1 3 3    0 3 0 0
mdm-miR10993f ACAUGUGGUGUACCAUCCUGU 21 3 1 3 3    0 3 0 0
mdm-miR10994-3p UGCUUUUUUCUUGACCAUAGC 21 250 63 158 1    89 158 1 2
mdm-miR10994-5p UAUGGUUAAGAAACAAGCAGA 21 101 25 78 1    16 78 1 6
mdm-miR10995 CAAGCUUCCUCUUCAUACUCGU 22 12 3 7 2    0 3 7 2
mdm-miR10996a ACACCAUCGCAUCUCAUGUUCC 22 43 11 27 16    16 0 27 0
mdm-miR10996b UCACCAUUGCAUCUCAUGUUCC 22 3,657 914 3,244 1    3,244 113 299 1
mdm-miR10997 UAACCUUAUUUGAUUUCACGA 21 86 22 60 3    60 23 3 0
mdm-miR10998 CUUGGGAUUCAGUCUAGGACUU 22 25 6 10 2    10 5 8 2
mdm-miR10999a GGGCGUGAUAUUCACACACCU 21 0 0 0 0    0 0 0 0
mdm-miR10999b GGGCGUGAUAUUCACACACCU 21 0 0 0 0    0 0 0 0
mdm-miR11000 GUGUUCCAAAGAAAUCCGGAGU 22 1 0 1 1    0 0 1 0
mdm-miR11001 UACAAAGAUGGACUCCACCCUA 22 44 11 40 1    0 40 3 1
mdm-miR11002a GAGGAUGAGCUUCGGCGGUGA 21 33 8 24 9    0 9 24 0
mdm-miR11002b GAGGAUGAGCUUCGGCGGUGA 21 33 8 24 9    0 9 24 0
mdm-miR11002c-3p GAGGAUGAGCUUCGGCGGUGA 21 33 8 24 9    0 9 24 0
mdm-miR11002c-5p CCCAGUCACCUCCGAAGCUCA 21 1 0 1 1    0 0 1 0
mdm-miR11003 ACACAAUAUACGAUGAACAGA 21 2 1 2 2    0 2 0 0
mdm-miR11004 GUAUUCUUUCAUCUUCUACUA 21 458 115 420 5    420 33 5 0
mdm-miR11005 CUACUAUAUGGUCGUACACAUC 22 21 5 13 2    13 2 4 2
mdm-miR11006 CAAUGGGGAGGAGUCAUUCGUA 22 22 6 19 3    3 19 0 0
mdm-miR11007 CCGUCAAUUAUUUUGGUACGU 21 90 23 73 17    73 17 0 0
mdm-miR11008 GUGACCGCACAAAAUAGAAGA 21 8 2 7 1    0 7 1 0
mdm-miR11009 AUGCACAACAAUAUGAGGGUGU 22 90 23 48 1    48 40 1 1
mdm-miR11010 AGUAACUAUAGCUGUUUUCUA 21 2,911 728 2,566 6    6 2,566 253 86
mdm-miR11011a AAGUUCAUUCAAACACCAUGU 21 23,230 5,808 15,277 17    7,915 15,277 17 21
mdm-miR11011b UAAGUUCAUCCAAACACCAUA 21 8,096 2,024 4,715 72    4,715 3,214 95 72
mdm-miR11012a CCGCUGCCUAUGCAAUGCACCC 22 8 2 5 3    3 5 0 0
mdm-miR11012b CCGCUGCCUAUGCAAUGCACCC 22 8 2 5 3    3 5 0 0
mdm-miR11013 CAUGGGAAUUUUAAAGUCACCU 22 147 37 143 1    143 2 1 1
mdm-miR11014 CGACCAUUCAUGAAAACUGCC 21 28 7 15 3    0 3 15 10
mdm-miR11015 UGGGUAAAAUGACCCAACCUG 21 10 3 10 10    10 0 0 0
mdm-miR11016 UCCAUAAUUUUUCCAGAUCAA 21 119 30 108 4    108 7 4 0
mdm-miR11017 CUCUAAUCUGCCCAACAACUU 21 13 3 12 1    0 12 1 0
mdm-miR11018 CCAACAUCAAAAGUAAAAGGAA 22 44 11 29 1    29 14 1 0
mdm-miR11019 CCAGAUGAUCAUAAUCUCCUGA 22 35 9 32 1    32 2 1 0
mdm-miR11020 GACAUUACAACGGUUACACGG 21 4 1 2 1    0 2 1 1
mdm-miR1511 ACCUAGCUCUGAUACCAUGAA 21 103,998 26,000 68,884 2,803    68,884 22,187 10,124 2,803
mdm-miR156a UGACAGAAGAGAGUGAGCAC 20 1,141,343 285,336 1,125,503 416    5,311 416 10,113 1,125,503
mdm-miR156aa UGACAGAAGAUAGAGAGCAC 20 5,176 1,294 4,244 43    720 43 169 4,244
mdm-miR156ab UUGACAGAAGAUAGAGAGCAC 21 412,619 103,155 375,008 965    23,920 965 12,726 375,008
mdm-miR156ac UUGACAGAAGAUAGAGAGCAC 21 412,619 103,155 375,008 965    23,920 965 12,726 375,008
mdm-miR156ad UGACAGAAGAAAGUGAGCAC 20 149 37 146 3    3 0 0 146
mdm-miR156ae UGACAGAAGAAAGUGAGCAC 20 149 37 146 3    3 0 0 146
mdm-miR156b UGACAGAAGAGAGUGAGCAC 20 1,141,343 285,336 1,125,503 416    5,311 416 10,113 1,125,503
mdm-miR156c UGACAGAAGAGAGUGAGCAC 20 1,141,343 285,336 1,125,503 416    5,311 416 10,113 1,125,503
mdm-miR156d UGACAGAAGAGAGUGAGCAC 20 1,141,343 285,336 1,125,503 416    5,311 416 10,113 1,125,503
mdm-miR156e UGACAGAAGAGAGUGAGCAC 20 1,141,343 285,336 1,125,503 416    5,311 416 10,113 1,125,503
mdm-miR156f UGACAGAAGAGAGUGAGCAC 20 1,141,343 285,336 1,125,503 416    5,311 416 10,113 1,125,503
mdm-miR156g UGACAGAAGAGAGUGAGCAC 20 1,141,343 285,336 1,125,503 416    5,311 416 10,113 1,125,503
mdm-miR156h UGACAGAAGAGAGUGAGCAC 20 1,141,343 285,336 1,125,503 416    5,311 416 10,113 1,125,503
mdm-miR156i UGACAGAAGAGAGUGAGCAC 20 1,141,343 285,336 1,125,503 416    5,311 416 10,113 1,125,503
mdm-miR156j UGACAGAAGAGAGUGAGCAC 20 1,141,343 285,336 1,125,503 416    5,311 416 10,113 1,125,503
mdm-miR156k UGACAGAAGAGAGUGAGCAC 20 1,141,343 285,336 1,125,503 416    5,311 416 10,113 1,125,503
mdm-miR156l UGACAGAAGAGAGUGAGCAC 20 1,141,343 285,336 1,125,503 416    5,311 416 10,113 1,125,503
mdm-miR156m UGACAGAAGAGAGUGAGCAC 20 1,141,343 285,336 1,125,503 416    5,311 416 10,113 1,125,503
mdm-miR156n UGACAGAAGAGAGUGAGCAC 20 1,141,343 285,336 1,125,503 416    5,311 416 10,113 1,125,503
mdm-miR156o UGACAGAAGAGAGUGAGCAC 20 1,141,343 285,336 1,125,503 416    5,311 416 10,113 1,125,503
mdm-miR156p CUGACAGAAGAUAGAGAGCAC 21 24,311 6,078 24,054 10    188 10 59 24,054
mdm-miR156q CUGACAGAAGAUAGAGAGCAC 21 24,311 6,078 24,054 10    188 10 59 24,054
mdm-miR156r CUGACAGAAGAUAGAGAGCAC 21 24,311 6,078 24,054 10    188 10 59 24,054
mdm-miR156s CUGACAGAAGAUAGAGAGCAC 21 24,311 6,078 24,054 10    188 10 59 24,054
mdm-miR156t UUGACAGAAGAGAGAGAGCAC 21 109,054 27,264 89,489 60    60 371 19,134 89,489
mdm-miR156u UUGACAGAAGAGAGAGAGCAC 21 109,054 27,264 89,489 60    60 371 19,134 89,489
mdm-miR156v UUGACAGAAGAGAGAGAGCAC 21 109,054 27,264 89,489 60    60 371 19,134 89,489
mdm-miR156w UUGACAGAAGAGAGAGAGCAC 21 109,054 27,264 89,489 60    60 371 19,134 89,489
mdm-miR156x UGACAGAAGAUAGAGAGCAC 20 5,176 1,294 4,244 43    720 43 169 4,244
mdm-miR156y UGACAGAAGAUAGAGAGCAC 20 5,176 1,294 4,244 43    720 43 169 4,244
mdm-miR156z UGACAGAAGAUAGAGAGCAC 20 5,176 1,294 4,244 43    720 43 169 4,244
mdm-miR159a CUUGGAUUGAAGGGAGCUCC 20 7,560 1,890 4,097 12    48 12 3,403 4,097
mdm-miR159b CUUGGAUUGAAGGGAGCUCC 20 7,560 1,890 4,097 12    48 12 3,403 4,097
mdm-miR159c GAAUUCCUUCUCCUCUCCUUU 21 2,227 557 2,133 1    2,133 88 1 5
mdm-miR159d UUUGGAUUGAAGGGAGCUCUA 21 139,681 34,920 79,451 6,402    43,621 79,451 6,402 10,207
mdm-miR159e UUUGGAUUGAAGGGAGCUCUA 21 139,681 34,920 79,451 6,402    43,621 79,451 6,402 10,207
mdm-miR159f UUUGGAUUGAAGGGAGCUCUA 21 139,681 34,920 79,451 6,402    43,621 79,451 6,402 10,207
mdm-miR160a UGCCUGGCUCCCUGUAUGCCA 21 860 215 409 88    255 108 88 409
mdm-miR160b UGCCUGGCUCCCUGUAUGCCA 21 860 215 409 88    255 108 88 409
mdm-miR160c UGCCUGGCUCCCUGUAUGCCA 21 860 215 409 88    255 108 88 409
mdm-miR160d UGCCUGGCUCCCUGUAUGCCA 21 860 215 409 88    255 108 88 409
mdm-miR160e UGCCUGGCUCCCUGUAUGCCA 21 860 215 409 88    255 108 88 409
mdm-miR162a UCGAUAAACCUCUGCAUCCAG 21 18,964 4,741 11,481 816    11,481 4,116 2,551 816
mdm-miR162b UCGAUAAACCUCUGCAUCCAG 21 18,964 4,741 11,481 816    11,481 4,116 2,551 816
mdm-miR164a UGGAGAAGCAGGGCACAUGCC 21 98 25 94 4    0 0 4 94
mdm-miR164b UGGAGAAGCAGGGCACGUGCA 21 22,489 5,622 8,792 1,277    1,277 5,029 7,391 8,792
mdm-miR164c UGGAGAAGCAGGGCACGUGCA 21 22,489 5,622 8,792 1,277    1,277 5,029 7,391 8,792
mdm-miR164d UGGAGAAGCAGGGCACGUGCA 21 22,489 5,622 8,792 1,277    1,277 5,029 7,391 8,792
mdm-miR164e UGGAGAAGCAGGGCACGUGCA 21 22,489 5,622 8,792 1,277    1,277 5,029 7,391 8,792
mdm-miR164f UGGAGAAGCAGGGCACGUGCA 21 22,489 5,622 8,792 1,277    1,277 5,029 7,391 8,792
mdm-miR166a UCGGACCAGGCUUCAUUCCCC 21 304,539 76,135 195,639 3,403    3,403 4,572 195,639 100,925
mdm-miR166b UCGGACCAGGCUUCAUUCCCC 21 304,539 76,135 195,639 3,403    3,403 4,572 195,639 100,925
mdm-miR166c UCGGACCAGGCUUCAUUCCCC 21 304,539 76,135 195,639 3,403    3,403 4,572 195,639 100,925
mdm-miR166d UCGGACCAGGCUUCAUUCCCC 21 304,539 76,135 195,639 3,403    3,403 4,572 195,639 100,925
mdm-miR166e UCGGACCAGGCUUCAUUCCCC 21 304,539 76,135 195,639 3,403    3,403 4,572 195,639 100,925
mdm-miR166f UCGGACCAGGCUUCAUUCCCC 21 304,539 76,135 195,639 3,403    3,403 4,572 195,639 100,925
mdm-miR166g UCGGACCAGGCUUCAUUCCCC 21 304,539 76,135 195,639 3,403    3,403 4,572 195,639 100,925
mdm-miR166h UCGGACCAGGCUUCAUUCCCC 21 304,539 76,135 195,639 3,403    3,403 4,572 195,639 100,925
mdm-miR166i UCGGACCAGGCUUCAUUCCCC 21 304,539 76,135 195,639 3,403    3,403 4,572 195,639 100,925
mdm-miR166j UCGGACCAGGCUUCAUUCCCC 21 304,539 76,135 195,639 3,403    3,403 4,572 195,639 100,925
mdm-miR167a AGAUCAUCUGGCAGUUUCACC 21 524 131 465 11    465 24 11 24
mdm-miR167b UGAAGCUGCCAGCAUGAUCUA 21 227,520 56,880 144,708 2,811    54,016 2,811 144,708 25,985
mdm-miR167c UGAAGCUGCCAGCAUGAUCUA 21 227,520 56,880 144,708 2,811    54,016 2,811 144,708 25,985
mdm-miR167d UGAAGCUGCCAGCAUGAUCUA 21 227,520 56,880 144,708 2,811    54,016 2,811 144,708 25,985
mdm-miR167e UGAAGCUGCCAGCAUGAUCUA 21 227,520 56,880 144,708 2,811    54,016 2,811 144,708 25,985
mdm-miR167f UGAAGCUGCCAGCAUGAUCUA 21 227,520 56,880 144,708 2,811    54,016 2,811 144,708 25,985
mdm-miR167g UGAAGCUGCCAGCAUGAUCUA 21 227,520 56,880 144,708 2,811    54,016 2,811 144,708 25,985
mdm-miR167h UGAAGCUGCCAGCAUGAUCUUA 22 56,555 14,139 22,451 4,765    21,669 4,765 22,451 7,670
mdm-miR167i UGAAGCUGCCAGCAUGAUCUUA 22 56,555 14,139 22,451 4,765    21,669 4,765 22,451 7,670
mdm-miR167j UGAAGCUGCCAGCAUGAUCUUA 22 56,555 14,139 22,451 4,765    21,669 4,765 22,451 7,670
mdm-miR168a UCGCUUGGUGCAGGUCGGGAA 21 37,814 9,454 23,467 443    443 1,053 23,467 12,851
mdm-miR168b UCGCUUGGUGCAGGUCGGGAA 21 37,814 9,454 23,467 443    443 1,053 23,467 12,851
mdm-miR169a CAGCCAAGGAUGACUUGCCGG 21 1,832 458 1,783 2    1,783 42 2 5
mdm-miR169b UAGCCAAGGAUGAUUUGCCUGC 22 60 15 54 1    54 5 1 0
mdm-miR169c UAGCCAAGGAUGACUUGCCCG 21 60 15 38 1    38 21 0 1
mdm-miR169d UAGCCAAGGAUGACUUGCCCG 21 60 15 38 1    38 21 0 1
mdm-miR169e UGAAGAGAAGAGCGUUGUUUGG 22 102 26 73 29    29 0 73 0
mdm-miR169f UGAAGAGAAGAGCGUUGUUUGG 22 102 26 73 29    29 0 73 0
mdm-miR169g CAGCCAAGGAUGACUUGCCGG 21 1,832 458 1,783 2    1,783 42 2 5
mdm-miR169h CAGCCAAGGAUGACUUGCCGG 21 1,832 458 1,783 2    1,783 42 2 5
mdm-miR169i CAGCCAAGGAUGACUUGCCGG 21 1,832 458 1,783 2    1,783 42 2 5
mdm-miR169j CAGCCAAGGAUGACUUGCCGG 21 1,832 458 1,783 2    1,783 42 2 5
mdm-miR169k UAGCCAAGGAUGACUUGCCUG 21 25 6 25 25    25 0 0 0
mdm-miR169l UAGCCAAGGAUGACUUGCCUG 21 25 6 25 25    25 0 0 0
mdm-miR169m UAGCCAAGGAUGACUUGCCUG 21 25 6 25 25    25 0 0 0
mdm-miR169n UAGCCAAGGAUGACUUGCCUG 21 25 6 25 25    25 0 0 0
mdm-miR169o UAGCCAGGGAUGACUUGCCU 20 166 42 118 7    118 26 7 15
mdm-miR171a UUGAGCCGCGUCAAUAUCUCC 21 2,863 716 1,354 80    611 80 818 1,354
mdm-miR171b UUGAGCCGCGUCAAUAUCUCC 21 2,863 716 1,354 80    611 80 818 1,354
mdm-miR171c UGAUUGAGCCGCGCCAAUAUC 21 1,999 500 914 1    860 914 224 1
mdm-miR171d UGAUUGAGCCGCGCCAAUAUC 21 1,999 500 914 1    860 914 224 1
mdm-miR171e UGAUUGAGCCGCGCCAAUAUC 21 1,999 500 914 1    860 914 224 1
mdm-miR171f-3p UUGAGCCGUGCCAAUAUCACG 21 242 61 210 12    210 12 20 0
mdm-miR171f-5p GGAUAUUGGUCCGGUUCAAUA 21 307 77 283 24    283 24 0 0
mdm-miR171g UGAUUGAGCCGUGCCAAUAUC 21 53 13 35 1    35 12 1 5
mdm-miR171h UGAUUGAGCCGUGCCAAUAUC 21 53 13 35 1    35 12 1 5
mdm-miR171i UGAGCCGAACCAAUAUCACUC 21 1,519 380 1,180 12    296 1,180 31 12
mdm-miR171j UUGAGCCGCGCCAAUAUCACU 21 108 27 42 11    32 23 11 42
mdm-miR171k UUGAGCCGCGCCAAUAUCACU 21 108 27 42 11    32 23 11 42
mdm-miR171l UUGAGCCGCGCCAAUAUCACU 21 108 27 42 11    32 23 11 42
mdm-miR171m UUGAGCCGUGCCAAUAUCACA 21 92 23 45 2    10 35 2 45
mdm-miR171n UUGAGCCGUGCCAAUAUCACA 21 92 23 45 2    10 35 2 45
mdm-miR171o UGGGAUGUUGGUAUGGUUCAA 21 88 22 76 12    0 0 12 76
mdm-miR171p UUGAGCCGCGUCAAUAUCUCC 21 2,863 716 1,354 80    611 80 818 1,354
mdm-miR171q GGAUAUUGGUCCGGUUCAAUA 21 307 77 283 24    283 24 0 0
mdm-miR172a AGAAUCUUGAUGAUGCUGCA 20 356 89 172 3    172 36 145 3
mdm-miR172b AGAAUCUUGAUGAUGCUGCA 20 356 89 172 3    172 36 145 3
mdm-miR172c AGAAUCUUGAUGAUGCUGCA 20 356 89 172 3    172 36 145 3
mdm-miR172d AGAAUCUUGAUGAUGCUGCAU 21 44,282 11,071 30,882 889    9,504 3,007 30,882 889
mdm-miR172e AGAAUCUUGAUGAUGCUGCAU 21 44,282 11,071 30,882 889    9,504 3,007 30,882 889
mdm-miR172f AGAAUCUUGAUGAUGCUGCAU 21 44,282 11,071 30,882 889    9,504 3,007 30,882 889
mdm-miR172g AGAAUCUUGAUGAUGCUGCAU 21 44,282 11,071 30,882 889    9,504 3,007 30,882 889
mdm-miR172h AGAAUCUUGAUGAUGCUGCAU 21 44,282 11,071 30,882 889    9,504 3,007 30,882 889
mdm-miR172i GGAAUCUUGAUGAUGCUGCAU 21 1,460 365 901 5    901 432 122 5
mdm-miR172j GGAAUCUUGAUGAUGCUGCAU 21 1,460 365 901 5    901 432 122 5
mdm-miR172k GGAAUCUUGAUGAUGCUGCAU 21 1,460 365 901 5    901 432 122 5
mdm-miR172l GGAAUCUUGAUGAUGCUGCAG 21 168 42 143 1    143 24 1 0
mdm-miR172m AGAAUCUUGAUGAUGCUGCAG 21 8,768 2,192 7,794 20    7,794 769 20 185
mdm-miR172n AGAAUCUUGAUGAUGCUGCAG 21 8,768 2,192 7,794 20    7,794 769 20 185
mdm-miR172o AGAAUCUUGAUGAUGCUGCAG 21 8,768 2,192 7,794 20    7,794 769 20 185
mdm-miR172p AGAAUCUUGAUGAUGCUGCAU 21 44,282 11,071 30,882 889    9,504 3,007 30,882 889
mdm-miR2111a UAAUCUGCAUCCUGAGGUUUA 21 83 21 43 16    16 0 24 43
mdm-miR2111b UAAUCUGCAUCCUGAGGUUUA 21 83 21 43 16    16 0 24 43
mdm-miR2118a CUACCGAUGCCACUAAGUCCCA 22 33,952 8,488 20,125 2,644    20,125 8,168 3,015 2,644
mdm-miR2118b CUACCGAUGCCACUAAGUCCCA 22 33,952 8,488 20,125 2,644    20,125 8,168 3,015 2,644
mdm-miR2118c CUACCGAUGCCACUAAGUCCCA 22 33,952 8,488 20,125 2,644    20,125 8,168 3,015 2,644
mdm-miR319a UUGGACUGAAGGGAGCUCCCU 21 189 47 187 2    0 0 2 187
mdm-miR319b-3p UUGGACUGAAGGGAGCUCCCU 21 189 47 187 2    0 0 2 187
mdm-miR319b-5p GAGCUUUCUUCAGUCCACUC 20 5 1 5 5    0 5 0 0
mdm-miR319c-3p AUCCAACGAAGCAGGAGCUGA 21 749 187 507 3    236 507 3 3
mdm-miR319c-5p GAGCUCUUCUUCAGUCCAGUCC 22 231 58 215 16    16 215 0 0
mdm-miR319d AACUGCCGACUCAUUCACUCA 21 509 127 322 12    322 160 15 12
mdm-miR319e GAGCUUUCUUCAGUCCACUC 20 5 1 5 5    0 5 0 0
mdm-miR319f GAGCUUUCUUCAGUCCACUC 20 5 1 5 5    0 5 0 0
mdm-miR319g GAGCUUUCUUCAGUCCACUC 20 5 1 5 5    0 5 0 0
mdm-miR319h GAGCUCUUCUUCAGUCCAGUCC 22 231 58 215 16    16 215 0 0
mdm-miR3627a UCGCAGGAGAGAUGGCACUA 20 294 74 137 25    25 78 137 54
mdm-miR3627b UCGCAGGAGAGAUGGCACUA 20 294 74 137 25    25 78 137 54
mdm-miR3627c UCGCAGGAGAGAUGGCACUA 20 294 74 137 25    25 78 137 54
mdm-miR3627d UCCAUCCUCCUGUGACAUGAA 21 8 2 3 2    0 3 3 2
mdm-miR390a AAGCUCAGGAGGGAUAGCGCC 21 5,178 1,295 4,820 42    4,820 42 102 214
mdm-miR390b AAGCUCAGGAGGGAUAGCGCC 21 5,178 1,295 4,820 42    4,820 42 102 214
mdm-miR390c AAGCUCAGGAGGGAUAGCGCC 21 5,178 1,295 4,820 42    4,820 42 102 214
mdm-miR390d AAGCUCAGGAGGGAUAGCGCC 21 5,178 1,295 4,820 42    4,820 42 102 214
mdm-miR390e AAGCUCAGGAGGGAUAGCGCC 21 5,178 1,295 4,820 42    4,820 42 102 214
mdm-miR390f AAGCUCAGGAGGGAUAGCGCC 21 5,178 1,295 4,820 42    4,820 42 102 214
mdm-miR391 UACGCAGGAGAGAUGACGCCG 21 25,332 6,333 25,249 16    16 49 25,249 18
mdm-miR393a UCCAAAGGGAUCGCAUUGAUCU 22 191 48 143 5    143 5 31 12
mdm-miR393b UCCAAAGGGAUCGCAUUGAUCU 22 191 48 143 5    143 5 31 12
mdm-miR393c UCCAAAGGGAUCGCAUUGAUCU 22 191 48 143 5    143 5 31 12
mdm-miR393d AUCAUGCGAUCCCUUCGGACG 21 155 39 125 30    0 0 125 30
mdm-miR393e AUCAUGCGAUCCCUUCGGACG 21 155 39 125 30    0 0 125 30
mdm-miR393f AUCAUGCGAUCCCUUCGGACG 21 155 39 125 30    0 0 125 30
mdm-miR393g AUCAUGCUAUCCCUUUGGAUU 21 414 104 167 31    153 167 63 31
mdm-miR393h AUCAUGCUAUCCCUUUGGAUU 21 414 104 167 31    153 167 63 31
mdm-miR394a UUGGCAUUCUGUCCACCUCC 20 1,036 259 828 40    828 106 62 40
mdm-miR394b UUGGCAUUCUGUCCACCUCC 20 1,036 259 828 40    828 106 62 40
mdm-miR395a CUGAAGUGUUUGGGGGAACUC 21 5,412 1,353 4,177 47    4,177 857 331 47
mdm-miR395b CUGAAGUGUUUGGGGGAACUC 21 5,412 1,353 4,177 47    4,177 857 331 47
mdm-miR395c CUGAAGUGUUUGGGGGAACUC 21 5,412 1,353 4,177 47    4,177 857 331 47
mdm-miR395d-3p CUGAAGUGUUUGGGGGAACUC 21 5,412 1,353 4,177 47    4,177 857 331 47
mdm-miR395d-5p GUUCCCUUGACCACUUCAUUG 21 77 19 73 2    73 2 2 0
mdm-miR395e CUGAAGUGUUUGGGGGAACUC 21 5,412 1,353 4,177 47    4,177 857 331 47
mdm-miR395f CUGAAGUGUUUGGGGGAACUC 21 5,412 1,353 4,177 47    4,177 857 331 47
mdm-miR395g-3p CUGAAGUGUUUGGGGGAACUC 21 5,412 1,353 4,177 47    4,177 857 331 47
mdm-miR395g-5p GUUCCCUUGACCACUUCAUUG 21 77 19 73 2    73 2 2 0
mdm-miR395h CUGAAGUGUUUGGGGGAACUC 21 5,412 1,353 4,177 47    4,177 857 331 47
mdm-miR395i-3p CUGAAGUGUUUGGGGGAACUC 21 5,412 1,353 4,177 47    4,177 857 331 47
mdm-miR395i-5p GUUCCCUUGACCACUUCAUUG 21 77 19 73 2    73 2 2 0
mdm-miR395j GUUCCCUUGACCACUUCAUUG 21 77 19 73 2    73 2 2 0
mdm-miR395k GUUUCCUCAAACACUUCAUU 20 29 7 29 29    29 0 0 0
mdm-miR395l CUGAAGUGUUUGGGGGAACCC 21 369 92 331 1    331 35 2 1
mdm-miR396a UUCCACAGCUUUCUUGAACAG 21 47,464 11,866 25,929 2,165    25,929 16,362 3,008 2,165
mdm-miR396b UUCCACAGCUUUCUUGAACUG 21 166,775 41,694 108,172 616    108,172 57,059 928 616
mdm-miR396c UUCCACAGCUUUCUUGAACUU 21 51,461 12,865 35,442 116    35,442 14,668 1,235 116
mdm-miR396d UUCCACAGCUUUCUUGAACUU 21 51,461 12,865 35,442 116    35,442 14,668 1,235 116
mdm-miR396e UUCCACAGCUUUCUUGAACUU 21 51,461 12,865 35,442 116    35,442 14,668 1,235 116
mdm-miR396f UUCCACGGCUUUCUUGAACUG 21 6,689 1,672 3,174 20    3,174 2,936 559 20
mdm-miR396g UUCCACGGCUUUCUUGAACUG 21 6,689 1,672 3,174 20    3,174 2,936 559 20
mdm-miR397a UUGAGUGCAGCGUUGAUGAAA 21 758 190 720 6    6 10 22 720
mdm-miR397b UUGAGUGCAGCGUUGAUGAAA 21 758 190 720 6    6 10 22 720
mdm-miR398a UGUGUUCUCAGGUCACCCCUU 21 501 125 283 8    283 210 8 0
mdm-miR398b UGUGUUCUCAGGUCGCCCCUG 21 458 115 426 3    3 5 24 426
mdm-miR398c UGUGUUCUCAGGUCGCCCCUG 21 458 115 426 3    3 5 24 426
mdm-miR399a UGCCAAAGGAGAAUUGCCCUG 21 6,872 1,718 4,090 15    1,525 4,090 1,242 15
mdm-miR399b UGCCAAAGGAGAAUUGCCCUG 21 6,872 1,718 4,090 15    1,525 4,090 1,242 15
mdm-miR399c UGCCAAAGGAGAAUUGCCCUG 21 6,872 1,718 4,090 15    1,525 4,090 1,242 15
mdm-miR399d UGCCAAAGGAGAGUUGCCCUA 21 477 119 458 1    13 458 5 1
mdm-miR399e UGCCAAAGGAGAUUUGCUCGG 21 26,638 6,660 24,729 108    108 1,177 24,729 624
mdm-miR399f UGCCAAAGGAGAUUUGCUCGG 21 26,638 6,660 24,729 108    108 1,177 24,729 624
mdm-miR399g UGCCAAAGGAGAUUUGCUCGG 21 26,638 6,660 24,729 108    108 1,177 24,729 624
mdm-miR399h UGCCAAAGGAGAUUUGCUCGG 21 26,638 6,660 24,729 108    108 1,177 24,729 624
mdm-miR399i UGCCAAAGGAGAGUUGCCCUG 21 1,019 255 488 17    293 488 221 17
mdm-miR399j UGCCAAAGGAGAGUUGCCCUG 21 1,019 255 488 17    293 488 221 17
mdm-miR399k UGCCAAAGGAGAGUUGCCCUU 21 137 34 88 1    48 88 1 0
mdm-miR403a UUAGAUUCACGCACAAACUCG 21 1,086 272 394 169    169 264 394 259
mdm-miR403b UUAGAUUCACGCACAAACUCG 21 1,086 272 394 169    169 264 394 259
mdm-miR408a AUGCACUGCCUCUUCCCUGGC 21 3,370 843 3,310 60    0 0 60 3,310
mdm-miR408b ACAGGGAAGAGGUAGAGCAUG 21 261,280 65,320 248,774 147    0 147 12,359 248,774
mdm-miR408c ACAGGGAAGAGGUAGAGCAUG 21 261,280 65,320 248,774 147    0 147 12,359 248,774
mdm-miR408d ACAGGGAAGAGGUAGAGCAUG 21 261,280 65,320 248,774 147    0 147 12,359 248,774
mdm-miR477a ACUCUCCCUCAAGAGCUUCUC 21 309 77 207 3    207 99 0 3
mdm-miR477b ACUCUCCCUCAAGGGCUUCGAC 22 696 174 385 21    385 290 0 21
mdm-miR482a-3p UUCCCAAGCCCGCCCAUUCCUA 22 12,640 3,160 5,785 701    5,785 3,766 701 2,388
mdm-miR482a-5p AGGAAUGGGCUGUUUGGGAAGA 22 134 34 76 5    22 5 76 31
mdm-miR482b UCUUUCCUAUCCCUCCCAUUCC 22 11,893 2,973 6,043 53    6,043 5,667 53 130
mdm-miR482c UCUUUCCUAACCCUCCCAUUCC 22 15,022 3,756 8,698 106    8,698 5,884 106 334
mdm-miR482d AAUGGAAGGGUAGGAAAGAAG 21 17,475 4,369 11,575 576    1,853 576 11,575 3,471
mdm-miR5225a UCUGUCGAAGGUGAGAUGGUGC 22 802 201 680 3    10 3 109 680
mdm-miR5225b UCUGUCGAAGGUGAGAUGGUGC 22 802 201 680 3    10 3 109 680
mdm-miR5225c UCUGUCGUGGGUGAGAUGGUGC 22 2,575 644 1,556 13    13 43 1,556 963
mdm-miR530a UGCAUUUGCACCUGCACUUGU 21 168 42 115 22    115 31 22 0
mdm-miR530b UGCAUUUGCACCUGCACUUGU 21 168 42 115 22    115 31 22 0
mdm-miR530c UGCAUUUGCACCUGCACUUGU 21 168 42 115 22    115 31 22 0
mdm-miR535a UGACAACGAGAGAGAGCACGC 21 15,672 3,918 8,462 1,227    3,025 1,227 2,958 8,462
mdm-miR535b UGACAAGGAGAGAGAGCACGC 21 4,368 1,092 4,259 16    32 16 61 4,259
mdm-miR535c UGACAAGGAGAGAGAGCACGC 21 4,368 1,092 4,259 16    32 16 61 4,259
mdm-miR535d UGACGACGAGAGAGAGCACGC 21 233,805 58,451 140,953 76    576 76 92,200 140,953
mdm-miR7120a-3p CAGUCUGACAAUAUAACGUGC 21 9,797 2,449 6,098 524    2,324 6,098 851 524
mdm-miR7120a-5p UGUUAUAUUGUCAGAUUGUCA 21 17,200 4,300 11,727 26    76 26 11,727 5,371
mdm-miR7120b-3p CAGUCUGACAAUAUAACGUGC 21 9,797 2,449 6,098 524    2,324 6,098 851 524
mdm-miR7120b-5p UGUUAUAUUGUCAGAUUGUCA 21 17,200 4,300 11,727 26    76 26 11,727 5,371
mdm-miR7121a UCCUCUUGGUGAUCGCCCUGU 21 15,260 3,815 4,314 2,985    4,314 3,887 4,074 2,985
mdm-miR7121b UCCUCUUGGUGAUCGCCCUGU 21 15,260 3,815 4,314 2,985    4,314 3,887 4,074 2,985
mdm-miR7121c UCCUCUUGGUGAUCGCCCUGU 21 15,260 3,815 4,314 2,985    4,314 3,887 4,074 2,985
mdm-miR7121d UCCUCUUGGUGAUCGCCCUGC 21 4,267 1,067 2,329 3    3 555 1,380 2,329
mdm-miR7121e UCCUCUUGGUGAUCGCCCUGC 21 4,267 1,067 2,329 3    3 555 1,380 2,329
mdm-miR7121f UCCUCUUGGUGAUCGCCCUGC 21 4,267 1,067 2,329 3    3 555 1,380 2,329
mdm-miR7121g UCCUCUUGGUGAUCGCCCUGC 21 4,267 1,067 2,329 3    3 555 1,380 2,329
mdm-miR7121h UCCUCUUGGUGAUCGCCCUGC 21 4,267 1,067 2,329 3    3 555 1,380 2,329
mdm-miR7122a UUAUACAGAGAAAUCACGGUCG 22 14,181 3,545 6,680 324    1,388 324 5,789 6,680
mdm-miR7122b UUAUACAGAGAAAUCACGGUCG 22 14,181 3,545 6,680 324    1,388 324 5,789 6,680
mdm-miR7123a AAGAGCGGGAUGUGUAAAAGG 21 2,809 702 2,808 1    0 0 2,808 1
mdm-miR7123b AAGAGCGGGAUGUGUAAAAGG 21 2,809 702 2,808 1    0 0 2,808 1
mdm-miR7124a CACCAAUAUCAACUUUAUUUG 21 1,236 309 570 72    570 465 72 129
mdm-miR7124b CACCAAUAUCAACUUUAUUUG 21 1,236 309 570 72    570 465 72 129
mdm-miR7125 CGAACUUAUUGCAACUAGCUU 21 469 117 276 7    169 17 276 7
mdm-miR7126-3p UUGCGUUCCACUGAUUCUUUCG 22 186 47 60 19    51 56 60 19
mdm-miR7126-5p AAAGUAUCAAGGAGCGCAAAG 21 313 78 111 21    111 21 93 88
mdm-miR7127a AUACUCAUCGAAUUUGUCAUA 21 99 25 57 6    57 0 36 6
mdm-miR7127b AUACUCAUCGAAUUUGUCAUA 21 99 25 57 6    57 0 36 6
mdm-miR7128 AUCAUUAACACUUAAUAACGA 21 25 6 24 1    0 24 1 0
mdm-miR827 UUAGAUGACCAUCAACGAACA 21 7,840 1,960 5,592 656    825 767 5,592 656
mdm-miR828a UCUUGCUCAAAUGAGUAUUCCA 22 3,293 823 2,811 1    2,811 481 0 1
mdm-miR828b UCUUGCUCAAAUGAGUAUUCCA 22 3,293 823 2,811 1    2,811 481 0 1
mdm-miR858 UUCGUUGUCUGUUCGACCUGA 21 18,058 4,515 15,807 138    739 15,807 138 1,374