About This Database    FAQs   Our Collaborators

Annotated species Brassica rapa Annotation built on BRAD 3 Total number of genes 48,068
Library type small RNA Total bp in genome 410,265,358 Protein coding 48,068
Total number of libraries 10 Total chrs or contigs 11 Transposon related 0

This site contains small RNA data generated using Illumina's SBS method. Some or all of the data on this page were generated by our lab and collaborators, including the Mosher lab at the University of Arizona. Other data were generated completely independently by other labs and were publicly available from Genbank or other sources.

Some data contributed by: Rebecca Mosher (Department of Plant Sciences, University of Cambridge).

Access to this web site and the data contained herein are provided for research purposes only. No commercial rights of any nature are granted.

Basic Queries

Please enter specific information to retrieve data.
Adjust libraries/reads to display on the control panel (optional).

Protein or gene ID
Bulk Query

e.g. BraA01g000010.3C
Cluster or coordinate ID
Bulk Query

e.g. BRASSICARAPA_BRAD3.1.2001.500 (cluster)   BRASSICARAPA_BRAD3.1.2001.4500 (coordinate)
Sequence of small RNA read
Bulk Query
e.g. CTAAACCCTAAACCCTAAACCCT
Keyword for genes/proteins or repeats

e.g. MIRNA  LTR

Query by Chromosome Position

Click on a region of any chromosome for which you would like to retrieve the map. Because of the size of chromosomes, clicking on the diagram below will take you to a second map where you can refine the position. Note that if the genome has a mix of both chromosomes and small contigs or scaffolds, we only show images for the defined chromosomes, and contigs must be accessed via their ID.

0 - 10,000,00010,000,000 - 20,000,00020,000,000 - 29,595,52729,595,527 - 29,595,52729,595,527 - 29,595,52729,595,527 - 29,595,52729,595,527 - 29,595,52729,595,527 - 29,595,5270 - 10,000,00010,000,000 - 20,000,00020,000,000 - 30,000,00030,000,000 - 31,442,97931,442,979 - 31,442,97931,442,979 - 31,442,97931,442,979 - 31,442,97931,442,979 - 31,442,9790 - 10,000,00010,000,000 - 20,000,00020,000,000 - 30,000,00030,000,000 - 38,154,16038,154,160 - 38,154,16038,154,160 - 38,154,16038,154,160 - 38,154,16038,154,160 - 38,154,1600 - 10,000,00010,000,000 - 20,000,00020,000,000 - 21,928,41621,928,416 - 21,928,41621,928,416 - 21,928,41621,928,416 - 21,928,41621,928,416 - 21,928,41621,928,416 - 21,928,4160 - 10,000,00010,000,000 - 20,000,00020,000,000 - 28,493,05628,493,056 - 28,493,05628,493,056 - 28,493,05628,493,056 - 28,493,05628,493,056 - 28,493,05628,493,056 - 28,493,0560 - 10,000,00010,000,000 - 20,000,00020,000,000 - 29,167,99229,167,992 - 29,167,99229,167,992 - 29,167,99229,167,992 - 29,167,99229,167,992 - 29,167,99229,167,992 - 29,167,9920 - 10,000,00010,000,000 - 20,000,00020,000,000 - 28,928,90228,928,902 - 28,928,90228,928,902 - 28,928,90228,928,902 - 28,928,90228,928,902 - 28,928,90228,928,902 - 28,928,9020 - 10,000,00010,000,000 - 20,000,00020,000,000 - 22,981,70222,981,702 - 22,981,70222,981,702 - 22,981,70222,981,702 - 22,981,70222,981,702 - 22,981,70222,981,702 - 22,981,7020 - 10,000,00010,000,000 - 20,000,00020,000,000 - 30,000,00030,000,000 - 40,000,00040,000,000 - 45,156,81045,156,810 - 45,156,81045,156,810 - 45,156,81045,156,810 - 45,156,8100 - 10,000,00010,000,000 - 20,000,00020,000,000 - 30,000,00030,000,000 - 40,000,00040,000,000 - 50,000,00050,000,000 - 60,000,00060,000,000 - 70,000,00070,000,000 - 77,304,8620 - 10,000,00010,000,000 - 20,000,00020,000,000 - 30,000,00030,000,000 - 40,000,00040,000,000 - 50,000,00050,000,000 - 57,110,95257,110,952 - 57,110,95257,110,952 - 57,110,952 Chromosome image

If you know the start and/or end of your genomic region, please enter one or both coordinates here to go directly to our chromosome viewer. If you only enter one coordinate, we use a default size of 100 kb for the viewer.