About This Database    FAQs   Our Collaborators

Annotated species Oryza sativa (japonica, Nipponbare) Annotation built on MSU 7 Total number of genes 56,832
Library type RNA-seq Total bp in genome 375,096,285 Protein coding 39,889
Total number of libraries 36 Total chrs or contigs 16 Transposon related 16,943

The RNA-seq data are described in New Phytologist, a collaboration with the lab of Qili Fei (Agricultural Genomics Institute at Shenzhen-CAAS). Additional data and databases are accessible and described on our index page. Raw data were submitted to GEO under GSE191268.

Some data contributed by: Qili Fei (Agricultural Genomics Institute at Shenzhen-CAAS), Wanqi Liang (Shanghai Jiao Tong University).

    known microRNAs: osa-MIR172b
    inverted repeats: LOC_Os07g01240      LOC_Os12g16350
    tandem repeats: Chr. 5      LOC_Os09g11350      LOC_Os09g25300
    centromeric region: Chr. 4      Chr. 8
    transposons:   Retrotransposon      MITE      DNA transposon
  trans-acting siRNAs:   TAS3a      TAS3b      TAS3c

Access to this web site and the data contained herein are provided for research purposes only. No commercial rights of any nature are granted.

Basic Queries

Please enter specific information to retrieve data.
Adjust libraries/reads to display on the control panel (optional).

Protein or gene ID
Bulk Query
Using an IRGSP gene identifier? RAPDB version converter

e.g. LOC_Os01g01010
Cluster or coordinate ID
Bulk Query

e.g. RICE_MSU7.1.2001.500 (cluster)   RICE_MSU7.1.2001.4500 (coordinate)
Sequence of RNA-seq read
Bulk Query
e.g. TAGGAAACACGACGGAGGCGGAGATGATCGACGGCGGAGAGAGCTACAGA
Keyword for genes/proteins or repeats

e.g. MIRNA  LTR

Query by Chromosome Position

Click on a region of any chromosome for which you would like to retrieve the map. Because of the size of chromosomes, clicking on the diagram below will take you to a second map where you can refine the position. Note that if the genome has a mix of both chromosomes and small contigs or scaffolds, we only show images for the defined chromosomes, and contigs must be accessed via their ID.

0 - 5,000,0005,000,000 - 10,000,00010,000,000 - 15,000,00015,000,000 - 20,000,00020,000,000 - 25,000,00025,000,000 - 30,000,00030,000,000 - 35,000,00035,000,000 - 40,000,00040,000,000 - 43,270,9230 - 5,000,0005,000,000 - 10,000,00010,000,000 - 15,000,00015,000,000 - 20,000,00020,000,000 - 25,000,00025,000,000 - 30,000,00030,000,000 - 35,000,00035,000,000 - 35,937,25035,937,250 - 35,937,2500 - 5,000,0005,000,000 - 10,000,00010,000,000 - 15,000,00015,000,000 - 20,000,00020,000,000 - 25,000,00025,000,000 - 30,000,00030,000,000 - 35,000,00035,000,000 - 36,413,81936,413,819 - 36,413,8190 - 5,000,0005,000,000 - 10,000,00010,000,000 - 15,000,00015,000,000 - 20,000,00020,000,000 - 25,000,00025,000,000 - 30,000,00030,000,000 - 35,000,00035,000,000 - 35,502,69435,502,694 - 35,502,6940 - 5,000,0005,000,000 - 10,000,00010,000,000 - 15,000,00015,000,000 - 20,000,00020,000,000 - 25,000,00025,000,000 - 29,958,43429,958,434 - 29,958,43429,958,434 - 29,958,43429,958,434 - 29,958,4340 - 5,000,0005,000,000 - 10,000,00010,000,000 - 15,000,00015,000,000 - 20,000,00020,000,000 - 25,000,00025,000,000 - 30,000,00030,000,000 - 31,248,78731,248,787 - 31,248,78731,248,787 - 31,248,7870 - 5,000,0005,000,000 - 10,000,00010,000,000 - 15,000,00015,000,000 - 20,000,00020,000,000 - 25,000,00025,000,000 - 29,697,62129,697,621 - 29,697,62129,697,621 - 29,697,62129,697,621 - 29,697,6210 - 5,000,0005,000,000 - 10,000,00010,000,000 - 15,000,00015,000,000 - 20,000,00020,000,000 - 25,000,00025,000,000 - 28,443,02228,443,022 - 28,443,02228,443,022 - 28,443,02228,443,022 - 28,443,0220 - 5,000,0005,000,000 - 10,000,00010,000,000 - 15,000,00015,000,000 - 20,000,00020,000,000 - 23,012,72023,012,720 - 23,012,72023,012,720 - 23,012,72023,012,720 - 23,012,72023,012,720 - 23,012,7200 - 5,000,0005,000,000 - 10,000,00010,000,000 - 15,000,00015,000,000 - 20,000,00020,000,000 - 23,207,28723,207,287 - 23,207,28723,207,287 - 23,207,28723,207,287 - 23,207,28723,207,287 - 23,207,2870 - 5,000,0005,000,000 - 10,000,00010,000,000 - 15,000,00015,000,000 - 20,000,00020,000,000 - 25,000,00025,000,000 - 29,021,10629,021,106 - 29,021,10629,021,106 - 29,021,10629,021,106 - 29,021,1060 - 5,000,0005,000,000 - 10,000,00010,000,000 - 15,000,00015,000,000 - 20,000,00020,000,000 - 25,000,00025,000,000 - 27,531,85627,531,856 - 27,531,85627,531,856 - 27,531,85627,531,856 - 27,531,8560 - 134,525134,525 - 134,525134,525 - 134,525134,525 - 134,525134,525 - 134,525134,525 - 134,525134,525 - 134,525134,525 - 134,525134,525 - 134,5250 - 490,520490,520 - 490,520490,520 - 490,520490,520 - 490,520490,520 - 490,520490,520 - 490,520490,520 - 490,520490,520 - 490,520490,520 - 490,5200 - 633,585633,585 - 633,585633,585 - 633,585633,585 - 633,585633,585 - 633,585633,585 - 633,585633,585 - 633,585633,585 - 633,585633,585 - 633,5850 - 592,136592,136 - 592,136592,136 - 592,136592,136 - 592,136592,136 - 592,136592,136 - 592,136592,136 - 592,136592,136 - 592,136592,136 - 592,136 Chromosome image

If you know the start and/or end of your genomic region, please enter one or both coordinates here to go directly to our chromosome viewer. If you only enter one coordinate, we use a default size of 100 kb for the viewer.