About This Database    FAQs   Our Collaborators

Annotated species Glycine max Annotation built on JGI 2.0 Total number of genes 57,190
Library type small RNA Total bp in genome 978,647,490 Protein coding 57,190
Total number of libraries 35 Total chrs or contigs 1,191 Transposon related 0

This project is supported by the USDA National Research Initiative (NRI) Plant Genome Program of the USDA Cooperative State Research, Education and Extension Service (CSREES), grant # 2006-353000-17159.

Some data contributed by: D. Janine Sherrier (Delaware Biotechnology Institute, University of Delaware), Pamela Green (Delaware Biotechnology Institute, University of Delaware).

Access to this web site and the data contained herein are provided for research purposes only. No commercial rights of any nature are granted.

Basic Queries

Please enter specific information to retrieve data.
Adjust libraries/reads to display on the control panel (optional).

Protein or gene ID
Bulk Query
Using a v1 gene identifier? SoyBase version converter

e.g. Glyma.01G000100.Wm82.a2.v1
Cluster or coordinate ID
Bulk Query

e.g. SOY_JGI2.1.2001.500 (cluster)   SOY_JGI2.1.2001.4500 (coordinate)
Sequence of small RNA read
Bulk Query
e.g. TTCTTTGACGTCCAAACATGA
Keyword for genes/proteins or repeats

e.g. MIRNA  LTR

Query by Chromosome Position

Click on a region of any chromosome for which you would like to retrieve the map. Because of the size of chromosomes, clicking on the diagram below will take you to a second map where you can refine the position. Note that if the genome has a mix of both chromosomes and small contigs or scaffolds, we only show images for the defined chromosomes, and contigs must be accessed via their ID.

0 - 10,000,00010,000,000 - 20,000,00020,000,000 - 30,000,00030,000,000 - 40,000,00040,000,000 - 50,000,00050,000,000 - 56,831,6240 - 10,000,00010,000,000 - 20,000,00020,000,000 - 30,000,00030,000,000 - 40,000,00040,000,000 - 48,577,50548,577,505 - 48,577,5050 - 10,000,00010,000,000 - 20,000,00020,000,000 - 30,000,00030,000,000 - 40,000,00040,000,000 - 45,779,78145,779,781 - 45,779,7810 - 10,000,00010,000,000 - 20,000,00020,000,000 - 30,000,00030,000,000 - 40,000,00040,000,000 - 50,000,00050,000,000 - 52,389,1460 - 10,000,00010,000,000 - 20,000,00020,000,000 - 30,000,00030,000,000 - 40,000,00040,000,000 - 42,234,49842,234,498 - 42,234,4980 - 10,000,00010,000,000 - 20,000,00020,000,000 - 30,000,00030,000,000 - 40,000,00040,000,000 - 50,000,00050,000,000 - 51,416,4860 - 10,000,00010,000,000 - 20,000,00020,000,000 - 30,000,00030,000,000 - 40,000,00040,000,000 - 44,630,64644,630,646 - 44,630,6460 - 10,000,00010,000,000 - 20,000,00020,000,000 - 30,000,00030,000,000 - 40,000,00040,000,000 - 47,837,94047,837,940 - 47,837,9400 - 10,000,00010,000,000 - 20,000,00020,000,000 - 30,000,00030,000,000 - 40,000,00040,000,000 - 50,000,00050,000,000 - 50,189,7640 - 10,000,00010,000,000 - 20,000,00020,000,000 - 30,000,00030,000,000 - 40,000,00040,000,000 - 50,000,00050,000,000 - 51,566,8980 - 10,000,00010,000,000 - 20,000,00020,000,000 - 30,000,00030,000,000 - 34,766,86734,766,867 - 34,766,86734,766,867 - 34,766,8670 - 10,000,00010,000,000 - 20,000,00020,000,000 - 30,000,00030,000,000 - 40,000,00040,000,000 - 40,091,31440,091,314 - 40,091,3140 - 10,000,00010,000,000 - 20,000,00020,000,000 - 30,000,00030,000,000 - 40,000,00040,000,000 - 45,874,16245,874,162 - 45,874,1620 - 10,000,00010,000,000 - 20,000,00020,000,000 - 30,000,00030,000,000 - 40,000,00040,000,000 - 49,042,19249,042,192 - 49,042,1920 - 10,000,00010,000,000 - 20,000,00020,000,000 - 30,000,00030,000,000 - 40,000,00040,000,000 - 50,000,00050,000,000 - 51,756,3430 - 10,000,00010,000,000 - 20,000,00020,000,000 - 30,000,00030,000,000 - 37,887,01437,887,014 - 37,887,01437,887,014 - 37,887,0140 - 10,000,00010,000,000 - 20,000,00020,000,000 - 30,000,00030,000,000 - 40,000,00040,000,000 - 41,641,36641,641,366 - 41,641,3660 - 10,000,00010,000,000 - 20,000,00020,000,000 - 30,000,00030,000,000 - 40,000,00040,000,000 - 50,000,00050,000,000 - 58,018,7420 - 10,000,00010,000,000 - 20,000,00020,000,000 - 30,000,00030,000,000 - 40,000,00040,000,000 - 50,000,00050,000,000 - 50,746,9160 - 10,000,00010,000,000 - 20,000,00020,000,000 - 30,000,00030,000,000 - 40,000,00040,000,000 - 47,904,18147,904,181 - 47,904,1810 - 152,218152,218 - 152,218152,218 - 152,218152,218 - 152,218152,218 - 152,218152,218 - 152,218 Chromosome image

If you know the start and/or end of your genomic region, please enter one or both coordinates here to go directly to our chromosome viewer. If you only enter one coordinate, we use a default size of 100 kb for the viewer.