Soybean miRNA Abundances

The data below are based on the microRNAs listed in the Sanger registry. Adjust libraries/reads to display on the control panel.

        

        miRNA         miRNA sequence Len Sum (norm) Average Max Min (>0)  GMA01GMA02GMA03GMA04GMA05bGMA06bGMA07bPVU01PVU02PVU03PVU04AHY01AHY02MSDL1MYR1MINFMND1MRG1MLEFMRMI1MTR018hpiW82Ps8hpiHarPs8hW82CT8hHarCTWT_1WT_2dcl1a_1_3dcl1a_1_4dcl1a_2_5dcl1a_2_6dcl1b_1_7dcl1b_1_8dcl1a_dcl1b_9dcl1a_dcl1b_10
gma-miR1507a UCUCAUUCCAUACAUCGUCUGA 22 11,645,974 485,249 1,370,817 2    45,457 11,838 2,950 5,073 30,344 13,357 23,141 3 2 0 10 0 0 0 0 0 0 0 0 0 0 8,495 5,851 2,342 1,377 1,136,636 1,370,817 1,146,302 1,107,224 1,014,662 895,597 1,358,797 1,186,634 1,058,339 1,220,726
gma-miR1507b UCUCAUUCCAUACAUCGUCUG 21 8,305 395 1,010 1    20 10 1 13 65 33 45 0 0 0 0 0 0 0 0 0 0 0 0 0 0 40 18 38 4 814 948 757 749 782 557 884 1,010 719 798
gma-miR1507c-3p CCUCAUUCCAAACAUCAUCU 20 69 6 14 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 1 6 0 6 8 0 14 5 11 5 6 2 3
gma-miR1507c-5p GAGGUGUUUGGGAUGAGAGAA 21 1,645 78 773 1    2 5 5 3 6 2 6 0 0 0 0 0 0 0 0 0 0 0 0 0 0 217 773 42 515 7 4 6 12 8 11 1 9 7 4
gma-miR1508a UCUAGAAAGGGAAAUAGCAGUUG 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1508b UAGAAAGGGGAAUAGCAGUUG 21 5 1 1 1    0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 1 0 0 0 1
gma-miR1508c UAGAAAGGGAAAUAGCAGUUG 21 15,381 732 2,929 37    1,340 549 429 845 1,020 520 1,688 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2,929 2,712 1,890 115 138 144 174 166 109 205 37 102 182 87
gma-miR1509a UUAAUCAAGGAAAUCACGGUCG 22 60,462 2,748 10,426 10    6,441 10,426 6,478 3,000 8,300 6,895 8,315 0 0 0 10 0 0 0 0 0 0 0 0 0 0 2,734 1,664 2,192 236 358 510 375 349 399 504 175 475 231 395
gma-miR1509b UUAAUCAAGGAAAUCACGGUU 21 474 25 77 1    76 70 14 6 77 59 29 0 0 0 0 0 0 0 0 0 0 0 0 0 0 33 24 63 0 1 1 1 0 5 3 1 5 2 4
gma-miR1510a-3p UUGUUGUUUUACCUAUUCCACCC 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1510a-5p AGGGAUAGGUAAAACAAUGACUGC 24 331 17 60 3    39 21 29 28 3 7 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 60 0 23 0 6 13 3 8 9 10 11 28 12 18
gma-miR1510b-3p UGUUGUUUUACCUAUUCCACC 21 1,999 95 356 1    1 6 2 21 48 12 10 0 0 0 0 0 0 0 0 0 0 0 0 0 0 356 105 107 13 99 133 160 162 126 184 104 121 90 139
gma-miR1510b-5p AGGGAUAGGUAAAACAACUACU 22 24,941 1,134 3,919 7    88 47 343 52 469 3,919 352 0 0 0 7 0 0 0 0 0 0 0 0 0 0 122 208 77 154 1,626 1,870 1,872 1,890 1,606 2,884 1,462 1,796 2,535 1,562
gma-miR1511 AACCAGGCUCUGAUACCAUG 20 4,018 130 442 1    6 24 14 13 0 0 0 13 20 20 7 32 40 1 16 13 3 12 0 29 5 134 442 75 199 220 291 358 304 227 369 283 400 188 260
gma-miR1512a-3p GCUUUAAGAAUUUCAGUUAUG 21 3 1 1 1    0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0
gma-miR1512a-5p UAACUGAAAAUUCUUAAAGUAU 22 16 3 9 1    1 0 0 0 0 2 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 9 0 0 0 0 0 0 0 0 0 0 0
gma-miR1512b UAACUGGAAAUUCUUAAAGCAU 22 462 23 117 1    19 1 84 5 9 7 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 117 24 107 0 10 10 3 5 10 23 4 9 8 3
gma-miR1512c UAACUGAACAUUCUUAGAGCAU 22 10,453 1,045 5,460 1    0 219 5,460 4,750 6 7 1 0 0 0 7 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 1 0 0
gma-miR1513a-3p UUUAAAUGUGUAUAAGUCAUGGU 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1513a-5p UGAGAGAAAGCCAUGACUUAC 21 3,346 159 668 6    42 6 246 25 78 42 143 0 0 0 0 0 0 0 0 0 0 0 0 0 0 213 668 86 282 116 140 168 126 151 214 113 207 161 119
gma-miR1513b UGAGAGAAAGCCAUGACUUAC 21 3,346 159 668 6    42 6 246 25 78 42 143 0 0 0 0 0 0 0 0 0 0 0 0 0 0 213 668 86 282 116 140 168 126 151 214 113 207 161 119
gma-miR1513c UAUGAGAGAAAGCCAUGAC 19 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1514a-3p AUGCCUAUUUUAAAAUGAAAA 21 23 2 5 1    1 1 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5 1 1 3 1 2 3 0 2 1
gma-miR1514a-5p UUCAUUUUUAAAAUAGGCAUU 21 88 7 16 1    0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 10 10 8 8 7 16 6 9 4 8
gma-miR1514b-3p AUGCCUAUUUUAAAAUGAAAA 21 23 2 5 1    1 1 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5 1 1 3 1 2 3 0 2 1
gma-miR1514b-5p UUCAUUUUUAAAAUAGACAUU 21 2 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 0 0 0
gma-miR1515a UCAUUUUGCGUGCAAUGAUCUG 22 3,316 133 731 2    5 7 5 24 12 24 23 46 2 731 155 0 0 0 0 0 0 0 0 0 0 268 12 116 2 176 163 158 151 156 359 199 158 201 163
gma-miR1515b UCAUUUUGCGUGCAAUGAUCUG 22 3,316 133 731 2    5 7 5 24 12 24 23 46 2 731 155 0 0 0 0 0 0 0 0 0 0 268 12 116 2 176 163 158 151 156 359 199 158 201 163
gma-miR1516a-3p CAAAAGAGCUUAUGGCUUGUA 21 2 1 1 1    0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1516a-5p CAAGUUAUAAGCUCUUUUGAGAG 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1516b AGCUUCUCUACAGAAAAUAUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1516c AAUGUCUGGGCUUAGCGAGGCGGU 24 19 4 12 1    2 12 2 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1516d GUACUUGUGGCUUGUAUCCAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1517 AGUCUUGGUCAAUGUCGUUCGAAA 24 2 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0
gma-miR1518 UGUGUUGUAAAGUGAAUAUCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1519 UAAGUGUUGCAAAAUAGUCAUU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1520a UAGAACAUGAUACAUGACAGUCA 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1520b GUGACAGUCAUCAUUUAAUAAGA 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1520c UUCAAUAAGAACGUGACACGUGA 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1520d AUCAGAACAUGACACGUGACAA 22 1 1 1 1    0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1520e CAAUAAGAACGUGACAUAUGACAG 24 8 2 2 1    1 1 2 2 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1520f-3p CAAUCAGAACAUGACACAUGACAA 24 24 2 4 1    3 1 4 1 2 2 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 1 0 1 1 0 0 0 0 3
gma-miR1520f-5p AUUGUCACGUGUCAUGUUCUGAUU 24 973 75 121 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 1 4 0 66 114 85 109 104 101 98 121 57 109
gma-miR1520g CAAUCAGAACAUGACACGUGACAA 24 54 5 12 1    9 7 4 6 3 7 12 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 2 1 1 0 0
gma-miR1520h AACGUCCAAUCAGAACGUGACAUG 24 31 4 9 2    6 4 9 5 2 2 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1520i AACGUGACACGUGACGGUCAACAU 24 8 1 2 1    1 1 0 2 0 2 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0
gma-miR1520j AAGAACGUGACACAUGACAAUCAA 24 14 2 3 1    2 2 3 3 0 2 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1520k AAUCAGAACAUGACACAUGACAGU 24 87 5 14 1    1 0 8 1 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 3 0 6 5 11 4 14 7 6 8 1 8
gma-miR1520l AAUCAGAACAUGACACGUGAUAGU 24 118 6 20 1    1 1 20 5 6 9 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 1 4 0 4 6 13 9 8 4 5 9 1 8
gma-miR1520m AAUCAGAACAUGACAUGUGACAAU 24 13 2 3 1    1 1 2 1 2 2 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0
gma-miR1520n UCAAUCAGAACAUGACACGUGACA 24 34 2 5 1    1 4 5 1 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 3 0 1 2 3 2 4 0 3
gma-miR1520o UCAUCGUCCAAUCAGAAUGUGACA 24 21 2 4 1    0 4 4 1 2 2 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 1 0 1 0 0 1
gma-miR1520p AUGUUGUUAUUGGAUGAUGACGGU 24 17 3 8 1    4 8 3 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1520q AUUGACCAAUCAGAACAUGACACA 24 35 3 12 1    2 1 12 3 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 2 0 0 3 1 2 0 1 3 2 1
gma-miR1520r UGUCACAUCCUGGUUGGACAUGAA 24 17 2 4 1    3 4 1 3 2 2 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1521a CUGUUAAUGGAAAAUGUUGA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1521b GACUGUCACGUGUCAUAAUCAUA 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1522 UUUAUUGCUUAAAAUGAAAU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1523a AUGGGAUAAAUGUGAGCUCA 20 12 2 4 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 4 0 1 0 3 0 1 1 0 0
gma-miR1523b UCAUCGCUCCUGAGCUCACA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1524 CGAGUCCGAGGAAGGAACUCC 21 3 1 1 1    0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 0 0 0 0
gma-miR1525 UGGGUUAAUUAAGUUUUUAGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1526 CCGGAAGAGGAAAAUUAAGCAA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1527 UAACUCAACCUUACAAAACC 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1528 AUAGAUUAGAUCAAUAUAUUAGU 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1529 UUAAAGGAAACAAUUAAUCGUUA 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1530 UUUUCACAUAAAUUAAAAUAU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1531-3p UCGUCCAUAUGGGAAGACUUGUC 23 1 1 1 1    0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1531-5p AUAUGGACGAAGAGAUAGGUAAAU 24 28 3 9 1    1 0 9 0 0 5 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 1 0 0 1 0 0 2 0 1 0 0 1
gma-miR1532 AACACGCUAAGCGAGAGGAGCUC 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1533 AUAAUAAAAAUAAUAAUGA 19 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1534 UAUUUUGGGUAAAUAGUCAU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1535a CUUGUUUGUGGUGAUGUCU 19 2 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1535b CUUGUUUGUGGUGAUGUCUAG 21 184 10 83 1    83 4 7 0 5 33 14 0 0 0 0 0 0 0 0 0 0 0 0 0 0 7 5 1 0 5 3 1 3 3 1 0 1 5 3
gma-miR1536 AAGCAGAGACAAAUGUGUUUA 21 4 1 2 1    0 0 1 1 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR156a UGACAGAAGAGAGUGAGCAC 20 723,164 21,914 174,100 2    749 7,473 2,085 10,410 2 0 0 55,461 2,504 122,852 24,475 10,589 14,628 101,596 43,082 7,103 29,529 26,475 174,100 44,213 10,743 89 19 52 9 3,406 3,703 3,901 3,956 2,944 4,226 3,128 2,557 5,476 1,629
gma-miR156aa AUUGGAGUGAAGGGAGCU 18 1,716 95 613 1    19 134 0 3 14 21 1 341 2 613 0 106 43 0 2 0 9 12 0 0 0 38 94 54 210 0 0 0 0 0 0 0 0 0 0
gma-miR156ab AUUUAAGUGAUGGGAGCUCCG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR156b UGACAGAAGAGAGAGAGCACA 21 31 5 15 2    0 0 0 2 2 2 0 0 0 0 0 0 0 15 0 0 0 0 5 0 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR156c UUGACAGAAGAUAGAGAGCAC 21 725,646 20,733 233,988 121    8,673 3,118 1,391 2,256 24,933 20,235 9,274 83,454 96,653 92,730 4,335 15,782 57,292 233,988 29,214 4,926 12,493 121 8,384 2,729 286 527 1,139 245 346 787 810 1,016 612 740 1,546 415 880 3,906 410
gma-miR156d UUGACAGAAGAUAGAGAGCAC 21 725,646 20,733 233,988 121    8,673 3,118 1,391 2,256 24,933 20,235 9,274 83,454 96,653 92,730 4,335 15,782 57,292 233,988 29,214 4,926 12,493 121 8,384 2,729 286 527 1,139 245 346 787 810 1,016 612 740 1,546 415 880 3,906 410
gma-miR156e UUGACAGAAGAUAGAGAGCAC 21 725,646 20,733 233,988 121    8,673 3,118 1,391 2,256 24,933 20,235 9,274 83,454 96,653 92,730 4,335 15,782 57,292 233,988 29,214 4,926 12,493 121 8,384 2,729 286 527 1,139 245 346 787 810 1,016 612 740 1,546 415 880 3,906 410
gma-miR156f UUGACAGAAGAGAGAGAGCACA 22 67 6 16 1    0 0 0 14 2 2 1 0 9 0 0 5 0 16 0 7 0 0 2 4 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR156g ACAGAAGAUAGAGAGCACAG 20 320 20 90 1    90 64 8 12 0 0 0 0 0 0 0 5 0 16 11 0 0 0 0 0 0 35 16 26 0 0 0 1 0 1 12 0 1 21 1
gma-miR156h UGACAGAAGAGAGUGAGCAC 20 723,164 21,914 174,100 2    749 7,473 2,085 10,410 2 0 0 55,461 2,504 122,852 24,475 10,589 14,628 101,596 43,082 7,103 29,529 26,475 174,100 44,213 10,743 89 19 52 9 3,406 3,703 3,901 3,956 2,944 4,226 3,128 2,557 5,476 1,629
gma-miR156i UUGACAGAAGAUAGAGAGCAC 21 725,646 20,733 233,988 121    8,673 3,118 1,391 2,256 24,933 20,235 9,274 83,454 96,653 92,730 4,335 15,782 57,292 233,988 29,214 4,926 12,493 121 8,384 2,729 286 527 1,139 245 346 787 810 1,016 612 740 1,546 415 880 3,906 410
gma-miR156j UUGACAGAAGAUAGAGAGCAC 21 725,646 20,733 233,988 121    8,673 3,118 1,391 2,256 24,933 20,235 9,274 83,454 96,653 92,730 4,335 15,782 57,292 233,988 29,214 4,926 12,493 121 8,384 2,729 286 527 1,139 245 346 787 810 1,016 612 740 1,546 415 880 3,906 410
gma-miR156k UUGACAGAAGAGAGUGAGCAC 21 53,794 1,582 27,584 3    81 159 39 718 334 351 349 5,572 200 6,788 122 5,556 27,584 426 38 59 23 32 519 162 49 3 3 3 0 460 507 397 477 375 432 370 499 863 244
gma-miR156l UUGACAGAAGAUAGAGAGCAC 21 725,646 20,733 233,988 121    8,673 3,118 1,391 2,256 24,933 20,235 9,274 83,454 96,653 92,730 4,335 15,782 57,292 233,988 29,214 4,926 12,493 121 8,384 2,729 286 527 1,139 245 346 787 810 1,016 612 740 1,546 415 880 3,906 410
gma-miR156m UUGACAGAAGAUAGAGAGCAC 21 725,646 20,733 233,988 121    8,673 3,118 1,391 2,256 24,933 20,235 9,274 83,454 96,653 92,730 4,335 15,782 57,292 233,988 29,214 4,926 12,493 121 8,384 2,729 286 527 1,139 245 346 787 810 1,016 612 740 1,546 415 880 3,906 410
gma-miR156n UUGACAGAAGAGAGUGAGCAC 21 53,794 1,582 27,584 3    81 159 39 718 334 351 349 5,572 200 6,788 122 5,556 27,584 426 38 59 23 32 519 162 49 3 3 3 0 460 507 397 477 375 432 370 499 863 244
gma-miR156o UUGACAGAAGAGAGUGAGCAC 21 53,794 1,582 27,584 3    81 159 39 718 334 351 349 5,572 200 6,788 122 5,556 27,584 426 38 59 23 32 519 162 49 3 3 3 0 460 507 397 477 375 432 370 499 863 244
gma-miR156p UUGACAGAAGAAAGGGAGCAC 21 364 21 212 1    1 1 212 60 26 33 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 5 7 3 2 1 1 4 2 2
gma-miR156q UGACAGAAGAGAGUGAGCACU 21 32,419 1,046 12,801 1    1 17 6 171 11,993 12,801 4,390 34 3 136 10 5 35 146 35 10 20 32 214 44 5 0 0 0 0 205 233 253 209 159 377 203 156 378 138
gma-miR156r CUGACAGAAGAUAGAGAGCAU 21 385 32 214 1    69 18 214 2 20 33 24 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 1 0 0 1 0 0
gma-miR156s UGACAGAAGAGAGUGAGCACU 21 32,419 1,046 12,801 1    1 17 6 171 11,993 12,801 4,390 34 3 136 10 5 35 146 35 10 20 32 214 44 5 0 0 0 0 205 233 253 209 159 377 203 156 378 138
gma-miR156t UUGACAGAAGAAAGGGAGCAC 21 364 21 212 1    1 1 212 60 26 33 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 5 7 3 2 1 1 4 2 2
gma-miR156u UGACAGAAGAGAGUGAGCAC 20 723,164 21,914 174,100 2    749 7,473 2,085 10,410 2 0 0 55,461 2,504 122,852 24,475 10,589 14,628 101,596 43,082 7,103 29,529 26,475 174,100 44,213 10,743 89 19 52 9 3,406 3,703 3,901 3,956 2,944 4,226 3,128 2,557 5,476 1,629
gma-miR156v UGACAGAAGAGAGUGAGCAC 20 723,164 21,914 174,100 2    749 7,473 2,085 10,410 2 0 0 55,461 2,504 122,852 24,475 10,589 14,628 101,596 43,082 7,103 29,529 26,475 174,100 44,213 10,743 89 19 52 9 3,406 3,703 3,901 3,956 2,944 4,226 3,128 2,557 5,476 1,629
gma-miR156w UGACAGAAGAGAGUGAGCAC 20 723,164 21,914 174,100 2    749 7,473 2,085 10,410 2 0 0 55,461 2,504 122,852 24,475 10,589 14,628 101,596 43,082 7,103 29,529 26,475 174,100 44,213 10,743 89 19 52 9 3,406 3,703 3,901 3,956 2,944 4,226 3,128 2,557 5,476 1,629
gma-miR156x UGACAGAAGAGAGUGAGCAC 20 723,164 21,914 174,100 2    749 7,473 2,085 10,410 2 0 0 55,461 2,504 122,852 24,475 10,589 14,628 101,596 43,082 7,103 29,529 26,475 174,100 44,213 10,743 89 19 52 9 3,406 3,703 3,901 3,956 2,944 4,226 3,128 2,557 5,476 1,629
gma-miR156y UGACAGAAGAGAGUGAGCAC 20 723,164 21,914 174,100 2    749 7,473 2,085 10,410 2 0 0 55,461 2,504 122,852 24,475 10,589 14,628 101,596 43,082 7,103 29,529 26,475 174,100 44,213 10,743 89 19 52 9 3,406 3,703 3,901 3,956 2,944 4,226 3,128 2,557 5,476 1,629
gma-miR156z AUUGGAGUGAAGGGAGCU 18 1,716 95 613 1    19 134 0 3 14 21 1 341 2 613 0 106 43 0 2 0 9 12 0 0 0 38 94 54 210 0 0 0 0 0 0 0 0 0 0
gma-miR159a-3p UUUGGAUUGAAGGGAGCUCUA 21 2,517,766 71,936 698,008 132    215 349 230 281 262 193 431 571 135 455 132 786 594 501 603 1,240 937 1,275 1,098 832 378 44,318 47,610 12,383 10,509 280,330 165,110 243,359 244,521 143,190 164,229 114,324 124,755 698,008 213,622
gma-miR159a-5p GAGCUCCUUGAAGUCCAAUUG 21 632 27 171 1    1 1 2 4 0 5 67 24 5 12 0 0 0 0 0 0 0 0 0 0 0 108 171 31 48 15 22 11 16 14 19 14 15 8 19
gma-miR159b-3p AUUGGAGUGAAGGGAGCUCCA 21 7,402 390 2,684 2    153 20 0 0 668 918 16 3 2 12 0 1,668 2,684 2 313 0 400 500 0 4 0 7 13 6 13 0 0 0 0 0 0 0 0 0 0
gma-miR159b-5p GAGUUCCCUGCACUCCAAGUC 21 40 8 15 2    0 0 0 0 6 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 15 6 11 2 0 0 0 0 0 0 0 0 0 0
gma-miR159c AUUGGAGUGAAGGGAGCUCCG 21 5,931 424 5,550 2    2 85 0 26 5 12 0 211 0 5,550 0 9 3 0 0 0 9 0 0 0 0 2 5 3 9 0 0 0 0 0 0 0 0 0 0
gma-miR159d AGCUGCUUAGCUAUGGAUCCC 21 1,752 57 286 1    5 30 1 3 8 12 13 4 7 26 0 0 0 32 87 98 88 286 182 44 0 22 142 6 22 47 47 55 74 40 83 87 102 41 58
gma-miR159e-3p UUUGGAUUGAAGGGAGCUCUA 21 2,517,766 71,936 698,008 132    215 349 230 281 262 193 431 571 135 455 132 786 594 501 603 1,240 937 1,275 1,098 832 378 44,318 47,610 12,383 10,509 280,330 165,110 243,359 244,521 143,190 164,229 114,324 124,755 698,008 213,622
gma-miR159e-5p GAGCUCCUUGAAGUCCAAUU 20 394 36 130 1    0 0 1 1 0 0 0 11 0 4 3 0 0 0 0 0 0 0 0 0 0 70 108 64 130 0 0 1 0 0 0 0 0 0 1
gma-miR159f-3p AUUGGAGUGAAGGGAGCUCCA 21 7,402 390 2,684 2    153 20 0 0 668 918 16 3 2 12 0 1,668 2,684 2 313 0 400 500 0 4 0 7 13 6 13 0 0 0 0 0 0 0 0 0 0
gma-miR159f-5p GAGUUCCCUGCACUCCAAGUC 21 40 8 15 2    0 0 0 0 6 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 15 6 11 2 0 0 0 0 0 0 0 0 0 0
gma-miR160a-3p GCGUAUGAGGAGCCAAGCAUA 21 4,566 157 855 1    75 161 115 39 166 125 177 556 398 353 13 202 80 53 373 163 267 156 139 855 22 27 22 19 6 0 0 1 0 1 1 0 0 0 1
gma-miR160a-5p UGCCUGGCUCCCUGUAUGCCA 21 16,234 464 3,470 7    104 142 7 81 60 87 60 558 159 1,484 36 1,319 1,890 18 443 869 3,470 1,099 148 2,350 373 184 63 203 15 75 99 99 95 109 186 82 127 48 92
gma-miR160b UGCCUGGCUCCCUGUAUGCC 20 105 6 12 1    0 0 0 0 0 0 0 1 0 2 0 0 3 0 0 0 9 0 0 0 0 12 5 11 4 2 5 10 4 8 6 6 9 4 4
gma-miR160c UGCCUGGCUCCCUGUAUGCC 20 105 6 12 1    0 0 0 0 0 0 0 1 0 2 0 0 3 0 0 0 9 0 0 0 0 12 5 11 4 2 5 10 4 8 6 6 9 4 4
gma-miR160d UGCCUGGCUCCCUGUAUGCC 20 105 6 12 1    0 0 0 0 0 0 0 1 0 2 0 0 3 0 0 0 9 0 0 0 0 12 5 11 4 2 5 10 4 8 6 6 9 4 4
gma-miR160e UGCCUGGCUCCCUGUAUGCC 20 105 6 12 1    0 0 0 0 0 0 0 1 0 2 0 0 3 0 0 0 9 0 0 0 0 12 5 11 4 2 5 10 4 8 6 6 9 4 4
gma-miR160f UGCCUGGCUCCCUGUAUGCCA 21 16,234 464 3,470 7    104 142 7 81 60 87 60 558 159 1,484 36 1,319 1,890 18 443 869 3,470 1,099 148 2,350 373 184 63 203 15 75 99 99 95 109 186 82 127 48 92
gma-miR162a UCGAUAAACCUCUGCAUCCA 20 759 40 102 2    0 0 0 0 0 0 0 0 0 4 0 0 0 0 2 0 3 0 2 7 0 31 37 10 9 45 87 42 83 50 102 54 82 56 53
gma-miR162b UCGAUAAACCUCUGCAUCCAG 21 38,140 1,090 4,057 16    20 118 83 68 43 52 121 280 46 538 43 51 466 274 562 521 250 532 391 969 16 305 262 100 37 4,057 3,866 3,144 3,112 3,216 3,229 3,361 2,531 3,069 2,407
gma-miR162c UCGAUAAACCUCUGCAUCCAG 21 38,140 1,090 4,057 16    20 118 83 68 43 52 121 280 46 538 43 51 466 274 562 521 250 532 391 969 16 305 262 100 37 4,057 3,866 3,144 3,112 3,216 3,229 3,361 2,531 3,069 2,407
gma-miR164a UGGAGAAGCAGGGCACGUGCA 21 24,672 705 5,833 7    302 28 745 197 378 603 395 1,097 550 345 23 87 378 355 3,148 2,684 486 5,833 2,885 3,525 59 104 78 65 30 12 11 15 13 14 189 8 10 7 13
gma-miR164b UGGAGAAGCAGGGCACGUGC 20 63 5 13 1    0 1 1 0 0 0 0 1 3 0 0 0 0 0 7 13 6 12 10 7 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR164c UGGAGAAGCAGGGCACGUGC 20 63 5 13 1    0 1 1 0 0 0 0 1 3 0 0 0 0 0 7 13 6 12 10 7 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR164d UGGAGAAGCAGGGCACGUGC 20 63 5 13 1    0 1 1 0 0 0 0 1 3 0 0 0 0 0 7 13 6 12 10 7 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR164e UGGAGAAGCAGGGCACGUGCA 21 24,672 705 5,833 7    302 28 745 197 378 603 395 1,097 550 345 23 87 378 355 3,148 2,684 486 5,833 2,885 3,525 59 104 78 65 30 12 11 15 13 14 189 8 10 7 13
gma-miR164f UGGAGAAGCAGGGCACGUGCA 21 24,672 705 5,833 7    302 28 745 197 378 603 395 1,097 550 345 23 87 378 355 3,148 2,684 486 5,833 2,885 3,525 59 104 78 65 30 12 11 15 13 14 189 8 10 7 13
gma-miR164g UGGAGAAGCAGGGCACGUGCA 21 24,672 705 5,833 7    302 28 745 197 378 603 395 1,097 550 345 23 87 378 355 3,148 2,684 486 5,833 2,885 3,525 59 104 78 65 30 12 11 15 13 14 189 8 10 7 13
gma-miR164h UGGAGAAGCAGGGCACGUGCA 21 24,672 705 5,833 7    302 28 745 197 378 603 395 1,097 550 345 23 87 378 355 3,148 2,684 486 5,833 2,885 3,525 59 104 78 65 30 12 11 15 13 14 189 8 10 7 13
gma-miR164i UGGAGAAGCAGGGCACGUGCA 21 24,672 705 5,833 7    302 28 745 197 378 603 395 1,097 550 345 23 87 378 355 3,148 2,684 486 5,833 2,885 3,525 59 104 78 65 30 12 11 15 13 14 189 8 10 7 13
gma-miR164j UGGAGAAGCAGGGCACGUGCA 21 24,672 705 5,833 7    302 28 745 197 378 603 395 1,097 550 345 23 87 378 355 3,148 2,684 486 5,833 2,885 3,525 59 104 78 65 30 12 11 15 13 14 189 8 10 7 13
gma-miR164k UGGAGAAGCAGGGCACGUGCA 21 24,672 705 5,833 7    302 28 745 197 378 603 395 1,097 550 345 23 87 378 355 3,148 2,684 486 5,833 2,885 3,525 59 104 78 65 30 12 11 15 13 14 189 8 10 7 13
gma-miR166a-3p UCGGACCAGGCUUCAUUCCCC 21 19,601,307 560,037 2,349,301 31    3,693 50,254 14,973 8,485 39,127 17,347 21,619 35,284 14,739 60,810 3,135 9,560 115,535 17,370 262,987 235,620 251,289 207,816 140,948 78,708 11,456 125 5,270 31 1,351 1,649,706 1,989,892 1,617,015 1,497,271 1,747,820 1,093,529 1,830,964 2,246,912 2,349,301 1,971,365
gma-miR166a-5p GGAAUGUUGUCUGGCUCGAGG 21 23,814 680 4,565 6    67 403 103 38 257 146 225 435 306 246 10 432 1,723 748 1,229 2,525 792 732 2,229 1,805 38 4,565 2,263 1,048 1,208 36 22 31 23 20 42 6 22 12 27
gma-miR166b UCGGACCAGGCUUCAUUCCCC 21 19,601,307 560,037 2,349,301 31    3,693 50,254 14,973 8,485 39,127 17,347 21,619 35,284 14,739 60,810 3,135 9,560 115,535 17,370 262,987 235,620 251,289 207,816 140,948 78,708 11,456 125 5,270 31 1,351 1,649,706 1,989,892 1,617,015 1,497,271 1,747,820 1,093,529 1,830,964 2,246,912 2,349,301 1,971,365
gma-miR166c-3p UCGGACCAGGCUUCAUUCCCC 21 19,601,307 560,037 2,349,301 31    3,693 50,254 14,973 8,485 39,127 17,347 21,619 35,284 14,739 60,810 3,135 9,560 115,535 17,370 262,987 235,620 251,289 207,816 140,948 78,708 11,456 125 5,270 31 1,351 1,649,706 1,989,892 1,617,015 1,497,271 1,747,820 1,093,529 1,830,964 2,246,912 2,349,301 1,971,365
gma-miR166c-5p GGAAUGUUGUCUGGCUCGAGG 21 23,814 680 4,565 6    67 403 103 38 257 146 225 435 306 246 10 432 1,723 748 1,229 2,525 792 732 2,229 1,805 38 4,565 2,263 1,048 1,208 36 22 31 23 20 42 6 22 12 27
gma-miR166d UCGGACCAGGCUUCAUUCCCC 21 19,601,307 560,037 2,349,301 31    3,693 50,254 14,973 8,485 39,127 17,347 21,619 35,284 14,739 60,810 3,135 9,560 115,535 17,370 262,987 235,620 251,289 207,816 140,948 78,708 11,456 125 5,270 31 1,351 1,649,706 1,989,892 1,617,015 1,497,271 1,747,820 1,093,529 1,830,964 2,246,912 2,349,301 1,971,365
gma-miR166e UCGGACCAGGCUUCAUUCCCC 21 19,601,307 560,037 2,349,301 31    3,693 50,254 14,973 8,485 39,127 17,347 21,619 35,284 14,739 60,810 3,135 9,560 115,535 17,370 262,987 235,620 251,289 207,816 140,948 78,708 11,456 125 5,270 31 1,351 1,649,706 1,989,892 1,617,015 1,497,271 1,747,820 1,093,529 1,830,964 2,246,912 2,349,301 1,971,365
gma-miR166f UCGGACCAGGCUUCAUUCCCC 21 19,601,307 560,037 2,349,301 31    3,693 50,254 14,973 8,485 39,127 17,347 21,619 35,284 14,739 60,810 3,135 9,560 115,535 17,370 262,987 235,620 251,289 207,816 140,948 78,708 11,456 125 5,270 31 1,351 1,649,706 1,989,892 1,617,015 1,497,271 1,747,820 1,093,529 1,830,964 2,246,912 2,349,301 1,971,365
gma-miR166g UCGGACCAGGCUUCAUUCCCC 21 19,601,307 560,037 2,349,301 31    3,693 50,254 14,973 8,485 39,127 17,347 21,619 35,284 14,739 60,810 3,135 9,560 115,535 17,370 262,987 235,620 251,289 207,816 140,948 78,708 11,456 125 5,270 31 1,351 1,649,706 1,989,892 1,617,015 1,497,271 1,747,820 1,093,529 1,830,964 2,246,912 2,349,301 1,971,365
gma-miR166h-3p UCUCGGACCAGGCUUCAUUCC 21 2,357,450 67,356 236,649 501    22,366 4,539 5,196 501 17,114 12,542 13,158 9,555 1,116 4,107 853 67,556 14,854 1,265 17,001 1,653 10,142 23,488 5,237 2,564 627 7,444 13,687 5,906 6,867 216,970 230,403 200,486 210,491 199,571 236,649 196,910 204,929 192,441 199,262
gma-miR166h-5p GGAAUGUUGUUUGGCUCGAGG 21 333 15 82 2    12 8 8 0 2 7 2 4 3 4 0 9 16 8 18 26 14 12 10 11 0 82 41 19 17 0 0 0 0 0 0 0 0 0 0
gma-miR166i-3p UCGGACCAGGCUUCAUUCCCC 21 19,601,307 560,037 2,349,301 31    3,693 50,254 14,973 8,485 39,127 17,347 21,619 35,284 14,739 60,810 3,135 9,560 115,535 17,370 262,987 235,620 251,289 207,816 140,948 78,708 11,456 125 5,270 31 1,351 1,649,706 1,989,892 1,617,015 1,497,271 1,747,820 1,093,529 1,830,964 2,246,912 2,349,301 1,971,365
gma-miR166i-5p GGAAUGUCGUCUGGUUCGAG 20 78 5 10 1    0 0 0 0 0 0 0 0 9 10 0 0 3 0 0 0 0 0 0 0 0 10 7 3 6 5 2 6 5 3 3 3 0 1 2
gma-miR166j-3p UCGGACCAGGCUUCAUUCCCG 21 85,548 2,673 16,164 12    346 1,364 852 18 5,671 2,236 1,525 2,341 140 3,020 26 754 16,164 0 18 65 26 14 12 0 0 125 2,936 49 1,130 4,702 5,414 5,543 4,533 5,381 3,748 3,646 5,647 4,771 3,331
gma-miR166j-5p GGAAUGUUGUUUGGCUCGAGG 21 333 15 82 2    12 8 8 0 2 7 2 4 3 4 0 9 16 8 18 26 14 12 10 11 0 82 41 19 17 0 0 0 0 0 0 0 0 0 0
gma-miR166k UCUCGGACCAGGCUUCAUUCC 21 2,357,450 67,356 236,649 501    22,366 4,539 5,196 501 17,114 12,542 13,158 9,555 1,116 4,107 853 67,556 14,854 1,265 17,001 1,653 10,142 23,488 5,237 2,564 627 7,444 13,687 5,906 6,867 216,970 230,403 200,486 210,491 199,571 236,649 196,910 204,929 192,441 199,262
gma-miR166l GGAAUGUUGUCUGGCUCGAGG 21 23,814 680 4,565 6    67 403 103 38 257 146 225 435 306 246 10 432 1,723 748 1,229 2,525 792 732 2,229 1,805 38 4,565 2,263 1,048 1,208 36 22 31 23 20 42 6 22 12 27
gma-miR166m CGGACCAGGCUUCAUUCCCC 20 12,807 442 2,591 1    1 2,591 4 238 0 0 0 3 7 1,208 0 5 2,391 87 1,868 1,302 1,073 694 658 29 5 0 2 1 0 65 81 67 55 63 30 63 70 67 79
gma-miR166n UCGGACCAGGCUUCAUUCCCC 21 19,601,307 560,037 2,349,301 31    3,693 50,254 14,973 8,485 39,127 17,347 21,619 35,284 14,739 60,810 3,135 9,560 115,535 17,370 262,987 235,620 251,289 207,816 140,948 78,708 11,456 125 5,270 31 1,351 1,649,706 1,989,892 1,617,015 1,497,271 1,747,820 1,093,529 1,830,964 2,246,912 2,349,301 1,971,365
gma-miR166o UCGGACCAGGCUUCAUUCCCC 21 19,601,307 560,037 2,349,301 31    3,693 50,254 14,973 8,485 39,127 17,347 21,619 35,284 14,739 60,810 3,135 9,560 115,535 17,370 262,987 235,620 251,289 207,816 140,948 78,708 11,456 125 5,270 31 1,351 1,649,706 1,989,892 1,617,015 1,497,271 1,747,820 1,093,529 1,830,964 2,246,912 2,349,301 1,971,365
gma-miR166p UCGGACCAGGCUUCAUUCCC 20 45,888 1,350 3,795 2    94 837 198 90 2 2 0 588 201 1,017 63 161 1,518 136 3,795 1,321 2,743 3,305 751 722 157 6 251 6 357 2,483 2,786 2,685 2,402 2,604 2,130 2,756 3,779 3,467 2,475
gma-miR166q UCGGACCAGGCUUCAUUCCC 20 45,888 1,350 3,795 2    94 837 198 90 2 2 0 588 201 1,017 63 161 1,518 136 3,795 1,321 2,743 3,305 751 722 157 6 251 6 357 2,483 2,786 2,685 2,402 2,604 2,130 2,756 3,779 3,467 2,475
gma-miR166r UCGGACCAGGCUUCAUUCCC 20 45,888 1,350 3,795 2    94 837 198 90 2 2 0 588 201 1,017 63 161 1,518 136 3,795 1,321 2,743 3,305 751 722 157 6 251 6 357 2,483 2,786 2,685 2,402 2,604 2,130 2,756 3,779 3,467 2,475
gma-miR166s UCGGACCAGGCUUCAUUCCC 20 45,888 1,350 3,795 2    94 837 198 90 2 2 0 588 201 1,017 63 161 1,518 136 3,795 1,321 2,743 3,305 751 722 157 6 251 6 357 2,483 2,786 2,685 2,402 2,604 2,130 2,756 3,779 3,467 2,475
gma-miR166t UCGGACCAGGCUUCAUUCCC 20 45,888 1,350 3,795 2    94 837 198 90 2 2 0 588 201 1,017 63 161 1,518 136 3,795 1,321 2,743 3,305 751 722 157 6 251 6 357 2,483 2,786 2,685 2,402 2,604 2,130 2,756 3,779 3,467 2,475
gma-miR166u UCUCGGACCAGGCUUCAUUC 20 43,245 1,310 4,129 2    2,572 684 427 34 0 2 0 4,129 48 597 86 1,540 533 23 405 23 196 468 73 41 49 588 1,011 382 780 2,573 3,162 2,657 2,890 2,701 3,094 2,407 4,004 2,101 2,965
gma-miR167a UGAAGCUGCCAGCAUGAUCUA 21 36,887 1,085 6,232 1    34 375 207 152 228 285 73 857 333 6,232 238 6,048 317 336 5,376 2,463 3,262 2,637 3,023 4,240 86 17 3 13 0 1 3 4 6 5 19 3 3 3 5
gma-miR167b UGAAGCUGCCAGCAUGAUCUA 21 36,887 1,085 6,232 1    34 375 207 152 228 285 73 857 333 6,232 238 6,048 317 336 5,376 2,463 3,262 2,637 3,023 4,240 86 17 3 13 0 1 3 4 6 5 19 3 3 3 5
gma-miR167c UGAAGCUGCCAGCAUGAUCUG 21 159,798 4,700 19,937 4    36 537 137 224 28 113 4 158 118 668 7 5 0 1,896 3,260 5,105 3,674 2,392 15,901 2,147 157 513 316 359 160 8,925 10,941 11,986 12,291 7,906 19,937 13,591 10,093 17,924 8,289
gma-miR167d UGAAGCUGCCAGCAUGAUCUA 21 36,887 1,085 6,232 1    34 375 207 152 228 285 73 857 333 6,232 238 6,048 317 336 5,376 2,463 3,262 2,637 3,023 4,240 86 17 3 13 0 1 3 4 6 5 19 3 3 3 5
gma-miR167e UGAAGCUGCCAGCAUGAUCUU 21 98,201 2,888 40,230 3    146 398 2,565 2,467 69 113 39 387 273 646 1,577 1,659 327 6,606 5,385 40,230 14,424 3,389 8,991 3,043 4,229 8 3 6 0 83 124 147 130 78 226 124 114 122 73
gma-miR167f UGAAGCUGCCAGCAUGAUCUU 21 98,201 2,888 40,230 3    146 398 2,565 2,467 69 113 39 387 273 646 1,577 1,659 327 6,606 5,385 40,230 14,424 3,389 8,991 3,043 4,229 8 3 6 0 83 124 147 130 78 226 124 114 122 73
gma-miR167g UGAAGCUGCCAGCAUGAUCUGA 22 28,709 870 11,035 1    1 6 4 3 3 2 1 584 563 940 23 0 0 1,631 4,207 3,130 2,947 1,799 11,035 1,208 151 2 4 1 6 24 50 46 57 33 53 55 41 70 29
gma-miR167h AUCAUGCUGGCAGCUUCAACUGGU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR167i UCAUGCUGGCAGCUUCAACUGGU 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR167j UGAAGCUGCCAGCAUGAUCUG 21 159,798 4,700 19,937 4    36 537 137 224 28 113 4 158 118 668 7 5 0 1,896 3,260 5,105 3,674 2,392 15,901 2,147 157 513 316 359 160 8,925 10,941 11,986 12,291 7,906 19,937 13,591 10,093 17,924 8,289
gma-miR167k UGAAGCUGCCAGCCUGAUCUUA 22 41 6 17 1    0 0 1 4 0 0 0 0 0 2 17 9 5 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR168a UCGCUUGGUGCAGGUCGGGAA 21 223,813 6,395 27,208 575    2,100 1,816 3,575 915 7,402 4,809 6,647 13,704 3,939 3,755 2,887 4,063 20,701 8,489 13,732 20,291 6,437 25,174 27,208 12,170 2,344 1,480 1,217 575 786 2,062 2,390 2,625 2,467 2,427 4,231 2,413 3,091 3,412 2,479
gma-miR168b UCGCUUGGUGCAGGUCGGG 19 142 5 23 1    2 4 2 1 5 0 2 3 3 8 0 18 16 2 2 13 6 23 2 0 0 1 5 5 11 1 1 1 1 0 0 1 2 1 0
gma-miR169a CAGCCAAGGAUGACUUGCCGG 21 29,797 851 10,632 3    23 265 329 149 1,348 1,862 1,258 254 3,922 142 10,632 64 8,696 82 16 33 3 3 66 169 54 12 115 20 180 6 9 8 9 7 24 7 12 4 14
gma-miR169b CAGCCAAGGAUGACUUGCCGA 21 524 44 403 1    0 0 11 60 0 5 3 0 5 0 3 0 3 0 4 403 17 9 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0
gma-miR169c AAGCCAAGGAUGACUUGCCGA 21 102 7 28 1    28 3 13 6 8 2 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 10 3 17 0 0 0 0 0 3 1 0 1 1
gma-miR169d UGAGCCAAGGAUGACUUGCCGGU 23 260 22 98 1    15 44 11 0 0 0 0 98 31 2 50 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 1 1 2 0 2 0 0
gma-miR169e AGCCAAGGAUGACUUGCCGG 20 401 21 97 1    1 27 18 7 0 0 0 30 97 8 66 0 51 1 5 3 3 0 5 0 0 1 24 1 52 0 0 0 0 0 0 0 1 0 0
gma-miR169f CAGCCAAGGAUGACUUGCCGG 21 29,797 851 10,632 3    23 265 329 149 1,348 1,862 1,258 254 3,922 142 10,632 64 8,696 82 16 33 3 3 66 169 54 12 115 20 180 6 9 8 9 7 24 7 12 4 14
gma-miR169g CAGCCAAGGAUGACUUGCCGG 21 29,797 851 10,632 3    23 265 329 149 1,348 1,862 1,258 254 3,922 142 10,632 64 8,696 82 16 33 3 3 66 169 54 12 115 20 180 6 9 8 9 7 24 7 12 4 14
gma-miR169h GGCGAGACAUCUUGGCUCAUU 21 1 1 1 1    0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR169i-3p CCGGUGCCAUCCCGUCUCAUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR169i-5p UGAGCCGGGAUGGCUUGCCGGCA 23 115 9 55 1    15 2 8 3 5 16 3 4 55 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 1 0 0 0 0 0 1
gma-miR169j-3p UUUCGACGAGUUGUUCUUGGC 21 231 13 42 1    15 1 2 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 15 42 4 35 17 8 11 8 7 18 8 8 21 8
gma-miR169j-5p UAGCCAAGAAUGACUUGCCGG 21 503 20 283 1    7 25 32 283 25 40 33 0 2 2 10 0 8 0 0 0 0 0 0 0 0 1 1 4 2 2 2 3 1 3 8 3 2 1 3
gma-miR169k CAGCCAAGAAUGACUUGCCGG 21 4,014 149 2,437 1    11 35 11 8 51 59 34 365 276 83 2,437 51 514 0 0 0 0 0 0 0 0 1 1 5 2 2 5 8 1 5 26 4 10 2 7
gma-miR169l-3p CGGGCAAGUUGUUUUUGGCUAC 22 155 19 74 1    3 3 2 0 74 24 47 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 1
gma-miR169l-5p CAGCCAAGAAUGACUUGCCGG 21 4,014 149 2,437 1    11 35 11 8 51 59 34 365 276 83 2,437 51 514 0 0 0 0 0 0 0 0 1 1 5 2 2 5 8 1 5 26 4 10 2 7
gma-miR169m CAGCCAAGGAUGACUUGCCGG 21 29,797 851 10,632 3    23 265 329 149 1,348 1,862 1,258 254 3,922 142 10,632 64 8,696 82 16 33 3 3 66 169 54 12 115 20 180 6 9 8 9 7 24 7 12 4 14
gma-miR169n-3p UGCCGGCAAGUUUCUCUUGGC 21 501 31 80 1    1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 13 9 5 4 37 46 50 43 35 80 56 52 35 34
gma-miR169n-5p CAGCCAAGGGUGAUUUGCCGG 21 1,668 52 845 2    88 2 4 0 15 31 4 845 61 61 36 0 0 164 5 3 43 3 5 26 5 23 14 27 4 20 16 31 21 14 53 9 10 21 4
gma-miR169o UGAGCCAGGAUGGCUUGCCGGC 22 4,236 265 757 1    49 14 1 0 14 14 10 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 308 400 458 383 208 757 374 708 319 219
gma-miR169p UGAGCCAAGGAUGACUUGCCG 21 74 8 28 1    9 0 19 1 6 28 6 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 0 0
gma-miR169r UGAGCCAGGAUGGCUUGCCGGC 22 4,236 265 757 1    49 14 1 0 14 14 10 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 308 400 458 383 208 757 374 708 319 219
gma-miR169s AAGCCAAGGAUGACUUGCCGG 21 1,638 66 455 1    53 56 2 2 11 5 4 174 118 39 73 455 189 1 100 0 150 17 33 0 0 2 53 1 97 1 0 0 0 0 0 1 0 0 1
gma-miR169t UAGCCAAGGAUGGACUUGCCUA 22 59 6 40 1    2 5 40 5 2 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 1 0 0 1 0 0 0
gma-miR169u CAGCCAAGGAUGACUUGCCGU 21 328 16 157 1    0 1 3 5 35 40 4 0 157 0 33 0 19 1 0 13 0 0 0 0 0 0 1 0 0 1 3 3 1 1 1 2 1 0 3
gma-miR169v CAGCCAAGGAUGACUUGCC 19 32 5 11 1    0 0 0 0 3 0 1 0 3 0 10 0 11 0 0 0 0 0 0 0 0 0 0 0 4 0 0 0 0 0 0 0 0 0 0
gma-miR171a UGAGCCGUGCCAAUAUCACGA 21 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0
gma-miR171b-3p CGAGCCGAAUCAAUAUCACUC 21 6,820 273 3,106 1    60 249 1 0 11 9 2 0 0 0 0 60 0 3 3,106 16 1,647 72 99 1,186 0 0 0 1 0 20 53 32 19 14 62 28 30 19 21
gma-miR171b-5p ACGGCGUGAUAUUGGUACGGCUC 23 9 5 5 4    4 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR171c-3p UUGAGCCGUGCCAAUAUCACA 21 3,163 117 493 1    5 0 11 0 98 108 2 3 22 0 10 0 19 1 4 49 0 6 8 0 27 2 0 1 0 186 369 186 274 249 325 235 493 160 310
gma-miR171c-5p AGAUAUUGGUGCGGUUCAAUC 21 338 13 71 1    5 0 11 1 71 49 3 3 15 2 3 0 0 8 16 46 6 6 25 4 0 0 0 0 0 1 9 10 9 7 4 4 10 2 8
gma-miR171d UGAUUGAGUCGUGUCAAUAUC 21 14 4 5 2    5 0 2 2 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR171e UGAUUGAGCCGUGCCAAUAUC 21 3,455 123 676 2    79 53 554 24 211 137 26 9 553 0 427 0 676 2 0 114 0 0 7 0 27 4 3 5 0 32 45 52 42 47 171 27 38 39 51
gma-miR171f UGAUUGAGCCGUGCCAAUAUC 21 3,455 123 676 2    79 53 554 24 211 137 26 9 553 0 427 0 676 2 0 114 0 0 7 0 27 4 3 5 0 32 45 52 42 47 171 27 38 39 51
gma-miR171g UGAUUGAGCCGUGCCAAUAUC 21 3,455 123 676 2    79 53 554 24 211 137 26 9 553 0 427 0 676 2 0 114 0 0 7 0 27 4 3 5 0 32 45 52 42 47 171 27 38 39 51
gma-miR171h AUUGAGACGAGCCGAAUCAAU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR171i-3p UUGAGCCGUGCCAAUAUCACG 21 458 24 50 1    0 0 0 1 0 2 1 0 0 0 0 0 32 1 2 20 0 0 2 0 27 0 0 0 0 27 48 28 45 26 31 36 50 34 45
gma-miR171i-5p AUAAGAAAGCAAUGCUCAAA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR171j-3p UGAUUGAGCCGUGCCAAUAUC 21 3,455 123 676 2    79 53 554 24 211 137 26 9 553 0 427 0 676 2 0 114 0 0 7 0 27 4 3 5 0 32 45 52 42 47 171 27 38 39 51
gma-miR171j-5p UAUUGGCCUGGUUCACUCAGA 21 1,374 81 172 1    0 0 1 0 6 2 2 0 3 0 0 0 0 0 0 3 0 0 2 0 0 0 0 0 0 131 145 104 157 133 172 115 119 160 119
gma-miR171k-3p UUGAGCCGCGCCAAUAUCACU 21 1,296 42 200 1    5 1 1 0 14 24 1 9 2 2 0 0 3 1 154 13 40 200 8 41 27 10 7 1 0 48 70 87 75 82 64 59 129 58 60
gma-miR171k-5p CGAUGUUGGUGAGGUUCAAUC 21 286 9 64 1    13 1 3 3 3 19 1 20 2 2 3 0 3 4 64 7 9 52 7 7 5 13 13 8 2 1 2 6 3 3 1 1 1 4 0
gma-miR171l CGAUGUUGGUGAGGUUCAAUC 21 286 9 64 1    13 1 3 3 3 19 1 20 2 2 3 0 3 4 64 7 9 52 7 7 5 13 13 8 2 1 2 6 3 3 1 1 1 4 0
gma-miR171m UUGAGCCGCGUCAAUAUCUCA 21 4,727 189 1,398 1    97 20 83 79 212 56 2 68 94 674 1,243 60 1,398 0 0 0 0 0 0 0 0 4 1 0 0 44 74 62 83 66 67 41 73 52 74
gma-miR171n UUGAGCCGCGUCAAUAUCUUA 21 832 32 186 1    30 2 17 5 22 61 3 16 0 49 23 37 186 0 0 0 0 0 0 0 0 3 1 5 4 29 37 29 36 32 32 18 38 76 41
gma-miR171o-3p UUGAGCCGUGCCAAUAUCACA 21 3,163 117 493 1    5 0 11 0 98 108 2 3 22 0 10 0 19 1 4 49 0 6 8 0 27 2 0 1 0 186 369 186 274 249 325 235 493 160 310
gma-miR171o-5p AGAUAUUGGUACGGUUCAAUC 21 347 16 38 1    13 0 36 2 8 9 8 9 38 0 3 0 0 0 0 3 0 0 0 0 0 1 1 0 0 19 22 24 19 21 29 12 31 14 25
gma-miR171p UUGAGCCGCGUCAAUAUCUUA 21 832 32 186 1    30 2 17 5 22 61 3 16 0 49 23 37 186 0 0 0 0 0 0 0 0 3 1 5 4 29 37 29 36 32 32 18 38 76 41
gma-miR171q UUGAGCCGUGCCAAUAUCACA 21 3,163 117 493 1    5 0 11 0 98 108 2 3 22 0 10 0 19 1 4 49 0 6 8 0 27 2 0 1 0 186 369 186 274 249 325 235 493 160 310
gma-miR171r CGAGCCGAAUCAAUACCACUC 21 737 34 571 1    26 571 2 0 9 5 1 0 0 0 0 0 0 0 2 0 0 0 2 0 0 2 1 1 2 10 12 11 23 3 10 10 12 14 8
gma-miR171s CGAGCCGAAUCAAUACCACUC 21 737 34 571 1    26 571 2 0 9 5 1 0 0 0 0 0 0 0 2 0 0 0 2 0 0 2 1 1 2 10 12 11 23 3 10 10 12 14 8
gma-miR171t UUGAGCCGCGUCAAUAUCUCA 21 4,727 189 1,398 1    97 20 83 79 212 56 2 68 94 674 1,243 60 1,398 0 0 0 0 0 0 0 0 4 1 0 0 44 74 62 83 66 67 41 73 52 74
gma-miR171u UGAUUGAGCCGUGCCAAUAUC 21 3,455 123 676 2    79 53 554 24 211 137 26 9 553 0 427 0 676 2 0 114 0 0 7 0 27 4 3 5 0 32 45 52 42 47 171 27 38 39 51
gma-miR172a AGAAUCUUGAUGAUGCUGCAU 21 122,151 3,490 32,493 2    876 393 1,398 70 3,185 1,088 269 7,797 6,265 1,153 784 8,539 7,969 27 2,223 10,572 16,400 32,493 17,202 925 2,015 87 14 55 2 39 36 34 47 39 53 36 31 6 29
gma-miR172b-3p AGAAUCUUGAUGAUGCUGCAU 21 122,151 3,490 32,493 2    876 393 1,398 70 3,185 1,088 269 7,797 6,265 1,153 784 8,539 7,969 27 2,223 10,572 16,400 32,493 17,202 925 2,015 87 14 55 2 39 36 34 47 39 53 36 31 6 29
gma-miR172b-5p GUAGCAUCAUCAAGAUUCAC 20 85 4 11 1    0 0 0 0 0 0 0 4 9 2 3 0 3 0 2 3 3 9 10 0 11 1 0 10 0 0 1 3 0 1 4 1 2 0 3
gma-miR172c GGAAUCUUGAUGAUGCUGCAG 21 11,528 549 3,732 1    3 3,732 327 185 6 33 8 93 3,466 3,632 13 0 8 0 0 3 0 3 0 0 0 7 1 3 0 0 0 0 0 1 2 1 0 1 0
gma-miR172d GGAAUCUUGAUGAUGCUGCAGCAG 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR172e GGAAUCUUGAUGAUGCUGCAGCAG 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR172f AGAAUCUUGAUGAUGCUGCA 20 3,106 141 1,806 1    15 5 19 2 0 0 0 142 92 26 13 1,806 218 0 27 114 128 295 149 7 43 0 0 0 0 1 1 0 1 1 1 0 0 0 0
gma-miR172g GCAGCACCAUCAAGAUUCAC 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR172h-3p AGAAUCUUGAUGAUGCUGCAU 21 122,151 3,490 32,493 2    876 393 1,398 70 3,185 1,088 269 7,797 6,265 1,153 784 8,539 7,969 27 2,223 10,572 16,400 32,493 17,202 925 2,015 87 14 55 2 39 36 34 47 39 53 36 31 6 29
gma-miR172h-5p GCAGCAGCAUCAAGAUUCACA 21 373 19 172 1    1 0 2 1 6 5 1 4 0 10 0 0 0 0 11 10 31 78 172 22 0 2 1 8 2 0 0 0 0 0 5 1 0 0 0
gma-miR172i-3p GGAAUCUUGAUGAUGCUGCAU 21 1,141 60 490 2    306 490 5 3 23 5 8 4 34 162 0 9 0 0 2 7 11 35 7 0 0 8 0 20 2 0 0 0 0 0 0 0 0 0 0
gma-miR172i-5p GCAGCAGCAUCAAGAUUCACA 21 373 19 172 1    1 0 2 1 6 5 1 4 0 10 0 0 0 0 11 10 31 78 172 22 0 2 1 8 2 0 0 0 0 0 5 1 0 0 0
gma-miR172j GCAGCAGCAUCAAGAUUCACA 21 373 19 172 1    1 0 2 1 6 5 1 4 0 10 0 0 0 0 11 10 31 78 172 22 0 2 1 8 2 0 0 0 0 0 5 1 0 0 0
gma-miR172k UGAAUCUUGAUGAUGCUGCAU 21 103 5 42 1    0 1 42 2 17 2 1 1 2 0 0 5 0 0 2 3 6 9 2 0 0 0 0 0 0 0 1 0 0 1 2 1 2 0 1
gma-miR172l GGAAUCUUGAUGAUGCUGCAU 21 1,141 60 490 2    306 490 5 3 23 5 8 4 34 162 0 9 0 0 2 7 11 35 7 0 0 8 0 20 2 0 0 0 0 0 0 0 0 0 0
gma-miR2107 CAAACCUCCGUAGCCUGUAUC 21 6 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 1 0 1 1 0 1
gma-miR2108a UUAAUGUGUUGUGUUUGUCGG 21 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0
gma-miR2108b UUAAUGUGUUGUGUUUGUGAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR2109-3p GGAGGCGUAGAUACUCACACC 21 7,740 369 975 4    30 15 4 73 975 440 102 0 0 0 0 0 0 0 0 0 0 0 0 0 0 751 602 554 295 379 389 448 291 339 623 359 452 135 484
gma-miR2109-5p UGCGAGUGUCUUCGCCUCUG 20 24 3 5 1    3 1 4 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 5 1 2 0 0 0 1 0 0 0 0 0 0
gma-miR2111a GUCCUUGGGAUGCAGAUUACG 21 118 13 49 1    1 8 1 22 28 7 49 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0 0
gma-miR2111b UAAUCUGCAUCCUGAGGUUUA 21 1,747 58 560 1    0 0 1 3 15 9 7 3 14 14 30 5 11 24 160 560 133 347 307 0 49 12 0 10 0 9 5 1 1 3 2 1 5 2 4
gma-miR2111c UAAUCUGCAUCCUGAGGUUUA 21 1,747 58 560 1    0 0 1 3 15 9 7 3 14 14 30 5 11 24 160 560 133 347 307 0 49 12 0 10 0 9 5 1 1 3 2 1 5 2 4
gma-miR2111d GUCCUUGGGAUGCAGAUUACG 21 118 13 49 1    1 8 1 22 28 7 49 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0 0
gma-miR2111e UAAUCUGCAUCCUGAGGUUUA 21 1,747 58 560 1    0 0 1 3 15 9 7 3 14 14 30 5 11 24 160 560 133 347 307 0 49 12 0 10 0 9 5 1 1 3 2 1 5 2 4
gma-miR2111f UAAUCUGCAUCCUGAGGUUUA 21 1,747 58 560 1    0 0 1 3 15 9 7 3 14 14 30 5 11 24 160 560 133 347 307 0 49 12 0 10 0 9 5 1 1 3 2 1 5 2 4
gma-miR2118a-3p UUGCCGAUUCCACCCAUUCCU 21 335 15 42 1    0 0 0 2 3 5 1 3 3 0 17 0 3 0 0 0 0 0 0 0 0 15 13 14 35 11 18 15 25 14 42 15 29 30 22
gma-miR2118a-5p GGAGAUGGGAGGGUCGGUAAAG 22 7,298 348 1,571 20    232 629 1,571 315 220 323 1,007 0 0 0 0 0 0 0 0 0 0 0 0 0 0 416 1,201 84 459 104 74 94 116 63 106 20 63 111 90
gma-miR2118b-3p UUGCCGAUUCCACCCAUUCCU 21 335 15 42 1    0 0 0 2 3 5 1 3 3 0 17 0 3 0 0 0 0 0 0 0 0 15 13 14 35 11 18 15 25 14 42 15 29 30 22
gma-miR2118b-5p GGAGAUGGGAGGGUCGGUAAAG 22 7,298 348 1,571 20    232 629 1,571 315 220 323 1,007 0 0 0 0 0 0 0 0 0 0 0 0 0 0 416 1,201 84 459 104 74 94 116 63 106 20 63 111 90
gma-miR2119 UCAAAGGGAGUUGUAGGGGAA 21 7,335 333 5,023 2    144 11 38 2 23 14 3 5,023 0 0 3 0 0 0 0 0 0 0 0 0 0 14 9 8 0 75 81 55 42 61 157 17 57 1,466 32
gma-miR2606a AAAAGCACUUAAGGAACGGUA 21 38 6 17 1    17 7 0 0 9 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 3 0 0 0 0 0 0 0 0 0 0 0
gma-miR2606b AAAAGCACUUAAGGAACGGUA 21 38 6 17 1    17 7 0 0 9 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 3 0 0 0 0 0 0 0 0 0 0 0
gma-miR319a UUGGACUGAAGGGAGCUCCC 20 33,547 1,118 10,628 1    1 1 10 2 0 0 0 10 43 2 0 9 16 5 11 10 3 9 10 0 16 658 9,338 162 10,628 1,073 991 2,632 245 1,708 2,029 159 2,861 730 175
gma-miR319b UUGGACUGAAGGGAGCUCCC 20 33,547 1,118 10,628 1    1 1 10 2 0 0 0 10 43 2 0 9 16 5 11 10 3 9 10 0 16 658 9,338 162 10,628 1,073 991 2,632 245 1,708 2,029 159 2,861 730 175
gma-miR319c UUGGACUGAAAGGAGCUCCU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR319d UGGACUGAAGGGGAGCUCCUUC 22 2,881 120 478 1    0 0 19 0 0 0 3 1 2 0 0 5 16 0 5 3 0 6 8 0 0 10 19 5 17 319 235 357 179 335 366 156 478 109 228
gma-miR319e UUGGACUGAAGGGAGCUCCC 20 33,547 1,118 10,628 1    1 1 10 2 0 0 0 10 43 2 0 9 16 5 11 10 3 9 10 0 16 658 9,338 162 10,628 1,073 991 2,632 245 1,708 2,029 159 2,861 730 175
gma-miR319f UUGGACUGAAGGGGCCUCUU 20 815 34 307 1    1 1 307 20 0 0 0 1 3 2 3 0 59 4 2 189 0 0 83 0 0 0 3 0 2 22 9 29 1 31 13 0 25 3 2
gma-miR319g UUGGACUGAAGGGAGCUCCUUC 22 1,095 64 176 1    1 0 0 0 0 0 1 0 0 0 0 0 0 0 2 0 0 0 0 0 0 1 34 3 74 80 105 176 48 111 161 40 147 46 65
gma-miR319h UUGGACUGAAGGGAGCUCCCU 21 8,396 254 2,083 2    7 2 38 12 15 19 66 17 27 2 0 0 149 3 9 65 6 52 33 7 5 183 2,083 69 2,057 336 242 764 64 486 544 50 770 163 51
gma-miR319i UUGGACUGAAGGGGAGCUCCUUC 23 777 78 123 35    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 75 68 123 57 102 109 43 102 35 63
gma-miR319j UUGGACUGAAGGGAGCUCCCU 21 8,396 254 2,083 2    7 2 38 12 15 19 66 17 27 2 0 0 149 3 9 65 6 52 33 7 5 183 2,083 69 2,057 336 242 764 64 486 544 50 770 163 51
gma-miR319k UUGGACUGAAGGGAGCUCCCU 21 8,396 254 2,083 2    7 2 38 12 15 19 66 17 27 2 0 0 149 3 9 65 6 52 33 7 5 183 2,083 69 2,057 336 242 764 64 486 544 50 770 163 51
gma-miR319l UUGGACUGAAGGGAGCUCCUUC 22 1,095 64 176 1    1 0 0 0 0 0 1 0 0 0 0 0 0 0 2 0 0 0 0 0 0 1 34 3 74 80 105 176 48 111 161 40 147 46 65
gma-miR319m UUGGACUGAAGGGAGCUCCCU 21 8,396 254 2,083 2    7 2 38 12 15 19 66 17 27 2 0 0 149 3 9 65 6 52 33 7 5 183 2,083 69 2,057 336 242 764 64 486 544 50 770 163 51
gma-miR319n UUUGGACCGAAGGGAGCCCCU 21 3,065 236 625 2    0 5 27 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 344 350 197 255 352 209 266 625 109 324
gma-miR319o UGGACUGAAGGGGAGCUCCUUC 22 2,881 120 478 1    0 0 19 0 0 0 3 1 2 0 0 5 16 0 5 3 0 6 8 0 0 10 19 5 17 319 235 357 179 335 366 156 478 109 228
gma-miR319p UUUUGGACUGAAGGGAGCUCC 21 868 48 355 1    0 1 1 3 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 72 91 115 355 17 20 28 29 33 25 9 30 16 22
gma-miR319q UGGACUGAAGGGAGCUCCUUC 21 5,178 192 1,602 1    1 1 17 1 2 0 15 6 3 30 0 0 19 0 2 0 0 3 0 0 5 261 540 458 1,602 244 223 253 117 214 340 145 403 89 184
gma-miR3522 AGACCAAAUGAGCAGCUGA 19 422 32 75 1    44 14 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 30 75 15 42 48 50 32 24 31 16
gma-miR390a-3p CGCUAUCCAUCCUGAGUUUC 20 50 3 13 1    0 1 0 0 0 0 0 1 7 0 3 0 13 0 5 0 6 0 2 4 0 1 1 1 0 0 2 0 0 0 1 0 1 0 1
gma-miR390a-5p AAGCUCAGGAGGGAUAGCGCC 21 24,612 703 2,990 66    81 591 446 69 406 275 117 188 952 95 1,746 1,604 2,990 141 718 1,061 1,743 526 478 210 351 72 80 66 100 487 1,203 1,185 549 914 1,308 450 2,010 702 698
gma-miR390b-3p UACUUGGCGCUAUCUAUCUUGA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR390b-5p AAGCUCAGGAGGGAUAGCACC 21 8,215 316 5,678 3    162 5 87 19 274 282 592 607 49 5,678 50 0 3 0 0 0 3 0 0 0 0 5 7 4 0 32 28 53 13 38 50 22 103 30 19
gma-miR390c CGCUAUCCAUCCUGAGUUUC 20 50 3 13 1    0 1 0 0 0 0 0 1 7 0 3 0 13 0 5 0 6 0 2 4 0 1 1 1 0 0 2 0 0 0 1 0 1 0 1
gma-miR390d AAGCUCAGGAGGGAUAGCACC 21 8,215 316 5,678 3    162 5 87 19 274 282 592 607 49 5,678 50 0 3 0 0 0 3 0 0 0 0 5 7 4 0 32 28 53 13 38 50 22 103 30 19
gma-miR390e AGCUCAGGAGGGAUAGCGCC 20 526 19 161 1    0 21 40 20 0 0 0 10 97 0 43 161 48 2 5 3 11 14 7 4 5 2 3 1 0 2 4 4 0 1 4 1 4 5 4
gma-miR390f AAGCUCAGGAGGGAUAGCGCC 21 24,612 703 2,990 66    81 591 446 69 406 275 117 188 952 95 1,746 1,604 2,990 141 718 1,061 1,743 526 478 210 351 72 80 66 100 487 1,203 1,185 549 914 1,308 450 2,010 702 698
gma-miR390g AAGCUCAGGAGGGAUAGCGCC 21 24,612 703 2,990 66    81 591 446 69 406 275 117 188 952 95 1,746 1,604 2,990 141 718 1,061 1,743 526 478 210 351 72 80 66 100 487 1,203 1,185 549 914 1,308 450 2,010 702 698
gma-miR393a UCCAAAGGGAUCGCAUUGAUC 21 719 31 86 1    30 37 13 0 0 0 2 14 0 24 0 51 8 0 5 3 0 0 0 0 0 2 1 4 0 57 35 64 58 39 86 43 54 25 64
gma-miR393b UUUGGGAUCAUGCUAUCCCUU 21 23 5 12 1    1 0 0 12 5 2 0 0 0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR393c-3p AUCAUGCUAUCCCUUUGGAUU 21 393 14 72 1    1 3 2 1 2 7 1 0 2 0 0 0 72 2 24 68 6 12 10 18 0 2 2 0 0 11 17 20 23 12 22 9 16 9 19
gma-miR393c-5p UCCAAAGGGAUCGCAUUGAUCC 22 1,191 40 679 1    20 27 17 9 23 14 6 23 32 128 3 51 679 0 4 0 6 14 3 7 0 1 0 3 0 16 7 14 9 10 26 10 12 2 15
gma-miR393d UCCAAAGGGAUCGCAUUGAUCC 22 1,191 40 679 1    20 27 17 9 23 14 6 23 32 128 3 51 679 0 4 0 6 14 3 7 0 1 0 3 0 16 7 14 9 10 26 10 12 2 15
gma-miR393e UCCAAAGGGAUCGCAUUGAUCC 22 1,191 40 679 1    20 27 17 9 23 14 6 23 32 128 3 51 679 0 4 0 6 14 3 7 0 1 0 3 0 16 7 14 9 10 26 10 12 2 15
gma-miR393f UCCAAAGGGAUCGCAUUGAUCC 22 1,191 40 679 1    20 27 17 9 23 14 6 23 32 128 3 51 679 0 4 0 6 14 3 7 0 1 0 3 0 16 7 14 9 10 26 10 12 2 15
gma-miR393g UCCAAAGGGAUCGCAUUGAUCC 22 1,191 40 679 1    20 27 17 9 23 14 6 23 32 128 3 51 679 0 4 0 6 14 3 7 0 1 0 3 0 16 7 14 9 10 26 10 12 2 15
gma-miR393h UUCCAAAGGGAUCGCAUUGAUC 22 5,386 224 891 2    324 105 69 3 0 0 2 63 5 35 0 5 3 0 0 0 0 0 0 0 0 3 7 4 4 559 312 564 397 456 891 515 265 362 433
gma-miR393i UUCCAAAGGGAUCGCAUUGAUC 22 5,386 224 891 2    324 105 69 3 0 0 2 63 5 35 0 5 3 0 0 0 0 0 0 0 0 3 7 4 4 559 312 564 397 456 891 515 265 362 433
gma-miR393j UUCCAAAGGGAUCGCAUUGAUC 22 5,386 224 891 2    324 105 69 3 0 0 2 63 5 35 0 5 3 0 0 0 0 0 0 0 0 3 7 4 4 559 312 564 397 456 891 515 265 362 433
gma-miR393k UUCCAAAGGGAUCGCAUUGAUC 22 5,386 224 891 2    324 105 69 3 0 0 2 63 5 35 0 5 3 0 0 0 0 0 0 0 0 3 7 4 4 559 312 564 397 456 891 515 265 362 433
gma-miR394a-3p AGCUCUGUUGGCUACACUUU 20 12 4 6 1    1 0 5 6 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR394a-5p UUGGCAUUCUGUCCACCUCC 20 4,156 166 833 1    2 0 15 19 0 0 0 13 833 0 7 0 533 1 2 10 0 0 2 0 0 137 142 285 78 154 175 171 273 202 645 98 154 38 167
gma-miR394b-3p AGGUGGGCAUACUGUCAACU 20 228 23 119 1    12 0 86 119 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 3 1 0 0 0 0 0 1 0 1 2 0 2
gma-miR394b-5p UUGGCAUUCUGUCCACCUCC 20 4,156 166 833 1    2 0 15 19 0 0 0 13 833 0 7 0 533 1 2 10 0 0 2 0 0 137 142 285 78 154 175 171 273 202 645 98 154 38 167
gma-miR394c-5p UUGGCAUUCUGUCCACCUCC 20 4,156 166 833 1    2 0 15 19 0 0 0 13 833 0 7 0 533 1 2 10 0 0 2 0 0 137 142 285 78 154 175 171 273 202 645 98 154 38 167
gma-miR394d UUGGCAUUCUGUCCACCUCC 20 4,156 166 833 1    2 0 15 19 0 0 0 13 833 0 7 0 533 1 2 10 0 0 2 0 0 137 142 285 78 154 175 171 273 202 645 98 154 38 167
gma-miR394e UUGGCAUUCUGUCCACCUCC 20 4,156 166 833 1    2 0 15 19 0 0 0 13 833 0 7 0 533 1 2 10 0 0 2 0 0 137 142 285 78 154 175 171 273 202 645 98 154 38 167
gma-miR394f UUGGCAUUCUGUCCACCUCC 20 4,156 166 833 1    2 0 15 19 0 0 0 13 833 0 7 0 533 1 2 10 0 0 2 0 0 137 142 285 78 154 175 171 273 202 645 98 154 38 167
gma-miR394g UUGGCAUUCUGUCCACCUCC 20 4,156 166 833 1    2 0 15 19 0 0 0 13 833 0 7 0 533 1 2 10 0 0 2 0 0 137 142 285 78 154 175 171 273 202 645 98 154 38 167
gma-miR395a CUGAAGUGUUUGGGGGAACUC 21 163 8 41 1    1 0 3 2 0 2 0 0 0 2 0 0 3 0 0 0 0 0 0 0 0 4 7 4 17 10 14 10 6 6 41 1 6 22 2
gma-miR395b CUGAAGUGUUUGGGGGAACUC 21 163 8 41 1    1 0 3 2 0 2 0 0 0 2 0 0 3 0 0 0 0 0 0 0 0 4 7 4 17 10 14 10 6 6 41 1 6 22 2
gma-miR395c CUGAAGUGUUUGGGGGAACUC 21 163 8 41 1    1 0 3 2 0 2 0 0 0 2 0 0 3 0 0 0 0 0 0 0 0 4 7 4 17 10 14 10 6 6 41 1 6 22 2
gma-miR395d UGAAGUGUUUGGGGGAACUUU 21 21 4 10 2    0 0 10 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 5 0 2 0 0 0 0 0 0 0 0 2 0
gma-miR395e UGAAGUGUUUGGGGGAACUUU 21 21 4 10 2    0 0 10 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 5 0 2 0 0 0 0 0 0 0 0 2 0
gma-miR395f UGAAGUGUUUGGGGGAACUUU 21 21 4 10 2    0 0 10 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 5 0 2 0 0 0 0 0 0 0 0 2 0
gma-miR395g UGAAGUGUUUGGGGGAACUUU 21 21 4 10 2    0 0 10 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 5 0 2 0 0 0 0 0 0 0 0 2 0
gma-miR395h AUGAAGUGUUUGGGAGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR395i AUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR395j AUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR395k AUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR395l AUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR395m AUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR396a-3p UUCAAUAAAGCUGUGGGAAG 20 1,930 64 244 1    12 22 39 1 0 0 0 16 5 14 0 9 35 14 84 65 11 23 116 18 0 104 148 57 108 102 78 123 78 83 244 63 55 126 77
gma-miR396a-5p UUCCACAGCUUUCUUGAACUG 21 134,846 3,853 16,513 11    98 78 11 67 234 1,723 58 187 24 1,354 79 83 2,133 35 2,741 1,175 2,144 4,049 2,962 5,547 113 16,513 11,962 7,738 9,825 7,655 4,529 8,039 4,718 3,900 11,560 7,291 3,148 9,875 3,198
gma-miR396b-3p GCUCAAGAAAGCUGUGGGAGA 21 66,432 1,898 10,689 34    115 34 181 322 9,905 1,191 7,437 1,217 10,689 171 126 1,117 961 4,001 682 2,307 165 272 5,174 140 146 1,746 8,472 416 8,528 135 78 91 100 81 122 88 39 98 85
gma-miR396b-5p UUCCACAGCUUUCUUGAACUU 21 673,472 19,808 94,381 1    6 1 1 5 18 38 12 4 3 22 40 0 64 514 929 1,253 233 1,032 1,879 125 5 7,711 11,899 2,746 4,208 69,505 57,267 75,206 73,809 56,843 59,765 94,381 37,892 79,135 36,921
gma-miR396c UUCCACAGCUUUCUUGAACUU 21 673,472 19,808 94,381 1    6 1 1 5 18 38 12 4 3 22 40 0 64 514 929 1,253 233 1,032 1,879 125 5 7,711 11,899 2,746 4,208 69,505 57,267 75,206 73,809 56,843 59,765 94,381 37,892 79,135 36,921
gma-miR396d AAGAAAGCUGUGGGAGAAUAUGGC 24 83 4 14 1    1 1 5 2 0 0 3 1 3 2 0 0 0 1 0 0 0 3 2 0 0 1 2 0 0 6 5 1 3 3 14 5 12 3 4
gma-miR396e UUCCACAGCUUUCUUGAACUGU 22 1,084 45 199 1    1 0 0 0 3 7 0 0 0 0 0 0 11 1 7 3 23 43 0 7 0 4 3 5 2 107 63 108 71 56 199 120 52 130 58
gma-miR396f AGCUUUCUUGAACUUCUUAUGCCUA 25 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR396g UUCUUGAACUUCUUAUGCAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR396h UCCACAGCUUUCUUGAACUG 20 677 28 146 3    0 9 0 8 0 0 0 0 0 83 0 0 146 0 27 3 14 38 22 4 0 25 47 8 32 19 22 27 16 15 31 25 10 35 11
gma-miR396i-3p GUUCAAUAAAGCUGUGGGAAG 21 9,566 290 3,107 12    44 167 22 12 175 35 104 92 169 14 0 115 232 132 162 88 26 26 584 74 0 934 3,107 207 2,120 137 61 119 90 74 214 40 50 67 73
gma-miR396i-5p UUCCACAGCUUUCUUGAACUG 21 134,846 3,853 16,513 11    98 78 11 67 234 1,723 58 187 24 1,354 79 83 2,133 35 2,741 1,175 2,144 4,049 2,962 5,547 113 16,513 11,962 7,738 9,825 7,655 4,529 8,039 4,718 3,900 11,560 7,291 3,148 9,875 3,198
gma-miR396j AUUCAAGAUAGCUGUGGAAAA 21 4,894 245 629 1    1 0 12 8 23 45 23 0 0 0 0 0 0 0 0 0 0 0 0 0 0 51 290 26 455 629 419 462 492 424 473 287 241 259 274
gma-miR396k-3p GCUCAAGAAAGCUGUGGGAGA 21 66,432 1,898 10,689 34    115 34 181 322 9,905 1,191 7,437 1,217 10,689 171 126 1,117 961 4,001 682 2,307 165 272 5,174 140 146 1,746 8,472 416 8,528 135 78 91 100 81 122 88 39 98 85
gma-miR396k-5p UUCCACAGCUUUCUUGAACUU 21 673,472 19,808 94,381 1    6 1 1 5 18 38 12 4 3 22 40 0 64 514 929 1,253 233 1,032 1,879 125 5 7,711 11,899 2,746 4,208 69,505 57,267 75,206 73,809 56,843 59,765 94,381 37,892 79,135 36,921
gma-miR397a UCAUUGAGUGCAGCGUUGAUG 21 23,696 817 5,148 1    178 28 8 3 2 5 1 5,148 0 14 3 138 551 1 65 0 0 14 38 11 0 2 0 3 0 2,598 1,295 949 1,156 1,747 3,216 1,633 1,680 1,019 2,190
gma-miR397b-3p UAUUGACGCUGCACUCAAUCA 21 5,733 319 3,885 1    3,885 701 35 108 108 198 35 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 37 30 34 40 60 315 38 34 13 61
gma-miR397b-5p UCAUUGAGUGCAGCGUUGAUG 21 23,696 817 5,148 1    178 28 8 3 2 5 1 5,148 0 14 3 138 551 1 65 0 0 14 38 11 0 2 0 3 0 2,598 1,295 949 1,156 1,747 3,216 1,633 1,680 1,019 2,190
gma-miR398a UGUGUUCUCAGGUCACCCCUU 21 173 10 99 1    3 0 0 0 0 0 0 10 0 0 0 0 99 0 5 7 0 6 0 0 0 0 0 1 0 2 1 3 1 1 12 1 2 18 1
gma-miR398b UGUGUUCUCAGGUCACCCCUU 21 173 10 99 1    3 0 0 0 0 0 0 10 0 0 0 0 99 0 5 7 0 6 0 0 0 0 0 1 0 2 1 3 1 1 12 1 2 18 1
gma-miR398c UGUGUUCUCAGGUCGCCCCUG 21 7,827,211 326,134 1,098,212 2    34 16 0 0 2 0 0 244 0 0 0 115 29 2 167 3 88 1,087 196 195 11 0 0 0 0 1,098,212 681,384 592,002 686,658 1,012,431 1,063,964 735,853 553,379 624,842 776,297
gma-miR398d UGUGUUCUCAGGUCGCCCCUG 21 7,827,211 326,134 1,098,212 2    34 16 0 0 2 0 0 244 0 0 0 115 29 2 167 3 88 1,087 196 195 11 0 0 0 0 1,098,212 681,384 592,002 686,658 1,012,431 1,063,964 735,853 553,379 624,842 776,297
gma-miR399a UGCCAAAGGAGAGUUGCCCUG 21 4,460 186 1,126 1    11 223 6 0 0 0 0 19 2 2 13 1,126 29 1 0 10 0 0 0 0 0 1 26 0 35 338 394 263 316 328 265 236 411 140 265
gma-miR399b UGCCAAAGGAGAGUUGCCCUG 21 4,460 186 1,126 1    11 223 6 0 0 0 0 19 2 2 13 1,126 29 1 0 10 0 0 0 0 0 1 26 0 35 338 394 263 316 328 265 236 411 140 265
gma-miR399c UGCCAAAGGAGAGUUGCCCUG 21 4,460 186 1,126 1    11 223 6 0 0 0 0 19 2 2 13 1,126 29 1 0 10 0 0 0 0 0 1 26 0 35 338 394 263 316 328 265 236 411 140 265
gma-miR399d UGCCAAAGGAGAUUUGCCCAG 21 584 25 165 1    0 0 88 2 8 7 1 161 5 0 0 106 165 0 2 0 0 0 0 0 0 0 2 1 2 1 3 4 3 7 9 1 2 1 3
gma-miR399e UGCCAAAGGAGAUUUGCCCAG 21 584 25 165 1    0 0 88 2 8 7 1 161 5 0 0 106 165 0 2 0 0 0 0 0 0 0 2 1 2 1 3 4 3 7 9 1 2 1 3
gma-miR399f UGCCAAAGGAGAUUUGCCCAG 21 584 25 165 1    0 0 88 2 8 7 1 161 5 0 0 106 165 0 2 0 0 0 0 0 0 0 2 1 2 1 3 4 3 7 9 1 2 1 3
gma-miR399g UGCCAAAGGAGAUUUGCCCAG 21 584 25 165 1    0 0 88 2 8 7 1 161 5 0 0 106 165 0 2 0 0 0 0 0 0 0 2 1 2 1 3 4 3 7 9 1 2 1 3
gma-miR399h UGCCAAAGGAGAGUUGCCCUG 21 4,460 186 1,126 1    11 223 6 0 0 0 0 19 2 2 13 1,126 29 1 0 10 0 0 0 0 0 1 26 0 35 338 394 263 316 328 265 236 411 140 265
gma-miR399i UGCCAAAGGAGAAUUGCCCUG 21 24 2 4 1    0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 2 3 4 2 2 2 2 0 1
gma-miR403a UUAGAUUCACGCACAAACUUG 21 3,736 178 479 1    0 0 2 2 3 5 1 0 12 8 33 0 0 0 0 0 0 0 0 0 0 15 4 14 0 404 377 434 479 357 460 383 246 241 256
gma-miR403b UUAGAUUCACGCACAAACUUG 21 3,736 178 479 1    0 0 2 2 3 5 1 0 12 8 33 0 0 0 0 0 0 0 0 0 0 15 4 14 0 404 377 434 479 357 460 383 246 241 256
gma-miR408a-3p AUGCACUGCCUCUUCCCUGGC 21 1,087,014 33,969 145,519 2    127 104 3 0 8 7 0 197 5 2 0 41 29 3 378 46 85 295 264 678 27 30 23 23 9 137,195 103,824 83,561 90,846 145,519 92,809 129,647 82,721 102,973 115,535
gma-miR408a-5p CAGGGGAACAGGCAGAGCAUG 21 4,083 186 1,811 1    1,105 1,811 12 3 2 0 1 1,091 12 0 7 0 0 0 0 0 0 0 0 0 0 1 1 1 2 5 3 3 0 5 6 2 2 2 6
gma-miR408b-3p AUGCACUGCCUCUUCCCUGGC 21 1,087,014 33,969 145,519 2    127 104 3 0 8 7 0 197 5 2 0 41 29 3 378 46 85 295 264 678 27 30 23 23 9 137,195 103,824 83,561 90,846 145,519 92,809 129,647 82,721 102,973 115,535
gma-miR408b-5p CUGGGAACAGGCAGGGCACG 20 1,363 97 601 1    337 601 8 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 53 33 34 30 38 67 30 29 25 77
gma-miR408c-3p AUGCACUGCCUCUUCCCUGGC 21 1,087,014 33,969 145,519 2    127 104 3 0 8 7 0 197 5 2 0 41 29 3 378 46 85 295 264 678 27 30 23 23 9 137,195 103,824 83,561 90,846 145,519 92,809 129,647 82,721 102,973 115,535
gma-miR408c-5p CAGGGGAACAGGCAGAGCAUG 21 4,083 186 1,811 1    1,105 1,811 12 3 2 0 1 1,091 12 0 7 0 0 0 0 0 0 0 0 0 0 1 1 1 2 5 3 3 0 5 6 2 2 2 6
gma-miR408d UGCACUGCCUCUUCCCUGGC 20 146,123 6,088 20,035 1    17 8 0 0 0 0 0 16 0 0 0 5 3 0 20 0 3 14 33 26 5 3 1 3 0 19,476 14,352 10,379 11,332 20,035 10,260 18,797 12,444 13,684 15,207
gma-miR4340 UGCAGAGAUAGGGACGCGCUUA 22 18 4 12 1    0 0 12 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 1 0 0
gma-miR4341 UGUGUUGAAAGUUUAACAUGACGG 24 13 2 3 1    0 3 1 3 2 2 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR4342 AAUCGACUUAGAAUGUAGGAUGGU 24 36 5 21 1    2 7 2 21 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 1 0 0 0 0 1 0 0 0
gma-miR4343a AAAAAACUUACGGAUCAAGUUGAU 24 9 5 5 4    5 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR4343b UCUUACAGAUCAAGUUGAUUCGGA 24 10 2 4 1    0 0 0 1 2 2 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0
gma-miR4344 AAGUAGACAUUCUAAGACGUUGCU 24 36 3 7 1    1 1 2 3 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 7 3 1 2 4 3 1 4
gma-miR4345 UAAGACGGAACUUACAAAGAUU 22 295 16 32 2    32 23 26 10 3 12 11 0 0 0 0 0 0 0 0 0 0 0 0 0 0 8 2 0 0 9 23 13 22 21 17 12 26 7 18
gma-miR4346 GAAAGACCAAACGAGAAGCUGCAU 24 1,619 162 1,361 2    11 37 1,361 65 23 47 61 0 0 0 0 0 0 0 0 0 0 0 0 0 0 8 2 4 0 0 0 0 0 0 0 0 0 0 0
gma-miR4347 AAGCUUCUUACGGAUCAAGUUGAU 24 8 4 5 3    5 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR4348a AAACUUGUAAGAUGGUGACAUU 22 12 3 5 1    0 0 0 0 3 5 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0
gma-miR4348b UCUUUUGAAUUUGACUAUUAG 21 17 2 5 1    0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5 1 5 0 0 0 1 0 1 1 0 1 0 1
gma-miR4348c UGUUAAACUUGCAAGAUGACA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR4349 UAUUGGCUAGAGAUAAGACAAAGA 24 20 3 10 1    2 1 2 0 0 0 10 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 1 0 2
gma-miR4350 UCAAAUGAUUUUGUGUCGUUGG 22 11 2 4 1    1 0 4 2 2 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR4351 AUUGGGAUUCAGUUGGAGUUGG 22 48 6 12 2    9 2 5 0 2 2 12 0 0 0 0 0 0 0 0 0 0 0 0 0 0 8 8 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR4352a AUUUCUAGGACAUACUACGACGGU 24 9 2 3 2    3 2 2 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR4352b UAAAAUGUAGACAUUCUAAGACGG 24 16 2 5 1    3 5 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 1 0 0 0 2 1 0 0 1
gma-miR4353 CAAGUCGUAGCCGGUGUUAUUACU 24 30 2 6 1    2 5 2 1 6 5 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 0 0 0 0 1 1 0 0 1 0 1
gma-miR4354 CAAUUGGAUCGGUCCAACCGGC 22 8 8 8 8    0 8 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR4355 CACUGUUGUGCUGGGUGUACCA 22 24 12 23 1    0 23 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR4356 CAGGACUGUCUUAGAAAGCCAGGC 24 12 2 6 1    1 1 3 6 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR4357 CAGUCGUGUGAUUGUACGGUUCAU 24 10 2 3 1    1 1 3 2 2 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR4358 CAGUGCAUGACUAUAUCGCCAG 22 10 2 3 1    2 3 1 3 0 0 0 0 0 0 0 0 0 0 0 0