Soybean Small RNA miRNA Abundances

The data below are based on the microRNAs listed in the miRBase registry. Adjust libraries/reads to display on the control panel.


        miRNA         miRNA sequence Len Sum (norm) Average Max Min (>0)  GMA01GMA02GMA03GMA04GMA05bGMA06bGMA07bPVU01PVU02PVU03PVU04AHY01AHY02MSDL1MYR1MINFMND1MRG1MLEFMRMI1MTR018hpiW82Ps8hpiHarPs8hW82CT8hHarCTWT_1WT_2dcl1a_1_3dcl1a_1_4dcl1a_2_5dcl1a_2_6dcl1b_1_7dcl1b_1_8dcl1a_dcl1b_9dcl1a_dcl1b_10
gma-miR10186a UUGGGAAUUAAAAUGUAAACUU 22 354 10 48 16    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 48 28 45 16 34 35 31 47 27 43
gma-miR10186b UUUUGGGAAUUAAAAUGUAAACUU 24 424 12 79 9    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 29 41 57 43 38 48 29 79 9 51
gma-miR10186c UUUUGGGAAUUAAAAUGUAAACUU 24 424 12 79 9    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 29 41 57 43 38 48 29 79 9 51
gma-miR10186d UUUUGGGAAUUAAAAUGUAAACUU 24 424 12 79 9    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 29 41 57 43 38 48 29 79 9 51
gma-miR10186e UUGGGAAUUAAAAUGUAAACUU 22 354 10 48 16    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 48 28 45 16 34 35 31 47 27 43
gma-miR10186f UUUUGGGAAUUAAAAUGUAAACUU 24 424 12 79 9    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 29 41 57 43 38 48 29 79 9 51
gma-miR10186g UUUUGGGAAUUAAAAUGUAAACUU 24 424 12 79 9    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 29 41 57 43 38 48 29 79 9 51
gma-miR10186h UUUUGGGAAUUAAAAUGUAAACUU 24 424 12 79 9    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 29 41 57 43 38 48 29 79 9 51
gma-miR10186i UUUUGGGAAUUAAAAUGUAAACUU 24 424 12 79 9    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 29 41 57 43 38 48 29 79 9 51
gma-miR10186j UUUUGGGAAUUAAAAUGUAAACUU 24 424 12 79 9    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 29 41 57 43 38 48 29 79 9 51
gma-miR10186k UUUUGGGAAUUAAAAUGUAAACUU 24 424 12 79 9    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 29 41 57 43 38 48 29 79 9 51
gma-miR10186l UUUUGGGAAUUAAAAUGUAAACUU 24 424 12 79 9    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 29 41 57 43 38 48 29 79 9 51
gma-miR10187 CGAGGAUAAUUGUUGGAACCA 21 113 3 15 1    1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 10 14 11 12 8 15 6 15 10 11
gma-miR10188 UCUCUGAUUUUGCAGAUAAGGACU 24 5 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 1 1 1 0
gma-miR10189 AAGAACACUAGAACCAUCUCC 21 860 25 120 1    0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 9 13 0 15 91 80 91 88 55 120 94 71 84 48
gma-miR10190 UCCUGAUGACUAUUAUGAGCU 21 1,977 56 268 1    1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 6 18 6 4 224 247 174 195 208 268 136 176 149 164
gma-miR10191 GGCGACUGCGGCUCCUCCGCCG 22 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0
gma-miR10192 UAAACGUUUGAUCCCUUGUAU 21 13 0 3 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 3 0 2 0 0 1 0 0 2 2 0 1
gma-miR10193a UCUGAAACCGAUGUUAACUACU 22 66 2 9 3    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 9 7 8 5 3 8 4 6 8 8
gma-miR10193b UCUGAAACCGAUGUUAACUACU 22 66 2 9 3    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 9 7 8 5 3 8 4 6 8 8
gma-miR10193c UCUGAAACCGAUGUUAACUACU 22 66 2 9 3    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 9 7 8 5 3 8 4 6 8 8
gma-miR10193d UCUGAAACCGAUGUUAACUACU 22 66 2 9 3    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 9 7 8 5 3 8 4 6 8 8
gma-miR10193e UAAAAAAACCAAUGUUAACUGU 22 958 27 153 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 99 109 88 114 90 72 87 153 35 110
gma-miR10193f UAAAAAAACCAAUGUUAACUGU 22 958 27 153 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 99 109 88 114 90 72 87 153 35 110
gma-miR10194 UGUUGAAGGUGUGUAUGACAAG 22 1 0 1 1    0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR10195 UAUGAUUUUGUGGAUCAAAGGA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR10196 UGAUUGUGGGAGAGCAUUUCAU 22 3 0 3 3    0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR10197 AUUUUAGAACGACUUUUUCCU 21 231 7 52 2    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 9 8 6 2 52 24 13 14 7 20 32 21 13 10
gma-miR10198 AAGGAACUCGAAAUUCAUAGU 21 24 1 6 1    0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 4 0 6 0 1 0 0 1 6 1 0 1 2
gma-miR10199 AGCAAUGUUGAGCUUGGGCCU 21 174 5 22 1    1 0 0 0 9 2 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 1 1 0 16 20 7 21 16 22 11 14 16 14
gma-miR10200 AGGUUUUAAAGAAAUUAAAUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR10201 UACCGGUAGUAAAUGGAUGCCU 22 775 22 109 1    0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 46 78 69 73 77 109 79 100 49 93
gma-miR10405a UUGUUUCUUAUAAAAAGGACC 21 19 1 6 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 6 1 1 3 3 2 1 0 0 2
gma-miR10405b UUGUUUCUUAUAAAAAGGACC 21 19 1 6 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 6 1 1 3 3 2 1 0 0 2
gma-miR10405c UUGUUUCUUAUAAAAAGGACC 21 19 1 6 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 6 1 1 3 3 2 1 0 0 2
gma-miR10405d UUGUUUCUUAUAAAAAGGACC 21 19 1 6 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 6 1 1 3 3 2 1 0 0 2
gma-miR10405e UUGUUUCUUAUAAAAAGGACC 21 19 1 6 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 6 1 1 3 3 2 1 0 0 2
gma-miR10406a CAGUCGAGUUAUUGUAUAAUUCAC 24 6 0 2 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 2 0 0 0 2
gma-miR10406b CAGUCGAGUUAUUGUAUAAUUCAC 24 6 0 2 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 2 0 0 0 2
gma-miR10407a AGUUAACGGAUGAAUGAAUUUGUC 24 1,255 36 164 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 116 141 109 145 137 164 99 151 45 147
gma-miR10407b AGUUAACGGAUGAAUGAAUUUGUC 24 1,255 36 164 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 116 141 109 145 137 164 99 151 45 147
gma-miR10407c UUAACAGUCGGAUAUAUUUAUCGC 24 318 9 46 1    0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 21 40 31 29 31 30 34 42 12 46
gma-miR10407d UUAACGGCUGGAUAUAUUUGUUGC 24 14 0 6 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 1 1 1 1 6 1 0 1 1
gma-miR10408 CGAGGACUCCUUUAAAUAGACU 22 2,866 82 379 2    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 9 2 4 2 307 265 243 197 362 374 279 379 127 316
gma-miR10409 CCUCUGAAGAUAUUAAAAGCCU 22 89 3 15 5    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 11 9 8 5 5 12 10 15 6 8
gma-miR10410a UUUCCACAUCGUUGCUGACAUAAG 24 832 24 119 1    1 1 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 83 79 85 82 88 90 71 119 29 102
gma-miR10410b UUUCCACAUCGUUGCUGACAUAAG 24 832 24 119 1    1 1 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 83 79 85 82 88 90 71 119 29 102
gma-miR10410c UUUCCACAUCGUUGCUGACAUAAG 24 832 24 119 1    1 1 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 83 79 85 82 88 90 71 119 29 102
gma-miR10411 UAAUUUUAGACUGAUAUUUUGCCU 24 117 3 19 2    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 19 9 13 10 14 14 10 10 2 16
gma-miR10412 GAACGUUCUGGAGAACUCUAGAGU 24 89 3 16 4    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5 8 5 4 10 5 4 4 6 10 5 7 0 16
gma-miR10413a UUUUGGUAGAGAACGAAACCCU 22 453 13 73 1    0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 4 0 46 39 42 49 32 55 37 73 25 47
gma-miR10413b UUUUGGUAGAGAACGAAACCCU 22 453 13 73 1    0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 4 0 46 39 42 49 32 55 37 73 25 47
gma-miR10414 UCUGAGAAGAACCAUUGGUACC 22 5 0 1 1    0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 1 0 0 0 0
gma-miR10415 AUCUUAGAAUGUGAGUUUGGAUCU 24 132 4 17 1    1 1 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 12 16 7 16 14 13 15 17 1 15
gma-miR10416 AAGAUUUGACUGUUGGAACUGCCU 24 740 21 106 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 0 68 88 80 64 89 75 55 106 23 89
gma-miR10417 GAGGCUGUUUCCAGAUUUGAACCC 24 687 20 89 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 61 76 59 62 75 76 60 86 41 89
gma-miR10418 GAAGUAAUCCUAGGAACUCCCU 22 12 0 3 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 1 0 3 1 1 1 1 0 3
gma-miR10419 CAAAAAACACAUAUGAAACUG 21 24 1 4 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 3 0 4 3 3 3 4 2 1
gma-miR10420 CCUGAACCAUCAUUUUUUU 19 601 17 94 1    0 1 0 0 0 7 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 65 58 63 58 86 30 94 68 16 53
gma-miR10421 CAGAAUGAGACCUUGAGCGUGG 22 1,759 50 241 1    0 1 2 1 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 155 186 144 212 167 209 103 241 119 216
gma-miR10422 UUCUGAUUAGAGAGCAACACC 21 16 0 2 1    0 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 2 2 1 0 1 2 2 1 1 0 0
gma-miR10423 AUGAAAGCACCAAAUUGAUAGGACU 25 605 17 100 1    1 0 0 9 2 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 58 5 24 6 45 63 39 30 57 43 57 100 14 50
gma-miR10424a UUUUCUAAUUUAUUAGGGACU 21 7 0 2 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 1 0 0 0 2 1 0 1 0
gma-miR10424b UUUUCUAAUUUAUUAGGGACU 21 7 0 2 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 1 0 0 0 2 1 0 1 0
gma-miR10424c UUUUCUAAUUUAUUAGGGACU 21 7 0 2 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 1 0 0 0 2 1 0 1 0
gma-miR10424d UUUUCUAAUUUAUUAGGGACU 21 7 0 2 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 1 0 0 0 2 1 0 1 0
gma-miR10425 UUACAACCGUCUUUGAAAUCGCCU 24 157 4 31 7    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 12 14 14 22 20 7 17 31 8 12
gma-miR10426 UAGAAAAGAAUCAAUGUAGAAAGU 24 245 7 38 12    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 21 36 25 38 25 26 15 23 12 24
gma-miR10427a AAGAGAAUUGGGCUAGAGCUGC 22 10,327 295 1,445 4    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 4 4 0 758 1,298 823 1,272 1,038 957 713 1,445 873 1,138
gma-miR10427b CAAGAGAAUUGGGCUAGAGCUG 22 2,251 64 369 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 0 189 248 160 238 247 193 169 369 191 244
gma-miR10428 UGAGGACAAAACACGUUGAAAAGU 24 35 1 6 1    0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 2 4 3 3 6 2 4 2 6
gma-miR10429 UGAGGACAAAACAUGUUGAAAAGU 24 36 1 7 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5 1 4 5 6 3 2 2 1 7
gma-miR10430 UCGGUCUGACCUUUUUAAAAGCCU 24 447 13 60 10    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 46 47 45 42 46 50 43 60 10 58
gma-miR10431 UUAGAAUAAACAUGUGUAGAAAUU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR10432 UUUUCCAGAUCAUAUCGCCGGUUC 24 725 21 109 1    2 2 2 0 2 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 93 72 91 58 93 57 58 109 11 73
gma-miR10433 CUGCGGAUCAAGUUGAUUGUUACG 24 231 7 31 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 3 0 2 19 28 27 14 29 20 22 31 9 26
gma-miR10434 CUACUGAUUAUAUAUCUGAUACCAG 25 18 1 5 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 2 0 0 1 5 2 2 0 4
gma-miR10435 UUCCAUUUCAACGUCGGGUUAGAA 24 142 4 25 4    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 10 12 18 14 14 25 12 12 4 21
gma-miR10436 UCUUGGCAACACAACUUUUAACAU 24 2 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0
gma-miR10437 UAUUGUUCAAACAUAUACUGUU 22 22 1 6 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 3 4 1 3 0 0 6 1 3
gma-miR10438 UUGGACUAAGGUUUUUUGGCAC 22 2,609 75 412 1    33 9 86 2 3 5 19 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 1 0 242 245 220 168 299 285 205 412 131 241
gma-miR10439 CAGACAGAUAAUGCUAGAGCC 21 317 9 49 1    1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 37 30 25 30 38 10 30 49 28 37
gma-miR10440 UUGGGACAAUACUUUAGAUAU 21 49,884 1,425 6,289 1    1 7 8 2 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 2 1 0 4,842 5,812 4,896 5,071 4,874 4,329 3,066 6,289 5,406 5,274
gma-miR10441 CAACCCUGAGAACAAUGAAAUCGU 24 75 2 11 4    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5 10 11 9 5 7 9 4 9 6
gma-miR10442 CUACAUGCUGCACUUGGAUCC 21 335 10 72 1    1 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5 4 0 4 29 30 50 32 17 72 24 17 24 24
gma-miR10443 UCGACUGAGAACAACAUAAUUCAU 24 310 9 87 1    0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 27 33 20 25 28 16 40 87 4 29
gma-miR10444 GACAUACAUGUGAGUUCGGAUGUA 24 439 13 59 1    0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 40 43 32 57 57 49 36 57 8 59
gma-miR10445 AAGGACCAAAUUUAUGAAUUAAAU 24 202 6 33 5    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 15 20 18 30 24 19 17 33 5 21
gma-miR10446 UCAACUCAAGUCGAGCUCAAGCCU 24 1,045 30 147 1    0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 92 119 97 101 100 88 133 129 35 147
gma-miR10447 UGUUUCCAUGUUGUUGAGUGAC 22 3 0 1 1    0 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR10448 UUAGGCUUUGUGGGACGUGAUU 22 325 9 43 1    1 1 3 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 18 1 9 0 27 30 32 18 26 27 26 43 30 32
gma-miR1446 UUCUGAACUCUCUCCCUCAAU 21 2 0 2 2    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0
gma-miR1507a UCUCAUUCCAUACAUCGUCUGA 22 11,645,974 332,742 1,370,817 2    45,457 11,838 2,950 5,073 30,344 13,357 23,141 3 2 0 10 0 0 0 0 0 0 0 0 0 0 8,495 5,851 2,342 1,377 1,136,636 1,370,817 1,146,302 1,107,224 1,014,662 895,597 1,358,797 1,186,634 1,058,339 1,220,726
gma-miR1507b UCUCAUUCCAUACAUCGUCUG 21 8,305 237 1,010 1    20 10 1 13 65 33 45 0 0 0 0 0 0 0 0 0 0 0 0 0 0 40 18 38 4 814 948 757 749 782 557 884 1,010 719 798
gma-miR1507c-3p CCUCAUUCCAAACAUCAUCU 20 69 2 14 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 1 6 0 6 8 0 14 5 11 5 6 2 3
gma-miR1507c-5p GAGGUGUUUGGGAUGAGAGAA 21 1,645 47 773 1    2 5 5 3 6 2 6 0 0 0 0 0 0 0 0 0 0 0 0 0 0 217 773 42 515 7 4 6 12 8 11 1 9 7 4
gma-miR1508a UCUAGAAAGGGAAAUAGCAGUUG 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1508b UAGAAAGGGAAAUAGCAGUUG 21 15,381 439 2,929 37    1,340 549 429 845 1,020 520 1,688 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2,929 2,712 1,890 115 138 144 174 166 109 205 37 102 182 87
gma-miR1508c UAGAAAGGGAAAUAGCAGUUG 21 15,381 439 2,929 37    1,340 549 429 845 1,020 520 1,688 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2,929 2,712 1,890 115 138 144 174 166 109 205 37 102 182 87
gma-miR1509a UUAAUCAAGGAAAUCACGGUCG 22 60,462 1,727 10,426 10    6,441 10,426 6,478 3,000 8,300 6,895 8,315 0 0 0 10 0 0 0 0 0 0 0 0 0 0 2,734 1,664 2,192 236 358 510 375 349 399 504 175 475 231 395
gma-miR1509b UUAAUCAAGGAAAUCACGGUU 21 474 14 77 1    76 70 14 6 77 59 29 0 0 0 0 0 0 0 0 0 0 0 0 0 0 33 24 63 0 1 1 1 0 5 3 1 5 2 4
gma-miR1510a-3p UUGUUGUUUUACCUAUUCCACCC 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1510a-5p AGGGAUAGGUAAAACAAUGACUGC 24 331 9 60 3    39 21 29 28 3 7 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 60 0 23 0 6 13 3 8 9 10 11 28 12 18
gma-miR1510b-3p UGUUGUUUUACCUAUUCCACC 21 1,999 57 356 1    1 6 2 21 48 12 10 0 0 0 0 0 0 0 0 0 0 0 0 0 0 356 105 107 13 99 133 160 162 126 184 104 121 90 139
gma-miR1510b-5p AGGGAUAGGUAAAACAACUACU 22 24,941 713 3,919 7    88 47 343 52 469 3,919 352 0 0 0 7 0 0 0 0 0 0 0 0 0 0 122 208 77 154 1,626 1,870 1,872 1,890 1,606 2,884 1,462 1,796 2,535 1,562
gma-miR1511 AACCAGGCUCUGAUACCAUG 20 4,018 115 442 1    6 24 14 13 0 0 0 13 20 20 7 32 40 1 16 13 3 12 0 29 5 134 442 75 199 220 291 358 304 227 369 283 400 188 260
gma-miR1512a-3p GCUUUAAGAAUUUCAGUUAUG 21 3 0 1 1    0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0
gma-miR1512a-5p UAACUGAAAAUUCUUAAAGUAU 22 16 0 9 1    1 0 0 0 0 2 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 9 0 0 0 0 0 0 0 0 0 0 0
gma-miR1512b UAACUGGAAAUUCUUAAAGCAU 22 462 13 117 1    19 1 84 5 9 7 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 117 24 107 0 10 10 3 5 10 23 4 9 8 3
gma-miR1512c UAACUGAACAUUCUUAGAGCAU 22 10,453 299 5,460 1    0 219 5,460 4,750 6 7 1 0 0 0 7 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 1 0 0
gma-miR1513a-3p UUUAAAUGUGUAUAAGUCAUGGU 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1513a-5p UGAGAGAAAGCCAUGACUUAC 21 3,346 96 668 6    42 6 246 25 78 42 143 0 0 0 0 0 0 0 0 0 0 0 0 0 0 213 668 86 282 116 140 168 126 151 214 113 207 161 119
gma-miR1513b UGAGAGAAAGCCAUGACUUAC 21 3,346 96 668 6    42 6 246 25 78 42 143 0 0 0 0 0 0 0 0 0 0 0 0 0 0 213 668 86 282 116 140 168 126 151 214 113 207 161 119
gma-miR1513c UAUGAGAGAAAGCCAUGAC 19 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1514a-3p AUGCCUAUUUUAAAAUGAAAA 21 23 1 5 1    1 1 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5 1 1 3 1 2 3 0 2 1
gma-miR1514a-5p UUCAUUUUUAAAAUAGGCAUU 21 88 3 16 1    0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 10 10 8 8 7 16 6 9 4 8
gma-miR1514b-3p AUGCCUAUUUUAAAAUGAAAA 21 23 1 5 1    1 1 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5 1 1 3 1 2 3 0 2 1
gma-miR1514b-5p UUCAUUUUUAAAAUAGACAUU 21 2 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 0 0 0
gma-miR1515a UCAUUUUGCGUGCAAUGAUCUG 22 3,316 95 731 2    5 7 5 24 12 24 23 46 2 731 155 0 0 0 0 0 0 0 0 0 0 268 12 116 2 176 163 158 151 156 359 199 158 201 163
gma-miR1515b UCAUUUUGCGUGCAAUGAUCUG 22 3,316 95 731 2    5 7 5 24 12 24 23 46 2 731 155 0 0 0 0 0 0 0 0 0 0 268 12 116 2 176 163 158 151 156 359 199 158 201 163
gma-miR1516a-3p CAAAAGAGCUUAUGGCUUGUA 21 2 0 1 1    0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1516a-5p CAAGUUAUAAGCUCUUUUGAGAG 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1516b AGCUUCUCUACAGAAAAUAUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1516c AAUGUCUGGGCUUAGCGAGGCGGU 24 19 1 12 1    2 12 2 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1516d GUACUUGUGGCUUGUAUCCAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1517 AGUCUUGGUCAAUGUCGUUCGAAA 24 2 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0
gma-miR1518 UGUGUUGUAAAGUGAAUAUCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1519 UAAGUGUUGCAAAAUAGUCAUU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1520a UAGAACAUGAUACAUGACAGUCA 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1520b GUGACAGUCAUCAUUUAAUAAGA 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1520c UUCAAUAAGAACGUGACACGUGA 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1520d AUCAGAACAUGACACGUGACAA 22 1 0 1 1    0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1520e CAAUAAGAACGUGACAUAUGACAG 24 8 0 2 1    1 1 2 2 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1520f-3p CAAUCAGAACAUGACACAUGACAA 24 24 1 4 1    3 1 4 1 2 2 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 1 0 1 1 0 0 0 0 3
gma-miR1520f-5p AUUGUCACGUGUCAUGUUCUGAUU 24 973 28 121 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 1 4 0 66 114 85 109 104 101 98 121 57 109
gma-miR1520g CAAUCAGAACAUGACACGUGACAA 24 54 2 12 1    9 7 4 6 3 7 12 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 2 1 1 0 0
gma-miR1520h AACGUCCAAUCAGAACGUGACAUG 24 31 1 9 2    6 4 9 5 2 2 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1520i AACGUGACACGUGACGGUCAACAU 24 8 0 2 1    1 1 0 2 0 2 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0
gma-miR1520j AAGAACGUGACACAUGACAAUCAA 24 14 0 3 1    2 2 3 3 0 2 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1520k AAUCAGAACAUGACACAUGACAGU 24 87 2 14 1    1 0 8 1 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 3 0 6 5 11 4 14 7 6 8 1 8
gma-miR1520l AAUCAGAACAUGACACGUGAUAGU 24 118 3 20 1    1 1 20 5 6 9 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 1 4 0 4 6 13 9 8 4 5 9 1 8
gma-miR1520m AAUCAGAACAUGACAUGUGACAAU 24 13 0 3 1    1 1 2 1 2 2 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0
gma-miR1520n UCAAUCAGAACAUGACACGUGACA 24 34 1 5 1    1 4 5 1 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 3 0 1 2 3 2 4 0 3
gma-miR1520o UCAUCGUCCAAUCAGAAUGUGACA 24 21 1 4 1    0 4 4 1 2 2 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 1 0 1 0 0 1
gma-miR1520p AUGUUGUUAUUGGAUGAUGACGGU 24 17 0 8 1    4 8 3 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1520q AUUGACCAAUCAGAACAUGACACA 24 35 1 12 1    2 1 12 3 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 2 0 0 3 1 2 0 1 3 2 1
gma-miR1520r UGUCACAUCCUGGUUGGACAUGAA 24 17 0 4 1    3 4 1 3 2 2 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1521a CUGUUAAUGGAAAAUGUUGA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1521b GACUGUCACGUGUCAUAAUCAUA 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1522 UUUAUUGCUUAAAAUGAAAU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1523a AUGGGAUAAAUGUGAGCUCA 20 12 0 4 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 4 0 1 0 3 0 1 1 0 0
gma-miR1523b UCAUCGCUCCUGAGCUCACA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1524 CGAGUCCGAGGAAGGAACUCC 21 3 0 1 1    0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 0 0 0 0
gma-miR1525 UGGGUUAAUUAAGUUUUUAGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1526 CCGGAAGAGGAAAAUUAAGCAA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1527 UAACUCAACCUUACAAAACC 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1528 AUAGAUUAGAUCAAUAUAUUAGU 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1529 UUAAAGGAAACAAUUAAUCGUUA 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1530 UUUUCACAUAAAUUAAAAUAU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1531-3p UCGUCCAUAUGGGAAGACUUGUC 23 1 0 1 1    0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1531-5p AUAUGGACGAAGAGAUAGGUAAAU 24 28 1 9 1    1 0 9 0 0 5 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 1 0 0 1 0 0 2 0 1 0 0 1
gma-miR1532 AACACGCUAAGCGAGAGGAGCUC 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1533 AUAAUAAAAAUAAUAAUGA 19 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1534 UAUUUUGGGUAAAUAGUCAU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1535a CUUGUUUGUGGUGAUGUCU 19 2 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1535b CUUGUUUGUGGUGAUGUCUAG 21 184 5 83 1    83 4 7 0 5 33 14 0 0 0 0 0 0 0 0 0 0 0 0 0 0 7 5 1 0 5 3 1 3 3 1 0 1 5 3
gma-miR1536 AAGCAGAGACAAAUGUGUUUA 21 4 0 2 1    0 0 1 1 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR156a UGACAGAAGAGAGUGAGCAC 20 723,164 20,662 174,100 2    749 7,473 2,085 10,410 2 0 0 55,461 2,504 122,852 24,475 10,589 14,628 101,596 43,082 7,103 29,529 26,475 174,100 44,213 10,743 89 19 52 9 3,406 3,703 3,901 3,956 2,944 4,226 3,128 2,557 5,476 1,629
gma-miR156aa AUUGGAGUGAAGGGAGCU 18 1,716 49 613 1    19 134 0 3 14 21 1 341 2 613 0 106 43 0 2 0 9 12 0 0 0 38 94 54 210 0 0 0 0 0 0 0 0 0 0
gma-miR156ab AUUUAAGUGAUGGGAGCUCCG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR156b UGACAGAAGAGAGAGAGCACA 21 31 1 15 2    0 0 0 2 2 2 0 0 0 0 0 0 0 15 0 0 0 0 5 0 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR156c UUGACAGAAGAUAGAGAGCAC 21 725,646 20,733 233,988 121    8,673 3,118 1,391 2,256 24,933 20,235 9,274 83,454 96,653 92,730 4,335 15,782 57,292 233,988 29,214 4,926 12,493 121 8,384 2,729 286 527 1,139 245 346 787 810 1,016 612 740 1,546 415 880 3,906 410
gma-miR156d UUGACAGAAGAUAGAGAGCAC 21 725,646 20,733 233,988 121    8,673 3,118 1,391 2,256 24,933 20,235 9,274 83,454 96,653 92,730 4,335 15,782 57,292 233,988 29,214 4,926 12,493 121 8,384 2,729 286 527 1,139 245 346 787 810 1,016 612 740 1,546 415 880 3,906 410
gma-miR156e CUGACAGAAGAUAGAGAGCAC 21 7,616 218 2,525 1    382 462 5 116 2,525 1,921 1,890 33 63 34 10 9 32 79 7 3 0 0 2 7 0 10 1 3 0 2 3 1 3 3 2 1 0 7 0
gma-miR156f UUGACAGAAGAGAGAGAGCACA 22 67 2 16 1    0 0 0 14 2 2 1 0 9 0 0 5 0 16 0 7 0 0 2 4 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR156g ACAGAAGAUAGAGAGCACAG 20 320 9 90 1    90 64 8 12 0 0 0 0 0 0 0 5 0 16 11 0 0 0 0 0 0 35 16 26 0 0 0 1 0 1 12 0 1 21 1
gma-miR156h UGACAGAAGAGAGUGAGCAC 20 723,164 20,662 174,100 2    749 7,473 2,085 10,410 2 0 0 55,461 2,504 122,852 24,475 10,589 14,628 101,596 43,082 7,103 29,529 26,475 174,100 44,213 10,743 89 19 52 9 3,406 3,703 3,901 3,956 2,944 4,226 3,128 2,557 5,476 1,629
gma-miR156i UUGACAGAAGAUAGAGAGCAC 21 725,646 20,733 233,988 121    8,673 3,118 1,391 2,256 24,933 20,235 9,274 83,454 96,653 92,730 4,335 15,782 57,292 233,988 29,214 4,926 12,493 121 8,384 2,729 286 527 1,139 245 346 787 810 1,016 612 740 1,546 415 880 3,906 410
gma-miR156j UUGACAGAAGAUAGAGAGCAC 21 725,646 20,733 233,988 121    8,673 3,118 1,391 2,256 24,933 20,235 9,274 83,454 96,653 92,730 4,335 15,782 57,292 233,988 29,214 4,926 12,493 121 8,384 2,729 286 527 1,139 245 346 787 810 1,016 612 740 1,546 415 880 3,906 410
gma-miR156k UUGACAGAAGAGAGUGAGCAC 21 53,794 1,537 27,584 3    81 159 39 718 334 351 349 5,572 200 6,788 122 5,556 27,584 426 38 59 23 32 519 162 49 3 3 3 0 460 507 397 477 375 432 370 499 863 244
gma-miR156l UUGACAGAAGAUAGAGAGCAC 21 725,646 20,733 233,988 121    8,673 3,118 1,391 2,256 24,933 20,235 9,274 83,454 96,653 92,730 4,335 15,782 57,292 233,988 29,214 4,926 12,493 121 8,384 2,729 286 527 1,139 245 346 787 810 1,016 612 740 1,546 415 880 3,906 410
gma-miR156m UUGACAGAAGAUAGAGAGCAC 21 725,646 20,733 233,988 121    8,673 3,118 1,391 2,256 24,933 20,235 9,274 83,454 96,653 92,730 4,335 15,782 57,292 233,988 29,214 4,926 12,493 121 8,384 2,729 286 527 1,139 245 346 787 810 1,016 612 740 1,546 415 880 3,906 410
gma-miR156n UUGACAGAAGAGAGUGAGCAC 21 53,794 1,537 27,584 3    81 159 39 718 334 351 349 5,572 200 6,788 122 5,556 27,584 426 38 59 23 32 519 162 49 3 3 3 0 460 507 397 477 375 432 370 499 863 244
gma-miR156o UUGACAGAAGAGAGUGAGCAC 21 53,794 1,537 27,584 3    81 159 39 718 334 351 349 5,572 200 6,788 122 5,556 27,584 426 38 59 23 32 519 162 49 3 3 3 0 460 507 397 477 375 432 370 499 863 244
gma-miR156p UUGACAGAAGAAAGGGAGCAC 21 364 10 212 1    1 1 212 60 26 33 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 5 7 3 2 1 1 4 2 2
gma-miR156q UGACAGAAGAGAGUGAGCACU 21 32,419 926 12,801 1    1 17 6 171 11,993 12,801 4,390 34 3 136 10 5 35 146 35 10 20 32 214 44 5 0 0 0 0 205 233 253 209 159 377 203 156 378 138
gma-miR156r CUGACAGAAGAUAGAGAGCAU 21 385 11 214 1    69 18 214 2 20 33 24 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 1 0 0 1 0 0
gma-miR156s UGACAGAAGAGAGUGAGCACU 21 32,419 926 12,801 1    1 17 6 171 11,993 12,801 4,390 34 3 136 10 5 35 146 35 10 20 32 214 44 5 0 0 0 0 205 233 253 209 159 377 203 156 378 138
gma-miR156t UUGACAGAAGAAAGGGAGCAC 21 364 10 212 1    1 1 212 60 26 33 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 5 7 3 2 1 1 4 2 2
gma-miR156u UGACAGAAGAGAGUGAGCAC 20 723,164 20,662 174,100 2    749 7,473 2,085 10,410 2 0 0 55,461 2,504 122,852 24,475 10,589 14,628 101,596 43,082 7,103 29,529 26,475 174,100 44,213 10,743 89 19 52 9 3,406 3,703 3,901 3,956 2,944 4,226 3,128 2,557 5,476 1,629
gma-miR156v UGACAGAAGAGAGUGAGCAC 20 723,164 20,662 174,100 2    749 7,473 2,085 10,410 2 0 0 55,461 2,504 122,852 24,475 10,589 14,628 101,596 43,082 7,103 29,529 26,475 174,100 44,213 10,743 89 19 52 9 3,406 3,703 3,901 3,956 2,944 4,226 3,128 2,557 5,476 1,629
gma-miR156w UGACAGAAGAGAGUGAGCAC 20 723,164 20,662 174,100 2    749 7,473 2,085 10,410 2 0 0 55,461 2,504 122,852 24,475 10,589 14,628 101,596 43,082 7,103 29,529 26,475 174,100 44,213 10,743 89 19 52 9 3,406 3,703 3,901 3,956 2,944 4,226 3,128 2,557 5,476 1,629
gma-miR156x UGACAGAAGAGAGUGAGCAC 20 723,164 20,662 174,100 2    749 7,473 2,085 10,410 2 0 0 55,461 2,504 122,852 24,475 10,589 14,628 101,596 43,082 7,103 29,529 26,475 174,100 44,213 10,743 89 19 52 9 3,406 3,703 3,901 3,956 2,944 4,226 3,128 2,557 5,476 1,629
gma-miR156y UGACAGAAGAGAGUGAGCAC 20 723,164 20,662 174,100 2    749 7,473 2,085 10,410 2 0 0 55,461 2,504 122,852 24,475 10,589 14,628 101,596 43,082 7,103 29,529 26,475 174,100 44,213 10,743 89 19 52 9 3,406 3,703 3,901 3,956 2,944 4,226 3,128 2,557 5,476 1,629
gma-miR156z AUUGGAGUGAAGGGAGCU 18 1,716 49 613 1    19 134 0 3 14 21 1 341 2 613 0 106 43 0 2 0 9 12 0 0 0 38 94 54 210 0 0 0 0 0 0 0 0 0 0
gma-miR159a-3p UUUGGAUUGAAGGGAGCUCUA 21 2,517,766 71,936 698,008 132    215 349 230 281 262 193 431 571 135 455 132 786 594 501 603 1,240 937 1,275 1,098 832 378 44,318 47,610 12,383 10,509 280,330 165,110 243,359 244,521 143,190 164,229 114,324 124,755 698,008 213,622
gma-miR159a-5p GAGCUCCUUGAAGUCCAAUUG 21 632 18 171 1    1 1 2 4 0 5 67 24 5 12 0 0 0 0 0 0 0 0 0 0 0 108 171 31 48 15 22 11 16 14 19 14 15 8 19
gma-miR159b-3p AUUGGAGUGAAGGGAGCUCCA 21 7,402 211 2,684 2    153 20 0 0 668 918 16 3 2 12 0 1,668 2,684 2 313 0 400 500 0 4 0 7 13 6 13 0 0 0 0 0 0 0 0 0 0
gma-miR159b-5p GAGUUCCCUGCACUCCAAGUC 21 40 1 15 2    0 0 0 0 6 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 15 6 11 2 0 0 0 0 0 0 0 0 0 0
gma-miR159c AUUGGAGUGAAGGGAGCUCCG 21 5,931 169 5,550 2    2 85 0 26 5 12 0 211 0 5,550 0 9 3 0 0 0 9 0 0 0 0 2 5 3 9 0 0 0 0 0 0 0 0 0 0
gma-miR159d AGCUGCUUAGCUAUGGAUCCC 21 1,752 50 286 1    5 30 1 3 8 12 13 4 7 26 0 0 0 32 87 98 88 286 182 44 0 22 142 6 22 47 47 55 74 40 83 87 102 41 58
gma-miR159e-3p UUUGGAUUGAAGGGAGCUCUA 21 2,517,766 71,936 698,008 132    215 349 230 281 262 193 431 571 135 455 132 786 594 501 603 1,240 937 1,275 1,098 832 378 44,318 47,610 12,383 10,509 280,330 165,110 243,359 244,521 143,190 164,229 114,324 124,755 698,008 213,622
gma-miR159e-5p GAGCUCCUUGAAGUCCAAUU 20 394 11 130 1    0 0 1 1 0 0 0 11 0 4 3 0 0 0 0 0 0 0 0 0 0 70 108 64 130 0 0 1 0 0 0 0 0 0 1
gma-miR159f-3p AUUGGAGUGAAGGGAGCUCCA 21 7,402 211 2,684 2    153 20 0 0 668 918 16 3 2 12 0 1,668 2,684 2 313 0 400 500 0 4 0 7 13 6 13 0 0 0 0 0 0 0 0 0 0
gma-miR159f-5p GAGUUCCCUGCACUCCAAGUC 21 40 1 15 2    0 0 0 0 6 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 15 6 11 2 0 0 0 0 0 0 0 0 0 0
gma-miR160a-3p GCGUAUGAGGAGCCAAGCAUA 21 4,566 130 855 1    75 161 115 39 166 125 177 556 398 353 13 202 80 53 373 163 267 156 139 855 22 27 22 19 6 0 0 1 0 1 1 0 0 0 1
gma-miR160a-5p UGCCUGGCUCCCUGUAUGCCA 21 16,234 464 3,470 7    104 142 7 81 60 87 60 558 159 1,484 36 1,319 1,890 18 443 869 3,470 1,099 148 2,350 373 184 63 203 15 75 99 99 95 109 186 82 127 48 92
gma-miR160b UGCCUGGCUCCCUGUAUGCC 20 105 3 12 1    0 0 0 0 0 0 0 1 0 2 0 0 3 0 0 0 9 0 0 0 0 12 5 11 4 2 5 10 4 8 6 6 9 4 4
gma-miR160c UGCCUGGCUCCCUGUAUGCC 20 105 3 12 1    0 0 0 0 0 0 0 1 0 2 0 0 3 0 0 0 9 0 0 0 0 12 5 11 4 2 5 10 4 8 6 6 9 4 4
gma-miR160d UGCCUGGCUCCCUGUAUGCC 20 105 3 12 1    0 0 0 0 0 0 0 1 0 2 0 0 3 0 0 0 9 0 0 0 0 12 5 11 4 2 5 10 4 8 6 6 9 4 4
gma-miR160e UGCCUGGCUCCCUGUAUGCC 20 105 3 12 1    0 0 0 0 0 0 0 1 0 2 0 0 3 0 0 0 9 0 0 0 0 12 5 11 4 2 5 10 4 8 6 6 9 4 4
gma-miR160f UGCCUGGCUCCCUGUAUGCCA 21 16,234 464 3,470 7    104 142 7 81 60 87 60 558 159 1,484 36 1,319 1,890 18 443 869 3,470 1,099 148 2,350 373 184 63 203 15 75 99 99 95 109 186 82 127 48 92
gma-miR162a UCGAUAAACCUCUGCAUCCA 20 759 22 102 2    0 0 0 0 0 0 0 0 0 4 0 0 0 0 2 0 3 0 2 7 0 31 37 10 9 45 87 42 83 50 102 54 82 56 53
gma-miR162b UCGAUAAACCUCUGCAUCCAG 21 38,140 1,090 4,057 16    20 118 83 68 43 52 121 280 46 538 43 51 466 274 562 521 250 532 391 969 16 305 262 100 37 4,057 3,866 3,144 3,112 3,216 3,229 3,361 2,531 3,069 2,407
gma-miR162c UCGAUAAACCUCUGCAUCCAG 21 38,140 1,090 4,057 16    20 118 83 68 43 52 121 280 46 538 43 51 466 274 562 521 250 532 391 969 16 305 262 100 37 4,057 3,866 3,144 3,112 3,216 3,229 3,361 2,531 3,069 2,407
gma-miR164a UGGAGAAGCAGGGCACGUGCA 21 24,672 705 5,833 7    302 28 745 197 378 603 395 1,097 550 345 23 87 378 355 3,148 2,684 486 5,833 2,885 3,525 59 104 78 65 30 12 11 15 13 14 189 8 10 7 13
gma-miR164b UGGAGAAGCAGGGCACGUGC 20 63 2 13 1    0 1 1 0 0 0 0 1 3 0 0 0 0 0 7 13 6 12 10 7 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR164c UGGAGAAGCAGGGCACGUGC 20 63 2 13 1    0 1 1 0 0 0 0 1 3 0 0 0 0 0 7 13 6 12 10 7 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR164d UGGAGAAGCAGGGCACGUGC 20 63 2 13 1    0 1 1 0 0 0 0 1 3 0 0 0 0 0 7 13 6 12 10 7 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR164e UGGAGAAGCAGGGCACGUGCA 21 24,672 705 5,833 7    302 28 745 197 378 603 395 1,097 550 345 23 87 378 355 3,148 2,684 486 5,833 2,885 3,525 59 104 78 65 30 12 11 15 13 14 189 8 10 7 13
gma-miR164f UGGAGAAGCAGGGCACGUGCA 21 24,672 705 5,833 7    302 28 745 197 378 603 395 1,097 550 345 23 87 378 355 3,148 2,684 486 5,833 2,885 3,525 59 104 78 65 30 12 11 15 13 14 189 8 10 7 13
gma-miR164g UGGAGAAGCAGGGCACGUGCA 21 24,672 705 5,833 7    302 28 745 197 378 603 395 1,097 550 345 23 87 378 355 3,148 2,684 486 5,833 2,885 3,525 59 104 78 65 30 12 11 15 13 14 189 8 10 7 13
gma-miR164h UGGAGAAGCAGGGCACGUGCA 21 24,672 705 5,833 7    302 28 745 197 378 603 395 1,097 550 345 23 87 378 355 3,148 2,684 486 5,833 2,885 3,525 59 104 78 65 30 12 11 15 13 14 189 8 10 7 13
gma-miR164i UGGAGAAGCAGGGCACGUGCA 21 24,672 705 5,833 7    302 28 745 197 378 603 395 1,097 550 345 23 87 378 355 3,148 2,684 486 5,833 2,885 3,525 59 104 78 65 30 12 11 15 13 14 189 8 10 7 13
gma-miR164j UGGAGAAGCAGGGCACGUGCA 21 24,672 705 5,833 7    302 28 745 197 378 603 395 1,097 550 345 23 87 378 355 3,148 2,684 486 5,833 2,885 3,525 59 104 78 65 30 12 11 15 13 14 189 8 10 7 13
gma-miR164k UGGAGAAGCAGGGCACGUGCA 21 24,672 705 5,833 7    302 28 745 197 378 603 395 1,097 550 345 23 87 378 355 3,148 2,684 486 5,833 2,885 3,525 59 104 78 65 30 12 11 15 13 14 189 8 10 7 13
gma-miR166a-3p UCGGACCAGGCUUCAUUCCCC 21 19,601,307 560,037 2,349,301 31    3,693 50,254 14,973 8,485 39,127 17,347 21,619 35,284 14,739 60,810 3,135 9,560 115,535 17,370 262,987 235,620 251,289 207,816 140,948 78,708 11,456 125 5,270 31 1,351 1,649,706 1,989,892 1,617,015 1,497,271 1,747,820 1,093,529 1,830,964 2,246,912 2,349,301 1,971,365
gma-miR166a-5p GGAAUGUUGUCUGGCUCGAGG 21 23,814 680 4,565 6    67 403 103 38 257 146 225 435 306 246 10 432 1,723 748 1,229 2,525 792 732 2,229 1,805 38 4,565 2,263 1,048 1,208 36 22 31 23 20 42 6 22 12 27
gma-miR166b UCGGACCAGGCUUCAUUCCCC 21 19,601,307 560,037 2,349,301 31    3,693 50,254 14,973 8,485 39,127 17,347 21,619 35,284 14,739 60,810 3,135 9,560 115,535 17,370 262,987 235,620 251,289 207,816 140,948 78,708 11,456 125 5,270 31 1,351 1,649,706 1,989,892 1,617,015 1,497,271 1,747,820 1,093,529 1,830,964 2,246,912 2,349,301 1,971,365
gma-miR166c-3p UCGGACCAGGCUUCAUUCCCC 21 19,601,307 560,037 2,349,301 31    3,693 50,254 14,973 8,485 39,127 17,347 21,619 35,284 14,739 60,810 3,135 9,560 115,535 17,370 262,987 235,620 251,289 207,816 140,948 78,708 11,456 125 5,270 31 1,351 1,649,706 1,989,892 1,617,015 1,497,271 1,747,820 1,093,529 1,830,964 2,246,912 2,349,301 1,971,365
gma-miR166c-5p GGAAUGUUGUCUGGCUCGAGG 21 23,814 680 4,565 6    67 403 103 38 257 146 225 435 306 246 10 432 1,723 748 1,229 2,525 792 732 2,229 1,805 38 4,565 2,263 1,048 1,208 36 22 31 23 20 42 6 22 12 27
gma-miR166d UCGGACCAGGCUUCAUUCCCC 21 19,601,307 560,037 2,349,301 31    3,693 50,254 14,973 8,485 39,127 17,347 21,619 35,284 14,739 60,810 3,135 9,560 115,535 17,370 262,987 235,620 251,289 207,816 140,948 78,708 11,456 125 5,270 31 1,351 1,649,706 1,989,892 1,617,015 1,497,271 1,747,820 1,093,529 1,830,964 2,246,912 2,349,301 1,971,365
gma-miR166e UCGGACCAGGCUUCAUUCCCC 21 19,601,307 560,037 2,349,301 31    3,693 50,254 14,973 8,485 39,127 17,347 21,619 35,284 14,739 60,810 3,135 9,560 115,535 17,370 262,987 235,620 251,289 207,816 140,948 78,708 11,456 125 5,270 31 1,351 1,649,706 1,989,892 1,617,015 1,497,271 1,747,820 1,093,529 1,830,964 2,246,912 2,349,301 1,971,365
gma-miR166f UCGGACCAGGCUUCAUUCCCC 21 19,601,307 560,037 2,349,301 31    3,693 50,254 14,973 8,485 39,127 17,347 21,619 35,284 14,739 60,810 3,135 9,560 115,535 17,370 262,987 235,620 251,289 207,816 140,948 78,708 11,456 125 5,270 31 1,351 1,649,706 1,989,892 1,617,015 1,497,271 1,747,820 1,093,529 1,830,964 2,246,912 2,349,301 1,971,365
gma-miR166g UCGGACCAGGCUUCAUUCCCC 21 19,601,307 560,037 2,349,301 31    3,693 50,254 14,973 8,485 39,127 17,347 21,619 35,284 14,739 60,810 3,135 9,560 115,535 17,370 262,987 235,620 251,289 207,816 140,948 78,708 11,456 125 5,270 31 1,351 1,649,706 1,989,892 1,617,015 1,497,271 1,747,820 1,093,529 1,830,964 2,246,912 2,349,301 1,971,365
gma-miR166h-3p UCUCGGACCAGGCUUCAUUCC 21 2,357,450 67,356 236,649 501    22,366 4,539 5,196 501 17,114 12,542 13,158 9,555 1,116 4,107 853 67,556 14,854 1,265 17,001 1,653 10,142 23,488 5,237 2,564 627 7,444 13,687 5,906 6,867 216,970 230,403 200,486 210,491 199,571 236,649 196,910 204,929 192,441 199,262
gma-miR166h-5p GGAAUGUUGUUUGGCUCGAGG 21 333 10 82 2    12 8 8 0 2 7 2 4 3 4 0 9 16 8 18 26 14 12 10 11 0 82 41 19 17 0 0 0 0 0 0 0 0 0 0
gma-miR166i-3p UCGGACCAGGCUUCAUUCCCC 21 19,601,307 560,037 2,349,301 31    3,693 50,254 14,973 8,485 39,127 17,347 21,619 35,284 14,739 60,810 3,135 9,560 115,535 17,370 262,987 235,620 251,289 207,816 140,948 78,708 11,456 125 5,270 31 1,351 1,649,706 1,989,892 1,617,015 1,497,271 1,747,820 1,093,529 1,830,964 2,246,912 2,349,301 1,971,365
gma-miR166i-5p GGAAUGUCGUCUGGUUCGAG 20 78 2 10 1    0 0 0 0 0 0 0 0 9 10 0 0 3 0 0 0 0 0 0 0 0 10 7 3 6 5 2 6 5 3 3 3 0 1 2
gma-miR166j-3p UCGGACCAGGCUUCAUUCCCG 21 85,548 2,444 16,164 12    346 1,364 852 18 5,671 2,236 1,525 2,341 140 3,020 26 754 16,164 0 18 65 26 14 12 0 0 125 2,936 49 1,130 4,702 5,414 5,543 4,533 5,381 3,748 3,646 5,647 4,771 3,331
gma-miR166j-5p GGAAUGUUGUUUGGCUCGAGG 21 333 10 82 2    12 8 8 0 2 7 2 4 3 4 0 9 16 8 18 26 14 12 10 11 0 82 41 19 17 0 0 0 0 0 0 0 0 0 0
gma-miR166k UCUCGGACCAGGCUUCAUUCC 21 2,357,450 67,356 236,649 501    22,366 4,539 5,196 501 17,114 12,542 13,158 9,555 1,116 4,107 853 67,556 14,854 1,265 17,001 1,653 10,142 23,488 5,237 2,564 627 7,444 13,687 5,906 6,867 216,970 230,403 200,486 210,491 199,571 236,649 196,910 204,929 192,441 199,262
gma-miR166l GGAAUGUUGUCUGGCUCGAGG 21 23,814 680 4,565 6    67 403 103 38 257 146 225 435 306 246 10 432 1,723 748 1,229 2,525 792 732 2,229 1,805 38 4,565 2,263 1,048 1,208 36 22 31 23 20 42 6 22 12 27
gma-miR166m CGGACCAGGCUUCAUUCCCC 20 12,807 366 2,591 1    1 2,591 4 238 0 0 0 3 7 1,208 0 5 2,391 87 1,868 1,302 1,073 694 658 29 5 0 2 1 0 65 81 67 55 63 30 63 70 67 79
gma-miR166n UCGGACCAGGCUUCAUUCCCC 21 19,601,307 560,037 2,349,301 31    3,693 50,254 14,973 8,485 39,127 17,347 21,619 35,284 14,739 60,810 3,135 9,560 115,535 17,370 262,987 235,620 251,289 207,816 140,948 78,708 11,456 125 5,270 31 1,351 1,649,706 1,989,892 1,617,015 1,497,271 1,747,820 1,093,529 1,830,964 2,246,912 2,349,301 1,971,365
gma-miR166o UCGGACCAGGCUUCAUUCCCC 21 19,601,307 560,037 2,349,301 31    3,693 50,254 14,973 8,485 39,127 17,347 21,619 35,284 14,739 60,810 3,135 9,560 115,535 17,370 262,987 235,620 251,289 207,816 140,948 78,708 11,456 125 5,270 31 1,351 1,649,706 1,989,892 1,617,015 1,497,271 1,747,820 1,093,529 1,830,964 2,246,912 2,349,301 1,971,365
gma-miR166p UCGGACCAGGCUUCAUUCCC 20 45,888 1,311 3,795 2    94 837 198 90 2 2 0 588 201 1,017 63 161 1,518 136 3,795 1,321 2,743 3,305 751 722 157 6 251 6 357 2,483 2,786 2,685 2,402 2,604 2,130 2,756 3,779 3,467 2,475
gma-miR166q UCGGACCAGGCUUCAUUCCC 20 45,888 1,311 3,795 2    94 837 198 90 2 2 0 588 201 1,017 63 161 1,518 136 3,795 1,321 2,743 3,305 751 722 157 6 251 6 357 2,483 2,786 2,685 2,402 2,604 2,130 2,756 3,779 3,467 2,475
gma-miR166r UCGGACCAGGCUUCAUUCCC 20 45,888 1,311 3,795 2    94 837 198 90 2 2 0 588 201 1,017 63 161 1,518 136 3,795 1,321 2,743 3,305 751 722 157 6 251 6 357 2,483 2,786 2,685 2,402 2,604 2,130 2,756 3,779 3,467 2,475
gma-miR166s UCGGACCAGGCUUCAUUCCC 20 45,888 1,311 3,795 2    94 837 198 90 2 2 0 588 201 1,017 63 161 1,518 136 3,795 1,321 2,743 3,305 751 722 157 6 251 6 357 2,483 2,786 2,685 2,402 2,604 2,130 2,756 3,779 3,467 2,475
gma-miR166t UCGGACCAGGCUUCAUUCCC 20 45,888 1,311 3,795 2    94 837 198 90 2 2 0 588 201 1,017 63 161 1,518 136 3,795 1,321 2,743 3,305 751 722 157 6 251 6 357 2,483 2,786 2,685 2,402 2,604 2,130 2,756 3,779 3,467 2,475
gma-miR166u UCUCGGACCAGGCUUCAUUC 20 43,245 1,236 4,129 2    2,572 684 427 34 0 2 0 4,129 48 597 86 1,540 533 23 405 23 196 468 73 41 49 588 1,011 382 780 2,573 3,162 2,657 2,890 2,701 3,094 2,407 4,004 2,101 2,965
gma-miR167a UGAAGCUGCCAGCAUGAUCUA 21 36,887 1,054 6,232 1    34 375 207 152 228 285 73 857 333 6,232 238 6,048 317 336 5,376 2,463 3,262 2,637 3,023 4,240 86 17 3 13 0 1 3 4 6 5 19 3 3 3 5
gma-miR167b UGAAGCUGCCAGCAUGAUCUA 21 36,887 1,054 6,232 1    34 375 207 152 228 285 73 857 333 6,232 238 6,048 317 336 5,376 2,463 3,262 2,637 3,023 4,240 86 17 3 13 0 1 3 4 6 5 19 3 3 3 5
gma-miR167c UGAAGCUGCCAGCAUGAUCUG 21 159,798 4,566 19,937 4    36 537 137 224 28 113 4 158 118 668 7 5 0 1,896 3,260 5,105 3,674 2,392 15,901 2,147 157 513 316 359 160 8,925 10,941 11,986 12,291 7,906 19,937 13,591 10,093 17,924 8,289
gma-miR167d UGAAGCUGCCAGCAUGAUCUA 21 36,887 1,054 6,232 1    34 375 207 152 228 285 73 857 333 6,232 238 6,048 317 336 5,376 2,463 3,262 2,637 3,023 4,240 86 17 3 13 0 1 3 4 6 5 19 3 3 3 5
gma-miR167e UGAAGCUGCCAGCAUGAUCUU 21 98,201 2,806 40,230 3    146 398 2,565 2,467 69 113 39 387 273 646 1,577 1,659 327 6,606 5,385 40,230 14,424 3,389 8,991 3,043 4,229 8 3 6 0 83 124 147 130 78 226 124 114 122 73
gma-miR167f UGAAGCUGCCAGCAUGAUCUU 21 98,201 2,806 40,230 3    146 398 2,565 2,467 69 113 39 387 273 646 1,577 1,659 327 6,606 5,385 40,230 14,424 3,389 8,991 3,043 4,229 8 3 6 0 83 124 147 130 78 226 124 114 122 73
gma-miR167g UGAAGCUGCCAGCAUGAUCUGA 22 28,709 820 11,035 1    1 6 4 3 3 2 1 584 563 940 23 0 0 1,631 4,207 3,130 2,947 1,799 11,035 1,208 151 2 4 1 6 24 50 46 57 33 53 55 41 70 29
gma-miR167h AUCAUGCUGGCAGCUUCAACUGGU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR167i UCAUGCUGGCAGCUUCAACUGGU 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR167j UGAAGCUGCCAGCAUGAUCUG 21 159,798 4,566 19,937 4    36 537 137 224 28 113 4 158 118 668 7 5 0 1,896 3,260 5,105 3,674 2,392 15,901 2,147 157 513 316 359 160 8,925 10,941 11,986 12,291 7,906 19,937 13,591 10,093 17,924 8,289
gma-miR167k UGAAGCUGCCAGCCUGAUCUUA 22 41 1 17 1    0 0 1 4 0 0 0 0 0 2 17 9 5 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR167l UGAAGCUGCCAGCAUGAUCU 20 3,029 87 680 3    3 31 91 88 0 0 0 152 55 680 63 101 27 65 158 426 165 139 111 140 65 19 8 8 6 34 39 46 32 36 64 44 55 47 31
gma-miR168a UCGCUUGGUGCAGGUCGGGAA 21 223,813 6,395 27,208 575    2,100 1,816 3,575 915 7,402 4,809 6,647 13,704 3,939 3,755 2,887 4,063 20,701 8,489 13,732 20,291 6,437 25,174 27,208 12,170 2,344 1,480 1,217 575 786 2,062 2,390 2,625 2,467 2,427 4,231 2,413 3,091 3,412 2,479
gma-miR168b UCGCUUGGUGCAGGUCGGG 19 142 4 23 1    2 4 2 1 5 0 2 3 3 8 0 18 16 2 2 13 6 23 2 0 0 1 5 5 11 1 1 1 1 0 0 1 2 1 0
gma-miR169a CAGCCAAGGAUGACUUGCCGG 21 29,797 851 10,632 3    23 265 329 149 1,348 1,862 1,258 254 3,922 142 10,632 64 8,696 82 16 33 3 3 66 169 54 12 115 20 180 6 9 8 9 7 24 7 12 4 14
gma-miR169b CAGCCAAGGAUGACUUGCCGA 21 524 15 403 1    0 0 11 60 0 5 3 0 5 0 3 0 3 0 4 403 17 9 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0
gma-miR169c AAGCCAAGGAUGACUUGCCGA 21 102 3 28 1    28 3 13 6 8 2 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 10 3 17 0 0 0 0 0 3 1 0 1 1
gma-miR169d UGAGCCAAGGAUGACUUGCCGGU 23 260 7 98 1    15 44 11 0 0 0 0 98 31 2 50 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 1 1 2 0 2 0 0
gma-miR169e AGCCAAGGAUGACUUGCCGG 20 401 11 97 1    1 27 18 7 0 0 0 30 97 8 66 0 51 1 5 3 3 0 5 0 0 1 24 1 52 0 0 0 0 0 0 0 1 0 0
gma-miR169f CAGCCAAGGAUGACUUGCCGG 21 29,797 851 10,632 3    23 265 329 149 1,348 1,862 1,258 254 3,922 142 10,632 64 8,696 82 16 33 3 3 66 169 54 12 115 20 180 6 9 8 9 7 24 7 12 4 14
gma-miR169g CAGCCAAGGAUGACUUGCCGG 21 29,797 851 10,632 3    23 265 329 149 1,348 1,862 1,258 254 3,922 142 10,632 64 8,696 82 16 33 3 3 66 169 54 12 115 20 180 6 9 8 9 7 24 7 12 4 14
gma-miR169h GGCGAGACAUCUUGGCUCAUU 21 1 0 1 1    0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR169i-3p CCGGUGCCAUCCCGUCUCAUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR169i-5p UGAGCCGGGAUGGCUUGCCGGCA 23 115 3 55 1    15 2 8 3 5 16 3 4 55 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 1 0 0 0 0 0 1
gma-miR169j-3p UUUCGACGAGUUGUUCUUGGC 21 231 7 42 1    15 1 2 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 15 42 4 35 17 8 11 8 7 18 8 8 21 8
gma-miR169j-5p UAGCCAAGAAUGACUUGCCGG 21 503 14 283 1    7 25 32 283 25 40 33 0 2 2 10 0 8 0 0 0 0 0 0 0 0 1 1 4 2 2 2 3 1 3 8 3 2 1 3
gma-miR169k CAGCCAAGAAUGACUUGCCGG 21 4,014 115 2,437 1    11 35 11 8 51 59 34 365 276 83 2,437 51 514 0 0 0 0 0 0 0 0 1 1 5 2 2 5 8 1 5 26 4 10 2 7
gma-miR169l-3p CGGGCAAGUUGUUUUUGGCUAC 22 155 4 74 1    3 3 2 0 74 24 47 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 1
gma-miR169l-5p CAGCCAAGAAUGACUUGCCGG 21 4,014 115 2,437 1    11 35 11 8 51 59 34 365 276 83 2,437 51 514 0 0 0 0 0 0 0 0 1 1 5 2 2 5 8 1 5 26 4 10 2 7
gma-miR169m CAGCCAAGGAUGACUUGCCGG 21 29,797 851 10,632 3    23 265 329 149 1,348 1,862 1,258 254 3,922 142 10,632 64 8,696 82 16 33 3 3 66 169 54 12 115 20 180 6 9 8 9 7 24 7 12 4 14
gma-miR169n-3p UGCCGGCAAGUUUCUCUUGGC 21 501 14 80 1    1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 13 9 5 4 37 46 50 43 35 80 56 52 35 34
gma-miR169n-5p CAGCCAAGGGUGAUUUGCCGG 21 1,668 48 845 2    88 2 4 0 15 31 4 845 61 61 36 0 0 164 5 3 43 3 5 26 5 23 14 27 4 20 16 31 21 14 53 9 10 21 4
gma-miR169o UGAGCCAGGAUGGCUUGCCGGC 22 4,236 121 757 1    49 14 1 0 14 14 10 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 308 400 458 383 208 757 374 708 319 219
gma-miR169p UGAGCCAAGGAUGACUUGCCG 21 74 2 28 1    9 0 19 1 6 28 6 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 0 0
gma-miR169r UGAGCCAGGAUGGCUUGCCGGC 22 4,236 121 757 1    49 14 1 0 14 14 10 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 308 400 458 383 208 757 374 708 319 219
gma-miR169s-3p CGGCAAGUAAUCUUUGGCUGC 21 57 2 15 1    0 0 0 0 2 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 9 14 14 15 0 0 0 0 0 1 0 1 0 0
gma-miR169s-5p AAGCCAAGGAUGACUUGCCGG 21 1,638 47 455 1    53 56 2 2 11 5 4 174 118 39 73 455 189 1 100 0 150 17 33 0 0 2 53 1 97 1 0 0 0 0 0 1 0 0 1
gma-miR169t UAGCCAAGGAUGGACUUGCCUA 22 59 2 40 1    2 5 40 5 2 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 1 0 0 1 0 0 0
gma-miR169u CAGCCAAGGAUGACUUGCCGU 21 328 9 157 1    0 1 3 5 35 40 4 0 157 0 33 0 19 1 0 13 0 0 0 0 0 0 1 0 0 1 3 3 1 1 1 2 1 0 3
gma-miR169v CAGCCAAGGAUGACUUGCC 19 32 1 11 1    0 0 0 0 3 0 1 0 3 0 10 0 11 0 0 0 0 0 0 0 0 0 0 0 4 0 0 0 0 0 0 0 0 0 0
gma-miR169w CAAGGAUGACUUGCCGGCAUU 21 568 16 75 1    14 1 1 3 8 9 19 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 2 46 41 52 71 40 75 51 46 39 47
gma-miR171a UGAGCCGUGCCAAUAUCACGA 21 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0
gma-miR171b-3p CGAGCCGAAUCAAUAUCACUC 21 6,820 195 3,106 1    60 249 1 0 11 9 2 0 0 0 0 60 0 3 3,106 16 1,647 72 99 1,186 0 0 0 1 0 20 53 32 19 14 62 28 30 19 21
gma-miR171b-5p ACGGCGUGAUAUUGGUACGGCUC 23 9 0 5 4    4 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR171c-3p UUGAGCCGUGCCAAUAUCACA 21 3,163 90 493 1    5 0 11 0 98 108 2 3 22 0 10 0 19 1 4 49 0 6 8 0 27 2 0 1 0 186 369 186 274 249 325 235 493 160 310
gma-miR171c-5p AGAUAUUGGUGCGGUUCAAUC 21 338 10 71 1    5 0 11 1 71 49 3 3 15 2 3 0 0 8 16 46 6 6 25 4 0 0 0 0 0 1 9 10 9 7 4 4 10 2 8
gma-miR171d UGAUUGAGUCGUGUCAAUAUC 21 14 0 5 2    5 0 2 2 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR171e UGAUUGAGCCGUGCCAAUAUC 21 3,455 99 676 2    79 53 554 24 211 137 26 9 553 0 427 0 676 2 0 114 0 0 7 0 27 4 3 5 0 32 45 52 42 47 171 27 38 39 51
gma-miR171f UGAUUGAGCCGUGCCAAUAUC 21 3,455 99 676 2    79 53 554 24 211 137 26 9 553 0 427 0 676 2 0 114 0 0 7 0 27 4 3 5 0 32 45 52 42 47 171 27 38 39 51
gma-miR171g UGAUUGAGCCGUGCCAAUAUC 21 3,455 99 676 2    79 53 554 24 211 137 26 9 553 0 427 0 676 2 0 114 0 0 7 0 27 4 3 5 0 32 45 52 42 47 171 27 38 39 51
gma-miR171h AUUGAGACGAGCCGAAUCAAU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR171i-3p UUGAGCCGUGCCAAUAUCACG 21 458 13 50 1    0 0 0 1 0 2 1 0 0 0 0 0 32 1 2 20 0 0 2 0 27 0 0 0 0 27 48 28 45 26 31 36 50 34 45
gma-miR171i-5p AUAAGAAAGCAAUGCUCAAA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR171j-3p UGAUUGAGCCGUGCCAAUAUC 21 3,455 99 676 2    79 53 554 24 211 137 26 9 553 0 427 0 676 2 0 114 0 0 7 0 27 4 3 5 0 32 45 52 42 47 171 27 38 39 51
gma-miR171j-5p UAUUGGCCUGGUUCACUCAGA 21 1,374 39 172 1    0 0 1 0 6 2 2 0 3 0 0 0 0 0 0 3 0 0 2 0 0 0 0 0 0 131 145 104 157 133 172 115 119 160 119
gma-miR171k-3p UUGAGCCGCGCCAAUAUCACU 21 1,296 37 200 1    5 1 1 0 14 24 1 9 2 2 0 0 3 1 154 13 40 200 8 41 27 10 7 1 0 48 70 87 75 82 64 59 129 58 60
gma-miR171k-5p CGAUGUUGGUGAGGUUCAAUC 21 286 8 64 1    13 1 3 3 3 19 1 20 2 2 3 0 3 4 64 7 9 52 7 7 5 13 13 8 2 1 2 6 3 3 1 1 1 4 0
gma-miR171l CGAUGUUGGUGAGGUUCAAUC 21 286 8 64 1    13 1 3 3 3 19 1 20 2 2 3 0 3 4 64 7 9 52 7 7 5 13 13 8 2 1 2 6 3 3 1 1 1 4 0
gma-miR171m UUGAGCCGCGUCAAUAUCUCA 21 4,727 135 1,398 1    97 20 83 79 212 56 2 68 94 674 1,243 60 1,398 0 0 0 0 0 0 0 0 4 1 0 0 44 74 62 83 66 67 41 73 52 74
gma-miR171n UUGAGCCGCGUCAAUAUCUUA 21 832 24 186 1    30 2 17 5 22 61 3 16 0 49 23 37 186 0 0 0 0 0 0 0 0 3 1 5 4 29 37 29 36 32 32 18 38 76 41
gma-miR171o-3p UUGAGCCGUGCCAAUAUCACA 21 3,163 90 493 1    5 0 11 0 98 108 2 3 22 0 10 0 19 1 4 49 0 6 8 0 27 2 0 1 0 186 369 186 274 249 325 235 493 160 310
gma-miR171o-5p AGAUAUUGGUACGGUUCAAUC 21 347 10 38 1    13 0 36 2 8 9 8 9 38 0 3 0 0 0 0 3 0 0 0 0 0 1 1 0 0 19 22 24 19 21 29 12 31 14 25
gma-miR171p UUGAGCCGCGUCAAUAUCUUA 21 832 24 186 1    30 2 17 5 22 61 3 16 0 49 23 37 186 0 0 0 0 0 0 0 0 3 1 5 4 29 37 29 36 32 32 18 38 76 41
gma-miR171q UUGAGCCGUGCCAAUAUCACA 21 3,163 90 493 1    5 0 11 0 98 108 2 3 22 0 10 0 19 1 4 49 0 6 8 0 27 2 0 1 0 186 369 186 274 249 325 235 493 160 310
gma-miR171r CGAGCCGAAUCAAUACCACUC 21 737 21 571 1    26 571 2 0 9 5 1 0 0 0 0 0 0 0 2 0 0 0 2 0 0 2 1 1 2 10 12 11 23 3 10 10 12 14 8
gma-miR171s CGAGCCGAAUCAAUACCACUC 21 737 21 571 1    26 571 2 0 9 5 1 0 0 0 0 0 0 0 2 0 0 0 2 0 0 2 1 1 2 10 12 11 23 3 10 10 12 14 8
gma-miR171t UUGAGCCGCGUCAAUAUCUCA 21 4,727 135 1,398 1    97 20 83 79 212 56 2 68 94 674 1,243 60 1,398 0 0 0 0 0 0 0 0 4 1 0 0 44 74 62 83 66 67 41 73 52 74
gma-miR171u UGAUUGAGCCGUGCCAAUAUC 21 3,455 99 676 2    79 53 554 24 211 137 26 9 553 0 427 0 676 2 0 114 0 0 7 0 27 4 3 5 0 32 45 52 42 47 171 27 38 39 51
gma-miR172a AGAAUCUUGAUGAUGCUGCAU 21 122,151 3,490 32,493 2    876 393 1,398 70 3,185 1,088 269 7,797 6,265 1,153 784 8,539 7,969 27 2,223 10,572 16,400 32,493 17,202 925 2,015 87 14 55 2 39 36 34 47 39 53 36 31 6 29
gma-miR172b-3p AGAAUCUUGAUGAUGCUGCAU 21 122,151 3,490 32,493 2    876 393 1,398 70 3,185 1,088 269 7,797 6,265 1,153 784 8,539 7,969 27 2,223 10,572 16,400 32,493 17,202 925 2,015 87 14 55 2 39 36 34 47 39 53 36 31 6 29
gma-miR172b-5p GUAGCAUCAUCAAGAUUCAC 20 85 2 11 1    0 0 0 0 0 0 0 4 9 2 3 0 3 0 2 3 3 9 10 0 11 1 0 10 0 0 1 3 0 1 4 1 2 0 3
gma-miR172c GGAAUCUUGAUGAUGCUGCAG 21 11,528 329 3,732 1    3 3,732 327 185 6 33 8 93 3,466 3,632 13 0 8 0 0 3 0 3 0 0 0 7 1 3 0 0 0 0 0 1 2 1 0 1 0
gma-miR172d GGAAUCUUGAUGAUGCUGCAGCAG 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR172e GGAAUCUUGAUGAUGCUGCAGCAG 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR172f AGAAUCUUGAUGAUGCUGCA 20 3,106 89 1,806 1    15 5 19 2 0 0 0 142 92 26 13 1,806 218 0 27 114 128 295 149 7 43 0 0 0 0 1 1 0 1 1 1 0 0 0 0
gma-miR172g GCAGCACCAUCAAGAUUCAC 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR172h-3p AGAAUCUUGAUGAUGCUGCAU 21 122,151 3,490 32,493 2    876 393 1,398 70 3,185 1,088 269 7,797 6,265 1,153 784 8,539 7,969 27 2,223 10,572 16,400 32,493 17,202 925 2,015 87 14 55 2 39 36 34 47 39 53 36 31 6 29
gma-miR172h-5p GCAGCAGCAUCAAGAUUCACA 21 373 11 172 1    1 0 2 1 6 5 1 4 0 10 0 0 0 0 11 10 31 78 172 22 0 2 1 8 2 0 0 0 0 0 5 1 0 0 0
gma-miR172i-3p GGAAUCUUGAUGAUGCUGCAU 21 1,141 33 490 2    306 490 5 3 23 5 8 4 34 162 0 9 0 0 2 7 11 35 7 0 0 8 0 20 2 0 0 0 0 0 0 0 0 0 0
gma-miR172i-5p GCAGCAGCAUCAAGAUUCACA 21 373 11 172 1    1 0 2 1 6 5 1 4 0 10 0 0 0 0 11 10 31 78 172 22 0 2 1 8 2 0 0 0 0 0 5 1 0 0 0
gma-miR172j GCAGCAGCAUCAAGAUUCACA 21 373 11 172 1    1 0 2 1 6 5 1 4 0 10 0 0 0 0 11 10 31 78 172 22 0 2 1 8 2 0 0 0 0 0 5 1 0 0 0
gma-miR172k UGAAUCUUGAUGAUGCUGCAU 21 103 3 42 1    0 1 42 2 17 2 1 1 2 0 0 5 0 0 2 3 6 9 2 0 0 0 0 0 0 0 1 0 0 1 2 1 2 0 1
gma-miR172l GGAAUCUUGAUGAUGCUGCAU 21 1,141 33 490 2    306 490 5 3 23 5 8 4 34 162 0 9 0 0 2 7 11 35 7 0 0 8 0 20 2 0 0 0 0 0 0 0 0 0 0
gma-miR2107 CAAACCUCCGUAGCCUGUAUC 21 6 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 1 0 1 1 0 1
gma-miR2108a UUAAUGUGUUGUGUUUGUCGG 21 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0
gma-miR2108b UUAAUGUGUUGUGUUUGUGAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR2109-3p GGAGGCGUAGAUACUCACACC 21 7,740 221 975 4    30 15 4 73 975 440 102 0 0 0 0 0 0 0 0 0 0 0 0 0 0 751 602 554 295 379 389 448 291 339 623 359 452 135 484
gma-miR2109-5p UGCGAGUGUCUUCGCCUCUG 20 24 1 5 1    3 1 4 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 5 1 2 0 0 0 1 0 0 0 0 0 0
gma-miR2111a GUCCUUGGGAUGCAGAUUACG 21 118 3 49 1    1 8 1 22 28 7 49 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0 0
gma-miR2111b UAAUCUGCAUCCUGAGGUUUA 21 1,747 50 560 1    0 0 1 3 15 9 7 3 14 14 30 5 11 24 160 560 133 347 307 0 49 12 0 10 0 9 5 1 1 3 2 1 5 2 4
gma-miR2111c UAAUCUGCAUCCUGAGGUUUA 21 1,747 50 560 1    0 0 1 3 15 9 7 3 14 14 30 5 11 24 160 560 133 347 307 0 49 12 0 10 0 9 5 1 1 3 2 1 5 2 4
gma-miR2111d GUCCUUGGGAUGCAGAUUACG 21 118 3 49 1    1 8 1 22 28 7 49 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0 0
gma-miR2111e UAAUCUGCAUCCUGAGGUUUA 21 1,747 50 560 1    0 0 1 3 15 9 7 3 14 14 30 5 11 24 160 560 133 347 307 0 49 12 0 10 0 9 5 1 1 3 2 1 5 2 4
gma-miR2111f UAAUCUGCAUCCUGAGGUUUA 21 1,747 50 560 1    0 0 1 3 15 9 7 3 14 14 30 5 11 24 160 560 133 347 307 0 49 12 0 10 0 9 5 1 1 3 2 1 5 2 4
gma-miR2118a-3p UUGCCGAUUCCACCCAUUCCU 21 335 10 42 1    0 0 0 2 3 5 1 3 3 0 17 0 3 0 0 0 0 0 0 0 0 15 13 14 35 11 18 15 25 14 42 15 29 30 22
gma-miR2118a-5p GGAGAUGGGAGGGUCGGUAAAG 22 7,298 209 1,571 20    232 629 1,571 315 220 323 1,007 0 0 0 0 0 0 0 0 0 0 0 0 0 0 416 1,201 84 459 104 74 94 116 63 106 20 63 111 90
gma-miR2118b-3p UUGCCGAUUCCACCCAUUCCU 21 335 10 42 1    0 0 0 2 3 5 1 3 3 0 17 0 3 0 0 0 0 0 0 0 0 15 13 14 35 11 18 15 25 14 42 15 29 30 22
gma-miR2118b-5p GGAGAUGGGAGGGUCGGUAAAG 22 7,298 209 1,571 20    232 629 1,571 315 220 323 1,007 0 0 0 0 0 0 0 0 0 0 0 0 0 0 416 1,201 84 459 104 74 94 116 63 106 20 63 111 90
gma-miR2119 UCAAAGGGAGUUGUAGGGGAA 21 7,335 210 5,023 2    144 11 38 2 23 14 3 5,023 0 0 3 0 0 0 0 0 0 0 0 0 0 14 9 8 0 75 81 55 42 61 157 17 57 1,466 32
gma-miR2606a AAAAGCACUUAAGGAACGGUA 21 38 1 17 1    17 7 0 0 9 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 3 0 0 0 0 0 0 0 0 0 0 0
gma-miR2606b AAAAGCACUUAAGGAACGGUA 21 38 1 17 1    17 7 0 0 9 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 3 0 0 0 0 0 0 0 0 0 0 0
gma-miR319a UUGGACUGAAGGGAGCUCCC 20 33,547 958 10,628 1    1 1 10 2 0 0 0 10 43 2 0 9 16 5 11 10 3 9 10 0 16 658 9,338 162 10,628 1,073 991 2,632 245 1,708 2,029 159 2,861 730 175
gma-miR319b UUGGACUGAAGGGAGCUCCC 20 33,547 958 10,628 1    1 1 10 2 0 0 0 10 43 2 0 9 16 5 11 10 3 9 10 0 16 658 9,338 162 10,628 1,073 991 2,632 245 1,708 2,029 159 2,861 730 175
gma-miR319c UUGGACUGAAGGGAGCUCCU 20 183 5 93 1    0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 59 1 93 2 1 4 3 4 6 1 1 1 1
gma-miR319d UGGACUGAAGGGGAGCUCCUUC 22 2,881 82 478 1    0 0 19 0 0 0 3 1 2 0 0 5 16 0 5 3 0 6 8 0 0 10 19 5 17 319 235 357 179 335 366 156 478 109 228
gma-miR319e UUGGACUGAAGGGAGCUCCC 20 33,547 958 10,628 1    1 1 10 2 0 0 0 10 43 2 0 9 16 5 11 10 3 9 10 0 16 658 9,338 162 10,628 1,073 991 2,632 245 1,708 2,029 159 2,861 730 175
gma-miR319f UUGGACUGAAGGGGCCUCUU 20 815 23 307 1    1 1 307 20 0 0 0 1 3 2 3 0 59 4 2 189 0 0 83 0 0 0 3 0 2 22 9 29 1 31 13 0 25 3 2
gma-miR319g UUGGACUGAAGGGAGCUCCUUC 22 1,095 31 176 1    1 0 0 0 0 0 1 0 0 0 0 0 0 0 2 0 0 0 0 0 0 1 34 3 74 80 105 176 48 111 161 40 147 46 65
gma-miR319h UUGGACUGAAGGGAGCUCCCU 21 8,396 240 2,083 2    7 2 38 12 15 19 66 17 27 2 0 0 149 3 9 65 6 52 33 7 5 183 2,083 69 2,057 336 242 764 64 486 544 50 770 163 51
gma-miR319i UUGGACUGAAGGGGAGCUCCUUC 23 777 22 123 35    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 75 68 123 57 102 109 43 102 35 63
gma-miR319j UUGGACUGAAGGGAGCUCCCU 21 8,396 240 2,083 2    7 2 38 12 15 19 66 17 27 2 0 0 149 3 9 65 6 52 33 7 5 183 2,083 69 2,057 336 242 764 64 486 544 50 770 163 51
gma-miR319k UUGGACUGAAGGGAGCUCCCU 21 8,396 240 2,083 2    7 2 38 12 15 19 66 17 27 2 0 0 149 3 9 65 6 52 33 7 5 183 2,083 69 2,057 336 242 764 64 486 544 50 770 163 51
gma-miR319l UUGGACUGAAGGGAGCUCCUUC 22 1,095 31 176 1    1 0 0 0 0 0 1 0 0 0 0 0 0 0 2 0 0 0 0 0 0 1 34 3 74 80 105 176 48 111 161 40 147 46 65
gma-miR319m UUGGACUGAAGGGAGCUCCCU 21 8,396 240 2,083 2    7 2 38 12 15 19 66 17 27 2 0 0 149 3 9 65 6 52 33 7 5 183 2,083 69 2,057 336 242 764 64 486 544 50 770 163 51
gma-miR319n UUUGGACCGAAGGGAGCCCCU 21 3,065 88 625 2    0 5 27 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 344 350 197 255 352 209 266 625 109 324
gma-miR319o UGGACUGAAGGGGAGCUCCUUC 22 2,881 82 478 1    0 0 19 0 0 0 3 1 2 0 0 5 16 0 5 3 0 6 8 0 0 10 19 5 17 319 235 357 179 335 366 156 478 109 228
gma-miR319p UUUUGGACUGAAGGGAGCUCC 21 868 25 355 1    0 1 1 3 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 72 91 115 355 17 20 28 29 33 25 9 30 16 22
gma-miR319q UGGACUGAAGGGAGCUCCUUC 21 5,178 148 1,602 1    1 1 17 1 2 0 15 6 3 30 0 0 19 0 2 0 0 3 0 0 5 261 540 458 1,602 244 223 253 117 214 340 145 403 89 184
gma-miR3522 AGACCAAAUGAGCAGCUGA 19 422 12 75 1    44 14 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 30 75 15 42 48 50 32 24 31 16
gma-miR390a-3p CGCUAUCCAUCCUGAGUUUC 20 50 1 13 1    0 1 0 0 0 0 0 1 7 0 3 0 13 0 5 0 6 0 2 4 0 1 1 1 0 0 2 0 0 0 1 0 1 0 1
gma-miR390a-5p AAGCUCAGGAGGGAUAGCGCC 21 24,612 703 2,990 66    81 591 446 69 406 275 117 188 952 95 1,746 1,604 2,990 141 718 1,061 1,743 526 478 210 351 72 80 66 100 487 1,203 1,185 549 914 1,308 450 2,010 702 698
gma-miR390b-3p UACUUGGCGCUAUCUAUCUUGA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR390b-5p AAGCUCAGGAGGGAUAGCACC 21 8,215 235 5,678 3    162 5 87 19 274 282 592 607 49 5,678 50 0 3 0 0 0 3 0 0 0 0 5 7 4 0 32 28 53 13 38 50 22 103 30 19
gma-miR390c CGCUAUCCAUCCUGAGUUUC 20 50 1 13 1    0 1 0 0 0 0 0 1 7 0 3 0 13 0 5 0 6 0 2 4 0 1 1 1 0 0 2 0 0 0 1 0 1 0 1
gma-miR390d AAGCUCAGGAGGGAUAGCACC 21 8,215 235 5,678 3    162 5 87 19 274 282 592 607 49 5,678 50 0 3 0 0 0 3 0 0 0 0 5 7 4 0 32 28 53 13 38 50 22 103 30 19
gma-miR390e AGCUCAGGAGGGAUAGCGCC 20 526 15 161 1    0 21 40 20 0 0 0 10 97 0 43 161 48 2 5 3 11 14 7 4 5 2 3 1 0 2 4 4 0 1 4 1 4 5 4
gma-miR390f AAGCUCAGGAGGGAUAGCGCC 21 24,612 703 2,990 66    81 591 446 69 406 275 117 188 952 95 1,746 1,604 2,990 141 718 1,061 1,743 526 478 210 351 72 80 66 100 487 1,203 1,185 549 914 1,308 450 2,010 702 698
gma-miR390g AAGCUCAGGAGGGAUAGCGCC 21 24,612 703 2,990 66    81 591 446 69 406 275 117 188 952 95 1,746 1,604 2,990 141 718 1,061 1,743 526 478 210 351 72 80 66 100 487 1,203 1,185 549 914 1,308 450 2,010 702 698
gma-miR391-5p UACGCAGGAGAGAUGACGCUGU 22 473 14 181 2    0 0 18 0 3 2 0 0 181 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 25 30 25 27 31 36 21 20 22 29
gma-miR391a-3p AGCAUCAUAUCUCCUGCAUAG 21 8 0 2 1    0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 2 0 0 1 1
gma-miR393a UCCAAAGGGAUCGCAUUGAUC 21 719 21 86 1    30 37 13 0 0 0 2 14 0 24 0 51 8 0 5 3 0 0 0 0 0 2 1 4 0 57 35 64 58 39 86 43 54 25 64
gma-miR393b UUUGGGAUCAUGCUAUCCCUU 21 23 1 12 1    1 0 0 12 5 2 0 0 0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR393c-3p AUCAUGCUAUCCCUUUGGAUU 21 393 11 72 1    1 3 2 1 2 7 1 0 2 0 0 0 72 2 24 68 6 12 10 18 0 2 2 0 0 11 17 20 23 12 22 9 16 9 19
gma-miR393c-5p UCCAAAGGGAUCGCAUUGAUCC 22 1,191 34 679 1    20 27 17 9 23 14 6 23 32 128 3 51 679 0 4 0 6 14 3 7 0 1 0 3 0 16 7 14 9 10 26 10 12