Soybean Small RNA miRNA Abundances

The data below are based on the microRNAs listed in the miRBase registry. Adjust libraries/reads to display on the control panel.

        

        miRNA         miRNA sequence Len Sum (norm) Average Max Min (>0)  dcl2_coat_rep1dcl2_coat_rep2dcl2_coat_rep3dcl2_leaf_rep1dcl2_leaf_rep2dcl2_leaf_rep3TL_coat_rep1TL_coat_rep2TL_coat_rep3TL_leaf_rep1TL_leaf_rep2TL_leaf_rep3
gma-miR10186a UUGGGAAUUAAAAUGUAAACUU 22 2 0 1 1    0 0 0 0 0 0 0 0 1 1 0 0
gma-miR10186b UUUUGGGAAUUAAAAUGUAAACUU 24 1 0 1 1    0 0 0 0 0 0 0 0 0 1 0 0
gma-miR10186c UUUUGGGAAUUAAAAUGUAAACUU 24 1 0 1 1    0 0 0 0 0 0 0 0 0 1 0 0
gma-miR10186d UUUUGGGAAUUAAAAUGUAAACUU 24 1 0 1 1    0 0 0 0 0 0 0 0 0 1 0 0
gma-miR10186e UUGGGAAUUAAAAUGUAAACUU 22 2 0 1 1    0 0 0 0 0 0 0 0 1 1 0 0
gma-miR10186f UUUUGGGAAUUAAAAUGUAAACUU 24 1 0 1 1    0 0 0 0 0 0 0 0 0 1 0 0
gma-miR10186g UUUUGGGAAUUAAAAUGUAAACUU 24 1 0 1 1    0 0 0 0 0 0 0 0 0 1 0 0
gma-miR10186h UUUUGGGAAUUAAAAUGUAAACUU 24 1 0 1 1    0 0 0 0 0 0 0 0 0 1 0 0
gma-miR10186i UUUUGGGAAUUAAAAUGUAAACUU 24 1 0 1 1    0 0 0 0 0 0 0 0 0 1 0 0
gma-miR10186j UUUUGGGAAUUAAAAUGUAAACUU 24 1 0 1 1    0 0 0 0 0 0 0 0 0 1 0 0
gma-miR10186k UUUUGGGAAUUAAAAUGUAAACUU 24 1 0 1 1    0 0 0 0 0 0 0 0 0 1 0 0
gma-miR10186l UUUUGGGAAUUAAAAUGUAAACUU 24 1 0 1 1    0 0 0 0 0 0 0 0 0 1 0 0
gma-miR10187 CGAGGAUAAUUGUUGGAACCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR10188 UCUCUGAUUUUGCAGAUAAGGACU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR10189 AAGAACACUAGAACCAUCUCC 21 1,627 136 449 4    7 4 10 322 178 202 13 6 10 449 184 242
gma-miR10190 UCCUGAUGACUAUUAUGAGCU 21 1,659 138 267 39    83 46 44 235 243 189 55 39 78 246 267 134
gma-miR10191 GGCGACUGCGGCUCCUCCGCCG 22 214 18 98 1    17 16 36 1 0 0 98 8 7 30 0 1
gma-miR10192 UAAACGUUUGAUCCCUUGUAU 21 29 2 7 3    0 0 0 7 3 5 0 0 0 7 3 4
gma-miR10193a UCUGAAACCGAUGUUAACUACU 22 2 0 1 1    0 0 0 0 0 0 0 0 1 1 0 0
gma-miR10193b UCUGAAACCGAUGUUAACUACU 22 2 0 1 1    0 0 0 0 0 0 0 0 1 1 0 0
gma-miR10193c UCUGAAACCGAUGUUAACUACU 22 2 0 1 1    0 0 0 0 0 0 0 0 1 1 0 0
gma-miR10193d UCUGAAACCGAUGUUAACUACU 22 2 0 1 1    0 0 0 0 0 0 0 0 1 1 0 0
gma-miR10193e UAAAAAAACCAAUGUUAACUGU 22 10 1 4 1    0 1 0 0 0 0 0 2 2 4 1 0
gma-miR10193f UAAAAAAACCAAUGUUAACUGU 22 10 1 4 1    0 1 0 0 0 0 0 2 2 4 1 0
gma-miR10194 UGUUGAAGGUGUGUAUGACAAG 22 17 1 7 1    0 0 0 0 0 0 7 6 3 1 0 0
gma-miR10195 UAUGAUUUUGUGGAUCAAAGGA 22 2 0 1 1    0 0 0 0 0 0 1 0 1 0 0 0
gma-miR10196 UGAUUGUGGGAGAGCAUUUCAU 22 2 0 2 2    0 0 0 0 0 0 2 0 0 0 0 0
gma-miR10197 AUUUUAGAACGACUUUUUCCU 21 485 40 178 1    0 0 0 44 21 40 0 1 0 178 104 97
gma-miR10198 AAGGAACUCGAAAUUCAUAGU 21 70 6 24 1    0 1 1 20 6 13 0 0 0 24 5 0
gma-miR10199 AGCAAUGUUGAGCUUGGGCCU 21 68 6 18 1    16 18 7 1 0 0 8 5 9 1 0 3
gma-miR10200 AGGUUUUAAAGAAAUUAAAUG 21 24 2 8 1    8 3 1 0 0 0 2 6 4 0 0 0
gma-miR10201 UACCGGUAGUAAAUGGAUGCCU 22 2 0 1 1    0 0 0 0 0 0 0 1 0 0 0 1
gma-miR10405a UUGUUUCUUAUAAAAAGGACC 21 4 0 4 4    0 0 0 0 0 0 0 0 0 4 0 0
gma-miR10405b UUGUUUCUUAUAAAAAGGACC 21 4 0 4 4    0 0 0 0 0 0 0 0 0 4 0 0
gma-miR10405c UUGUUUCUUAUAAAAAGGACC 21 4 0 4 4    0 0 0 0 0 0 0 0 0 4 0 0
gma-miR10405d UUGUUUCUUAUAAAAAGGACC 21 4 0 4 4    0 0 0 0 0 0 0 0 0 4 0 0
gma-miR10405e UUGUUUCUUAUAAAAAGGACC 21 4 0 4 4    0 0 0 0 0 0 0 0 0 4 0 0
gma-miR10406a CAGUCGAGUUAUUGUAUAAUUCAC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR10406b CAGUCGAGUUAUUGUAUAAUUCAC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR10407a AGUUAACGGAUGAAUGAAUUUGUC 24 24 2 5 1    1 2 5 3 2 1 2 1 2 4 0 1
gma-miR10407b AGUUAACGGAUGAAUGAAUUUGUC 24 24 2 5 1    1 2 5 3 2 1 2 1 2 4 0 1
gma-miR10407c UUAACAGUCGGAUAUAUUUAUCGC 24 1 0 1 1    0 0 0 0 0 0 0 1 0 0 0 0
gma-miR10407d UUAACGGCUGGAUAUAUUUGUUGC 24 84 7 16 2    4 4 4 4 16 5 2 3 9 10 15 8
gma-miR10408 CGAGGACUCCUUUAAAUAGACU 22 110 9 31 1    0 1 0 0 0 0 13 15 3 31 19 28
gma-miR10409 CCUCUGAAGAUAUUAAAAGCCU 22 5 0 2 1    0 0 0 0 0 0 0 2 1 1 1 0
gma-miR10410a UUUCCACAUCGUUGCUGACAUAAG 24 3 0 2 1    0 0 0 0 0 0 2 1 0 0 0 0
gma-miR10410b UUUCCACAUCGUUGCUGACAUAAG 24 3 0 2 1    0 0 0 0 0 0 2 1 0 0 0 0
gma-miR10410c UUUCCACAUCGUUGCUGACAUAAG 24 3 0 2 1    0 0 0 0 0 0 2 1 0 0 0 0
gma-miR10411 UAAUUUUAGACUGAUAUUUUGCCU 24 7 1 3 1    3 1 0 0 2 0 0 0 0 1 0 0
gma-miR10412 GAACGUUCUGGAGAACUCUAGAGU 24 12 1 4 1    0 3 4 1 0 0 4 0 0 0 0 0
gma-miR10413a UUUUGGUAGAGAACGAAACCCU 22 8 1 5 1    0 0 0 0 0 0 1 1 1 5 0 0
gma-miR10413b UUUUGGUAGAGAACGAAACCCU 22 8 1 5 1    0 0 0 0 0 0 1 1 1 5 0 0
gma-miR10414 UCUGAGAAGAACCAUUGGUACC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR10415 AUCUUAGAAUGUGAGUUUGGAUCU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR10416 AAGAUUUGACUGUUGGAACUGCCU 24 18 2 4 1    1 4 1 2 1 1 1 3 1 2 0 1
gma-miR10417 GAGGCUGUUUCCAGAUUUGAACCC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR10418 GAAGUAAUCCUAGGAACUCCCU 22 19 2 6 1    0 0 0 0 0 0 6 6 5 1 0 1
gma-miR10419 CAAAAAACACAUAUGAAACUG 21 1 0 1 1    0 0 0 1 0 0 0 0 0 0 0 0
gma-miR10420 CCUGAACCAUCAUUUUUUU 19 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR10421 CAGAAUGAGACCUUGAGCGUGG 22 97 8 38 1    2 0 0 1 0 0 20 38 19 12 2 3
gma-miR10422 UUCUGAUUAGAGAGCAACACC 21 3 0 1 1    0 0 0 1 0 0 0 0 0 1 1 0
gma-miR10423 AUGAAAGCACCAAAUUGAUAGGACU 25 21 2 7 1    1 3 1 0 3 2 2 7 1 1 0 0
gma-miR10424a UUUUCUAAUUUAUUAGGGACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR10424b UUUUCUAAUUUAUUAGGGACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR10424c UUUUCUAAUUUAUUAGGGACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR10424d UUUUCUAAUUUAUUAGGGACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR10425 UUACAACCGUCUUUGAAAUCGCCU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR10426 UAGAAAAGAAUCAAUGUAGAAAGU 24 2 0 1 1    0 1 0 0 1 0 0 0 0 0 0 0
gma-miR10427a AAGAGAAUUGGGCUAGAGCUGC 22 287 24 148 1    3 0 2 1 2 0 46 148 52 15 9 9
gma-miR10427b CAAGAGAAUUGGGCUAGAGCUG 22 176 15 67 2    0 2 0 0 0 0 31 67 44 7 8 17
gma-miR10428 UGAGGACAAAACACGUUGAAAAGU 24 40 3 11 1    5 5 6 0 0 0 5 11 6 1 0 1
gma-miR10429 UGAGGACAAAACAUGUUGAAAAGU 24 13 1 4 1    0 1 0 1 0 1 2 4 3 0 0 1
gma-miR10430 UCGGUCUGACCUUUUUAAAAGCCU 24 8 1 2 1    1 0 2 1 1 0 0 0 0 1 2 0
gma-miR10431 UUAGAAUAAACAUGUGUAGAAAUU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR10432 UUUUCCAGAUCAUAUCGCCGGUUC 24 25 2 10 1    3 6 0 1 0 0 2 10 3 0 0 0
gma-miR10433 CUGCGGAUCAAGUUGAUUGUUACG 24 63 5 17 1    0 1 0 1 1 0 3 17 14 4 9 13
gma-miR10434 CUACUGAUUAUAUAUCUGAUACCAG 25 5 0 2 1    0 1 0 0 0 0 0 0 2 2 0 0
gma-miR10435 UUCCAUUUCAACGUCGGGUUAGAA 24 26 2 4 1    2 2 3 2 3 3 1 1 1 4 0 4
gma-miR10436 UCUUGGCAACACAACUUUUAACAU 24 12 1 4 1    0 1 2 1 1 1 0 1 0 1 0 4
gma-miR10437 UAUUGUUCAAACAUAUACUGUU 22 1 0 1 1    0 0 0 0 0 0 0 1 0 0 0 0
gma-miR10438 UUGGACUAAGGUUUUUUGGCAC 22 39 3 18 1    0 0 0 0 0 0 2 1 1 18 11 6
gma-miR10439 CAGACAGAUAAUGCUAGAGCC 21 72 6 22 1    0 2 2 6 1 1 5 22 12 11 1 9
gma-miR10440 UUGGGACAAUACUUUAGAUAU 21 15,764 1,314 2,159 426    1,347 1,707 1,762 982 785 678 2,052 2,159 1,937 1,002 927 426
gma-miR10441 CAACCCUGAGAACAAUGAAAUCGU 24 11 1 3 1    3 2 2 0 0 0 1 0 2 1 0 0
gma-miR10442 CUACAUGCUGCACUUGGAUCC 21 2,523 210 617 56    164 152 74 338 213 251 59 56 69 617 388 142
gma-miR10443 UCGACUGAGAACAACAUAAUUCAU 24 15 1 4 1    4 3 2 1 0 2 2 0 1 0 0 0
gma-miR10444 GACAUACAUGUGAGUUCGGAUGUA 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR10445 AAGGACCAAAUUUAUGAAUUAAAU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR10446 UCAACUCAAGUCGAGCUCAAGCCU 24 6 1 2 1    0 0 0 0 1 0 0 2 1 1 1 0
gma-miR10447 UGUUUCCAUGUUGUUGAGUGAC 22 1 0 1 1    0 1 0 0 0 0 0 0 0 0 0 0
gma-miR10448 UUAGGCUUUGUGGGACGUGAUU 22 1,712 143 355 1    2 0 1 1 0 0 288 314 355 215 280 256
gma-miR1446 UUCUGAACUCUCUCCCUCAAU 21 7 1 3 1    0 0 0 3 0 0 0 0 0 1 0 3
gma-miR1507a UCUCAUUCCAUACAUCGUCUGA 22 303,394 25,283 77,819 1,450    1,707 2,568 3,120 39,456 40,277 40,720 1,450 2,389 1,603 53,584 38,701 77,819
gma-miR1507b UCUCAUUCCAUACAUCGUCUG 21 51,809 4,317 13,318 197    351 393 864 4,329 10,430 7,911 414 197 329 5,683 7,590 13,318
gma-miR1507c-3p CCUCAUUCCAAACAUCAUCU 20 158 13 28 2    2 2 6 22 19 21 2 6 5 21 24 28
gma-miR1507c-5p GAGGUGUUUGGGAUGAGAGAA 21 2,903 242 494 75    102 199 323 75 188 153 494 399 309 205 332 124
gma-miR1508a UCUAGAAAGGGAAAUAGCAGUUG 23 46 4 24 1    0 0 0 24 1 4 1 0 0 11 1 4
gma-miR1508b UAGAAAGGGAAAUAGCAGUUG 21 617,103 51,425 136,343 2,415    6,458 7,040 3,320 112,770 63,744 64,021 2,415 9,265 4,764 136,343 84,145 122,818
gma-miR1508c UAGAAAGGGAAAUAGCAGUUG 21 617,103 51,425 136,343 2,415    6,458 7,040 3,320 112,770 63,744 64,021 2,415 9,265 4,764 136,343 84,145 122,818
gma-miR1509a UUAAUCAAGGAAAUCACGGUCG 22 224,727 18,727 52,624 5,285    10,209 12,741 7,706 31,299 16,868 13,405 5,285 21,011 8,219 31,431 13,929 52,624
gma-miR1509b UUAAUCAAGGAAAUCACGGUU 21 1,596 133 346 43    72 43 54 138 175 346 74 79 58 234 182 141
gma-miR1510a-3p UUGUUGUUUUACCUAUUCCACCC 23 55 5 12 1    2 1 0 8 12 7 1 2 2 10 6 4
gma-miR1510a-5p AGGGAUAGGUAAAACAAUGACUGC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1510b-3p UGUUGUUUUACCUAUUCCACC 21 272,762 22,730 38,698 10,017    10,901 11,108 11,699 33,329 38,698 29,700 11,466 12,761 10,017 35,924 31,016 36,143
gma-miR1510b-5p AGGGAUAGGUAAAACAACUACU 22 9,398 783 2,286 247    427 273 283 895 751 425 765 2,286 1,113 1,370 563 247
gma-miR1511 AACCAGGCUCUGAUACCAUG 20 17,003 1,417 3,713 331    1,067 827 500 1,211 1,740 1,247 747 331 418 3,713 2,866 2,336
gma-miR1512a-3p GCUUUAAGAAUUUCAGUUAUG 21 1,335 111 291 1    285 169 102 1 2 1 291 222 216 12 8 26
gma-miR1512a-5p UAACUGAAAAUUCUUAAAGUAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1512b UAACUGGAAAUUCUUAAAGCAU 22 38 3 14 1    2 2 0 1 2 2 2 6 1 14 5 1
gma-miR1512c UAACUGAACAUUCUUAGAGCAU 22 2,417 201 847 188    503 264 188 0 0 0 241 847 374 0 0 0
gma-miR1513a-3p UUUAAAUGUGUAUAAGUCAUGGU 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1513a-5p UGAGAGAAAGCCAUGACUUAC 21 48,798 4,067 9,188 851    1,010 999 851 6,016 5,637 6,912 948 1,060 954 9,188 6,371 8,852
gma-miR1513b UGAGAGAAAGCCAUGACUUAC 21 48,798 4,067 9,188 851    1,010 999 851 6,016 5,637 6,912 948 1,060 954 9,188 6,371 8,852
gma-miR1513c UAUGAGAGAAAGCCAUGAC 19 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1514a-3p AUGCCUAUUUUAAAAUGAAAA 21 1,136 95 319 11    37 25 12 223 188 116 16 21 11 319 84 84
gma-miR1514a-5p UUCAUUUUUAAAAUAGGCAUU 21 1,263 105 310 2    6 7 2 117 267 310 8 6 2 180 211 147
gma-miR1514b-3p AUGCCUAUUUUAAAAUGAAAA 21 1,136 95 319 11    37 25 12 223 188 116 16 21 11 319 84 84
gma-miR1514b-5p UUCAUUUUUAAAAUAGACAUU 21 28 2 10 2    0 0 0 9 3 0 0 0 0 10 2 4
gma-miR1515a UCAUUUUGCGUGCAAUGAUCUG 22 8,392 699 1,988 44    161 208 85 1,305 1,091 780 44 180 83 1,988 971 1,496
gma-miR1515b UCAUUUUGCGUGCAAUGAUCUG 22 8,392 699 1,988 44    161 208 85 1,305 1,091 780 44 180 83 1,988 971 1,496
gma-miR1516a-3p CAAAAGAGCUUAUGGCUUGUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1516a-5p CAAGUUAUAAGCUCUUUUGAGAG 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1516b AGCUUCUCUACAGAAAAUAUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1516c AAUGUCUGGGCUUAGCGAGGCGGU 24 2 0 1 1    0 0 0 0 0 1 1 0 0 0 0 0
gma-miR1516d GUACUUGUGGCUUGUAUCCAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1517 AGUCUUGGUCAAUGUCGUUCGAAA 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1518 UGUGUUGUAAAGUGAAUAUCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1519 UAAGUGUUGCAAAAUAGUCAUU 22 4 0 3 1    0 0 0 0 0 0 1 0 0 0 0 3
gma-miR1520a UAGAACAUGAUACAUGACAGUCA 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1520b GUGACAGUCAUCAUUUAAUAAGA 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1520c UUCAAUAAGAACGUGACACGUGA 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1520d AUCAGAACAUGACACGUGACAA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1520e CAAUAAGAACGUGACAUAUGACAG 24 15 1 4 1    2 3 0 1 0 0 2 3 4 0 0 0
gma-miR1520f-3p CAAUCAGAACAUGACACAUGACAA 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1520f-5p AUUGUCACGUGUCAUGUUCUGAUU 24 724 60 137 9    20 18 13 57 137 110 9 17 10 97 111 125
gma-miR1520g CAAUCAGAACAUGACACGUGACAA 24 5 0 2 1    0 0 0 0 0 0 2 0 2 1 0 0
gma-miR1520h AACGUCCAAUCAGAACGUGACAUG 24 1 0 1 1    0 0 0 0 0 0 1 0 0 0 0 0
gma-miR1520i AACGUGACACGUGACGGUCAACAU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1520j AAGAACGUGACACAUGACAAUCAA 24 15 1 4 1    3 2 3 1 0 0 1 4 0 0 1 0
gma-miR1520k AAUCAGAACAUGACACAUGACAGU 24 58 5 10 1    9 10 5 2 2 1 9 8 8 2 2 0
gma-miR1520l AAUCAGAACAUGACACGUGAUAGU 24 221 18 37 5    32 34 23 10 8 6 26 37 25 9 6 5
gma-miR1520m AAUCAGAACAUGACAUGUGACAAU 24 14 1 4 1    1 4 4 0 0 0 1 1 2 1 0 0
gma-miR1520n UCAAUCAGAACAUGACACGUGACA 24 5 0 1 1    1 0 0 1 0 0 1 0 0 1 1 0
gma-miR1520o UCAUCGUCCAAUCAGAAUGUGACA 24 2 0 1 1    0 0 0 0 0 0 1 0 0 1 0 0
gma-miR1520p AUGUUGUUAUUGGAUGAUGACGGU 24 1 0 1 1    0 0 0 0 0 0 0 0 0 1 0 0
gma-miR1520q AUUGACCAAUCAGAACAUGACACA 24 4 0 1 1    0 1 1 0 0 0 0 1 0 1 0 0
gma-miR1520r UGUCACAUCCUGGUUGGACAUGAA 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1521a CUGUUAAUGGAAAAUGUUGA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1521b GACUGUCACGUGUCAUAAUCAUA 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1522 UUUAUUGCUUAAAAUGAAAU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1523a AUGGGAUAAAUGUGAGCUCA 20 9 1 3 1    3 1 0 0 1 2 1 0 0 1 0 0
gma-miR1523b UCAUCGCUCCUGAGCUCACA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1524 CGAGUCCGAGGAAGGAACUCC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1525 UGGGUUAAUUAAGUUUUUAGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1526 CCGGAAGAGGAAAAUUAAGCAA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1527 UAACUCAACCUUACAAAACC 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1528 AUAGAUUAGAUCAAUAUAUUAGU 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1529 UUAAAGGAAACAAUUAAUCGUUA 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1530 UUUUCACAUAAAUUAAAAUAU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1531-3p UCGUCCAUAUGGGAAGACUUGUC 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1531-5p AUAUGGACGAAGAGAUAGGUAAAU 24 97 8 33 3    0 0 0 0 0 0 29 33 32 0 3 0
gma-miR1532 AACACGCUAAGCGAGAGGAGCUC 23 25 2 5 1    4 5 2 0 0 0 4 5 4 0 0 1
gma-miR1533 AUAAUAAAAAUAAUAAUGA 19 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1534 UAUUUUGGGUAAAUAGUCAU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1535a CUUGUUUGUGGUGAUGUCU 19 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1535b CUUGUUUGUGGUGAUGUCUAG 21 5,629 469 1,464 4    15 18 11 1,049 437 836 6 6 4 1,066 717 1,464
gma-miR1536 AAGCAGAGACAAAUGUGUUUA 21 3 0 2 1    0 0 0 1 0 0 0 0 0 2 0 0
gma-miR156a UGACAGAAGAGAGUGAGCAC 20 155,668 12,972 28,973 533    547 1,356 533 23,536 19,708 19,350 1,056 7,444 1,782 27,128 24,255 28,973
gma-miR156aa AUUGGAGUGAAGGGAGCU 18 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR156ab AUUUAAGUGAUGGGAGCUCCG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR156b UGACAGAAGAGAGAGAGCACA 21 9 1 4 1    0 0 0 0 0 1 2 4 2 0 0 0
gma-miR156c UUGACAGAAGAUAGAGAGCAC 21 68,877 5,740 15,182 201    201 1,556 1,197 10,922 8,189 6,901 1,108 4,876 1,989 10,273 6,483 15,182
gma-miR156d UUGACAGAAGAUAGAGAGCAC 21 68,877 5,740 15,182 201    201 1,556 1,197 10,922 8,189 6,901 1,108 4,876 1,989 10,273 6,483 15,182
gma-miR156e CUGACAGAAGAUAGAGAGCAC 21 88 7 41 1    0 1 0 35 1 1 0 1 0 41 2 6
gma-miR156f UUGACAGAAGAGAGAGAGCACA 22 37 3 13 1    1 4 3 0 0 0 6 13 10 0 0 0
gma-miR156g ACAGAAGAUAGAGAGCACAG 20 3,464 289 725 7    7 93 68 725 346 337 75 232 132 458 430 561
gma-miR156h UGACAGAAGAGAGUGAGCAC 20 155,668 12,972 28,973 533    547 1,356 533 23,536 19,708 19,350 1,056 7,444 1,782 27,128 24,255 28,973
gma-miR156i UUGACAGAAGAUAGAGAGCAC 21 68,877 5,740 15,182 201    201 1,556 1,197 10,922 8,189 6,901 1,108 4,876 1,989 10,273 6,483 15,182
gma-miR156j UUGACAGAAGAUAGAGAGCAC 21 68,877 5,740 15,182 201    201 1,556 1,197 10,922 8,189 6,901 1,108 4,876 1,989 10,273 6,483 15,182
gma-miR156k UUGACAGAAGAGAGUGAGCAC 21 3,538 295 749 1    3 11 1 667 445 447 2 31 6 647 529 749
gma-miR156l UUGACAGAAGAUAGAGAGCAC 21 68,877 5,740 15,182 201    201 1,556 1,197 10,922 8,189 6,901 1,108 4,876 1,989 10,273 6,483 15,182
gma-miR156m UUGACAGAAGAUAGAGAGCAC 21 68,877 5,740 15,182 201    201 1,556 1,197 10,922 8,189 6,901 1,108 4,876 1,989 10,273 6,483 15,182
gma-miR156n UUGACAGAAGAGAGUGAGCAC 21 3,538 295 749 1    3 11 1 667 445 447 2 31 6 647 529 749
gma-miR156o UUGACAGAAGAGAGUGAGCAC 21 3,538 295 749 1    3 11 1 667 445 447 2 31 6 647 529 749
gma-miR156p UUGACAGAAGAAAGGGAGCAC 21 5,671 473 2,110 1    480 1,091 822 8 5 1 568 2,110 555 18 7 6
gma-miR156q UGACAGAAGAGAGUGAGCACU 21 7,209 601 2,151 252    298 650 387 252 316 355 698 2,151 1,048 342 349 363
gma-miR156r CUGACAGAAGAUAGAGAGCAU 21 1 0 1 1    0 0 0 0 0 0 0 0 0 1 0 0
gma-miR156s UGACAGAAGAGAGUGAGCACU 21 7,209 601 2,151 252    298 650 387 252 316 355 698 2,151 1,048 342 349 363
gma-miR156t UUGACAGAAGAAAGGGAGCAC 21 5,671 473 2,110 1    480 1,091 822 8 5 1 568 2,110 555 18 7 6
gma-miR156u UGACAGAAGAGAGUGAGCAC 20 155,668 12,972 28,973 533    547 1,356 533 23,536 19,708 19,350 1,056 7,444 1,782 27,128 24,255 28,973
gma-miR156v UGACAGAAGAGAGUGAGCAC 20 155,668 12,972 28,973 533    547 1,356 533 23,536 19,708 19,350 1,056 7,444 1,782 27,128 24,255 28,973
gma-miR156w UGACAGAAGAGAGUGAGCAC 20 155,668 12,972 28,973 533    547 1,356 533 23,536 19,708 19,350 1,056 7,444 1,782 27,128 24,255 28,973
gma-miR156x UGACAGAAGAGAGUGAGCAC 20 155,668 12,972 28,973 533    547 1,356 533 23,536 19,708 19,350 1,056 7,444 1,782 27,128 24,255 28,973
gma-miR156y UGACAGAAGAGAGUGAGCAC 20 155,668 12,972 28,973 533    547 1,356 533 23,536 19,708 19,350 1,056 7,444 1,782 27,128 24,255 28,973
gma-miR156z AUUGGAGUGAAGGGAGCU 18 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR159a-3p UUUGGAUUGAAGGGAGCUCUA 21 3,439,196 286,600 547,794 70,338    111,035 115,788 92,077 382,568 376,056 505,003 71,899 106,816 70,338 544,435 515,387 547,794
gma-miR159a-5p GAGCUCCUUGAAGUCCAAUUG 21 56,993 4,749 10,718 1,296    2,429 2,202 2,736 5,165 6,297 4,617 6,594 1,296 1,588 7,465 5,886 10,718
gma-miR159b-3p AUUGGAGUGAAGGGAGCUCCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR159b-5p GAGUUCCCUGCACUCCAAGUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR159c AUUGGAGUGAAGGGAGCUCCG 21 2 0 2 2    0 0 0 0 0 0 0 2 0 0 0 0
gma-miR159d AGCUGCUUAGCUAUGGAUCCC 21 8,038 670 2,205 105    132 162 137 166 1,285 637 105 344 148 2,205 1,016 1,701
gma-miR159e-3p UUUGGAUUGAAGGGAGCUCUA 21 3,439,196 286,600 547,794 70,338    111,035 115,788 92,077 382,568 376,056 505,003 71,899 106,816 70,338 544,435 515,387 547,794
gma-miR159e-5p GAGCUCCUUGAAGUCCAAUU 20 10,814 901 1,776 228    425 333 228 1,180 1,231 1,185 696 761 322 1,776 1,185 1,492
gma-miR159f-3p AUUGGAGUGAAGGGAGCUCCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR159f-5p GAGUUCCCUGCACUCCAAGUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR160a-3p GCGUAUGAGGAGCCAAGCAUA 21 2,262 189 619 23    23 34 29 235 238 619 54 111 40 270 205 404
gma-miR160a-5p UGCCUGGCUCCCUGUAUGCCA 21 210,782 17,565 63,556 1,033    8,510 1,867 4,895 1,033 63,556 7,535 6,984 3,098 3,482 25,126 43,524 41,172
gma-miR160b UGCCUGGCUCCCUGUAUGCC 20 3,331 278 966 43    65 51 58 45 966 272 78 43 51 357 704 641
gma-miR160c UGCCUGGCUCCCUGUAUGCC 20 3,331 278 966 43    65 51 58 45 966 272 78 43 51 357 704 641
gma-miR160d UGCCUGGCUCCCUGUAUGCC 20 3,331 278 966 43    65 51 58 45 966 272 78 43 51 357 704 641
gma-miR160e UGCCUGGCUCCCUGUAUGCC 20 3,331 278 966 43    65 51 58 45 966 272 78 43 51 357 704 641
gma-miR160f UGCCUGGCUCCCUGUAUGCCA 21 210,782 17,565 63,556 1,033    8,510 1,867 4,895 1,033 63,556 7,535 6,984 3,098 3,482 25,126 43,524 41,172
gma-miR162a UCGAUAAACCUCUGCAUCCA 20 665 55 155 2    7 0 4 105 93 140 7 5 2 155 88 59
gma-miR162b UCGAUAAACCUCUGCAUCCAG 21 118,700 9,892 32,406 658    793 658 1,482 21,094 15,661 10,028 1,811 712 1,027 32,406 15,991 17,037
gma-miR162c UCGAUAAACCUCUGCAUCCAG 21 118,700 9,892 32,406 658    793 658 1,482 21,094 15,661 10,028 1,811 712 1,027 32,406 15,991 17,037
gma-miR164a UGGAGAAGCAGGGCACGUGCA 21 1,069,757 89,146 204,782 2,087    204,782 159,590 112,952 11,081 23,984 2,087 193,908 129,929 145,034 21,255 30,339 34,816
gma-miR164b UGGAGAAGCAGGGCACGUGC 20 16,053 1,338 2,804 95    2,443 2,526 1,273 186 557 95 2,804 2,567 1,781 283 678 860
gma-miR164c UGGAGAAGCAGGGCACGUGC 20 16,053 1,338 2,804 95    2,443 2,526 1,273 186 557 95 2,804 2,567 1,781 283 678 860
gma-miR164d UGGAGAAGCAGGGCACGUGC 20 16,053 1,338 2,804 95    2,443 2,526 1,273 186 557 95 2,804 2,567 1,781 283 678 860
gma-miR164e UGGAGAAGCAGGGCACGUGCA 21 1,069,757 89,146 204,782 2,087    204,782 159,590 112,952 11,081 23,984 2,087 193,908 129,929 145,034 21,255 30,339 34,816
gma-miR164f UGGAGAAGCAGGGCACGUGCA 21 1,069,757 89,146 204,782 2,087    204,782 159,590 112,952 11,081 23,984 2,087 193,908 129,929 145,034 21,255 30,339 34,816
gma-miR164g UGGAGAAGCAGGGCACGUGCA 21 1,069,757 89,146 204,782 2,087    204,782 159,590 112,952 11,081 23,984 2,087 193,908 129,929 145,034 21,255 30,339 34,816
gma-miR164h UGGAGAAGCAGGGCACGUGCA 21 1,069,757 89,146 204,782 2,087    204,782 159,590 112,952 11,081 23,984 2,087 193,908 129,929 145,034 21,255 30,339 34,816
gma-miR164i UGGAGAAGCAGGGCACGUGCA 21 1,069,757 89,146 204,782 2,087    204,782 159,590 112,952 11,081 23,984 2,087 193,908 129,929 145,034 21,255 30,339 34,816
gma-miR164j UGGAGAAGCAGGGCACGUGCA 21 1,069,757 89,146 204,782 2,087    204,782 159,590 112,952 11,081 23,984 2,087 193,908 129,929 145,034 21,255 30,339 34,816
gma-miR164k UGGAGAAGCAGGGCACGUGCA 21 1,069,757 89,146 204,782 2,087    204,782 159,590 112,952 11,081 23,984 2,087 193,908 129,929 145,034 21,255 30,339 34,816
gma-miR166a-3p UCGGACCAGGCUUCAUUCCCC 21 9,755,255 812,938 1,483,136 114,365    999,308 863,159 582,490 529,126 1,145,564 1,483,136 360,420 114,365 335,432 656,136 1,467,797 1,218,322
gma-miR166a-5p GGAAUGUUGUCUGGCUCGAGG 21 566,698 47,225 142,803 19,029    45,474 34,554 142,803 24,153 24,706 53,000 65,106 43,402 30,698 25,315 19,029 58,458
gma-miR166b UCGGACCAGGCUUCAUUCCCC 21 9,755,255 812,938 1,483,136 114,365    999,308 863,159 582,490 529,126 1,145,564 1,483,136 360,420 114,365 335,432 656,136 1,467,797 1,218,322
gma-miR166c-3p UCGGACCAGGCUUCAUUCCCC 21 9,755,255 812,938 1,483,136 114,365    999,308 863,159 582,490 529,126 1,145,564 1,483,136 360,420 114,365 335,432 656,136 1,467,797 1,218,322
gma-miR166c-5p GGAAUGUUGUCUGGCUCGAGG 21 566,698 47,225 142,803 19,029    45,474 34,554 142,803 24,153 24,706 53,000 65,106 43,402 30,698 25,315 19,029 58,458
gma-miR166d UCGGACCAGGCUUCAUUCCCC 21 9,755,255 812,938 1,483,136 114,365    999,308 863,159 582,490 529,126 1,145,564 1,483,136 360,420 114,365 335,432 656,136 1,467,797 1,218,322
gma-miR166e UCGGACCAGGCUUCAUUCCCC 21 9,755,255 812,938 1,483,136 114,365    999,308 863,159 582,490 529,126 1,145,564 1,483,136 360,420 114,365 335,432 656,136 1,467,797 1,218,322
gma-miR166f UCGGACCAGGCUUCAUUCCCC 21 9,755,255 812,938 1,483,136 114,365    999,308 863,159 582,490 529,126 1,145,564 1,483,136 360,420 114,365 335,432 656,136 1,467,797 1,218,322
gma-miR166g UCGGACCAGGCUUCAUUCCCC 21 9,755,255 812,938 1,483,136 114,365    999,308 863,159 582,490 529,126 1,145,564 1,483,136 360,420 114,365 335,432 656,136 1,467,797 1,218,322
gma-miR166h-3p UCUCGGACCAGGCUUCAUUCC 21 114,621 9,552 15,952 2,293    8,623 5,351 8,669 11,765 12,764 12,652 5,428 2,293 5,884 15,026 10,214 15,952
gma-miR166h-5p GGAAUGUUGUUUGGCUCGAGG 21 10,343 862 2,593 99    116 108 236 1,384 1,191 1,966 280 173 99 1,199 998 2,593
gma-miR166i-3p UCGGACCAGGCUUCAUUCCCC 21 9,755,255 812,938 1,483,136 114,365    999,308 863,159 582,490 529,126 1,145,564 1,483,136 360,420 114,365 335,432 656,136 1,467,797 1,218,322
gma-miR166i-5p GGAAUGUCGUCUGGUUCGAG 20 708 59 141 84    0 0 0 127 100 118 0 0 0 84 138 141
gma-miR166j-3p UCGGACCAGGCUUCAUUCCCG 21 544,249 45,354 107,457 209    1,286 851 1,089 71,824 82,674 97,583 997 209 551 88,993 90,735 107,457
gma-miR166j-5p GGAAUGUUGUUUGGCUCGAGG 21 10,343 862 2,593 99    116 108 236 1,384 1,191 1,966 280 173 99 1,199 998 2,593
gma-miR166k UCUCGGACCAGGCUUCAUUCC 21 114,621 9,552 15,952 2,293    8,623 5,351 8,669 11,765 12,764 12,652 5,428 2,293 5,884 15,026 10,214 15,952
gma-miR166l GGAAUGUUGUCUGGCUCGAGG 21 566,698 47,225 142,803 19,029    45,474 34,554 142,803 24,153 24,706 53,000 65,106 43,402 30,698 25,315 19,029 58,458
gma-miR166m CGGACCAGGCUUCAUUCCCC 20 29,418 2,452 4,248 868    4,248 2,677 1,663 1,588 3,282 2,764 2,428 868 1,261 2,081 3,500 3,058
gma-miR166n UCGGACCAGGCUUCAUUCCCC 21 9,755,255 812,938 1,483,136 114,365    999,308 863,159 582,490 529,126 1,145,564 1,483,136 360,420 114,365 335,432 656,136 1,467,797 1,218,322
gma-miR166o UCGGACCAGGCUUCAUUCCCC 21 9,755,255 812,938 1,483,136 114,365    999,308 863,159 582,490 529,126 1,145,564 1,483,136 360,420 114,365 335,432 656,136 1,467,797 1,218,322
gma-miR166p UCGGACCAGGCUUCAUUCCC 20 54,545 4,545 16,539 524    2,886 2,291 1,972 3,591 6,626 16,539 1,510 524 1,051 4,129 6,449 6,977
gma-miR166q UCGGACCAGGCUUCAUUCCC 20 54,545 4,545 16,539 524    2,886 2,291 1,972 3,591 6,626 16,539 1,510 524 1,051 4,129 6,449 6,977
gma-miR166r UCGGACCAGGCUUCAUUCCC 20 54,545 4,545 16,539 524    2,886 2,291 1,972 3,591 6,626 16,539 1,510 524 1,051 4,129 6,449 6,977
gma-miR166s UCGGACCAGGCUUCAUUCCC 20 54,545 4,545 16,539 524    2,886 2,291 1,972 3,591 6,626 16,539 1,510 524 1,051 4,129 6,449 6,977
gma-miR166t UCGGACCAGGCUUCAUUCCC 20 54,545 4,545 16,539 524    2,886 2,291 1,972 3,591 6,626 16,539 1,510 524 1,051 4,129 6,449 6,977
gma-miR166u UCUCGGACCAGGCUUCAUUC 20 3,196 266 623 22    83 43 58 336 495 623 66 22 64 432 475 499
gma-miR167a UGAAGCUGCCAGCAUGAUCUA 21 18,326 1,527 3,759 164    179 204 164 2,000 2,252 2,139 285 194 256 3,178 3,716 3,759
gma-miR167b UGAAGCUGCCAGCAUGAUCUA 21 18,326 1,527 3,759 164    179 204 164 2,000 2,252 2,139 285 194 256 3,178 3,716 3,759
gma-miR167c UGAAGCUGCCAGCAUGAUCUG 21 6,716,688 559,724 1,544,044 12,879    26,542 23,980 30,446 733,256 1,136,864 923,079 18,629 12,879 20,724 1,176,780 1,069,465 1,544,044
gma-miR167d UGAAGCUGCCAGCAUGAUCUA 21 18,326 1,527 3,759 164    179 204 164 2,000 2,252 2,139 285 194 256 3,178 3,716 3,759
gma-miR167e UGAAGCUGCCAGCAUGAUCUU 21 737,470 61,456 217,894 4,580    96,581 112,593 79,626 11,826 7,204 4,580 80,038 217,894 89,559 14,400 9,966 13,203
gma-miR167f UGAAGCUGCCAGCAUGAUCUU 21 737,470 61,456 217,894 4,580    96,581 112,593 79,626 11,826 7,204 4,580 80,038 217,894 89,559 14,400 9,966 13,203
gma-miR167g UGAAGCUGCCAGCAUGAUCUGA 22 8,247 687 1,994 21    31 30 32 772 1,331 1,994 21 31 33 1,190 1,184 1,598
gma-miR167h AUCAUGCUGGCAGCUUCAACUGGU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR167i UCAUGCUGGCAGCUUCAACUGGU 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR167j UGAAGCUGCCAGCAUGAUCUG 21 6,716,688 559,724 1,544,044 12,879    26,542 23,980 30,446 733,256 1,136,864 923,079 18,629 12,879 20,724 1,176,780 1,069,465 1,544,044
gma-miR167k UGAAGCUGCCAGCCUGAUCUUA 22 32 3 6 2    2 4 3 0 6 3 5 2 2 0 5 0
gma-miR167l UGAAGCUGCCAGCAUGAUCU 20 117,892 9,824 18,492 4,198    6,331 4,583 4,198 6,885 17,236 17,303 4,816 7,546 4,456 9,363 16,683 18,492
gma-miR168a UCGCUUGGUGCAGGUCGGGAA 21 1,816,878 151,407 244,176 74,419    164,539 125,784 154,559 74,419 215,146 127,850 158,666 92,856 137,611 148,419 172,853 244,176
gma-miR168b UCGCUUGGUGCAGGUCGGG 19 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR169a CAGCCAAGGAUGACUUGCCGG 21 13,852 1,154 6,383 89    164 89 93 2,142 1,100 1,043 195 206 107 6,383 921 1,409
gma-miR169b CAGCCAAGGAUGACUUGCCGA 21 2,478 207 570 59    465 141 100 161 126 77 160 291 241 570 59 87
gma-miR169c AAGCCAAGGAUGACUUGCCGA 21 933 78 519 6    26 7 6 154 55 31 16 54 9 519 24 32
gma-miR169d UGAGCCAAGGAUGACUUGCCGGU 23 786 66 184 1    14 12 1 181 126 6 9 29 4 124 184 96
gma-miR169e AGCCAAGGAUGACUUGCCGG 20 1,154 96 559 8    10 8 12 186 105 37 25 30 13 559 63 106
gma-miR169f CAGCCAAGGAUGACUUGCCGG 21 13,852 1,154 6,383 89    164 89 93 2,142 1,100 1,043 195 206 107 6,383 921 1,409
gma-miR169g CAGCCAAGGAUGACUUGCCGG 21 13,852 1,154 6,383 89    164 89 93 2,142 1,100 1,043 195 206 107 6,383 921 1,409
gma-miR169h GGCGAGACAUCUUGGCUCAUU 21 43 4 19 1    1 19 6 0 1 0 0 5 1 9 0 1
gma-miR169i-3p CCGGUGCCAUCCCGUCUCAUA 21 1,277 106 275 17    247 120 39 54 26 28 275 259 91 70 17 51
gma-miR169i-5p UGAGCCGGGAUGGCUUGCCGGCA 23 220 18 36 5    19 5 9 0 13 10 31 35 23 36 16 23
gma-miR169j-3p UUUCGACGAGUUGUUCUUGGC 21 1,214 101 322 1    4 4 4 143 138 138 6 5 1 281 168 322
gma-miR169j-5p UAGCCAAGAAUGACUUGCCGG 21 874 73 260 11    37 22 12 120 65 71 72 50 11 260 88 66
gma-miR169k CAGCCAAGAAUGACUUGCCGG 21 813 68 236 3    34 13 3 124 71 79 59 52 6 236 63 73
gma-miR169l-3p CGGGCAAGUUGUUUUUGGCUAC 22 27 2 7 1    0 0 0 6 2 7 0 0 0 6 1 5
gma-miR169l-5p CAGCCAAGAAUGACUUGCCGG 21 813 68 236 3    34 13 3 124 71 79 59 52 6 236 63 73
gma-miR169m CAGCCAAGGAUGACUUGCCGG 21 13,852 1,154 6,383 89    164 89 93 2,142 1,100 1,043 195 206 107 6,383 921 1,409
gma-miR169n-3p UGCCGGCAAGUUUCUCUUGGC 21 504 42 128 57    0 0 0 89 57 103 0 0 0 128 62 65
gma-miR169n-5p CAGCCAAGGGUGAUUUGCCGG 21 15,384 1,282 4,627 1    4 1 2 1,645 3,289 954 7 2 5 2,760 2,088 4,627
gma-miR169o UGAGCCAGGAUGGCUUGCCGGC 22 2,164 180 522 3    24 7 3 286 259 221 11 39 4 522 300 488
gma-miR169p UGAGCCAAGGAUGACUUGCCG 21 80 7 39 2    2 0 0 11 10 3 0 0 0 39 7 8
gma-miR169r UGAGCCAGGAUGGCUUGCCGGC 22 2,164 180 522 3    24 7 3 286 259 221 11 39 4 522 300 488
gma-miR169s-3p CGGCAAGUAAUCUUUGGCUGC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR169s-5p AAGCCAAGGAUGACUUGCCGG 21 640 53 348 1    5 1 0 108 35 34 18 22 1 348 23 45
gma-miR169t UAGCCAAGGAUGGACUUGCCUA 22 77 6 43 1    0 0 0 15 8 0 1 0 0 43 2 8
gma-miR169u CAGCCAAGGAUGACUUGCCGU 21 636 53 312 2    2 0 0 95 60 67 2 0 0 312 46 52
gma-miR169v CAGCCAAGGAUGACUUGCC 19 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR169w CAAGGAUGACUUGCCGGCAUU 21 1,207 101 212 24    30 52 29 212 142 108 25 60 24 179 164 182
gma-miR171a UGAGCCGUGCCAAUAUCACGA 21 20 2 8 1    0 0 0 8 2 1 0 2 0 7 0 0
gma-miR171b-3p CGAGCCGAAUCAAUAUCACUC 21 1,005 84 261 1    4 1 2 221 93 105 2 1 1 261 164 150
gma-miR171b-5p ACGGCGUGAUAUUGGUACGGCUC 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR171c-3p UUGAGCCGUGCCAAUAUCACA 21 53,512 4,459 10,908 96    223 203 169 8,592 6,820 7,693 140 160 96 9,972 8,536 10,908
gma-miR171c-5p AGAUAUUGGUGCGGUUCAAUC 21 666 56 107 15    26 31 28 72 76 107 20 38 15 80 82 91
gma-miR171d UGAUUGAGUCGUGUCAAUAUC 21 414 35 155 2    117 155 34 9 4 5 20 31 14 19 2 4
gma-miR171e UGAUUGAGCCGUGCCAAUAUC 21 65,952 5,496 10,630 1,354    2,128 2,666 1,354 9,472 8,045 8,514 1,803 1,748 1,481 10,630 8,148 9,963
gma-miR171f UGAUUGAGCCGUGCCAAUAUC 21 65,952 5,496 10,630 1,354    2,128 2,666 1,354 9,472 8,045 8,514 1,803 1,748 1,481 10,630 8,148 9,963
gma-miR171g UGAUUGAGCCGUGCCAAUAUC 21 65,952 5,496 10,630 1,354    2,128 2,666 1,354 9,472 8,045 8,514 1,803 1,748 1,481 10,630 8,148 9,963
gma-miR171h AUUGAGACGAGCCGAAUCAAU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR171i-3p UUGAGCCGUGCCAAUAUCACG 21 160,890 13,408 31,186 287    690 494 484 21,084 22,515 27,308 306 287 323 30,401 31,186 25,812
gma-miR171i-5p AUAAGAAAGCAAUGCUCAAA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR171j-3p UGAUUGAGCCGUGCCAAUAUC 21 65,952 5,496 10,630 1,354    2,128 2,666 1,354 9,472 8,045 8,514 1,803 1,748 1,481 10,630 8,148 9,963
gma-miR171j-5p UAUUGGCCUGGUUCACUCAGA 21 38,357 3,196 7,131 13    40 27 37 5,853 7,131 6,946 30 13 18 5,846 5,876 6,540
gma-miR171k-3p UUGAGCCGCGCCAAUAUCACU 21 31,050 2,588 5,474 381    5,474 2,853 2,929 1,434 2,686 3,171 2,441 381 2,864 2,022 2,326 2,469
gma-miR171k-5p CGAUGUUGGUGAGGUUCAAUC 21 1,031 86 137 46    72 80 46 78 58 107 63 137 110 91 103 86
gma-miR171l CGAUGUUGGUGAGGUUCAAUC 21 1,031 86 137 46    72 80 46 78 58 107 63 137 110 91 103 86
gma-miR171m UUGAGCCGCGUCAAUAUCUCA 21 677,116 56,426 138,817 21,868    138,817 128,969 101,556 22,367 22,045 21,868 62,889 41,041 68,266 24,306 22,099 22,893
gma-miR171n UUGAGCCGCGUCAAUAUCUUA 21 15,973 1,331 2,281 526    1,176 1,325 829 1,975 1,650 1,484 562 526 613 2,281 1,886 1,666
gma-miR171o-3p UUGAGCCGUGCCAAUAUCACA 21 53,512 4,459 10,908 96    223 203 169 8,592 6,820 7,693 140 160 96 9,972 8,536 10,908
gma-miR171o-5p AGAUAUUGGUACGGUUCAAUC 21 1,791 149 352 7    8 15 10 276 260 307 9 7 9 352 248 290
gma-miR171p UUGAGCCGCGUCAAUAUCUUA 21 15,973 1,331 2,281 526    1,176 1,325 829 1,975 1,650 1,484 562 526 613 2,281 1,886 1,666
gma-miR171q UUGAGCCGUGCCAAUAUCACA 21 53,512 4,459 10,908 96    223 203 169 8,592 6,820 7,693 140 160 96 9,972 8,536 10,908
gma-miR171r CGAGCCGAAUCAAUACCACUC 21 460 38 137 1    2 1 0 137 27 35 0 0 2 113 59 84
gma-miR171s CGAGCCGAAUCAAUACCACUC 21 460 38 137 1    2 1 0 137 27 35 0 0 2 113 59 84
gma-miR171t UUGAGCCGCGUCAAUAUCUCA 21 677,116 56,426 138,817 21,868    138,817 128,969 101,556 22,367 22,045 21,868 62,889 41,041 68,266 24,306 22,099 22,893
gma-miR171u UGAUUGAGCCGUGCCAAUAUC 21 65,952 5,496 10,630 1,354    2,128 2,666 1,354 9,472 8,045 8,514 1,803 1,748 1,481 10,630 8,148 9,963
gma-miR172a AGAAUCUUGAUGAUGCUGCAU 21 594 50 315 1    0 1 0 165 35 24 2 2 0 315 19 31
gma-miR172b-3p AGAAUCUUGAUGAUGCUGCAU 21 594 50 315 1    0 1 0 165 35 24 2 2 0 315 19 31
gma-miR172b-5p GUAGCAUCAUCAAGAUUCAC 20 389 32 158 19    0 0 0 62 87 31 0 0 0 158 19 32
gma-miR172c GGAAUCUUGAUGAUGCUGCAG 21 892 74 360 3    95 137 30 8 3 7 144 360 87 21 0 0
gma-miR172d GGAAUCUUGAUGAUGCUGCAGCAG 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR172e GGAAUCUUGAUGAUGCUGCAGCAG 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR172f AGAAUCUUGAUGAUGCUGCA 20 19 2 6 1    0 0 0 4 2 6 0 0 0 5 1 1
gma-miR172g GCAGCACCAUCAAGAUUCAC 20 62 5 24 5    0 0 0 5 14 24 0 0 0 6 8 5
gma-miR172h-3p AGAAUCUUGAUGAUGCUGCAU 21 594 50 315 1    0 1 0 165 35 24 2 2 0 315 19 31
gma-miR172h-5p GCAGCAGCAUCAAGAUUCACA 21 717 60 143 1    4 10 1 135 72 92 9 91 13 143 96 51
gma-miR172i-3p GGAAUCUUGAUGAUGCUGCAU 21 3 0 1 1    0 0 0 1 0 0 1 0 0 1 0 0
gma-miR172i-5p GCAGCAGCAUCAAGAUUCACA 21 717 60 143 1    4 10 1 135 72 92 9 91 13 143 96 51
gma-miR172j GCAGCAGCAUCAAGAUUCACA 21 717 60 143 1    4 10 1 135 72 92 9 91 13 143 96 51
gma-miR172k UGAAUCUUGAUGAUGCUGCAU 21 5 0 3 2    0 0 0 3 0 0 0 0 0 2 0 0
gma-miR172l GGAAUCUUGAUGAUGCUGCAU 21 3 0 1 1    0 0 0 1 0 0 1 0 0 1 0 0
gma-miR2107 CAAACCUCCGUAGCCUGUAUC 21 13 1 5 1    2 1 5 0 1 1 1 0 1 1 0 0
gma-miR2108a UUAAUGUGUUGUGUUUGUCGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR2108b UUAAUGUGUUGUGUUUGUGAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR2109-3p GGAGGCGUAGAUACUCACACC 21 2,745 229 839 74    152 144 151 74 178 80 219 502 230 839 80 96
gma-miR2109-5p UGCGAGUGUCUUCGCCUCUG 20 197 16 63 1    4 1 2 8 63 12 2 20 6 31 10 38
gma-miR2111a GUCCUUGGGAUGCAGAUUACG 21 560 47 106 7    72 106 33 23 11 7 77 90 55 35 16 35
gma-miR2111b UAAUCUGCAUCCUGAGGUUUA 21 69 6 15 1    3 2 7 8 1 0 6 3 2 14 8 15
gma-miR2111c UAAUCUGCAUCCUGAGGUUUA 21 69 6 15 1    3 2 7 8 1 0 6 3 2 14 8 15
gma-miR2111d GUCCUUGGGAUGCAGAUUACG 21 560 47 106 7    72 106 33 23 11 7 77 90 55 35 16 35
gma-miR2111e UAAUCUGCAUCCUGAGGUUUA 21 69 6 15 1    3 2 7 8 1 0 6 3 2 14 8 15
gma-miR2111f UAAUCUGCAUCCUGAGGUUUA 21 69 6 15 1    3 2 7 8 1 0 6 3 2 14 8 15
gma-miR2118a-3p UUGCCGAUUCCACCCAUUCCU 21 432,285 36,024 163,227 777    17,319 15,388 15,695 19,072 49,069 163,227 7,495 777 5,913 33,416 62,655 42,259
gma-miR2118a-5p GGAGAUGGGAGGGUCGGUAAAG 22 330,448 27,537 72,460 77    34,903 61,573 47,978 1,732 2,398 77 72,460 59,109 37,054 3,509 4,856 4,799
gma-miR2118b-3p UUGCCGAUUCCACCCAUUCCU 21 432,285 36,024 163,227 777    17,319 15,388 15,695 19,072 49,069 163,227 7,495 777 5,913 33,416 62,655 42,259
gma-miR2118b-5p GGAGAUGGGAGGGUCGGUAAAG 22 330,448 27,537 72,460 77    34,903 61,573 47,978 1,732 2,398 77 72,460 59,109 37,054 3,509 4,856 4,799
gma-miR2119 UCAAAGGGAGUUGUAGGGGAA 21 4,130 344 876 67    741 876 178 67 127 293 296 675 503 113 180 81
gma-miR2606a AAAAGCACUUAAGGAACGGUA 21 2,400 200 325 124    124 179 205 175 325 181 165 152 172 309 198 215
gma-miR2606b AAAAGCACUUAAGGAACGGUA 21 2,400 200 325 124    124 179 205 175 325 181 165 152 172 309 198 215
gma-miR319a UUGGACUGAAGGGAGCUCCC 20 3,436 286 702 18    259 111 150 18 220 170 463 420 402 248 273 702
gma-miR319b UUGGACUGAAGGGAGCUCCC 20 3,436 286 702 18    259 111 150 18 220 170 463 420 402 248 273 702
gma-miR319c UUGGACUGAAGGGAGCUCCU 20 232 19 62 1    26 29 13 1 0 0 59 62 39 2 0 1
gma-miR319d UGGACUGAAGGGGAGCUCCUUC 22 6,118 510 1,897 14    18 14 14 294 636 945 25 44 30 1,474 727 1,897
gma-miR319e UUGGACUGAAGGGAGCUCCC 20 3,436 286 702 18    259 111 150 18 220 170 463 420 402 248 273 702
gma-miR319f UUGGACUGAAGGGGCCUCUU 20 117 10 19 2    11 7 8 4 13 2 11 6 10 17 9 19
gma-miR319g UUGGACUGAAGGGAGCUCCUUC 22 1,947 162 344 55    133 132 190 55 69 82 255 344 337 169 74 107
gma-miR319h UUGGACUGAAGGGAGCUCCCU 21 2,355 196 365 8    272 126 191 8 120 121 365 312 342 213 105 180
gma-miR319i UUGGACUGAAGGGGAGCUCCUUC 23 414 35 132 1    0 1 0 31 28 76 0 0 0 80 66 132
gma-miR319j UUGGACUGAAGGGAGCUCCCU 21 2,355 196 365 8    272 126 191 8 120 121 365 312 342 213 105 180
gma-miR319k UUGGACUGAAGGGAGCUCCCU 21 2,355 196 365 8    272 126 191 8 120 121 365 312 342 213 105 180
gma-miR319l UUGGACUGAAGGGAGCUCCUUC 22 1,947 162 344 55    133 132 190 55 69 82 255 344 337 169 74 107
gma-miR319m UUGGACUGAAGGGAGCUCCCU 21 2,355 196 365 8    272 126 191 8 120 121 365 312 342 213 105 180
gma-miR319n UUUGGACCGAAGGGAGCCCCU 21 1,739 145 239 31    222 116 72 31 156 158 121 97 111 191 225 239
gma-miR319o UGGACUGAAGGGGAGCUCCUUC 22 6,118 510 1,897 14    18 14 14 294 636 945 25 44 30 1,474 727 1,897
gma-miR319p UUUUGGACUGAAGGGAGCUCC 21 29,997 2,500 6,694 11    3,726 3,194 3,708 33 27 11 6,331 6,152 6,694 64 33 24
gma-miR319q UGGACUGAAGGGAGCUCCUUC 21 12,619 1,052 2,287 22    1,010 414 1,534 22 901 209 2,072 2,287 1,938 739 580 913
gma-miR3522 AGACCAAAUGAGCAGCUGA 19 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR390a-3p CGCUAUCCAUCCUGAGUUUC 20 10,922 910 1,659 295    1,659 1,485 1,326 614 631 366 1,309 478 1,525 785 295 449
gma-miR390a-5p AAGCUCAGGAGGGAUAGCGCC 21 56,407 4,701 16,639 992    6,710 9,445 3,902 2,233 992 1,453 5,308 16,639 4,808 2,081 1,023 1,813
gma-miR390b-3p UACUUGGCGCUAUCUAUCUUGA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR390b-5p AAGCUCAGGAGGGAUAGCACC 21 1,157 96 221 37    98 97 37 75 79 144 46 79 85 107 89 221
gma-miR390c CGCUAUCCAUCCUGAGUUUC 20 10,922 910 1,659 295    1,659 1,485 1,326 614 631 366 1,309 478 1,525 785 295 449
gma-miR390d AAGCUCAGGAGGGAUAGCACC 21 1,157 96 221 37    98 97 37 75 79 144 46 79 85 107 89 221
gma-miR390e AGCUCAGGAGGGAUAGCGCC 20 10,903 909 4,166 92    1,083 1,228 635 98 92 109 1,564 4,166 1,488 156 95 189
gma-miR390f AAGCUCAGGAGGGAUAGCGCC 21 56,407 4,701 16,639 992    6,710 9,445 3,902 2,233 992 1,453 5,308 16,639 4,808 2,081 1,023 1,813
gma-miR390g AAGCUCAGGAGGGAUAGCGCC 21 56,407 4,701 16,639 992    6,710 9,445 3,902 2,233 992 1,453 5,308 16,639 4,808 2,081 1,023 1,813
gma-miR391-5p UACGCAGGAGAGAUGACGCUGU 22 1,163 97 256 137    0 0 0 137 186 149 0 0 0 206 256 229
gma-miR391a-3p AGCAUCAUAUCUCCUGCAUAG 21 60 5 13 5    0 0 0 13 13 8 0 0 0 13 8 5
gma-miR393a UCCAAAGGGAUCGCAUUGAUC 21 515 43 315 5    29 10 8 47 26 13 5 10 9 315 16 27
gma-miR393b UUUGGGAUCAUGCUAUCCCUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR393c-3p AUCAUGCUAUCCCUUUGGAUU 21 703 59 214 10    16 22 15 95 118 56 16 20 10 214 53 68
gma-miR393c-5p UCCAAAGGGAUCGCAUUGAUCC 22 399 33 186 3    20 3 17 4 44 15 18 30 19 186 25 18
gma-miR393d UCCAAAGGGAUCGCAUUGAUCC 22 399 33 186 3    20 3 17 4 44 15 18 30 19 186 25 18
gma-miR393e UCCAAAGGGAUCGCAUUGAUCC 22 399 33 186 3    20 3 17 4 44 15 18 30 19 186 25 18
gma-miR393f UCCAAAGGGAUCGCAUUGAUCC 22 399 33 186 3    20 3 17 4 44 15 18 30 19 186 25 18
gma-miR393g UCCAAAGGGAUCGCAUUGAUCC 22 399 33 186 3    20 3 17 4 44 15 18 30 19 186 25 18
gma-miR393h UUCCAAAGGGAUCGCAUUGAUC 22 11,534 961 5,722 44    75 64 55 2,694 720 646 44 78 45 5,722 620 771
gma-miR393i UUCCAAAGGGAUCGCAUUGAUC 22 11,534 961 5,722 44    75 64 55 2,694 720 646 44 78 45 5,722 620 771
gma-miR393j UUCCAAAGGGAUCGCAUUGAUC 22 11,534 961 5,722 44    75 64 55 2,694 720 646 44 78 45 5,722 620 771
gma-miR393k UUCCAAAGGGAUCGCAUUGAUC 22 11,534 961 5,722 44    75 64 55 2,694 720 646 44 78 45 5,722 620 771
gma-miR394a-3p AGCUCUGUUGGCUACACUUU 20 35 3 8 1    8 7 2 0 0 1 4 5 8 0 0 0
gma-miR394a-5p UUGGCAUUCUGUCCACCUCC 20 21,390 1,783 4,918 58    1,660 238 1,339 58 4,918 158 1,524 2,517 1,380 1,530 1,864 4,204
gma-miR394b-3p AGGUGGGCAUACUGUCAACU 20 1,869 156 463 1    463 138 191 0 0 0 386 275 415 0 0 1
gma-miR394b-5p UUGGCAUUCUGUCCACCUCC 20 21,390 1,783 4,918 58    1,660 238 1,339 58 4,918 158 1,524 2,517 1,380 1,530 1,864 4,204
gma-miR394c-5p UUGGCAUUCUGUCCACCUCC 20 21,390 1,783 4,918 58    1,660 238 1,339 58 4,918 158 1,524 2,517 1,380 1,530 1,864 4,204
gma-miR394d UUGGCAUUCUGUCCACCUCC 20 21,390 1,783 4,918 58    1,660 238 1,339 58 4,918 158 1,524 2,517 1,380 1,530 1,864 4,204
gma-miR394e UUGGCAUUCUGUCCACCUCC 20 21,390 1,783 4,918 58    1,660 238 1,339 58 4,918 158 1,524 2,517 1,380 1,530 1,864 4,204
gma-miR394f UUGGCAUUCUGUCCACCUCC 20 21,390 1,783 4,918 58    1,660 238 1,339 58 4,918 158 1,524 2,517 1,380 1,530 1,864 4,204
gma-miR394g UUGGCAUUCUGUCCACCUCC 20 21,390 1,783 4,918 58    1,660 238 1,339 58 4,918 158 1,524 2,517 1,380 1,530 1,864 4,204
gma-miR395a CUGAAGUGUUUGGGGGAACUC 21 4,246 354 880 25    25 105 92 685 327 285 511 312 880 455 307 262
gma-miR395b CUGAAGUGUUUGGGGGAACUC 21 4,246 354 880 25    25 105 92 685 327 285 511 312 880 455 307 262
gma-miR395c CUGAAGUGUUUGGGGGAACUC 21 4,246 354 880 25    25 105 92 685 327 285 511 312 880 455 307 262
gma-miR395d UGAAGUGUUUGGGGGAACUUU 21 24 2 8 1    0 0 0 7 1 1 0 0 0 8 6 1
gma-miR395e UGAAGUGUUUGGGGGAACUUU 21 24 2 8 1    0 0 0 7 1 1 0 0 0 8 6 1
gma-miR395f UGAAGUGUUUGGGGGAACUUU 21 24 2 8 1    0 0 0 7 1 1 0 0 0 8 6 1
gma-miR395g UGAAGUGUUUGGGGGAACUUU 21 24 2 8 1    0 0 0 7 1 1 0 0 0 8 6 1
gma-miR395h AUGAAGUGUUUGGGAGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR395i AUGAAGUGUUUGGGGGAACUC 21 6 1 3 1    0 0 0 0 0 1 0 0 0 3 1 1
gma-miR395j AUGAAGUGUUUGGGGGAACUC 21 6 1 3 1    0 0 0 0 0 1 0 0 0 3 1 1
gma-miR395k AUGAAGUGUUUGGGGGAACUC 21 6 1 3 1    0 0 0 0 0 1 0 0 0 3 1 1
gma-miR395l AUGAAGUGUUUGGGGGAACUC 21 6 1 3 1    0 0 0 0 0 1 0 0 0 3 1 1
gma-miR395m AUGAAGUGUUUGGGGGAACUC 21 6 1 3 1    0 0 0 0 0 1 0 0 0 3 1 1
gma-miR396a-3p UUCAAUAAAGCUGUGGGAAG 20 4,105 342 1,280 56    81 108 83 844 265 157 89 122 56 1,280 289 731
gma-miR396a-5p UUCCACAGCUUUCUUGAACUG 21 72,544 6,045 24,565 140    140 272 360 14,505 7,951 3,764 317 597 335 24,565 9,110 10,628
gma-miR396b-3p GCUCAAGAAAGCUGUGGGAGA 21 27,832 2,319 4,855 1,002    2,545 1,873 1,002 3,197 2,058 1,327 1,827 3,899 2,055 4,855 1,630 1,564
gma-miR396b-5p UUCCACAGCUUUCUUGAACUU 21 660,370 55,031 187,563 1,551    5,459 4,333 5,938 114,202 84,748 63,784 2,984 1,551 3,148 187,563 91,585 95,075
gma-miR396c UUCCACAGCUUUCUUGAACUU 21 660,370 55,031 187,563 1,551    5,459 4,333 5,938 114,202 84,748 63,784 2,984 1,551 3,148 187,563 91,585 95,075
gma-miR396d AAGAAAGCUGUGGGAGAAUAUGGC 24 92 8 14 2    6 14 3 7 5 8 2 14 6 5 13 9
gma-miR396e UUCCACAGCUUUCUUGAACUGU 22 314 26 130 2    0 0 0 74 39 15 0 0 2 130 31 23
gma-miR396f AGCUUUCUUGAACUUCUUAUGCCUA 25 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR396g UUCUUGAACUUCUUAUGCAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR396h UCCACAGCUUUCUUGAACUG 20 510 43 193 1    4 3 0 74 55 26 2 6 1 193 64 82
gma-miR396i-3p GUUCAAUAAAGCUGUGGGAAG 21 148,928 12,411 25,554 6,386    6,679 7,861 6,386 18,942 10,604 9,358 8,084 11,954 7,037 25,554 12,695 23,774
gma-miR396i-5p UUCCACAGCUUUCUUGAACUG 21 72,544 6,045 24,565 140    140 272 360 14,505 7,951 3,764 317 597 335 24,565 9,110 10,628
gma-miR396j AUUCAAGAUAGCUGUGGAAAA 21 3,796 316 949 84    219 196 123 481 458 360 84 127 107 949 268 424
gma-miR396k-3p GCUCAAGAAAGCUGUGGGAGA 21 27,832 2,319 4,855 1,002    2,545 1,873 1,002 3,197 2,058 1,327 1,827 3,899 2,055 4,855 1,630 1,564
gma-miR396k-5p UUCCACAGCUUUCUUGAACUU 21 660,370 55,031 187,563 1,551    5,459 4,333 5,938 114,202 84,748 63,784 2,984 1,551 3,148 187,563 91,585 95,075
gma-miR397a UCAUUGAGUGCAGCGUUGAUG 21 41,841 3,487 15,855 195    406 380 195 15,855 10,287 8,503 1,010 932 485 1,290 1,684 814
gma-miR397b-3p UAUUGACGCUGCACUCAAUCA 21 242 20 129 1    2 5 2 129 28 11 6 50 2 6 0 1
gma-miR397b-5p UCAUUGAGUGCAGCGUUGAUG 21 41,841 3,487 15,855 195    406 380 195 15,855 10,287 8,503 1,010 932 485 1,290 1,684 814
gma-miR398a UGUGUUCUCAGGUCACCCCUU 21 1,382 115 178 65    175 124 79 129 127 86 125 178 94 110 65 90
gma-miR398b-3p UGUGUUCUCAGGUCACCCCUU 21 1,382 115 178 65    175 124 79 129 127 86 125 178 94 110 65 90
gma-miR398b-5p GAGUGGAUCUGAGAACACAAGG 22 4,092 341 791 60    506 663 791 60 146 213 546 434 327 166 117 123
gma-miR398c UGUGUUCUCAGGUCGCCCCUG 21 11,408,215 950,685 4,540,288 116,909    151,528 133,264 116,909 4,540,288 2,356,622 1,296,462 1,002,900 156,355 251,430 659,718 468,953 273,786
gma-miR398d UGUGUUCUCAGGUCGCCCCUG 21 11,408,215 950,685 4,540,288 116,909    151,528 133,264 116,909 4,540,288 2,356,622 1,296,462 1,002,900 156,355 251,430 659,718 468,953 273,786
gma-miR399a UGCCAAAGGAGAGUUGCCCUG 21 92,111 7,676 22,939 1,907    10,168 16,310 13,798 3,726 2,080 1,907 7,879 22,939 6,877 2,380 2,114 1,933
gma-miR399b UGCCAAAGGAGAGUUGCCCUG 21 92,111 7,676 22,939 1,907    10,168 16,310 13,798 3,726 2,080 1,907 7,879 22,939 6,877 2,380 2,114 1,933
gma-miR399c UGCCAAAGGAGAGUUGCCCUG 21 92,111 7,676 22,939 1,907    10,168 16,310 13,798 3,726 2,080 1,907 7,879 22,939 6,877 2,380 2,114 1,933
gma-miR399d UGCCAAAGGAGAUUUGCCCAG 21 11,432 953 2,658 211    850 1,445 2,658 523 397 211 1,052 1,903 1,338 452 318 285
gma-miR399e UGCCAAAGGAGAUUUGCCCAG 21 11,432 953 2,658 211    850 1,445 2,658 523 397 211 1,052 1,903 1,338 452 318 285
gma-miR399f UGCCAAAGGAGAUUUGCCCAG 21 11,432 953 2,658 211    850 1,445 2,658 523 397 211 1,052 1,903 1,338 452 318 285
gma-miR399g UGCCAAAGGAGAUUUGCCCAG 21 11,432 953 2,658 211    850 1,445 2,658 523 397 211 1,052 1,903 1,338 452 318 285
gma-miR399h UGCCAAAGGAGAGUUGCCCUG 21 92,111 7,676 22,939 1,907    10,168 16,310 13,798 3,726 2,080 1,907 7,879 22,939 6,877 2,380 2,114 1,933
gma-miR399i UGCCAAAGGAGAAUUGCCCUG 21 17,183 1,432 4,226 454    617 859 1,524 4,226 1,455 721 454 1,627 607 2,159 1,421 1,513
gma-miR399j UGCCAAAGGAGAUUUGCCCUG 21 17,721 1,477 4,518 217    1,668 2,382 4,066 626 403 217 1,452 4,518 1,423 383 364 219
gma-miR399k UGCCAAAGGAGAUUUGCCCUG 21 17,721 1,477 4,518 217    1,668 2,382 4,066 626 403 217 1,452 4,518 1,423 383 364 219
gma-miR399l UGCCAAAGGAGAGCUGCCCUG 21 47,321 3,943 20,993 191    4,173 8,333 5,697 439 306 218 3,641 20,993 2,588 411 331 191
gma-miR399m GGGCUCCUCUCUCCUGGCAUG 21 272,691 22,724 203,249 25    4,594 28,637 203,249 641 228 25 23,079 7,777 2,735 1,222 142 362
gma-miR399n UGCCAAAGGAGAGCUGCCCUG 21 47,321 3,943 20,993 191    4,173 8,333 5,697 439 306 218 3,641 20,993 2,588 411 331 191
gma-miR399o GGGCUCCUCUCUCCUGGCAUG 21 272,691 22,724 203,249 25    4,594 28,637 203,249 641 228 25 23,079 7,777 2,735 1,222 142 362
gma-miR403a UUAGAUUCACGCACAAACUUG 21 130,036 10,836 24,734 620    1,555 1,055 1,002 19,367 19,581 17,758 666 620 760 24,734 18,493 24,445
gma-miR403b UUAGAUUCACGCACAAACUUG 21 130,036 10,836 24,734 620    1,555 1,055 1,002 19,367 19,581 17,758 666 620 760 24,734 18,493 24,445
gma-miR408a-3p AUGCACUGCCUCUUCCCUGGC 21 842,513 70,209 369,305 2,228    2,228 7,276 16,253 369,305 149,219 70,545 43,404 15,721 7,158 75,871 45,917 39,616
gma-miR408a-5p CAGGGGAACAGGCAGAGCAUG 21 17,394 1,450 9,121 24    465 1,502 478 124 65 74 4,223 9,121 1,195 93 30 24
gma-miR408b-3p AUGCACUGCCUCUUCCCUGGC 21 842,513 70,209 369,305 2,228    2,228 7,276 16,253 369,305 149,219 70,545 43,404 15,721 7,158 75,871 45,917 39,616
gma-miR408b-5p CUGGGAACAGGCAGGGCACG 20 81,697 6,808 35,894 511    2,530 4,863 4,831 1,930 2,683 511 35,894 15,766 3,988 2,065 2,923 3,713
gma-miR408c-3p AUGCACUGCCUCUUCCCUGGC 21 842,513 70,209 369,305 2,228    2,228 7,276 16,253 369,305 149,219 70,545 43,404 15,721 7,158 75,871 45,917 39,616
gma-miR408c-5p CAGGGGAACAGGCAGAGCAUG 21 17,394 1,450 9,121 24    465 1,502 478 124 65 74 4,223 9,121 1,195 93 30 24
gma-miR408d UGCACUGCCUCUUCCCUGGC 20 44,071 3,673 13,829 167    167 366 1,483 6,801 13,829 3,033 4,645 1,913 696 4,501 2,367 4,270
gma-miR4340 UGCAGAGAUAGGGACGCGCUUA 22 11 1 5 1    0 0 0 0 0 0 2 1 0 3 0 5
gma-miR4341 UGUGUUGAAAGUUUAACAUGACGG 24 1 0 1 1    0 0 0 0 0 0 0 0 1 0 0 0
gma-miR4342 AAUCGACUUAGAAUGUAGGAUGGU 24 14 1 3 1    2 1 0 2 0 2 0 0 3 1 2 1
gma-miR4343a AAAAAACUUACGGAUCAAGUUGAU 24 1 0 1 1    0 0 1 0 0 0 0 0 0 0 0 0
gma-miR4343b UCUUACAGAUCAAGUUGAUUCGGA 24 1 0 1 1    0 0 0 0 0 0 0 0 0 1 0 0
gma-miR4344 AAGUAGACAUUCUAAGACGUUGCU 24 76 6 17 1    13 6 10 2 1 0 7 17 14 0 3 3
gma-miR4345 UAAGACGGAACUUACAAAGAUU 22 133 11 47 1    0 1 0 0 0 0 23 47 30 17 9 6
gma-miR4346 GAAAGACCAAACGAGAAGCUGCAU 24 265 22 122 1    1 0 0 0 0 0 58 122 81 1 2 0
gma-miR4347 AAGCUUCUUACGGAUCAAGUUGAU 24 5 0 2 1    1 0 0 1 0 0 0 0 2 1 0 0
gma-miR4348a-3p UAUCACAAUGUCAUCAUCUUG 21 28 2 11 8    0 0 0 0 0 0 0 0 0 9 11 8
gma-miR4348a-5p AAACUUGUAAGAUGGUGACAUU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR4348b UCUUUUGAAUUUGACUAUUAG 21 43 4 19 1    0 0 0 8 5 5 0 0 0 19 5 1
gma-miR4348c UGUUAAACUUGCAAGAUGACA 21 15 1 8 1    0 0 0 3 2 1 0 0 0 8 0 1
gma-miR4348d UUUCGGUGUCGGUGAAUUGCC 21 103,582 8,632 31,124 1    1 1 1 16,092 20,574 31,124 0 0 1 15,160 13,616 7,012
gma-miR4349-3p UCACUUAUAUACUCUUUCUUGGCC 24 14 1 6 1    0 0 0 1 0 0 1 1 2 2 6 1
gma-miR4349-5p UAUUGGCUAGAGAUAAGACAAAGA 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR4350 UCAAAUGAUUUUGUGUCGUUGG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR4351 AUUGGGAUUCAGUUGGAGUUGG 22 129 11 39 6    0 0 0 0 0 0 31 39 14 6 15 24
gma-miR4352a AUUUCUAGGACAUACUACGACGGU 24 7 1 2 1    0 1 0 2 0 1 1 0 1 1 0 0
gma-miR4352b UAAAAUGUAGACAUUCUAAGACGG 24 19 2 4 1    2 3 2 1 0 1 2 1 4 1 1 1
gma-miR4353 CAAGUCGUAGCCGGUGUUAUUACU 24 2 0 1 1    0 0 0 0 1 0 0 0 1 0 0 0
gma-miR4354 CAAUUGGAUCGGUCCAACCGGC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR4355 CACUGUUGUGCUGGGUGUACCA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR4356 CAGGACUGUCUUAGAAAGCCAGGC 24 3 0 3 3    3 0 0 0 0 0 0 0 0 0 0 0
gma-miR4357 CAGUCGUGUGAUUGUACGGUUCAU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR4358 CAGUGCAUGACUAUAUCGCCAG 22 3 0 2 1    0 0 0 0 0 0 0 0 2 1 0 0
gma-miR4359a AACGAAGUGACUCUAACAUCGGUU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR4359b AACGCGUGAUAUGUUAACAUCGGU 24 7 1 2 1    0 0 0 1 0 0 2 1 2 1 0 0
gma-miR4360 CAGUUGACGUACGUACGGAUUGAC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR4361 CCGGAAGAGACUUACGGAUCAACU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR4362 CCUUAGGACAGACGUCAUGUAG 22 2 0 1 1    0 0 0 0 0 0 1 0 1 0 0 0
gma-miR4363 CGAUUACCAGAAGGCUUAUUAG 22 10 1 3 1    0 0 0 0 0 0 1 1 2 2 3 1
gma-miR4364a CGCGAGAUCGCACGGAAGAAGGUU 24 74 6 30 2    7 12 5 3 0 0 7 30 8 2 0 0
gma-miR4364b UAACAACAGCGGAAGAACCUUCUU 24 9 1 3 1    3 1 1 2 0 0 0 0 1 0 0 1
gma-miR4365 AAGAACUUCUUCCGCGAGAUCGCA 24 72 6 11 2    7 4 6 11 8 6 2 5 5 8 7 3
gma-miR4366 CUACUUAGUAGAGAUUUGUUGG 22 2 0 1 1    0 0 1 0 0 0 1 0 0 0 0 0
gma-miR4367 CUGAACCCUAGCGAAGUAAAUC 22 60 5 14 4    0 0 0 0 0 0 13 10 14 13 6 4
gma-miR4368a AAGACGGUACUUACCUCAGUAACA 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR4368b AAGGACGGUACUUACGUAAGCAAC 24 1 0 1 1    0 0 0 0 0 0 0 1 0 0 0 0
gma-miR4369 GGAUCAAGCUGAUCCGGAAGUGGA 24 2 0 1 1    1 0 0 0 1 0 0 0 0 0 0 0
gma-miR4370 AGUAGACUCGUCCGAUUUUGCGUA 24 38 3 10 1    2 2 10 1 3 1 5 2 6 2 1 3
gma-miR4371a AAGUGAUGACAUGACAAGCGAAGU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR4371b AAGUGAUGACGUGGUAGACGGAGU 24 83 7 21 1    9 21 4 1 1 1 14 14 16 1 0 1
gma-miR4371c GACGUGACAGACGGAAUAUCACAU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR4372a UAAAAUCGUGACAUGUGACGGUCA 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR4372b UAAUAAAAUCGUGACAUGUAAC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR4373 AAGUUGACGUACGUACGGAUUGAC 24 4 0 2 1    2 0 0 0 0 0 1 1 0 0 0 0
gma-miR4374a UAAGACGGUCGUGAUGUCAGCA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR4374b UACUUUCAAAGACGUUGUUGAG 22 404 34 111 1    0 1 1 0 0 0 47 34 43 111 80 87
gma-miR4374c CAACACCGUCUUUGAAGCCUGG 22 1 0 1 1    0 0 1 0 0 0 0 0 0 0 0 0
gma-miR4375 UACCACUAGUGGUCGCGCCUGGCA 24 473 39 102 9    79 68 102 9 10 18 85 24 35 10 9 24
gma-miR4377 UACGUCAUCGCUGAAUGGAAGACG 24 1 0 1 1    0 0 1 0 0 0 0 0 0 0 0 0
gma-miR4378a AUAGGACUGUCUUAGAAUGGUGUA 24 1 0 1 1    1 0 0 0 0 0 0 0 0 0 0 0
gma-miR4378b UAGAACUGUCUUAGAAUGUGCUAC 24 1 0 1 1    0 1 0 0 0 0 0 0 0 0 0 0
gma-miR4379 UAGAGUGUAUACUGUGAGAGGCCU 24 10 1 2 1    0 1 1 0 0 1 1 2 2 1 1 0
gma-miR4380a CGGAUUGUUGAUCCGUAUGUGCAU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR4380b UAUGGUCAUACGGAUUGUUGAU 22 4 0 2 1    0 0 0 0 0 1 0 1 2 0 0 0
gma-miR4381 UAUGUGACGGUAAACGGUGACAAG 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR4382 UAUGUUAACUGAUUUCAUGGAU 22 6 1 3 1    0 0 0 0 0 0 0 0 0 3 2 1
gma-miR4383 UAUUGGAUCUCAGUUGAACCGGUC 24 2 0 2 2    0 0 2 0 0 0 0 0 0 0 0 0
gma-miR4384 AAUCAGACACUGCAUUCAAAGACG 24 13 1 3 1    3 1 2 0 1 1 2 2 1 0 0 0
gma-miR4385 AAUCGAUGUAGAAAAGUGAUUGGU 24 5 0 2 1    0 2 1 1 0 0 0 0 0 1 0 0
gma-miR4386 UCGAAGGUUCUGGAGAGGACUGCA 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR4387a AACAAGACGUGAUGACGUGACACU 24 9 1 2 1    1 0 0 1 0 0 2 0 2 1 2 0
gma-miR4387b AAGGUGUGAUGGCAUGACACUCUG 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR4387c AGCGUGAUGACGUGACACUCCGUC 24 2 0 1 1    0 0 0 0 0 0 0 1 0 0 1 0
gma-miR4387d AUGUCACUGAUUAGGCAUGAUGAU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR4387e UGUUAGUGAUAAGGCGUGAUG 21 1,851 154 285 97    212 285 151 120 167 144 97 120 113 141 145 156
gma-miR4388 AAUCUUAGGGACCAAAUUGACAGC 24 19 2 9 1    0 1 0 0 0 0 1 4 9 0 0 4
gma-miR4389 UCGGUCGGACCGAUCCAAUCGGAA 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR4390 UCGUACUCGUCGGGUAUCGGGUAU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR4391 UCUCGGCAAAGAACUAAGAAGAAG 24 1 0 1 1    0 0 0 0 0 0 0 0 1 0 0 0
gma-miR4392 UCUGCGAAAAUGUGAUUUCGGA 22 28 2 17 1    0 0 0 17 1 4 0 1 1 4 0 0
gma-miR4392b UCUGCGAAAAUGUGAUUUCGGA 22 28 2 17 1    0 0 0 17 1 4 0 1 1 4 0 0
gma-miR4393a UGAGAAAAGGACGGCAGAAAAGCC 24 229 19 58 1    38 25 8 1 2 6 22 58 54 4 8 3
gma-miR4393b UUGAAAAGGGACAGCAGAGAAGCC 24 2 0 1 1    0 0 0 0 0 0 0 1 1 0 0 0
gma-miR4394 AAUGGACUAAAGAGAAAGGGGCCG 24 9 1 2 1    1 1 1 0 0 0 2 1 2 1 0 0
gma-miR4395 UGGAUAGGAGUAUGGGCUUGAG 22 37 3 12 4    0 0 0 0 0 0 5 12 5 4 5 6
gma-miR4396 UGUAGUUUCUAAGACGAUGCUGAC 24 1 0 1 1    0 0 0 1 0 0 0 0 0 0 0 0
gma-miR4397-3p UGUCAAAGAUGUGGCGAAUACU 22 3 0 1 1    1 0 0 0 1 0 0 0 0 1 0 0
gma-miR4397-5p CAUCGUUGACGCUGACUGUACG 22 1,667 139 396 51    396 332 274 66 130 96 69 51 54 73 51 75
gma-miR4398 UGUCAGCGGAGUGAGAAGACGAAA 24 1 0 1 1    0 1 0 0 0 0 0 0 0 0 0 0
gma-miR4399 UUAACGAAAAAGGACUAACGAC 22 4 0 2 2    0 0 0 0 0 0 0 2 2 0 0 0
gma-miR4400 UUCGGAAAAAUUCUGGAAGACGUC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR4401a ACAACGUCUUUGAAAGUAGGCAUU 24 1 0 1 1    0 0 0 0 0 0 1 0 0 0 0 0
gma-miR4401b UCAAAGACGUUGCUGAGGUAA 21 13 1 3 1    3 3 1 0 1 2 0 0 1 1 0 1
gma-miR4402 ACAUAUUAUGGGUCUCAGACGGAC 24 1 0 1 1    0 0 0 0 0 0 0 0 0 1 0 0
gma-miR4403 ACGGACACCGAACACGACACGGAC 24 7 1 2 1    0 2 0 2 1 0 2 0 0 0 0 0
gma-miR4404 AUUCGUGGAAGACUGGCGGAUCAA 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR4405 AUUCUAAGACGGUUAUCUGGGACC 24 307 26 44 11    28 27 34 11 21 31 24 44 35 13 16 23
gma-miR4405b UUCCGAAUAACCGACUUAGAAAUC 24 21 2 7 1    1 0 0 1 2 1 1 2 2 1 7 3
gma-miR4406 AUUGAUUCUGAGAGAACCGGUGUA 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR4407 CAGAGGAAGCAGCACUUGUACC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR4408 UAACAACAUUGGAUGAGGGUUGGA 24 51 4 17 1    2 0 1 0 0 0 12 11 17 7 1 0
gma-miR4409 UAACAAGUGGGUUUGUUGACUG 22 73 6 40 1    3 1 0 14 5 3 0 0 0 40 2 5
gma-miR4410 UAUGUUGAUCCGUAUGAGUCGUAC 24 4 0 1 1    0 1 0 0 0 0 0 0 0 1 1 1
gma-miR4411 UUAUUGUAACUAAUUUGUCGGU 22 45 4 15 1    0 0 0 0 0 0 0 2 1 15 13 14
gma-miR4412-3p AGUGGCGUAGAUCCCCACAAC 21 1 0 1 1    0 0 0 1 0 0 0 0 0 0 0 0
gma-miR4412-5p UGUUGCGGGUAUCUUUGCCUC 21 257,245 21,437 87,804 982    1,904 1,976 1,443 47,933 32,148 26,008 1,258 1,322 982 87,804 19,949 34,518
gma-miR4413a AAGAGAAUUGUAAGUCACUG 20 19 2 7 1    0 0 0 3 1 3 1 3 0 7 1 0
gma-miR4413b UAAGAGAAUUGUAAGUCACU 20 331 28 65 2    2 7 0 46 40 57 4 4 2 46 65 58
gma-miR4414a-3p UCCAACGAUGCGGGAGCUGC 20 1 0 1 1    0 0 0 0 1 0 0 0 0 0 0 0
gma-miR4414a-5p AGCUGCUGACUCGUUGGCUC 20 2 0 1 1    0 0 0 0 0 1 0 0 0 1 0 0
gma-miR4414b AGCUGCUGACUCGUUGGUUCG 21 10 1 4 1    0 1 0 4 2 1 0 0 1 1 0 0
gma-miR4415a-3p UUGAUUCUCAUCACAACAUGG 21 140,075 11,673 66,005 76    76 109 114 66,005 36,069 17,370 629 354 161 9,994 5,270 3,924
gma-miR4415a-5p AAGUUGUGAUGAGAAUCAAUG 21 3,862 322 3,094 2    4 5 2 3,094 180 113 13 9 0 425 9 8
gma-miR4415b-3p UUGAUUCUCAUCACAACAUGG 21 140,075 11,673 66,005 76    76 109 114 66,005 36,069 17,370 629 354 161 9,994 5,270 3,924
gma-miR4415b-5p AAGUUGUGAUGGGAAUCAAUGGCA 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR4416a ACGGGUCGCUCUCACCUAGG 20 16 1 4 1    2 0 0 3 0 0 3 4 0 1 2 1
gma-miR4416b UGGGUGAGAGAAACGCGUAUC 21 278 23 59 5    7 25 11 22 17 17 5 17 9 59 35 54
gma-miR4416c-3p ACGGGUCGCUCUCACCUGGAG 21 396 33 104 3    19 47 22 21 17 64 30 3 4 44 21 104
gma-miR4416c-5p CUGGGUGAGAGAAACACGUAU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR482a-3p UCUUCCCAAUUCCGCCCAUUCCUA 24 1,557 130 505 17    505 225 307 31 32 50 134 28 123 83 22 17
gma-miR482a-5p AGAAUUUGUGGGAAUGGGCUGA 22 225 19 62 4    18 44 20 4 8 0 17 62 23 8 7 14
gma-miR482b-3p UCUUCCCUACACCUCCCAUACC 22 288,443 24,037 55,055 2,491    19,202 25,218 27,913 52,772 2,513 2,491 33,723 41,974 19,013 55,055 3,428 5,141
gma-miR482b-5p UAUGGGGGGAUUGGGAAGGAAU 22 2,738 228 570 30    41 165 202 228 124 30 394 570 120 250 255 359
gma-miR482c-3p UUCCCAAUUCCGCCCAUUCCU 21 8,556 713 1,961 171    1,961 890 1,153 267 418 1,632 524 171 458 546 236 300
gma-miR482c-5p AUUUGUGGGAAUGGGCUGAUUGG 23 18 2 5 1    1 1 2 1 0 0 2 0 5 1 0 5
gma-miR482d-3p UCUUCCCUACACCUCCCAUACC 22 288,443 24,037 55,055 2,491    19,202 25,218 27,913 52,772 2,513 2,491 33,723 41,974 19,013 55,055 3,428 5,141
gma-miR482d-5p UAUGGGGGGAUUGGGAAGGAAU 22 2,738 228 570 30    41 165 202 228 124 30 394 570 120 250 255 359
gma-miR482e UAUGGGGGGAUUGGGAAGGAA 21 12,526 1,044 3,236 68    293 1,121 2,079 443 395 68 3,236 2,512 616 469 491 803
gma-miR4992 AUUCUAAGAUGGUUUUUGUUAG 22 2 0 1 1    0 0 0 1 0 0 0 0 0 1 0 0
gma-miR4993 GAGCGGCGGCGGUGGAGGAUG 21 17 1 8 2    2 0 0 0 0 0 8 5 2 0 0 0
gma-miR4994-3p UGAUAUCCUUGAGCUAAUACA 21 4,386 366 848 67    155 246 171 562 625 515 101 68 67 576 452 848
gma-miR4994-5p GGUUAGCUCAAGGAUCUCAC 20 19 2 9 1    0 0 2 1 2 3 0 0 0 1 1 9
gma-miR4995 AGGCAGUGGCUUGGUUAAGGG 21 669 56 207 1    4 4 14 24 140 80 14 8 1 28 145 207
gma-miR4996 UAGAAGCUCCCCAUGUUCUC 20 8,844 737 2,960 145    194 472 145 2,960 1,304 1,504 901 308 276 235 351 194
gma-miR4997 GAUCGUCAAGCGCGAAGAUGAGG 23 15 1 9 1    0 0 0 0 0 0 9 3 2 1 0 0
gma-miR4997b UCGCGGCAGAAGAAAUCCUGAU 22 8 1 3 1    0 0 0 0 0 0 0 1 3 2 1 1
gma-miR4998 AGUUUCGUGACUACAACUUCUG 22 12 1 4 2    0 0 0 0 0 0 2 0 0 4 3 3
gma-miR5030 AGAACAAUUUGUGUUUUACCGG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR5030b UUCCGGAAGAACAAAGCUACC 21 73 6 19 1    0 1 0 19 8 5 1 1 0 10 11 17
gma-miR5031 UUAAUGAUUAACAUCUAAUUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR5032 AGAGCCACUUUUGGGUUCCCUAU 23 3 0 1 1    0 0 0 1 0 1 0 0 0 1 0 0
gma-miR5033 GGCUGUACAAAAGGAAACUAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR5034 GGUACCCUUUCAGAUAGUCUCA 22 61 5 25 1    1 0 2 0 0 0 11 9 12 25 1 0
gma-miR5035-3p UGUUUAGAAGCUCAUAGAAUAGAU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR5035-5p CUUCUAAACAUUUUUUCCCUUA 22 11 1 4 1    0 0 0 0 0 0 0 3 1 2 1 4
gma-miR5036 AGAGGCCCUUGGGGAGGAGUAA 22 73 6 20 1    3 7 2 10 3 1 18 20 2 2 2 3
gma-miR5037a GCCUCAAAGGCUUCCACUACUG 22 8 1 5 1    0 0 0 0 1 1 0 5 0 1 0 0
gma-miR5037b AACCCUCAAAGGCUUCCUAG 20 195 16 54 1    0 1 2 26 17 13 2 10 3 54 25 42
gma-miR5037c AGUGGAACUUUGAGGCCUGC 20 16 1 9 1    0 0 0 0 0 1 0 0 0 4 2 9
gma-miR5037d CGGGAGCCUAUGAAGGUUAAC 21 18 2 5 1    4 1 0 0 0 0 5 0 1 3 0 4
gma-miR5038a UGAGAAUUUGGCCUCUGUCCA 21 50,525 4,210 9,883 832    1,851 1,559 1,574 5,928 6,632 4,781 1,405 832 1,269 9,883 5,645 9,166
gma-miR5038b UGAGAAUUUGGCCUCUGUCCA 21 50,525 4,210 9,883 832    1,851 1,559 1,574 5,928 6,632 4,781 1,405 832 1,269 9,883 5,645 9,166
gma-miR5039 CCCUUUUUUAAUCGUUGCAUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR5040 AUGAUAUAUAACAAGCAUGAG 21 10 1 6 1    0 0 0 6 1 1 0 0 0 1 1 0
gma-miR5041-3p GUUGAGCAAGUUGAAGAUGAA 21 58 5 12 1    2 1 2 7 5 3 6 6 3 12 3 8
gma-miR5041-5p UUUCAUCUUCAACUUGCUCAA 21 41 3 9 3    0 0 3 9 4 5 0 0 0 8 3 9
gma-miR5042-3p UGGGGCUUGAUCCAAGAUAGG 21 721 60 116 17    17 43 47 53 62 28 75 45 67 78 90 116
gma-miR5042-5p UAUCUUGGAUCACAGCCCCAUU 22 417 35 76 6    15 13 8 68 29 75 6 8 10 76 48 61
gma-miR5043 UGUCCCCUUCUCUGCACCACC 21 511 43 113 14    49 24 37 63 14 19 59 49 35 113 21 28
gma-miR5044 GUAGUGGAUGCCUAGAGGUCCA 22 218 18 48 4    34 15 0 23 4 11 48 40 9 15 14 5
gma-miR5225 CCUGUCGUAGGAGAGAUGACGC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR530a UGCAUUUGCACCUGCACUUU 20 2 0 1 1    0 0 0 0 1 0 0 1 0 0 0 0
gma-miR530b UGCAUUUGCACCUGCACUUUA 21 19 2 8 1    0 1 1 8 0 0 0 2 0 4 0 3
gma-miR530c UGCAUUUGCACCUGCACUUUA 21 19 2 8 1    0 1 1 8 0 0 0 2 0 4 0 3
gma-miR530d UGCAUUUGCACCUGCACUUUA 21 19 2 8 1    0 1 1 8 0 0 0 2 0 4 0 3
gma-miR530e UGCAUUUGCACCUGCACUUUA 21 19 2 8 1    0 1 1 8 0 0 0 2 0 4 0 3
gma-miR5368 GGACAGUCUCAGGUAGACA 19 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR5369 UGAGAAAAGGAGGAUGUCA 19 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR5370 CUAAAGAUUGUCCAAAAGGAA 21 52 4 13 1    0 1 1 1 0 0 13 6 6 11 8 5
gma-miR5371-3p UCUCAGUGACUAAUUUCUAGA 21 233 19 83 6    0 0 0 65 45 19 0 0 0 83 6 15
gma-miR5371-5p UAGGAAUUAGUCACUCAGAUC 21 9,559 797 1,979 1,195    0 0 0 1,472 1,489 1,737 0 0 0 1,687 1,195 1,979
gma-miR5372 UUGUUCGAUAAAACUGUUGUG 21 46 4 19 1    0 10 19 0 0 0 16 0 0 1 0 0
gma-miR5373 UCUCUUGAUUCUAGAUGAUGU 21 6,021 502 1,422 13    54 47 13 1,084 697 784 25 24 13 1,422 847 1,011
gma-miR5374-3p UUCAAAUGUCAGAUUAUAAAA 21 24 2 7 1    0 0 0 6 3 5 0 0 1 7 2 0
gma-miR5374-5p UUAUAGUCUGACAUCUGGAAU 21 8,501 708 1,821 83    144 177 85 1,121 1,119 1,279 83 97 89 1,821 1,109 1,377
gma-miR5375 ACUAUAGAAGUACUUGUGGAGC 22 8 1 6 1    0 0 0 0 0 0 1 6 0 1 0 0
gma-miR5376 UGAAGAUUUGAAGAAUUUGGGA 22 279 23 97 6    0 0 0 0 0 0 28 96 30 97 22 6
gma-miR5377 CUGAAGGAUCGAUGUAGAAUGCU 23 1 0 1 1    0 0 0 0 0 0 1 0 0 0 0 0
gma-miR5377b GACCGAUGUAGAAUGUUCAACAUU 24 7 1 3 1    0 0 3 0 0 0 1 1 2 0 0 0
gma-miR5378 CAUCUGAAGGAUAGAACACAUA 22 1 0 1 1    0 0 0 0 0 0 0 1 0 0 0 0
gma-miR5379 AUGAAAAUCAUUCAUUAUGAUAUC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR5380a GAAAAUGAAUGAUGAGGAUGGGGA 24 142 12 75 1    1 0 0 0 0 0 27 75 32 1 5 1
gma-miR5380b GAAAAUGAAUGAUGAGGAUGGGGA 24 142 12 75 1    1 0 0 0 0 0 27 75 32 1 5 1
gma-miR5380c AUGAAUGGUGAAGAUGAAGAG 21 51 4 12 2    2 5 3 5 8 2 4 12 4 3 3 0
gma-miR5559 UACUUGGUGAAUUGUUGGAUC 21 3,648 304 709 6    29 25 6 289 523 617 46 43 19 698 709 644
gma-miR5667-3p AAACAGAUCUAAAUGGAUUCC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR5667-5p AAUCCAUUCAGAUCUGUUUCG 21 1 0 1 1    0 0 0 0 0 0 0 0 0 1 0 0
gma-miR5668 AGCAAUGGAAUUAUAGACUGC 21 10 1 3 1    3 1 2 0 0 0 0 1 1 2 0 0
gma-miR5669 CAAUGUAGUGUGGUAAGUGGUC 22 182 15 101 9    0 0 0 0 0 0 9 101 14 16 18 24
gma-miR5670a CAUCAUACCAUAUUUGCUUCAU 22 1 0 1 1    0 0 0 0 0 0 0 1 0 0 0 0
gma-miR5670b CACAUCAUACCAUAUUUGCUUC 22 654 55 370 1    0 1 1 0 0 0 125 370 156 0 1 0
gma-miR5671a CAUGGAAGUGAAUCGGGUGAC 21 5,303 442 2,541 60    434 572 311 134 60 97 400 2,541 427 132 88 107
gma-miR5671b UACCCGAAUUUGCUUCCAUGAU 22 29,121 2,427 3,708 1,426    2,395 3,708 3,292 1,840 1,580 2,556 2,020 1,426 1,778 3,098 2,789 2,639
gma-miR5672 CAUGGUAGUGGAAGAAAUGGA 21 83 7 11 1    11 11 4 1 11 10 5 3 8 4 5 10
gma-miR5673 CGUGGAAUCUCGCGGAAGACAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR5674a UAAUUGUGUUGUACAUUAUCA 21 609 51 395 1    1 0 1 149 17 14 1 2 1 395 16 12
gma-miR5674b UAAUUGUGUUGUACAUUAUCA 21 609 51 395 1    1 0 1 149 17 14 1 2 1 395 16 12
gma-miR5675 UAGAGACGACAACAAUGGAAA 21 37 3 4 1    4 4 4 4 4 2 2 4 2 1 3 3
gma-miR5676 UCGACACCAUAUGUAGAGGCAG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR5677 UUUGGUCUUUAAUCAAGCUGA 21 30 3 15 1    1 0 1 6 2 0 0 0 2 15 2 1
gma-miR5678 UUCCAUGAUAAGAUCUUUGAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR5679 UUGGUGACCCAGAAGAAGUUGA 22 13 1 5 1    0 1 0 0 0 0 0 1 0 2 5 4
gma-miR5761a UUUUGUGUCGUGAAGCUUUUG 21 164 14 69 5    0 16 10 14 5 15 13 0 0 69 17 5
gma-miR5761b UUUUGUGUCGUGAAGCUUUUG 21 164 14 69 5    0 16 10 14 5 15 13 0 0 69 17 5
gma-miR5762 UCAUAGGAGGAAUCAACUGGC 21 9 1 2 1    0 1 1 1 0 1 0 0 1 2 2 0
gma-miR5763a UGAACUAUACAAAGACGGUUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR5763b UGAACUAUACAAAGACGGUUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR5763c UGAACUAUACAAAGACGGUUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR5764 UCCAUUCGCGGACAUGAUGGAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR5764b UGAUGGAUCUUUGCUUGGUACC 22 48 4 26 1    1 0 0 0 1 1 0 1 1 9 8 26
gma-miR5765 CGAAACGUUGAGGUAUAUGUGGAC 24 15 1 11 1    0 1 1 0 0 0 0 11 2 0 0 0
gma-miR5766 UUGAGGCUGAGAAGAGGCAAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR5767 UGGAGGACCUUUGAAGGUGCA 21 679 57 328 3    5 4 3 21 103 29 18 24 10 328 64 70
gma-miR5768 AAGUGCAAUACUGAUCUUCGGAAC 24 31 3 9 1    4 0 2 3 3 0 1 9 4 4 1 0
gma-miR5769 UGAGGGAAAUGAAGACGACGA 21 21 2 12 1    0 0 0 0 0 0 7 12 1 0 0 1
gma-miR5770a UUAGGACUAUGGUUUGGACGA 21 74,164 6,180 25,131 723    737 723 960 19,375 25,131 17,389 1,471 1,488 1,118 1,845 2,426 1,501
gma-miR5770b UUAGGACUAUGGUUUGGACAA 21 14,355 1,196 5,758 9    237 293 249 5,758 5,229 853 758 515 335 119 9 0
gma-miR5770c UAGGACUAUGGUUUGGAUUU 20 3,164 264 1,085 5    9 5 13 1,085 1,042 841 9 6 10 41 76 27
gma-miR5771 AUCUCAAGUGGAUUGCUUAAGGAC 24 2 0 1 1    0 0 0 0 1 0 1 0 0 0 0 0
gma-miR5772 AGAAUGUGAGUUAGAGUGAGCAUC 24 17 1 8 1    4 1 2 0 0 0 1 8 1 0 0 0
gma-miR5773 UUUUUAAAAGGUUCAGUUAGGU 22 71 6 21 5    0 0 0 0 0 0 9 13 5 21 10 13
gma-miR5774a GCUGGCGUCGACACGUGGCAU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR5774b GCUGGCGUCGACACGUGGCAU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR5775 AUAAGCUCUUUUGAGAGCUUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR5776 AACUUGGGCUGAGCUUAGGUG 21 4 0 2 1    0 1 0 2 0 0 0 0 0 0 1 0
gma-miR5777 CUAGCAAUAAUGUUGGAUGCAC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR5778 CGACGAACUCUUCGUCGGCAUC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR5779 CAAGUCCAAAGUAGGAAUGUUGCA 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR5780a AUCACUUAGCUGACGGUAGGGAC 23 11 1 6 2    0 0 0 0 2 0 6 3 0 0 0 0
gma-miR5780b UCUGAGUCCAUGAUAUAUUAAA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR5780c UUUAAUAUAUCAGGGACUUGGA 22 2 0 1 1    0 0 0 1 0 0 0 0 0 1 0 0
gma-miR5780d UGUUUUGAGUUUCUGAUAAAUU 22 6 1 5 1    0 0 0 0 0 0 0 0 0 5 1 0
gma-miR5781 CUGAAACUGAGACUGCAUCUGG 22 316 26 89 1    1 1 2 1 0 1 89 45 47 52 41 36
gma-miR5782 UAGCUGGUAGGAGAAGUUCAG 21 39 3 8 1    8 4 3 3 3 0 2 3 3 7 2 1
gma-miR5783 GACGACGACGGGGAGGACGCGC 22 6,104 509 1,575 8    1,411 858 886 8 19 31 1,575 587 677 11 24 17
gma-miR5784 AAUUAGCUAAUGGUUAGCUAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR5785 UAGUGUUGUCCUGUCGAACACGGA 24 14 1 4 1    1 1 2 3 0 2 0 0 1 4 0 0
gma-miR5786 UGUCGCAGGAUAGAGGGCACU 21 2 0 1 1    0 1 0 0 0 0 0 0 0 0 1 0
gma-miR6299 AUUUAAAAUUAUUGAUUUGUCA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR6300 GUCGUUGUAGUAUAGUGG 18 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR828a UCUUGCUCAAAUGAGUAUUCCA 22 415 35 154 1    45 154 54 0 0 0 28 105 28 1 0 0
gma-miR828b UCUUGCUCAAAUGAGUAUUCCA 22 415 35 154 1    45 154 54 0 0 0 28 105 28 1 0 0
gma-miR862a UGCUGGAUGUCUUUGAAGGAAU 22 221 18 55 1    26 21 13 4 1 6 44 55 47 1 3 0
gma-miR862b GCUGGAUGUCUUUGAAGGA 19 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR9722 UAAUAGAGGGAAGAAGAUGAA 21 178 15 29 4    9 4 6 23 15 21 7 18 6 29 26 14
gma-miR9723 CAAAGGAGAUUUGGACAACUC 21 1 0 1 1    0 0 0 0 0 0 0 0 0 1 0 0
gma-miR9724 UAGAGAUAGUGUCAAAAUAGAA 22 4 0 4 4    0 0 0 0 0 0 0 4 0 0 0 0
gma-miR9724b UAUCUUGGCACUAUCUCUAAC 21 441 37 96 1    7 14 10 49 65 66 2 1 8 65 58 96
gma-miR9725 UUAAUUUUUUUGGAUCAGCAU 21 9 1 3 1    3 1 2 0 0 0 0 2 1 0 0 0
gma-miR9726 UAUAGGCAUUAUUUUUUUCUUC 22 1,830 153 544 1    0 1 2 500 191 174 1 0 0 544 195 222
gma-miR9727 UGAAGUUACUCUGAGCACUGAG 22 7 1 3 1    0 0 0 1 0 0 0 0 0 2 3 1
gma-miR9728 CGCAGAACUGAAACAAGUUGA 21 2 0 1 1    0 1 0 0 0 0 0 0 0 1 0 0
gma-miR9729 GUAAUGAGUAGAAACAUUUAGAAG 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR9730 CGAUUGCUGUCAUAACUGCUGC 22 189 16 35 1    0 0 0 1 0 0 34 28 35 29 29 33
gma-miR9731 AUACAUAUCGUGUUGCCAAGC 21 277 23 89 1    4 11 3 69 14 32 1 10 6 89 19 19
gma-miR9732 CAAGGGUAUGAUGUGCAAUCU 21 268 22 68 1    3 4 3 27 68 32 2 1 2 49 41 36
gma-miR9733 UAACAGACUUAGAUUAACAGA 21 4 0 1 1    1 1 1 1 0 0 0 0 0 0 0 0
gma-miR9734 UCGUGAAUGAGAUUUGUGUUGCUU 24 5 0 2 1    0 1 0 0 1 2 0 0 0 1 0 0
gma-miR9735 UACGGCUUAAGUUCAACUUUGGAG 24 570 48 129 1    0 1 5 0 0 0 101 109 95 45 85 129
gma-miR9736 UGAAAGACAAACAAAGGUGGG 21 160 13 71 4    34 71 19 0 0 0 9 23 4 0 0 0
gma-miR9737 UUGUGGCUGAAAUCACUGUUGC 22 21 2 6 1    0 0 0 2 2 3 0 1 0 6 1 6
gma-miR9738 UGAAACAUGAUGUGGACUCUUC 22 4 0 3 1    0 0 0 0 0 0 0 3 0 1 0 0
gma-miR9739 UUUGAAUGUCCAGAUACGUAC 21 3 0 1 1    0 0 0 1 1 0 0 0 0 1 0 0
gma-miR9740 UGUAGGUUCCAGUGAGGGAAA 21 353 29 109 1    109 96 40 1 0 1 19 57 30 0 0 0
gma-miR9741 AAUGUGUUGAACUGAGUGAAGACA 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR9742 UGUGUUGUUUGUUUUGUAGCA 21 17 1 3 1    1 1 0 2 0 2 2 1 1 3 1 3
gma-miR9743 AGAGAGUGCUUUGAAGAAAAUGCC 24 4 0 4 4    0 0 0 0 0 0 0 4 0 0 0 0
gma-miR9744 AAUGGAUAUGAGCUGCAUACA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR9745 AGAAUUAAAUUUGGACCGUAUAAC 24 6 1 3 1    0 0 0 0 0 0 0 2 3 0 1 0
gma-miR9746a AAAGUGUUUGAAUCUCAAUUAGAU 24 1 0 1 1    0 0 0 0 0 0 0 0 0 1 0 0
gma-miR9746b AAAGUGUUUGAAUCUCAAUUAGAU 24 1 0 1 1    0 0 0 0 0 0 0 0 0 1 0 0
gma-miR9746c AAAGUGUUUGAAUCUCAAUUAGAU 24 1 0 1 1    0 0 0 0 0 0 0 0 0 1 0 0
gma-miR9746d AAAGUGUUUGAAUCUCAAUUAGAU 24 1 0 1 1    0 0 0 0 0 0 0 0 0 1 0 0
gma-miR9746e AAAGUGUUUGAAUCUCAAUUAGAU 24 1 0 1 1    0 0 0 0 0 0 0 0 0 1 0 0
gma-miR9746f AAAGUGUUUGAAUCUCAAUUAGAU 24 1 0 1 1    0 0 0 0 0 0 0 0 0 1 0 0
gma-miR9746g AAAGUGUUUGAAUCUCAAUUAGAU 24 1 0 1 1    0 0 0 0 0 0 0 0 0 1 0 0
gma-miR9746h AAAGUGUUUGAAUCUCAAUUAGAU 24 1 0 1 1    0 0 0 0 0 0 0 0 0 1 0 0
gma-miR9746i AAAGUGUUUGAAUUUCAAUUAGAU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR9747 CAUGCGAUGAUUUAAAUACUUU 22 2 0 1 1    0 0 0 0 0 0 0 0 0 1 1 0
gma-miR9748 GAAGGAAGUGUAGAGGGAUGAC 22 5 0 2 1    0 0 0 0 0 0 2 1 2 0 0 0
gma-miR9749 UUAGCUUCUUUCACCUUUCCC 21 3,199 267 600 28    51 60 85 425 526 385 28 35 33 539 432 600
gma-miR9750-3p UGUAAGUCCAUAUGUGCUCUCU 22 1 0 1 1    0 0 0 0 0 0 0 0 0 1 0 0
gma-miR9750-5p AGGCGCGUAUGGACUUACGACC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR9751 GUAAUUUUAAACCUAAACCCUAAA 24 173 14 41 1    10 7 1 25 25 10 6 17 11 41 6 14
gma-miR9752 UGCUUCUUCUUUUCCCUGUUU 21 2 0 1 1    0 0 1 0 0 0 1 0 0 0 0 0
gma-miR9753 ACAAUUUGGGACUUAGGGCUACAA 24 29 2 14 1    5 14 2 0 0 0 3 1 4 0 0 0
gma-miR9754 UGACCACAUUAGACUGAAAGUA 22 2 0 1 1    0 0 0 0 0 0 1 0 1 0 0 0
gma-miR9755 UGAUCCAGGAACUUUUCAUCU 21 39 3 9 1    1 0 0 9 2 6 0 0 0 9 6 6
gma-miR9756 UGAGAACUUUAUCCAAACAGAG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0
gma-miR9757 CAACCCUCCUCAGUUAGAUCUC 22 22 2 9 1    0 0 0 0 0 0 1 5 2 9 2 3
gma-miR9758 UGUUUAGUCAUGCAAGUUUAG 21 11 1 6 1    0 1 1 6 0 1 0 0 1 0 0 1
gma-miR9759 UAUAAGCAAGUAGAAUUUAAU 21 1 0 1 1    0 0 0 0 0 0 0 0 0 1 0 0
gma-miR9760 UGGAUGAUGUAGUUUUGAUUG 21 11 1 2 1    2 1 0 2 1 0 0 2 1 0 2 0
gma-miR9761 UGAAGGUCUAGGAUAUUUUGU 21 3 0 2 1    0 0 1 0 0 0 2 0 0 0 0 0
gma-miR9762 UACAGAUCUUUGGAAACAGGC 21 11 1 3 1    1 1 1 2 1 3 0 0 0 0 1 1
gma-miR9763 ACCCAUCCAACUCUGAAGAUA 21 5 0 3 2    0 0 0 3 0 0 0 0 0 2 0 0
gma-miR9764 UGGAUACACUCUUACUUUCUC 21 14 1 6 1    0 1 0 1 6 0 0 0 0 3 2 1
gma-miR9765 UAAUACAGAAUUCGGAGACAAC 22 10 1 3 1    1 0 0 1 1 3 0 1 0 1 2 0
gma-miR9766 UUUGAAGGGAAGGAAUGAAAC 21 1 0 1 1    1 0 0 0 0 0 0 0 0 0 0 0
gma-miR9767 AUGGAAUGGUUACUUAUGAAAAGA 24 34 3 8 1    8 6 1 1 3 7 2 2 0 2 2 0