Amborella miRNA Abundances

The data below are based on the microRNAs listed in the Sanger registry. Adjust libraries/reads to display on the control panel.

        

        miRNA         miRNA sequence Len Sum (norm) Average Max Min (>0)  AmOFFs_1AmLeas_1
atr-miR156a UUGACAGAAGAUAGAGAGCAC 21 52 26 40 12    40 12
atr-miR156b UGACAGAAGAGAGUGAGCAC 20 12 6 8 4    4 8
atr-miR156c UUGACAGAAGAUAGAGAGCAC 21 52 26 40 12    40 12
atr-miR156d UGACAGAAGAGAGUGAGCAC 20 12 6 8 4    4 8
atr-miR159 UUUGGAUUGAAGGGAGCUCUA 21 5,696 2,848 3,094 2,602    3,094 2,602
atr-miR160 UGCCUGGCUCCCUGUAUGCCA 21 14 7 10 4    10 4
atr-miR164a UGGAGAAGCAGGGCACGUGCA 21 123 62 91 32    32 91
atr-miR164b UGGAGAAGCAGGGCACGUGCA 21 123 62 91 32    32 91
atr-miR166a UCGGACCAGGCUUCAUUCCCC 21 14,446 7,223 9,866 4,580    9,866 4,580
atr-miR166b UCUCGGACCAGGCUUCAUUCC 21 12,982 6,491 9,951 3,031    9,951 3,031
atr-miR166c UCGGACCAGGCUUCAUUCCCC 21 14,446 7,223 9,866 4,580    9,866 4,580
atr-miR166d UCGGACCAGGCUUCAUUCCCC 21 14,446 7,223 9,866 4,580    9,866 4,580
atr-miR167 UGAAGCUGCCAGCAUGAUCUG 21 408 204 204 204    204 204
atr-miR168 UCGCUUGGUGCAGGUCGGGAA 21 923 462 562 361    361 562
atr-miR169a UAGCCAAGGAUGACUUGCCU 20 2 1 1 1    1 1
atr-miR169b AGCAAGUCGCCUUGGCUAACC 21 3 2 2 1    2 1
atr-miR169c UAGCCAAGGAUGACUUGCCU 20 2 1 1 1    1 1
atr-miR171a UGAUUGAGCCGCGCCAAUAUC 21 109 55 108 1    108 1
atr-miR171b UUGAGCCGUGCCAAUAUCACA 21 11 6 10 1    10 1
atr-miR171c UGAUUGAGCCGCGCCAAUAUC 21 109 55 108 1    108 1
atr-miR172 GGAAUCUUGAUGAUGCUGCA 20 2 2 2 2    2 0
atr-miR2111 UAAUCUGUAUCUUGAGGUUUGG 22 129 65 128 1    1 128
atr-miR2950 UUCCAUCUCUUGCACACUGGA 21 30 15 16 14    14 16
atr-miR319a UUGGACUGAAGGGAGCUCCC 20 908 454 831 77    831 77
atr-miR319b UUUGGACUGAAGGGAGCUCCU 21 157 79 108 49    108 49
atr-miR319c UUGGACUGAAGGGAGCUCCC 20 908 454 831 77    831 77
atr-miR319d UUUGGACUGAAGGGAGCUCCU 21 157 79 108 49    108 49
atr-miR319e UUUGGACUGAAGGGAGCUCCU 21 157 79 108 49    108 49
atr-miR390.1 UAAAGCUCAGGAGGGAUAGCG 21 44 22 42 2    42 2
atr-miR390.2 AAGCUCAGGAGGGAUAGCGCC 21 27 14 26 1    26 1
atr-miR393 UCCAAAGGGAUCGCAUUGAUCC 22 5 3 4 1    1 4
atr-miR394 UUGGCAUUCUGUCCACCUCC 20 65 33 62 3    62 3
atr-miR395 CUGAAGUGUUUGGGGGAACUC 21 25 13 24 1    1 24
atr-miR396a UCCACAGGCUUUCUUGAACAU 21 70 35 64 6    64 6
atr-miR396b UUCCACAGCUUUCUUGAACUU 21 883 442 630 253    253 630
atr-miR396c UUCCACAGCUUUCUUGAACUU 21 883 442 630 253    253 630
atr-miR396d CUCCACGGCUUUCUUGAACUU 21 202 101 172 30    30 172
atr-miR396e UUCCACAGCUUUCUUGAACUU 21 883 442 630 253    253 630
atr-miR397a UCCUUGAGUGCAGCGUUGAUG 21 158 79 156 2    2 156
atr-miR397b UCAUUGAGUGCAGCGUUGGUG 21 91 46 82 9    9 82
atr-miR398 UGUGUUCCCAGGUCGCCCCUG 21 1,424 712 1,386 38    38 1,386
atr-miR477 AGAGGCCUUAGGGGAGAGUGG 21 7 4 6 1    6 1
atr-miR535 UGACAACGAGAGAGAGCACGC 21 213 107 111 102    111 102
atr-miR828 UGAUACUCAUUUCAGCAAGCAA 22 1 1 1 1    1 0
atr-miR8551 AUGUUCUAGGUUAGCUCUUGGAUG 24 21 11 15 6    15 6
atr-miR8552a CGAAAUGAGGUCGUGACCGUCAGA 24 10 5 7 3    7 3
atr-miR8552b UACCGGACAUCUGUGAUCGUCAGA 24 82 41 70 12    70 12
atr-miR8552c GGCCGUGAUCGUCAAAUUGGCUCA 24 19 10 15 4    15 4
atr-miR8552d UCCGUGAUCGUUAGAUCGGCCCAG 24 8 4 5 3    5 3
atr-miR8553a AUCGGGUGGUUCAGAAUUCAUAUC 24 18 9 14 4    14 4
atr-miR8553b UGUAUUUUGGACCACCUGAUGAAG 24 38 19 30 8    30 8
atr-miR8554 UGCGAUGACUUUGGAUCUUGAGGA 24 58 29 30 28    30 28
atr-miR8555 AGUUAACUAGGCAUCUAUAGGAUG 24 93 47 82 11    82 11
atr-miR8556 UAAAAGACAGGAAUUGUAACU 21 7 4 6 1    1 6
atr-miR8557 CCAAAUAGUUGGGAAAAGGCU 21 7 4 5 2    5 2
atr-miR8558a UUUCCGAAUCCGCCUAUACCUG 22 3,633 1,817 1,930 1,703    1,930 1,703
atr-miR8558b UUUCCGAUCCCGCCCAUGCCGU 22 930 465 691 239    691 239
atr-miR8559 UGACACUGUAGUAGUCAACCCGUG 24 18 9 10 8    8 10
atr-miR8560 UCCACUUUAAACACUCAGCCU 21 5 5 5 5    0 5
atr-miR8561.1 UGACAUUGUUGUCGGCUCACUACU 24 93 47 78 15    78 15
atr-miR8561.2 AAUGUCACACAUUAAUUAUGGCCU 24 109 55 90 19    90 19
atr-miR8562a UCGGAAUGAUCUGAAAUUUGGAGC 24 119 60 87 32    87 32
atr-miR8562b UCGGAAUGAUCUGAAAUUUGGAGC 24 119 60 87 32    87 32
atr-miR8562c UCAGAAUGAUCUGAAAUUUGGAGC 24 29 15 18 11    18 11
atr-miR8563 CUCCAUACUCUAAGCUGUUAGAAU 24 26 13 17 9    17 9
atr-miR8564 AGCUGUUGGGCUCAUAUGUUCAUA 24 3 2 2 1    2 1
atr-miR8565a UUGGCACAGAUCUCUAGAAAAGUU 24 46 23 45 1    45 1
atr-miR8565b UUUGGCACAGAUCUCUAGAAAAGU 24 109 55 106 3    106 3
atr-miR8565c UUUGGCACAGAUCUCUAGAAAAGU 24 109 55 106 3    106 3
atr-miR8565d UUUGGCACAGAUCUCUAGAAAAGU 24 109 55 106 3    106 3
atr-miR8565e UUUGGCACAGAUCUCUAGAAAAGU 24 109 55 106 3    106 3
atr-miR8565f UUUGGCACAGAUCUCUAGAAAAGU 24 109 55 106 3    106 3
atr-miR8565g CAUGUGUGUAGGAUUCCAAAUGAU 24 19 10 16 3    16 3
atr-miR8565h AUUAAAUUUGGCAUAGAUCUUUAG 24 2 1 1 1    1 1
atr-miR8566 AUUAGAGCUGGGUGGAUGAAGUGG 24 5 3 4 1    4 1
atr-miR8567 ACAAGAUGCACUAAUUUUAGGACU 24 130 65 95 35    95 35
atr-miR8568 UGGCUUACUGUGAUCGUUGUCC 22 24 12 16 8    16 8
atr-miR8569 ACUGGCAAUCUGGUCGGUCGGACC 24 229 115 171 58    171 58
atr-miR8570 AGUUGGGAGUGCGUCAUUGACUAG 24 18 9 14 4    14 4
atr-miR8571 UUCAAUCGUCAAGUAUCCAUGCCU 24 18 9 14 4    14 4
atr-miR8572 UGACCCGGUCGUUGGAAUCCUCUC 24 36 18 29 7    29 7
atr-miR8573 CCGGUCUGGCACAAUGUGUGC 21 44 22 41 3    41 3
atr-miR8574 ACAUCUUAUGAGUAAGAGUGAUUG 24 3 2 2 1    2 1
atr-miR8575 AGAUGUGUCGUGUCUGAAAGGUCA 24 76 38 67 9    67 9
atr-miR8576 AGCCAUCAUACUGGAUUUGUCGUA 24 14 7 12 2    12 2
atr-miR8577 AAAAGGCUCAGAUGAUGAUGAUGA 24 1 1 1 1    1 0
atr-miR8578.1 UUUAUGAGUGAUCUUUGCAAU 21 133 67 77 56    77 56
atr-miR8578.2 UAUGAGUGAUCUUUGCAAUAG 21 13 7 7 6    7 6
atr-miR8579 GUGAUGUAGCCCCGUUUAAGAAGG 24 9 5 6 3    6 3
atr-miR8580 UGUCUAAAUAGAAUGGAUGGUGUA 24 3 2 2 1    2 1
atr-miR8581 UGAGAGAAUUUUGGUAUGACGACU 24 62 31 47 15    47 15
atr-miR8582 UAGGAGUCAUGACGUAGCUUG 21 12 6 10 2    2 10
atr-miR8583 GCACCACUUGUGACUUAGCUACUG 24 33 17 30 3    30 3
atr-miR8584 UGAACCCUGGUCGUCGCGCUGUG 23 45 23 44 1    44 1
atr-miR8585 UCACAGGAGAGAUGAUACUGGU 22 11 6 7 4    7 4
atr-miR8586 UUUUCUCUUAACAACAGAGGA 21 15 8 13 2    2 13
atr-miR8587 UCCAACUUUUGAACUGCCCAAAAU 24 134 67 116 18    116 18
atr-miR8588 CCGAGCUCCCAGGGUUAAUGG 21 197 99 108 89    89 108
atr-miR8589 AGGACCACGAUUUUUCGGCCACGG 24 2 1 1 1    1 1
atr-miR8590 AUUCCGAUUUGUAGAAAAAAAAAU 24 42 21 31 11    31 11
atr-miR8591 AAGGAUGUAAGCUCGAGGCCGAGC 24 137 69 124 13    124 13
atr-miR8592 AUCUAAUGAACUCAUCCCGUCAGU 24 4 2 3 1    3 1
atr-miR8593 UCUUAGCUUGUCCUAAAAGGCAUG 24 5 3 3 2    2 3
atr-miR8594.1 UUAUCAACAGUAUCAAUGGAUAUG 24 13 7 8 5    8 5
atr-miR8594.2 AAUGGAUAUGUUAAGCAAAUAAAU 24 2 1 1 1    1 1
atr-miR8595 CCCUAGUUGAAGGUCUUGGCC 21 15 8 9 6    9 6
atr-miR8596 AAAUGGAUUUCAAGCUCUAAAAAU 24 17 9 14 3    14 3
atr-miR8597 UUAGUGGUACACAACUUUGUAACC 24 21 11 20 1    1 20
atr-miR8598 UUUAGUCAGCACGAUCGGUGGUGC 24 26 13 22 4    22 4
atr-miR8599 CCAAAAUGGCUUGAGUUCUAACCU 24 3 2 2 1    1 2
atr-miR8600 AUCUCAUGUAGAUGACGUCACACC 24 210 105 120 90    90 120
atr-miR8601 UGCGAUUAGGUGUUGGAGUUU 21 3 2 2 1    2 1
atr-miR8602 UCAGGAGAGAUGAUGCCGGCC 21 466 233 328 138    328 138
atr-miR8603 UGAGCUUGUGGUUCGACAUGU 21 29 15 20 9    9 20
atr-miR8604 CAUGAAGGACACUUAGUGCAAGAG 24 22 11 13 9    9 13
atr-miR8605 CACAUUAAUCUCGACCAUUGGAUG 24 19 10 10 9    9 10
atr-miR8606 UCACCGAUCCGUUUUUUUAAACCU 24 8 4 7 1    7 1
atr-miR8607 UUUGUAAUUCUAGAUCUCAGGCUC 24 2 1 1 1    1 1
atr-miR8608 UUUUCUACAGAUCAGAUUGACUUG 24 4 2 2 2    2 2
atr-miR8609 ACUAAGAUCCGUGUAGCUAAUCUC 24 20 10 10 10    10 10
atr-miR8610.1 ACCUUCUUCGGUUUGUUCAGAAAA 24 5 3 4 1    4 1
atr-miR8610.2 UUCUGACCAAAUUGAAGGAGG 21 6 3 5 1    5 1
atr-miR8611 UAAGGGCGCUCCGACAACGUG 21 4 2 3 1    3 1
atr-miR8612 UGACCACGCGAUGAAAUUUGGACA 24 5 3 4 1    1 4
atr-miR8613 CAUCAAAUUGGAUGACUUGGGAUG 24 59 30 35 24    35 24
atr-miR8614 CAAUAGCUAAAGUGAUUGUGACC 23 9 5 5 4    4 5
atr-miR8615 CUUGUAGGUAUGAUUCCACGCA 22 47 24 39 8    8 39
atr-miR8616 UCAUCGAUUAUAAAAUUUGUAGCU 24 12 6 9 3    9 3
atr-miR8617 UCAUUUUAGUUGGAUGGUGUAGAU 24 11 6 7 4    7 4