Amborella PARE miRNA Abundances

The data below are based on the microRNAs listed in the Sanger registry. Adjust libraries/reads to display on the control panel.


        miRNA         miRNA sequence Len Sum (norm) Average Max Min (>0)  AmLdAmbL_2AmbFF_1
atr-miR156a UUGACAGAAGAUAGAGAGCAC 21 0 0 0 0    0 0 0
atr-miR156b UGACAGAAGAGAGUGAGCAC 20 22 7 10 4    10 4 8
atr-miR156c UUGACAGAAGAUAGAGAGCAC 21 0 0 0 0    0 0 0
atr-miR156d UGACAGAAGAGAGUGAGCAC 20 22 7 10 4    10 4 8
atr-miR159 UUUGGAUUGAAGGGAGCUCUA 21 0 0 0 0    0 0 0
atr-miR160 UGCCUGGCUCCCUGUAUGCCA 21 0 0 0 0    0 0 0
atr-miR164a UGGAGAAGCAGGGCACGUGCA 21 0 0 0 0    0 0 0
atr-miR164b UGGAGAAGCAGGGCACGUGCA 21 0 0 0 0    0 0 0
atr-miR166a UCGGACCAGGCUUCAUUCCCC 21 0 0 0 0    0 0 0
atr-miR166b UCUCGGACCAGGCUUCAUUCC 21 0 0 0 0    0 0 0
atr-miR166c UCGGACCAGGCUUCAUUCCCC 21 0 0 0 0    0 0 0
atr-miR166d UCGGACCAGGCUUCAUUCCCC 21 0 0 0 0    0 0 0
atr-miR167 UGAAGCUGCCAGCAUGAUCUG 21 0 0 0 0    0 0 0
atr-miR168 UCGCUUGGUGCAGGUCGGGAA 21 0 0 0 0    0 0 0
atr-miR169a UAGCCAAGGAUGACUUGCCU 20 0 0 0 0    0 0 0
atr-miR169b AGCAAGUCGCCUUGGCUAACC 21 0 0 0 0    0 0 0
atr-miR169c UAGCCAAGGAUGACUUGCCU 20 0 0 0 0    0 0 0
atr-miR171a UGAUUGAGCCGCGCCAAUAUC 21 0 0 0 0    0 0 0
atr-miR171b UUGAGCCGUGCCAAUAUCACA 21 0 0 0 0    0 0 0
atr-miR171c UGAUUGAGCCGCGCCAAUAUC 21 0 0 0 0    0 0 0
atr-miR172 GGAAUCUUGAUGAUGCUGCA 20 0 0 0 0    0 0 0
atr-miR2111 UAAUCUGUAUCUUGAGGUUUGG 22 0 0 0 0    0 0 0
atr-miR2950 UUCCAUCUCUUGCACACUGGA 21 0 0 0 0    0 0 0
atr-miR319a UUGGACUGAAGGGAGCUCCC 20 16 5 16 16    16 0 0
atr-miR319b UUUGGACUGAAGGGAGCUCCU 21 0 0 0 0    0 0 0
atr-miR319c UUGGACUGAAGGGAGCUCCC 20 16 5 16 16    16 0 0
atr-miR319d UUUGGACUGAAGGGAGCUCCU 21 0 0 0 0    0 0 0
atr-miR319e UUUGGACUGAAGGGAGCUCCU 21 0 0 0 0    0 0 0
atr-miR390.1 UAAAGCUCAGGAGGGAUAGCG 21 0 0 0 0    0 0 0
atr-miR390.2 AAGCUCAGGAGGGAUAGCGCC 21 0 0 0 0    0 0 0
atr-miR393 UCCAAAGGGAUCGCAUUGAUCC 22 0 0 0 0    0 0 0
atr-miR394 UUGGCAUUCUGUCCACCUCC 20 12 4 6 1    5 1 6
atr-miR395 CUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0
atr-miR396a UCCACAGGCUUUCUUGAACAU 21 0 0 0 0    0 0 0
atr-miR396b UUCCACAGCUUUCUUGAACUU 21 0 0 0 0    0 0 0
atr-miR396c UUCCACAGCUUUCUUGAACUU 21 0 0 0 0    0 0 0
atr-miR396d CUCCACGGCUUUCUUGAACUU 21 0 0 0 0    0 0 0
atr-miR396e UUCCACAGCUUUCUUGAACUU 21 0 0 0 0    0 0 0
atr-miR397a UCCUUGAGUGCAGCGUUGAUG 21 0 0 0 0    0 0 0
atr-miR397b UCAUUGAGUGCAGCGUUGGUG 21 0 0 0 0    0 0 0
atr-miR398 UGUGUUCCCAGGUCGCCCCUG 21 0 0 0 0    0 0 0
atr-miR477 AGAGGCCUUAGGGGAGAGUGG 21 0 0 0 0    0 0 0
atr-miR535 UGACAACGAGAGAGAGCACGC 21 0 0 0 0    0 0 0
atr-miR828 UGAUACUCAUUUCAGCAAGCAA 22 0 0 0 0    0 0 0
atr-miR8551 AUGUUCUAGGUUAGCUCUUGGAUG 24 0 0 0 0    0 0 0
atr-miR8552a CGAAAUGAGGUCGUGACCGUCAGA 24 0 0 0 0    0 0 0
atr-miR8552b UACCGGACAUCUGUGAUCGUCAGA 24 0 0 0 0    0 0 0
atr-miR8552c GGCCGUGAUCGUCAAAUUGGCUCA 24 0 0 0 0    0 0 0
atr-miR8552d UCCGUGAUCGUUAGAUCGGCCCAG 24 0 0 0 0    0 0 0
atr-miR8553a AUCGGGUGGUUCAGAAUUCAUAUC 24 0 0 0 0    0 0 0
atr-miR8553b UGUAUUUUGGACCACCUGAUGAAG 24 0 0 0 0    0 0 0
atr-miR8554 UGCGAUGACUUUGGAUCUUGAGGA 24 0 0 0 0    0 0 0
atr-miR8555 AGUUAACUAGGCAUCUAUAGGAUG 24 0 0 0 0    0 0 0
atr-miR8556 UAAAAGACAGGAAUUGUAACU 21 0 0 0 0    0 0 0
atr-miR8557 CCAAAUAGUUGGGAAAAGGCU 21 0 0 0 0    0 0 0
atr-miR8558a UUUCCGAAUCCGCCUAUACCUG 22 0 0 0 0    0 0 0
atr-miR8558b UUUCCGAUCCCGCCCAUGCCGU 22 0 0 0 0    0 0 0
atr-miR8559 UGACACUGUAGUAGUCAACCCGUG 24 0 0 0 0    0 0 0
atr-miR8560 UCCACUUUAAACACUCAGCCU 21 0 0 0 0    0 0 0
atr-miR8561.1 UGACAUUGUUGUCGGCUCACUACU 24 0 0 0 0    0 0 0
atr-miR8561.2 AAUGUCACACAUUAAUUAUGGCCU 24 0 0 0 0    0 0 0
atr-miR8562a UCGGAAUGAUCUGAAAUUUGGAGC 24 0 0 0 0    0 0 0
atr-miR8562b UCGGAAUGAUCUGAAAUUUGGAGC 24 0 0 0 0    0 0 0
atr-miR8562c UCAGAAUGAUCUGAAAUUUGGAGC 24 0 0 0 0    0 0 0
atr-miR8563 CUCCAUACUCUAAGCUGUUAGAAU 24 0 0 0 0    0 0 0
atr-miR8564 AGCUGUUGGGCUCAUAUGUUCAUA 24 0 0 0 0    0 0 0
atr-miR8565a UUGGCACAGAUCUCUAGAAAAGUU 24 0 0 0 0    0 0 0
atr-miR8565b UUUGGCACAGAUCUCUAGAAAAGU 24 0 0 0 0    0 0 0
atr-miR8565c UUUGGCACAGAUCUCUAGAAAAGU 24 0 0 0 0    0 0 0
atr-miR8565d UUUGGCACAGAUCUCUAGAAAAGU 24 0 0 0 0    0 0 0
atr-miR8565e UUUGGCACAGAUCUCUAGAAAAGU 24 0 0 0 0    0 0 0
atr-miR8565f UUUGGCACAGAUCUCUAGAAAAGU 24 0 0 0 0    0 0 0
atr-miR8565g CAUGUGUGUAGGAUUCCAAAUGAU 24 0 0 0 0    0 0 0
atr-miR8565h AUUAAAUUUGGCAUAGAUCUUUAG 24 0 0 0 0    0 0 0
atr-miR8566 AUUAGAGCUGGGUGGAUGAAGUGG 24 0 0 0 0    0 0 0
atr-miR8567 ACAAGAUGCACUAAUUUUAGGACU 24 0 0 0 0    0 0 0
atr-miR8568 UGGCUUACUGUGAUCGUUGUCC 22 0 0 0 0    0 0 0
atr-miR8569 ACUGGCAAUCUGGUCGGUCGGACC 24 0 0 0 0    0 0 0
atr-miR8570 AGUUGGGAGUGCGUCAUUGACUAG 24 0 0 0 0    0 0 0
atr-miR8571 UUCAAUCGUCAAGUAUCCAUGCCU 24 0 0 0 0    0 0 0
atr-miR8572 UGACCCGGUCGUUGGAAUCCUCUC 24 0 0 0 0    0 0 0
atr-miR8573 CCGGUCUGGCACAAUGUGUGC 21 0 0 0 0    0 0 0
atr-miR8574 ACAUCUUAUGAGUAAGAGUGAUUG 24 0 0 0 0    0 0 0
atr-miR8575 AGAUGUGUCGUGUCUGAAAGGUCA 24 0 0 0 0    0 0 0
atr-miR8576 AGCCAUCAUACUGGAUUUGUCGUA 24 0 0 0 0    0 0 0
atr-miR8577 AAAAGGCUCAGAUGAUGAUGAUGA 24 0 0 0 0    0 0 0
atr-miR8578.1 UUUAUGAGUGAUCUUUGCAAU 21 0 0 0 0    0 0 0
atr-miR8578.2 UAUGAGUGAUCUUUGCAAUAG 21 0 0 0 0    0 0 0
atr-miR8579 GUGAUGUAGCCCCGUUUAAGAAGG 24 0 0 0 0    0 0 0
atr-miR8580 UGUCUAAAUAGAAUGGAUGGUGUA 24 0 0 0 0    0 0 0
atr-miR8581 UGAGAGAAUUUUGGUAUGACGACU 24 0 0 0 0    0 0 0
atr-miR8582 UAGGAGUCAUGACGUAGCUUG 21 0 0 0 0    0 0 0
atr-miR8583 GCACCACUUGUGACUUAGCUACUG 24 0 0 0 0    0 0 0
atr-miR8584 UGAACCCUGGUCGUCGCGCUGUG 23 0 0 0 0    0 0 0
atr-miR8585 UCACAGGAGAGAUGAUACUGGU 22 0 0 0 0    0 0 0
atr-miR8586 UUUUCUCUUAACAACAGAGGA 21 0 0 0 0    0 0 0
atr-miR8587 UCCAACUUUUGAACUGCCCAAAAU 24 0 0 0 0    0 0 0
atr-miR8588 CCGAGCUCCCAGGGUUAAUGG 21 0 0 0 0    0 0 0
atr-miR8589 AGGACCACGAUUUUUCGGCCACGG 24 0 0 0 0    0 0 0
atr-miR8590 AUUCCGAUUUGUAGAAAAAAAAAU 24 0 0 0 0    0 0 0
atr-miR8591 AAGGAUGUAAGCUCGAGGCCGAGC 24 0 0 0 0    0 0 0
atr-miR8592 AUCUAAUGAACUCAUCCCGUCAGU 24 0 0 0 0    0 0 0
atr-miR8593 UCUUAGCUUGUCCUAAAAGGCAUG 24 0 0 0 0    0 0 0
atr-miR8594.1 UUAUCAACAGUAUCAAUGGAUAUG 24 0 0 0 0    0 0 0
atr-miR8594.2 AAUGGAUAUGUUAAGCAAAUAAAU 24 0 0 0 0    0 0 0
atr-miR8595 CCCUAGUUGAAGGUCUUGGCC 21 0 0 0 0    0 0 0
atr-miR8596 AAAUGGAUUUCAAGCUCUAAAAAU 24 0 0 0 0    0 0 0
atr-miR8597 UUAGUGGUACACAACUUUGUAACC 24 0 0 0 0    0 0 0
atr-miR8598 UUUAGUCAGCACGAUCGGUGGUGC 24 0 0 0 0    0 0 0
atr-miR8599 CCAAAAUGGCUUGAGUUCUAACCU 24 0 0 0 0    0 0 0
atr-miR8600 AUCUCAUGUAGAUGACGUCACACC 24 0 0 0 0    0 0 0
atr-miR8601 UGCGAUUAGGUGUUGGAGUUU 21 0 0 0 0    0 0 0
atr-miR8602 UCAGGAGAGAUGAUGCCGGCC 21 0 0 0 0    0 0 0
atr-miR8603 UGAGCUUGUGGUUCGACAUGU 21 0 0 0 0    0 0 0
atr-miR8604 CAUGAAGGACACUUAGUGCAAGAG 24 0 0 0 0    0 0 0
atr-miR8605 CACAUUAAUCUCGACCAUUGGAUG 24 0 0 0 0    0 0 0
atr-miR8606 UCACCGAUCCGUUUUUUUAAACCU 24 0 0 0 0    0 0 0
atr-miR8607 UUUGUAAUUCUAGAUCUCAGGCUC 24 0 0 0 0    0 0 0
atr-miR8608 UUUUCUACAGAUCAGAUUGACUUG 24 0 0 0 0    0 0 0
atr-miR8609 ACUAAGAUCCGUGUAGCUAAUCUC 24 0 0 0 0    0 0 0
atr-miR8610.1 ACCUUCUUCGGUUUGUUCAGAAAA 24 0 0 0 0    0 0 0
atr-miR8610.2 UUCUGACCAAAUUGAAGGAGG 21 0 0 0 0    0 0 0
atr-miR8611 UAAGGGCGCUCCGACAACGUG 21 0 0 0 0    0 0 0
atr-miR8612 UGACCACGCGAUGAAAUUUGGACA 24 0 0 0 0    0 0 0
atr-miR8613 CAUCAAAUUGGAUGACUUGGGAUG 24 0 0 0 0    0 0 0
atr-miR8614 CAAUAGCUAAAGUGAUUGUGACC 23 0 0 0 0    0 0 0
atr-miR8615 CUUGUAGGUAUGAUUCCACGCA 22 0 0 0 0    0 0 0
atr-miR8616 UCAUCGAUUAUAAAAUUUGUAGCU 24 0 0 0 0    0 0 0
atr-miR8617 UCAUUUUAGUUGGAUGGUGUAGAU 24 0 0 0 0    0 0 0