Soybean Small RNA miRNA Abundances

The data below are based on the microRNAs listed in the miRBase registry. Adjust libraries/reads to display on the control panel.


        miRNA         miRNA sequence Len Sum (norm) Average Max Min (>0)  RImSCsWImSCsWImCOs55ImSCsemsSCsemsWSs15dAFsRSLIsAntW82_1OvaW82_1FlBW82_1OpFlW82_1WW3023_1WW3023_2WW3023_3WW3309_2WW3309_3WS3023_1WS3023_2WS3023_3WS3309_1WS3309_2WS3309_3W82CChi_1WW3309_1W82Chi_1DasCChi_1DasChi_1VicCChi_1VicChi_1W82CFlag_1W82Flag_1DasCFlag_1DasFlag_1VinCFlag_1VinFlag_1
gma-miR10186a UUGGGAAUUAAAAUGUAAACUU 22 1,353 38 215 4    0 0 0 0 0 0 0 0 113 215 29 134 95 48 4 31 12 129 16 46 72 10 24 36 101 35 13 13 7 4 38 50 27 11 22 18
gma-miR10186b UUUUGGGAAUUAAAAUGUAAACUU 24 1,711 48 410 1    0 0 0 0 0 0 0 0 261 410 74 235 27 7 1 33 13 27 5 6 49 8 19 58 133 44 12 10 13 21 31 42 26 34 58 54
gma-miR10186c UUUUGGGAAUUAAAAUGUAAACUU 24 1,711 48 410 1    0 0 0 0 0 0 0 0 261 410 74 235 27 7 1 33 13 27 5 6 49 8 19 58 133 44 12 10 13 21 31 42 26 34 58 54
gma-miR10186d UUUUGGGAAUUAAAAUGUAAACUU 24 1,711 48 410 1    0 0 0 0 0 0 0 0 261 410 74 235 27 7 1 33 13 27 5 6 49 8 19 58 133 44 12 10 13 21 31 42 26 34 58 54
gma-miR10186e UUGGGAAUUAAAAUGUAAACUU 22 1,353 38 215 4    0 0 0 0 0 0 0 0 113 215 29 134 95 48 4 31 12 129 16 46 72 10 24 36 101 35 13 13 7 4 38 50 27 11 22 18
gma-miR10186f UUUUGGGAAUUAAAAUGUAAACUU 24 1,711 48 410 1    0 0 0 0 0 0 0 0 261 410 74 235 27 7 1 33 13 27 5 6 49 8 19 58 133 44 12 10 13 21 31 42 26 34 58 54
gma-miR10186g UUUUGGGAAUUAAAAUGUAAACUU 24 1,711 48 410 1    0 0 0 0 0 0 0 0 261 410 74 235 27 7 1 33 13 27 5 6 49 8 19 58 133 44 12 10 13 21 31 42 26 34 58 54
gma-miR10186h UUUUGGGAAUUAAAAUGUAAACUU 24 1,711 48 410 1    0 0 0 0 0 0 0 0 261 410 74 235 27 7 1 33 13 27 5 6 49 8 19 58 133 44 12 10 13 21 31 42 26 34 58 54
gma-miR10186i UUUUGGGAAUUAAAAUGUAAACUU 24 1,711 48 410 1    0 0 0 0 0 0 0 0 261 410 74 235 27 7 1 33 13 27 5 6 49 8 19 58 133 44 12 10 13 21 31 42 26 34 58 54
gma-miR10186j UUUUGGGAAUUAAAAUGUAAACUU 24 1,711 48 410 1    0 0 0 0 0 0 0 0 261 410 74 235 27 7 1 33 13 27 5 6 49 8 19 58 133 44 12 10 13 21 31 42 26 34 58 54
gma-miR10186k UUUUGGGAAUUAAAAUGUAAACUU 24 1,711 48 410 1    0 0 0 0 0 0 0 0 261 410 74 235 27 7 1 33 13 27 5 6 49 8 19 58 133 44 12 10 13 21 31 42 26 34 58 54
gma-miR10186l UUUUGGGAAUUAAAAUGUAAACUU 24 1,711 48 410 1    0 0 0 0 0 0 0 0 261 410 74 235 27 7 1 33 13 27 5 6 49 8 19 58 133 44 12 10 13 21 31 42 26 34 58 54
gma-miR10187 CGAGGAUAAUUGUUGGAACCA 21 1,483 41 140 1    0 0 0 0 0 0 0 0 26 1 28 30 26 31 67 54 33 84 30 45 55 28 29 46 61 44 64 45 57 64 126 140 69 59 68 73
gma-miR10188 UCUCUGAUUUUGCAGAUAAGGACU 24 74 2 35 1    35 14 0 16 0 0 4 0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 0
gma-miR10189 AAGAACACUAGAACCAUCUCC 21 6,317 175 551 4    0 0 0 0 0 6 0 4 5 4 9 21 253 69 99 67 74 195 200 116 224 98 76 336 175 285 412 298 453 397 438 410 283 291 468 551
gma-miR10190 UCCUGAUGACUAUUAUGAGCU 21 3,955 110 404 56    0 0 0 0 0 0 0 0 116 79 84 108 130 73 108 96 89 175 56 93 98 66 77 133 129 162 177 148 200 221 137 108 186 191 311 404
gma-miR10191 GGCGACUGCGGCUCCUCCGCCG 22 158 4 72 1    59 14 0 72 0 0 2 7 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 2 0 0 0 0 0 0 0
gma-miR10192 UAAACGUUUGAUCCCUUGUAU 21 727 20 61 3    0 0 0 0 0 0 0 0 18 3 0 0 0 61 0 17 11 0 39 27 3 19 29 33 0 26 47 38 45 39 49 35 38 47 43 60
gma-miR10193a UCUGAAACCGAUGUUAACUACU 22 244 7 30 1    0 0 0 0 0 0 0 0 1 0 0 0 2 16 1 10 8 0 5 9 0 6 1 10 0 17 17 6 7 11 26 19 16 5 30 21
gma-miR10193b UCUGAAACCGAUGUUAACUACU 22 244 7 30 1    0 0 0 0 0 0 0 0 1 0 0 0 2 16 1 10 8 0 5 9 0 6 1 10 0 17 17 6 7 11 26 19 16 5 30 21
gma-miR10193c UCUGAAACCGAUGUUAACUACU 22 244 7 30 1    0 0 0 0 0 0 0 0 1 0 0 0 2 16 1 10 8 0 5 9 0 6 1 10 0 17 17 6 7 11 26 19 16 5 30 21
gma-miR10193d UCUGAAACCGAUGUUAACUACU 22 244 7 30 1    0 0 0 0 0 0 0 0 1 0 0 0 2 16 1 10 8 0 5 9 0 6 1 10 0 17 17 6 7 11 26 19 16 5 30 21
gma-miR10193e UAAAAAAACCAAUGUUAACUGU 22 1,919 53 152 6    0 0 0 0 0 0 0 0 99 142 53 73 8 91 16 67 22 6 69 72 17 45 41 152 13 143 51 50 67 93 116 111 61 47 85 109
gma-miR10193f UAAAAAAACCAAUGUUAACUGU 22 1,919 53 152 6    0 0 0 0 0 0 0 0 99 142 53 73 8 91 16 67 22 6 69 72 17 45 41 152 13 143 51 50 67 93 116 111 61 47 85 109
gma-miR10194 UGUUGAAGGUGUGUAUGACAAG 22 60 2 35 3    35 17 0 0 0 0 5 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR10195 UAUGAUUUUGUGGAUCAAAGGA 22 146 4 63 13    44 26 0 63 0 0 13 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR10196 UGAUUGUGGGAGAGCAUUUCAU 22 313 9 197 34    35 47 0 197 0 0 34 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR10197 AUUUUAGAACGACUUUUUCCU 21 1,900 53 221 2    0 0 0 0 0 0 0 0 10 4 2 16 33 30 2 11 3 23 9 9 27 2 8 148 14 158 83 72 107 117 221 180 193 97 114 207
gma-miR10198 AAGGAACUCGAAAUUCAUAGU 21 1,338 37 433 1    0 0 0 0 0 0 0 0 433 1 67 15 23 14 12 8 8 133 76 41 57 25 37 4 15 9 26 20 18 38 106 62 35 4 33 18
gma-miR10199 AGCAAUGUUGAGCUUGGGCCU 21 4,420 123 933 3    0 0 0 0 0 0 0 3 49 5 9 24 58 79 173 76 16 125 45 10 237 44 125 203 933 130 177 123 266 172 218 162 168 200 202 388
gma-miR10200 AGGUUUUAAAGAAAUUAAAUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR10201 UACCGGUAGUAAAUGGAUGCCU 22 3,032 84 695 3    0 0 0 0 0 0 3 0 472 695 311 551 77 39 34 97 46 30 19 77 60 37 50 67 52 59 21 6 21 21 48 36 14 35 24 30
gma-miR10405a UUGUUUCUUAUAAAAAGGACC 21 534 15 65 1    0 0 0 0 0 0 0 0 7 10 41 36 8 3 0 2 2 17 0 0 24 2 1 18 3 21 65 44 28 58 46 40 18 5 21 14
gma-miR10405b UUGUUUCUUAUAAAAAGGACC 21 534 15 65 1    0 0 0 0 0 0 0 0 7 10 41 36 8 3 0 2 2 17 0 0 24 2 1 18 3 21 65 44 28 58 46 40 18 5 21 14
gma-miR10405c UUGUUUCUUAUAAAAAGGACC 21 534 15 65 1    0 0 0 0 0 0 0 0 7 10 41 36 8 3 0 2 2 17 0 0 24 2 1 18 3 21 65 44 28 58 46 40 18 5 21 14
gma-miR10405d UUGUUUCUUAUAAAAAGGACC 21 534 15 65 1    0 0 0 0 0 0 0 0 7 10 41 36 8 3 0 2 2 17 0 0 24 2 1 18 3 21 65 44 28 58 46 40 18 5 21 14
gma-miR10405e UUGUUUCUUAUAAAAAGGACC 21 534 15 65 1    0 0 0 0 0 0 0 0 7 10 41 36 8 3 0 2 2 17 0 0 24 2 1 18 3 21 65 44 28 58 46 40 18 5 21 14
gma-miR10406a CAGUCGAGUUAUUGUAUAAUUCAC 24 94 3 27 1    0 0 0 0 0 0 0 0 11 7 27 20 2 0 0 0 0 0 0 0 3 0 1 1 2 3 6 2 1 2 1 2 2 0 0 1
gma-miR10406b CAGUCGAGUUAUUGUAUAAUUCAC 24 94 3 27 1    0 0 0 0 0 0 0 0 11 7 27 20 2 0 0 0 0 0 0 0 3 0 1 1 2 3 6 2 1 2 1 2 2 0 0 1
gma-miR10407a AGUUAACGGAUGAAUGAAUUUGUC 24 1,315 37 86 2    0 0 0 0 0 2 0 0 59 61 53 40 24 31 12 71 42 13 22 18 33 35 32 68 9 74 46 79 44 86 49 57 54 76 66 59
gma-miR10407b AGUUAACGGAUGAAUGAAUUUGUC 24 1,315 37 86 2    0 0 0 0 0 2 0 0 59 61 53 40 24 31 12 71 42 13 22 18 33 35 32 68 9 74 46 79 44 86 49 57 54 76 66 59
gma-miR10407c UUAACAGUCGGAUAUAUUUAUCGC 24 850 24 49 1    0 0 0 0 1 0 0 0 21 49 37 33 39 22 16 45 26 24 31 22 20 42 19 39 27 23 32 31 33 32 25 41 21 28 29 42
gma-miR10407d UUAACGGCUGGAUAUAUUUGUUGC 24 59 2 12 1    0 0 0 0 0 0 0 0 1 0 2 7 0 5 0 12 0 0 4 2 6 7 0 1 2 0 1 1 1 2 2 0 1 0 1 1
gma-miR10408 CGAGGACUCCUUUAAAUAGACU 22 32,197 894 2,627 3    0 0 0 0 3 0 0 0 771 1,489 1,586 2,353 1,463 1,532 202 467 385 1,408 454 1,859 1,408 175 308 2,573 1,583 2,616 596 312 309 313 2,627 2,571 1,324 409 485 616
gma-miR10409 CCUCUGAAGAUAUUAAAAGCCU 22 53 1 13 1    0 0 0 0 0 0 0 0 0 0 0 0 0 4 0 0 0 0 0 0 0 0 0 13 0 7 1 2 1 0 10 6 4 0 2 3
gma-miR10410a UUUCCACAUCGUUGCUGACAUAAG 24 1,779 49 218 1    0 0 0 0 0 0 1 0 121 218 128 190 5 22 26 44 43 9 13 21 17 21 30 85 15 66 61 109 61 45 93 69 52 69 76 69
gma-miR10410b UUUCCACAUCGUUGCUGACAUAAG 24 1,779 49 218 1    0 0 0 0 0 0 1 0 121 218 128 190 5 22 26 44 43 9 13 21 17 21 30 85 15 66 61 109 61 45 93 69 52 69 76 69
gma-miR10410c UUUCCACAUCGUUGCUGACAUAAG 24 1,779 49 218 1    0 0 0 0 0 0 1 0 121 218 128 190 5 22 26 44 43 9 13 21 17 21 30 85 15 66 61 109 61 45 93 69 52 69 76 69
gma-miR10411 UAAUUUUAGACUGAUAUUUUGCCU 24 269 7 50 1    0 0 0 0 0 0 0 0 43 50 13 42 1 4 1 8 2 3 2 12 14 1 9 6 6 3 4 9 4 2 4 5 5 5 1 10
gma-miR10412 GAACGUUCUGGAGAACUCUAGAGU 24 258 7 26 1    0 0 0 0 6 8 0 0 18 26 11 11 1 1 0 7 4 0 1 1 12 2 4 4 3 11 26 26 14 23 6 6 13 8 4 1
gma-miR10413a UUUUGGUAGAGAACGAAACCCU 22 1,670 46 237 1    0 0 0 0 0 0 1 0 173 237 75 237 85 37 9 33 22 108 9 22 42 14 16 63 83 67 44 22 30 24 50 62 26 24 25 30
gma-miR10413b UUUUGGUAGAGAACGAAACCCU 22 1,670 46 237 1    0 0 0 0 0 0 1 0 173 237 75 237 85 37 9 33 22 108 9 22 42 14 16 63 83 67 44 22 30 24 50 62 26 24 25 30
gma-miR10414 UCUGAGAAGAACCAUUGGUACC 22 4,339 121 540 1    0 0 0 0 0 0 0 8 76 301 247 306 90 264 139 222 203 61 95 127 85 146 74 411 49 378 0 0 0 1 516 540 0 0 0 0
gma-miR10415 AUCUUAGAAUGUGAGUUUGGAUCU 24 354 10 44 2    18 14 0 0 0 0 0 0 4 30 9 3 19 8 0 5 4 13 6 3 4 2 4 27 14 44 11 12 7 10 27 28 10 7 6 5
gma-miR10416 AAGAUUUGACUGUUGGAACUGCCU 24 2,220 62 341 15    0 0 0 0 20 0 0 0 150 341 84 222 34 65 72 82 83 38 15 79 74 35 89 74 44 65 38 70 43 58 80 64 52 62 50 37
gma-miR10417 GAGGCUGUUUCCAGAUUUGAACCC 24 752 21 55 3    0 0 0 0 3 3 0 0 14 20 27 22 7 11 39 55 25 0 13 20 0 39 32 42 6 54 28 34 34 37 24 24 30 41 33 35
gma-miR10418 GAAGUAAUCCUAGGAACUCCCU 22 12 0 3 1    0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 1 0 3 3 0 0 0 0 2 1 1 0 0
gma-miR10419 CAAAAAACACAUAUGAAACUG 21 45 1 7 1    0 0 0 0 0 0 0 0 1 7 5 1 0 1 1 3 0 0 1 1 0 0 1 4 0 2 4 0 1 1 1 2 1 3 1 3
gma-miR10420 CCUGAACCAUCAUUUUUUU 19 1,563 43 143 5    0 0 0 0 0 0 0 0 49 26 21 23 34 8 10 24 24 31 9 5 11 14 5 82 10 135 116 66 143 96 119 103 106 110 102 81
gma-miR10421 CAGAAUGAGACCUUGAGCGUGG 22 6,301 175 714 1    0 0 0 0 0 0 1 6 443 620 267 714 132 225 152 319 180 134 261 266 169 133 225 196 171 199 137 149 124 157 207 233 133 121 58 169
gma-miR10422 UUCUGAUUAGAGAGCAACACC 21 67 2 13 1    0 0 0 0 0 0 0 0 0 0 0 0 5 0 0 0 0 0 1 2 2 0 0 3 0 13 5 3 2 6 3 4 4 4 6 4
gma-miR10423 AUGAAAGCACCAAAUUGAUAGGACU 25 324 9 54 1    0 0 0 0 0 0 0 0 54 27 5 12 0 0 4 12 7 5 1 6 5 5 2 32 6 26 4 4 16 20 13 11 7 9 16 15
gma-miR10424a UUUUCUAAUUUAUUAGGGACU 21 101 3 47 1    0 0 0 0 0 0 0 0 0 0 5 8 5 2 1 2 1 47 1 3 2 2 2 0 0 0 5 2 0 2 0 0 7 2 1 1
gma-miR10424b UUUUCUAAUUUAUUAGGGACU 21 101 3 47 1    0 0 0 0 0 0 0 0 0 0 5 8 5 2 1 2 1 47 1 3 2 2 2 0 0 0 5 2 0 2 0 0 7 2 1 1
gma-miR10424c UUUUCUAAUUUAUUAGGGACU 21 101 3 47 1    0 0 0 0 0 0 0 0 0 0 5 8 5 2 1 2 1 47 1 3 2 2 2 0 0 0 5 2 0 2 0 0 7 2 1 1
gma-miR10424d UUUUCUAAUUUAUUAGGGACU 21 101 3 47 1    0 0 0 0 0 0 0 0 0 0 5 8 5 2 1 2 1 47 1 3 2 2 2 0 0 0 5 2 0 2 0 0 7 2 1 1
gma-miR10425 UUACAACCGUCUUUGAAAUCGCCU 24 179 5 28 1    0 0 0 0 0 0 0 0 16 22 15 28 0 5 3 4 2 1 2 9 3 7 2 5 1 5 0 0 9 8 5 8 3 0 9 7
gma-miR10426 UAGAAAAGAAUCAAUGUAGAAAGU 24 346 10 38 2    0 0 0 0 0 0 0 0 12 38 8 21 3 7 2 18 6 6 5 9 5 16 19 19 11 15 4 17 3 16 13 15 17 8 20 13
gma-miR10427a AAGAGAAUUGGGCUAGAGCUGC 22 28,183 783 2,889 15    70 102 20 63 107 69 15 30 1,523 2,889 636 1,750 612 1,207 1,154 1,273 493 434 1,178 1,720 282 600 863 1,272 330 809 963 1,331 756 1,117 864 864 719 869 620 579
gma-miR10427b CAAGAGAAUUGGGCUAGAGCUG 22 5,722 159 563 3    0 12 0 0 0 4 3 16 287 563 94 296 184 299 100 306 196 173 174 328 73 151 178 262 143 259 158 187 141 165 171 183 155 174 149 138
gma-miR10428 UGAGGACAAAACACGUUGAAAAGU 24 137 4 19 1    0 0 0 0 0 0 0 0 4 7 6 3 3 14 5 4 2 6 5 11 0 2 3 7 4 8 1 7 2 2 7 19 3 1 0 1
gma-miR10429 UGAGGACAAAACAUGUUGAAAAGU 24 109 3 19 1    0 0 0 0 0 0 0 0 7 19 7 10 1 3 0 4 1 1 2 5 1 3 0 4 3 9 3 6 1 2 4 2 3 2 1 5
gma-miR10430 UCGGUCUGACCUUUUUAAAAGCCU 24 1,957 54 187 15    0 0 0 0 0 0 0 0 87 187 118 126 40 51 15 84 33 23 25 51 85 43 58 130 60 132 62 30 45 69 87 96 92 55 35 38
gma-miR10431 UUAGAAUAAACAUGUGUAGAAAUU 24 187 5 22 2    0 0 0 0 0 0 0 0 18 15 8 4 0 0 0 5 2 0 0 0 14 4 2 20 10 15 4 7 0 0 22 11 12 14 0 0
gma-miR10432 UUUUCCAGAUCAUAUCGCCGGUUC 24 2,752 76 828 1    24 17 0 49 0 0 15 1 828 223 184 272 2 14 21 75 35 47 117 50 74 140 91 33 34 45 14 20 30 33 61 54 31 18 46 54
gma-miR10433 CUGCGGAUCAAGUUGAUUGUUACG 24 1,065 30 158 6    0 0 0 0 0 0 0 0 68 158 95 124 20 33 6 91 37 6 31 28 35 15 44 33 32 25 18 15 20 20 23 18 17 14 17 22
gma-miR10434 CUACUGAUUAUAUAUCUGAUACCAG 25 195 5 28 1    0 0 0 0 0 0 0 0 8 0 5 2 5 1 0 2 1 13 1 0 28 4 2 3 9 8 10 11 14 17 7 2 25 3 9 5
gma-miR10435 UUCCAUUUCAACGUCGGGUUAGAA 24 2,246 62 205 14    0 0 0 0 0 0 0 0 75 200 90 174 16 74 34 120 57 43 14 43 110 50 116 95 68 83 134 205 28 24 69 79 79 119 24 23
gma-miR10436 UCUUGGCAACACAACUUUUAACAU 24 18 1 5 1    0 0 0 0 0 0 0 0 0 0 2 1 0 1 0 0 1 0 0 5 0 1 1 0 0 0 1 1 0 0 1 0 1 0 2 0
gma-miR10437 UAUUGUUCAAACAUAUACUGUU 22 104 3 23 1    0 0 0 0 0 0 0 0 0 23 13 10 0 2 0 2 0 0 0 2 1 0 0 4 0 11 9 0 1 6 4 2 3 2 4 5
gma-miR10438 UUGGACUAAGGUUUUUUGGCAC 22 21,293 591 2,859 1    0 10 0 20 1 0 0 27 785 2,859 1,564 2,087 957 619 301 592 570 719 388 813 964 290 401 954 1,020 944 396 338 291 319 783 780 494 328 337 342
gma-miR10439 CAGACAGAUAAUGCUAGAGCC 21 797 22 64 6    0 0 0 0 0 0 6 11 7 16 15 19 20 29 7 17 6 24 28 46 26 17 18 64 13 50 31 31 39 24 36 32 50 49 33 33
gma-miR10440 UUGGGACAAUACUUUAGAUAU 21 278,500 7,736 32,087 2    156 33 53 321 8 26 2 3 32,087 12,612 7,218 9,287 11,809 20,575 1,313 10,854 4,422 9,168 5,500 15,482 11,735 5,897 7,432 6,606 12,859 7,736 11,844 6,828 5,869 5,831 7,873 5,813 10,069 9,260 10,699 11,220
gma-miR10441 CAACCCUGAGAACAAUGAAAUCGU 24 587 16 97 2    0 0 0 0 0 0 0 0 81 76 97 68 2 5 9 4 2 18 8 56 47 4 22 2 21 5 3 4 0 0 30 11 9 3 0 0
gma-miR10442 CUACAUGCUGCACUUGGAUCC 21 2,244 62 198 9    0 0 0 0 0 0 0 0 25 22 9 35 19 66 10 56 36 22 66 75 35 51 70 142 45 142 198 133 126 96 142 110 146 183 101 83
gma-miR10443 UCGACUGAGAACAACAUAAUUCAU 24 1,185 33 397 2    0 0 0 0 0 0 0 0 100 397 81 205 2 5 2 12 7 16 0 8 18 9 8 27 17 48 17 19 11 33 28 30 17 13 14 41
gma-miR10444 GACAUACAUGUGAGUUCGGAUGUA 24 1,046 29 86 1    0 0 0 0 0 0 0 1 37 78 86 57 20 16 0 37 11 13 3 13 29 13 19 42 22 54 57 82 37 68 48 44 58 33 39 29
gma-miR10445 AAGGACCAAAUUUAUGAAUUAAAU 24 226 6 34 1    0 0 0 0 0 0 0 0 11 34 5 26 14 12 2 10 5 4 4 10 8 6 4 9 9 9 1 2 3 1 9 7 7 3 3 8
gma-miR10446 UCAACUCAAGUCGAGCUCAAGCCU 24 2,337 65 168 9    0 0 0 0 0 0 0 0 65 168 87 137 68 86 9 65 21 58 27 86 77 36 41 139 75 124 116 119 85 106 77 79 91 116 80 99
gma-miR10447 UGUUUCCAUGUUGUUGAGUGAC 22 1,414 39 93 1    0 0 0 0 2 0 1 0 48 72 15 51 22 81 48 93 87 42 62 42 23 57 45 72 21 72 46 47 42 52 46 53 31 39 49 53
gma-miR10448 UUAGGCUUUGUGGGACGUGAUU 22 13,308 370 2,693 4    15 35 10 0 0 66 0 4 334 658 217 256 1,189 218 87 464 232 1,739 163 311 1,144 131 359 522 2,693 488 222 140 76 74 332 364 201 211 229 124
gma-miR1446 UUCUGAACUCUCUCCCUCAAU 21 401 11 157 1    0 0 0 0 0 0 0 0 0 0 0 0 0 7 2 2 2 53 157 97 8 15 36 1 0 0 0 3 1 2 3 2 2 5 1 2
gma-miR1507a UCUCAUUCCAUACAUCGUCUGA 22 14,882,554 413,404 1,162,551 120    115,476 81,959 88,900 37,488 120 461 71,189 163,858 89,302 124,002 152,976 225,489 65,742 352,737 223,347 684,301 378,966 78,215 496,267 458,864 211,587 559,987 333,965 798,709 59,577 940,883 794,855 616,936 820,039 748,704 714,937 741,270 645,366 884,886 958,643 1,162,551
gma-miR1507b UCUCAUUCCAUACAUCGUCUG 21 16,338 454 1,590 2    418 356 200 300 2 10 84 205 415 797 1,102 1,590 936 340 502 302 218 427 432 546 313 247 191 548 328 496 408 411 579 469 455 502 425 352 705 727
gma-miR1507c-3p CCUCAUUCCAAACAUCAUCU 20 3,094 86 323 1    0 0 0 0 0 0 0 0 1 1 0 2 3 193 24 74 61 7 323 266 0 128 113 162 3 93 159 133 211 217 290 254 116 85 92 83
gma-miR1507c-5p GAGGUGUUUGGGAUGAGAGAA 21 2,008 56 426 8    37 31 26 29 0 0 8 79 31 30 31 37 338 10 15 41 30 218 11 58 182 10 45 22 426 20 35 36 16 27 38 40 9 9 19 14
gma-miR1508a UCUAGAAAGGGAAAUAGCAGUUG 23 4 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 1 0 0 0 1 0
gma-miR1508b UAGAAAGGGAAAUAGCAGUUG 21 99,273 2,758 8,056 14    1,232 627 4,520 362 604 4,023 738 5,540 33 26 14 21 99 3,709 1,324 2,103 1,947 253 3,636 3,185 158 2,656 5,116 4,751 115 4,680 4,200 7,311 4,607 3,926 3,807 4,058 4,620 4,072 8,056 3,144
gma-miR1508c UAGAAAGGGAAAUAGCAGUUG 21 99,273 2,758 8,056 14    1,232 627 4,520 362 604 4,023 738 5,540 33 26 14 21 99 3,709 1,324 2,103 1,947 253 3,636 3,185 158 2,656 5,116 4,751 115 4,680 4,200 7,311 4,607 3,926 3,807 4,058 4,620 4,072 8,056 3,144
gma-miR1509a UUAAUCAAGGAAAUCACGGUCG 22 260,169 7,227 59,263 51    59,263 46,258 57,395 10,365 0 0 28,353 30,384 3,265 1,623 616 2,615 1,061 138 51 146 83 1,285 85 141 3,848 66 285 889 1,309 956 1,249 806 808 710 712 740 936 585 2,346 797
gma-miR1509b UUAAUCAAGGAAAUCACGGUU 21 473 13 45 2    13 10 25 0 0 0 45 45 23 5 7 8 6 14 2 4 2 0 5 7 9 3 9 24 0 13 22 19 20 13 25 11 19 17 33 15
gma-miR1510a-3p UUGUUGUUUUACCUAUUCCACCC 23 43 1 8 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 1 1 0 0 2 1 0 1 5 5 5 8 1 0 3 2 4 2
gma-miR1510a-5p AGGGAUAGGUAAAACAAUGACUGC 24 1,728 48 707 1    0 54 114 230 707 312 0 109 0 0 0 0 16 13 32 0 0 16 13 13 0 0 0 19 0 21 0 1 0 0 27 31 0 0 0 0
gma-miR1510b-3p UGUUGUUUUACCUAUUCCACC 21 81,568 2,266 8,213 59    134 97 655 459 478 296 59 160 1,570 751 1,277 1,480 1,462 2,776 250 1,174 831 1,123 1,762 2,237 2,103 962 3,125 3,226 1,013 2,490 8,213 7,526 4,134 6,837 4,713 4,265 4,195 2,641 4,291 2,803
gma-miR1510b-5p AGGGAUAGGUAAAACAACUACU 22 173,312 4,814 31,711 34    5,655 2,800 24,206 31,711 34 54 511 907 1,028 871 997 1,579 3,700 4,258 697 3,020 2,096 5,139 1,808 5,519 4,520 1,927 3,389 4,611 4,151 5,931 8,460 5,299 3,796 4,693 5,310 5,065 4,519 3,901 5,270 5,880
gma-miR1511 AACCAGGCUCUGAUACCAUG 20 2,839 79 240 4    35 0 10 24 14 0 4 25 100 117 124 109 143 35 44 28 9 96 28 31 24 5 11 119 35 105 170 211 240 222 147 131 64 104 134 141
gma-miR1512a-3p GCUUUAAGAAUUUCAGUUAUG 21 15 0 5 1    0 0 0 0 5 0 2 1 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 1 0 0 1 0 0 0
gma-miR1512a-5p UAACUGAAAAUUCUUAAAGUAU 22 1 0 1 1    0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1512b UAACUGGAAAUUCUUAAAGCAU 22 1,879 52 173 3    20 12 0 21 0 0 4 23 23 65 20 173 41 37 3 66 16 83 8 24 18 9 25 123 135 108 32 21 63 83 87 87 98 29 172 150
gma-miR1512c UAACUGAACAUUCUUAGAGCAU 22 959,928 26,665 334,398 1    242,823 334,398 360 310,875 0 0 70,513 757 0 0 1 199 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2
gma-miR1513a-3p UUUAAAUGUGUAUAAGUCAUGGU 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1513a-5p UGAGAGAAAGCCAUGACUUAC 21 14,855 413 1,687 7    35 54 69 13 0 7 30 131 39 19 24 40 38 167 50 212 153 36 106 156 41 167 119 1,012 36 630 1,687 1,478 1,168 1,329 802 822 925 1,291 1,053 916
gma-miR1513b UGAGAGAAAGCCAUGACUUAC 21 14,855 413 1,687 7    35 54 69 13 0 7 30 131 39 19 24 40 38 167 50 212 153 36 106 156 41 167 119 1,012 36 630 1,687 1,478 1,168 1,329 802 822 925 1,291 1,053 916
gma-miR1513c UAUGAGAGAAAGCCAUGAC 19 2 0 1 1    0 0 0 0 0 0 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1514a-3p AUGCCUAUUUUAAAAUGAAAA 21 300 8 36 1    0 0 0 0 0 0 0 0 7 0 2 0 6 5 1 1 2 4 3 4 3 2 4 18 1 17 19 33 26 17 36 24 16 9 23 17
gma-miR1514a-5p UUCAUUUUUAAAAUAGGCAUU 21 216 6 20 1    0 0 0 0 0 0 0 0 10 5 2 4 4 7 0 4 1 18 3 5 20 3 3 10 7 9 16 3 7 13 9 3 12 11 8 19
gma-miR1514b-3p AUGCCUAUUUUAAAAUGAAAA 21 300 8 36 1    0 0 0 0 0 0 0 0 7 0 2 0 6 5 1 1 2 4 3 4 3 2 4 18 1 17 19 33 26 17 36 24 16 9 23 17
gma-miR1514b-5p UUCAUUUUUAAAAUAGACAUU 21 7 0 2 1    0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 1 0 1 0 1 0
gma-miR1515a UCAUUUUGCGUGCAAUGAUCUG 22 6,844 190 759 6    77 64 38 0 0 0 6 27 261 214 92 316 686 116 270 106 132 759 102 118 673 106 150 135 574 150 149 210 160 165 227 187 174 134 145 121
gma-miR1515b UCAUUUUGCGUGCAAUGAUCUG 22 6,844 190 759 6    77 64 38 0 0 0 6 27 261 214 92 316 686 116 270 106 132 759 102 118 673 106 150 135 574 150 149 210 160 165 227 187 174 134 145 121
gma-miR1516a-3p CAAAAGAGCUUAUGGCUUGUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1516a-5p CAAGUUAUAAGCUCUUUUGAGAG 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1516b AGCUUCUCUACAGAAAAUAUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1516c AAUGUCUGGGCUUAGCGAGGCGGU 24 6 0 3 1    0 0 0 0 1 3 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1516d GUACUUGUGGCUUGUAUCCAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1517 AGUCUUGGUCAAUGUCGUUCGAAA 24 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1
gma-miR1518 UGUGUUGUAAAGUGAAUAUCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1519 UAAGUGUUGCAAAAUAGUCAUU 22 3 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 1 0 0 0 0 0 0 0 0 0 0
gma-miR1520a UAGAACAUGAUACAUGACAGUCA 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1520b GUGACAGUCAUCAUUUAAUAAGA 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1520c UUCAAUAAGAACGUGACACGUGA 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1520d AUCAGAACAUGACACGUGACAA 22 2 0 1 1    0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1520e CAAUAAGAACGUGACAUAUGACAG 24 27 1 12 1    11 0 0 12 0 0 3 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1520f-3p CAAUCAGAACAUGACACAUGACAA 24 34 1 21 1    0 0 0 21 0 0 2 4 0 1 1 0 0 0 0 0 0 0 0 0 2 0 0 1 0 0 0 1 0 0 0 1 0 0 0 0
gma-miR1520f-5p AUUGUCACGUGUCAUGUUCUGAUU 24 810 23 62 1    0 0 0 0 2 0 1 0 39 57 20 43 53 11 13 34 16 24 6 16 36 11 8 38 57 62 21 25 35 23 22 20 22 34 28 33
gma-miR1520g CAAUCAGAACAUGACACGUGACAA 24 80 2 36 1    20 0 15 36 0 0 7 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 1 0
gma-miR1520h AACGUCCAAUCAGAACGUGACAUG 24 1 0 1 1    0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1520i AACGUGACACGUGACGGUCAACAU 24 4 0 4 4    0 0 0 0 0 0 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1520j AAGAACGUGACACAUGACAAUCAA 24 7 0 3 1    0 0 0 0 0 0 2 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 0 0 0 0
gma-miR1520k AAUCAGAACAUGACACAUGACAGU 24 191 5 30 1    0 0 15 14 1 19 5 6 9 30 7 6 3 2 0 7 3 0 2 3 1 2 2 8 0 7 4 10 1 5 4 4 3 5 1 2
gma-miR1520l AAUCAGAACAUGACACGUGAUAGU 24 281 8 33 1    18 9 23 23 0 11 10 10 7 33 9 3 8 7 0 5 2 5 1 5 3 3 7 3 2 11 10 9 0 8 5 5 7 6 6 7
gma-miR1520m AAUCAGAACAUGACAUGUGACAAU 24 10 0 3 1    0 0 0 0 0 1 3 0 0 1 2 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0
gma-miR1520n UCAAUCAGAACAUGACACGUGACA 24 106 3 10 1    0 0 10 0 0 0 10 6 1 4 2 1 2 4 1 4 0 0 1 1 1 1 1 4 0 7 3 6 6 7 5 2 2 3 4 7
gma-miR1520o UCAUCGUCCAAUCAGAAUGUGACA 24 18 1 3 1    0 0 0 0 0 0 0 0 1 1 1 1 1 0 0 2 0 0 0 0 0 0 0 0 0 1 3 0 1 3 1 1 0 0 1 0
gma-miR1520p AUGUUGUUAUUGGAUGAUGACGGU 24 3 0 3 3    0 0 0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1520q AUUGACCAAUCAGAACAUGACACA 24 17 0 3 1    0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 1 0 0 1 0 0 0 2 1 0 1 1 1 0 1 1 1 0 1 1 1
gma-miR1520r UGUCACAUCCUGGUUGGACAUGAA 24 2 0 1 1    0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0
gma-miR1521a CUGUUAAUGGAAAAUGUUGA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1521b GACUGUCACGUGUCAUAAUCAUA 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1522 UUUAUUGCUUAAAAUGAAAU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1523a AUGGGAUAAAUGUGAGCUCA 20 15 0 5 1    0 0 0 0 0 0 0 0 0 0 0 0 5 0 0 1 1 0 0 1 0 0 0 0 0 2 0 1 0 1 0 0 2 1 0 0
gma-miR1523b UCAUCGCUCCUGAGCUCACA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1524 CGAGUCCGAGGAAGGAACUCC 21 23 1 4 1    0 0 0 0 0 0 0 0 0 3 0 0 1 0 1 0 0 0 0 0 1 0 0 1 0 1 0 2 2 4 4 1 1 0 1 0
gma-miR1525 UGGGUUAAUUAAGUUUUUAGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1526 CCGGAAGAGGAAAAUUAAGCAA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1527 UAACUCAACCUUACAAAACC 20 2 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0
gma-miR1528 AUAGAUUAGAUCAAUAUAUUAGU 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1529 UUAAAGGAAACAAUUAAUCGUUA 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1530 UUUUCACAUAAAUUAAAAUAU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1531-3p UCGUCCAUAUGGGAAGACUUGUC 23 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1531-5p AUAUGGACGAAGAGAUAGGUAAAU 24 441 12 76 1    0 0 40 21 3 5 15 1 47 42 9 11 1 3 0 76 25 1 1 3 26 9 26 5 31 6 3 3 2 2 4 4 2 2 4 8
gma-miR1532 AACACGCUAAGCGAGAGGAGCUC 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1533 AUAAUAAAAAUAAUAAUGA 19 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1534 UAUUUUGGGUAAAUAGUCAU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1535a CUUGUUUGUGGUGAUGUCU 19 21 1 5 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 1 0 3 0 0 5 0 2 0 0 2 4 1 2 0
gma-miR1535b CUUGUUUGUGGUGAUGUCUAG 21 5,556 154 965 1    26 0 0 0 0 1 3 89 0 0 1 2 20 138 965 388 431 114 382 159 59 356 289 178 98 214 131 145 170 193 252 271 267 79 78 57
gma-miR1536 AAGCAGAGACAAAUGUGUUUA 21 6 0 2 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 0 2 0 0 1 0 0 0
gma-miR156a UGACAGAAGAGAGUGAGCAC 20 499,401 13,872 102,873 46    14,186 11,414 102,873 59,047 0 1,214 56,622 75,297 192 46 234 565 16,960 1,281 1,459 1,892 1,786 15,054 2,451 2,168 10,377 1,853 1,215 9,226 19,428 9,020 9,882 8,197 9,568 7,833 8,597 7,868 7,046 5,751 10,461 8,338
gma-miR156aa AUUGGAGUGAAGGGAGCU 18 49 1 45 1    0 0 0 0 0 0 0 45 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0
gma-miR156ab AUUUAAGUGAUGGGAGCUCCG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR156b UGACAGAAGAGAGAGAGCACA 21 38 1 28 1    0 0 28 0 0 0 7 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0
gma-miR156c UUGACAGAAGAUAGAGAGCAC 21 145,758 4,049 28,906 31    28,906 10,702 124 20,158 31 46 6,815 12,995 9,991 114 1,006 543 800 747 474 1,340 983 1,043 1,362 1,006 1,592 1,183 889 3,396 1,009 3,553 4,169 2,756 3,353 4,031 2,865 2,913 3,711 2,361 4,358 4,433
gma-miR156d UUGACAGAAGAUAGAGAGCAC 21 145,758 4,049 28,906 31    28,906 10,702 124 20,158 31 46 6,815 12,995 9,991 114 1,006 543 800 747 474 1,340 983 1,043 1,362 1,006 1,592 1,183 889 3,396 1,009 3,553 4,169 2,756 3,353 4,031 2,865 2,913 3,711 2,361 4,358 4,433
gma-miR156e CUGACAGAAGAUAGAGAGCAC 21 12,774 355 11,599 1    11,599 104 0 630 0 0 87 324 0 0 0 1 0 0 0 2 0 0 0 0 1 1 0 4 1 8 1 0 0 0 1 3 0 0 3 4
gma-miR156f UUGACAGAAGAGAGAGAGCACA 22 143 4 99 2    0 0 99 0 0 2 31 11 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR156g ACAGAAGAUAGAGAGCACAG 20 1,454 40 702 1    702 99 0 149 0 0 89 170 4 0 1 0 3 1 0 5 0 1 1 5 1 3 4 18 1 23 19 13 11 16 10 8 21 26 26 24
gma-miR156h UGACAGAAGAGAGUGAGCAC 20 499,401 13,872 102,873 46    14,186 11,414 102,873 59,047 0 1,214 56,622 75,297 192 46 234 565 16,960 1,281 1,459 1,892 1,786 15,054 2,451 2,168 10,377 1,853 1,215 9,226 19,428 9,020 9,882 8,197 9,568 7,833 8,597 7,868 7,046 5,751 10,461 8,338
gma-miR156i UUGACAGAAGAUAGAGAGCAC 21 145,758 4,049 28,906 31    28,906 10,702 124 20,158 31 46 6,815 12,995 9,991 114 1,006 543 800 747 474 1,340 983 1,043 1,362 1,006 1,592 1,183 889 3,396 1,009 3,553 4,169 2,756 3,353 4,031 2,865 2,913 3,711 2,361 4,358 4,433
gma-miR156j UUGACAGAAGAUAGAGAGCAC 21 145,758 4,049 28,906 31    28,906 10,702 124 20,158 31 46 6,815 12,995 9,991 114 1,006 543 800 747 474 1,340 983 1,043 1,362 1,006 1,592 1,183 889 3,396 1,009 3,553 4,169 2,756 3,353 4,031 2,865 2,913 3,711 2,361 4,358 4,433
gma-miR156k UUGACAGAAGAGAGUGAGCAC 21 23,179 644 3,355 1    103 109 3,355 79 1 0 814 1,614 14 8 8 12 2,027 325 152 341 278 2,279 708 736 993 508 380 598 2,170 541 594 438 564 462 546 468 434 316 612 592
gma-miR156l UUGACAGAAGAUAGAGAGCAC 21 145,758 4,049 28,906 31    28,906 10,702 124 20,158 31 46 6,815 12,995 9,991 114 1,006 543 800 747 474 1,340 983 1,043 1,362 1,006 1,592 1,183 889 3,396 1,009 3,553 4,169 2,756 3,353 4,031 2,865 2,913 3,711 2,361 4,358 4,433
gma-miR156m UUGACAGAAGAUAGAGAGCAC 21 145,758 4,049 28,906 31    28,906 10,702 124 20,158 31 46 6,815 12,995 9,991 114 1,006 543 800 747 474 1,340 983 1,043 1,362 1,006 1,592 1,183 889 3,396 1,009 3,553 4,169 2,756 3,353 4,031 2,865 2,913 3,711 2,361 4,358 4,433
gma-miR156n UUGACAGAAGAGAGUGAGCAC 21 23,179 644 3,355 1    103 109 3,355 79 1 0 814 1,614 14 8 8 12 2,027 325 152 341 278 2,279 708 736 993 508 380 598 2,170 541 594 438 564 462 546 468 434 316 612 592
gma-miR156o UUGACAGAAGAGAGUGAGCAC 21 23,179 644 3,355 1    103 109 3,355 79 1 0 814 1,614 14 8 8 12 2,027 325 152 341 278 2,279 708 736 993 508 380 598 2,170 541 594 438 564 462 546 468 434 316 612 592
gma-miR156p UUGACAGAAGAAAGGGAGCAC 21 9,096 253 4,970 2    1,353 1,603 0 4,970 60 26 761 126 2 5 6 5 0 7 5 7 6 13 10 5 8 5 4 4 7 2 2 4 6 6 16 18 8 8 20 8
gma-miR156q UGACAGAAGAGAGUGAGCACU 21 14,169 394 2,213 5    827 865 46 2,213 11 5 337 179 10 20 53 103 987 113 96 161 222 674 74 133 617 83 91 431 1,228 383 641 462 448 474 396 385 361 245 408 387
gma-miR156r CUGACAGAAGAUAGAGAGCAU 21 704 20 203 1    112 12 0 0 0 0 9 58 0 0 12 42 0 1 0 1 0 15 4 8 3 1 5 2 2 16 2 3 1 4 203 122 50 2 8 6
gma-miR156s UGACAGAAGAGAGUGAGCACU 21 14,169 394 2,213 5    827 865 46 2,213 11 5 337 179 10 20 53 103 987 113 96 161 222 674 74 133 617 83 91 431 1,228 383 641 462 448 474 396 385 361 245 408 387
gma-miR156t UUGACAGAAGAAAGGGAGCAC 21 9,096 253 4,970 2    1,353 1,603 0 4,970 60 26 761 126 2 5 6 5 0 7 5 7 6 13 10 5 8 5 4 4 7 2 2 4 6 6 16 18 8 8 20 8
gma-miR156u UGACAGAAGAGAGUGAGCAC 20 499,401 13,872 102,873 46    14,186 11,414 102,873 59,047 0 1,214 56,622 75,297 192 46 234 565 16,960 1,281 1,459 1,892 1,786 15,054 2,451 2,168 10,377 1,853 1,215 9,226 19,428 9,020 9,882 8,197 9,568 7,833 8,597 7,868 7,046 5,751 10,461 8,338
gma-miR156v UGACAGAAGAGAGUGAGCAC 20 499,401 13,872 102,873 46    14,186 11,414 102,873 59,047 0 1,214 56,622 75,297 192 46 234 565 16,960 1,281 1,459 1,892 1,786 15,054 2,451 2,168 10,377 1,853 1,215 9,226 19,428 9,020 9,882 8,197 9,568 7,833 8,597 7,868 7,046 5,751 10,461 8,338
gma-miR156w UGACAGAAGAGAGUGAGCAC 20 499,401 13,872 102,873 46    14,186 11,414 102,873 59,047 0 1,214 56,622 75,297 192 46 234 565 16,960 1,281 1,459 1,892 1,786 15,054 2,451 2,168 10,377 1,853 1,215 9,226 19,428 9,020 9,882 8,197 9,568 7,833 8,597 7,868 7,046 5,751 10,461 8,338
gma-miR156x UGACAGAAGAGAGUGAGCAC 20 499,401 13,872 102,873 46    14,186 11,414 102,873 59,047 0 1,214 56,622 75,297 192 46 234 565 16,960 1,281 1,459 1,892 1,786 15,054 2,451 2,168 10,377 1,853 1,215 9,226 19,428 9,020 9,882 8,197 9,568 7,833 8,597 7,868 7,046 5,751 10,461 8,338
gma-miR156y UGACAGAAGAGAGUGAGCAC 20 499,401 13,872 102,873 46    14,186 11,414 102,873 59,047 0 1,214 56,622 75,297 192 46 234 565 16,960 1,281 1,459 1,892 1,786 15,054 2,451 2,168 10,377 1,853 1,215 9,226 19,428 9,020 9,882 8,197 9,568 7,833 8,597 7,868 7,046 5,751 10,461 8,338
gma-miR156z AUUGGAGUGAAGGGAGCU 18 49 1 45 1    0 0 0 0 0 0 0 45 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0
gma-miR159a-3p UUUGGAUUGAAGGGAGCUCUA 21 7,203,070 200,085 478,806 56    315 373 394 129 11,771 69,952 56 332 35,822 111,434 40,827 121,387 75,030 301,463 114,598 199,530 261,137 135,459 244,058 364,636 161,053 276,524 312,833 423,858 81,358 242,536 284,198 299,017 356,104 361,807 458,125 411,527 284,146 291,443 478,806 391,032
gma-miR159a-5p GAGCUCCUUGAAGUCCAAUUG 21 2,654 74 353 3    13 9 8 13 0 9 3 40 44 89 154 72 353 36 3 28 15 152 12 18 185 8 25 36 267 70 311 133 73 122 118 99 62 17 43 14
gma-miR159b-3p AUUGGAGUGAAGGGAGCUCCA 21 702 20 702 702    0 0 0 0 0 0 0 702 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR159b-5p GAGUUCCCUGCACUCCAAGUC 21 3 0 3 3    0 0 0 0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR159c AUUGGAGUGAAGGGAGCUCCG 21 3 0 3 3    0 0 0 0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR159d AGCUGCUUAGCUAUGGAUCCC 21 6,772 188 963 2    40 33 40 0 5 17 8 273 47 60 118 123 38 61 2 43 24 36 27 27 68 21 42 516 53 476 963 515 697 515 464 381 318 130 339 252
gma-miR159e-3p UUUGGAUUGAAGGGAGCUCUA 21 7,203,070 200,085 478,806 56    315 373 394 129 11,771 69,952 56 332 35,822 111,434 40,827 121,387 75,030 301,463 114,598 199,530 261,137 135,459 244,058 364,636 161,053 276,524 312,833 423,858 81,358 242,536 284,198 299,017 356,104 361,807 458,125 411,527 284,146 291,443 478,806 391,032
gma-miR159e-5p GAGCUCCUUGAAGUCCAAUU 20 1,239 34 225 1    24 12 0 22 1 1 1 8 1 3 7 10 6 225 1 34 46 4 33 57 25 16 70 19 8 24 161 137 27 74 64 62 27 20 6 3
gma-miR159f-3p AUUGGAGUGAAGGGAGCUCCA 21 702 20 702 702    0 0 0 0 0 0 0 702 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR159f-5p GAGUUCCCUGCACUCCAAGUC 21 3 0 3 3    0 0 0 0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR160a-3p GCGUAUGAGGAGCCAAGCAUA 21 1,940 54 779 1    18 10 203 19 0 8 334 779 0 0 1 6 5 8 2 6 3 5 3 3 12 1 5 17 3 16 115 71 17 68 76 69 26 9 13 9
gma-miR160a-5p UGCCUGGCUCCCUGUAUGCCA 21 158,681 4,408 19,149 6    62 66 71 24 0 0 23 341 96 243 95 150 6 7,604 591 5,092 4,962 16 1,386 4,648 32 2,130 5,678 10,888 9 8,074 12,670 19,149 12,099 13,337 11,156 10,156 7,422 5,909 8,558 5,938
gma-miR160b UGCCUGGCUCCCUGUAUGCC 20 521 14 58 2    0 0 0 0 0 0 0 0 12 18 14 14 3 16 0 13 7 4 8 18 2 7 16 36 2 17 57 58 27 32 25 17 24 17 33 24
gma-miR160c UGCCUGGCUCCCUGUAUGCC 20 521 14 58 2    0 0 0 0 0 0 0 0 12 18 14 14 3 16 0 13 7 4 8 18 2 7 16 36 2 17 57 58 27 32 25 17 24 17 33 24
gma-miR160d UGCCUGGCUCCCUGUAUGCC 20 521 14 58 2    0 0 0 0 0 0 0 0 12 18 14 14 3 16 0 13 7 4 8 18 2 7 16 36 2 17 57 58 27 32 25 17 24 17 33 24
gma-miR160e UGCCUGGCUCCCUGUAUGCC 20 521 14 58 2    0 0 0 0 0 0 0 0 12 18 14 14 3 16 0 13 7 4 8 18 2 7 16 36 2 17 57 58 27 32 25 17 24 17 33 24
gma-miR160f UGCCUGGCUCCCUGUAUGCCA 21 158,681 4,408 19,149 6    62 66 71 24 0 0 23 341 96 243 95 150 6 7,604 591 5,092 4,962 16 1,386 4,648 32 2,130 5,678 10,888 9 8,074 12,670 19,149 12,099 13,337 11,156 10,156 7,422 5,909 8,558 5,938
gma-miR162a UCGAUAAACCUCUGCAUCCA 20 2,185 61 201 1    0 0 0 0 0 1 0 13 22 16 14 44 55 61 21 42 26 48 36 72 60 24 34 84 59 55 201 142 167 152 119 98 115 116 133 155
gma-miR162b UCGAUAAACCUCUGCAUCCAG 21 62,293 1,730 4,093 51    108 90 226 62 0 51 67 855 1,003 531 590 1,230 1,695 1,449 488 1,230 425 2,568 1,420 1,637 1,903 1,122 889 3,025 1,613 4,073 3,886 2,248 3,321 2,466 3,183 3,079 4,087 3,495 4,085 4,093
gma-miR162c UCGAUAAACCUCUGCAUCCAG 21 62,293 1,730 4,093 51    108 90 226 62 0 51 67 855 1,003 531 590 1,230 1,695 1,449 488 1,230 425 2,568 1,420 1,637 1,903 1,122 889 3,025 1,613 4,073 3,886 2,248 3,321 2,466 3,183 3,079 4,087 3,495 4,085 4,093
gma-miR164a UGGAGAAGCAGGGCACGUGCA 21 42,363 1,177 8,046 62    2,864 8,046 797 1,748 705 739 4,022 1,761 354 159 62 223 63 559 256 261 552 78 188 554 236 351 610 1,697 66 1,059 1,448 1,713 1,448 1,345 1,251 1,066 869 1,016 2,904 1,293
gma-miR164b UGGAGAAGCAGGGCACGUGC 20 116 3 17 1    0 17 0 12 0 11 4 3 0 1 1 2 2 1 0 1 1 0 0 2 0 3 2 7 0 3 5 6 3 8 4 4 2 2 6 3
gma-miR164c UGGAGAAGCAGGGCACGUGC 20 116 3 17 1    0 17 0 12 0 11 4 3 0 1 1 2 2 1 0 1 1 0 0 2 0 3 2 7 0 3 5 6 3 8 4 4 2 2 6 3
gma-miR164d UGGAGAAGCAGGGCACGUGC 20 116 3 17 1    0 17 0 12 0 11 4 3 0 1 1 2 2 1 0 1 1 0 0 2 0 3 2 7 0 3 5 6 3 8 4 4 2 2 6 3
gma-miR164e UGGAGAAGCAGGGCACGUGCA 21 42,363 1,177 8,046 62    2,864 8,046 797 1,748 705 739 4,022 1,761 354 159 62 223 63 559 256 261 552 78 188 554 236 351 610 1,697 66 1,059 1,448 1,713 1,448 1,345 1,251 1,066 869 1,016 2,904 1,293
gma-miR164f UGGAGAAGCAGGGCACGUGCA 21 42,363 1,177 8,046 62    2,864 8,046 797 1,748 705 739 4,022 1,761 354 159 62 223 63 559 256 261 552 78 188 554 236 351 610 1,697 66 1,059 1,448 1,713 1,448 1,345 1,251 1,066 869 1,016 2,904 1,293
gma-miR164g UGGAGAAGCAGGGCACGUGCA 21 42,363 1,177 8,046 62    2,864 8,046 797 1,748 705 739 4,022 1,761 354 159 62 223 63 559 256 261 552 78 188 554 236 351 610 1,697 66 1,059 1,448 1,713 1,448 1,345 1,251 1,066 869 1,016 2,904 1,293
gma-miR164h UGGAGAAGCAGGGCACGUGCA 21 42,363 1,177 8,046 62    2,864 8,046 797 1,748 705 739 4,022 1,761 354 159 62 223 63 559 256 261 552 78 188 554 236 351 610 1,697 66 1,059 1,448 1,713 1,448 1,345 1,251 1,066 869 1,016 2,904 1,293
gma-miR164i UGGAGAAGCAGGGCACGUGCA 21 42,363 1,177 8,046 62    2,864 8,046 797 1,748 705 739 4,022 1,761 354 159 62 223 63 559 256 261 552 78 188 554 236 351 610 1,697 66 1,059 1,448 1,713 1,448 1,345 1,251 1,066 869 1,016 2,904 1,293
gma-miR164j UGGAGAAGCAGGGCACGUGCA 21 42,363 1,177 8,046 62    2,864 8,046 797 1,748 705 739 4,022 1,761 354 159 62 223 63 559 256 261 552 78 188 554 236 351 610 1,697 66 1,059 1,448 1,713 1,448 1,345 1,251 1,066 869 1,016 2,904 1,293
gma-miR164k UGGAGAAGCAGGGCACGUGCA 21 42,363 1,177 8,046 62    2,864 8,046 797 1,748 705 739 4,022 1,761 354 159 62 223 63 559 256 261 552 78 188 554 236 351 610 1,697 66 1,059 1,448 1,713 1,448 1,345 1,251 1,066 869 1,016 2,904 1,293
gma-miR166a-3p UCGGACCAGGCUUCAUUCCCC 21 40,941,229 1,137,256 3,734,326 21,059    76,253 154,951 61,169 116,280 0 0 21,059 34,181 357,159 445,836 275,146 388,886 667,559 694,837 3,734,326 1,836,058 1,519,430 568,846 1,810,511 1,536,989 542,183 2,162,440 1,089,927 1,900,438 508,037 2,093,605 1,534,269 1,278,048 2,023,679 1,704,574 1,950,923 1,920,358 1,422,171 1,533,924 2,221,716 2,755,461
gma-miR166a-5p GGAAUGUUGUCUGGCUCGAGG 21 74,199 2,061 13,338 131    1,016 1,311 1,138 3,490 0 0 398 2,363 1,314 1,307 1,329 2,022 9,537 502 188 354 504 8,689 462 609 8,967 255 1,361 285 13,338 494 2,438 3,470 684 1,222 1,173 1,680 610 131 1,418 140
gma-miR166b UCGGACCAGGCUUCAUUCCCC 21 40,941,229 1,137,256 3,734,326 21,059    76,253 154,951 61,169 116,280 0 0 21,059 34,181 357,159 445,836 275,146 388,886 667,559 694,837 3,734,326 1,836,058 1,519,430 568,846 1,810,511 1,536,989 542,183 2,162,440 1,089,927 1,900,438 508,037 2,093,605 1,534,269 1,278,048 2,023,679 1,704,574 1,950,923 1,920,358 1,422,171 1,533,924 2,221,716 2,755,461
gma-miR166c-3p UCGGACCAGGCUUCAUUCCCC 21 40,941,229 1,137,256 3,734,326 21,059    76,253 154,951 61,169 116,280 0 0 21,059 34,181 357,159 445,836 275,146 388,886 667,559 694,837 3,734,326 1,836,058 1,519,430 568,846 1,810,511 1,536,989 542,183 2,162,440 1,089,927 1,900,438 508,037 2,093,605 1,534,269 1,278,048 2,023,679 1,704,574 1,950,923 1,920,358 1,422,171 1,533,924 2,221,716 2,755,461
gma-miR166c-5p GGAAUGUUGUCUGGCUCGAGG 21 74,199 2,061 13,338 131    1,016 1,311 1,138 3,490 0 0 398 2,363 1,314 1,307 1,329 2,022 9,537 502 188 354 504 8,689 462 609 8,967 255 1,361 285 13,338 494 2,438 3,470 684 1,222 1,173 1,680 610 131 1,418 140
gma-miR166d UCGGACCAGGCUUCAUUCCCC 21 40,941,229 1,137,256 3,734,326 21,059    76,253 154,951 61,169 116,280 0 0 21,059 34,181 357,159 445,836 275,146 388,886 667,559 694,837 3,734,326 1,836,058 1,519,430 568,846 1,810,511 1,536,989 542,183 2,162,440 1,089,927 1,900,438 508,037 2,093,605 1,534,269 1,278,048 2,023,679 1,704,574 1,950,923 1,920,358 1,422,171 1,533,924 2,221,716 2,755,461
gma-miR166e UCGGACCAGGCUUCAUUCCCC 21 40,941,229 1,137,256 3,734,326 21,059    76,253 154,951 61,169 116,280 0 0 21,059 34,181 357,159 445,836 275,146 388,886 667,559 694,837 3,734,326 1,836,058 1,519,430 568,846 1,810,511 1,536,989 542,183 2,162,440 1,089,927 1,900,438 508,037 2,093,605 1,534,269 1,278,048 2,023,679 1,704,574 1,950,923 1,920,358 1,422,171 1,533,924 2,221,716 2,755,461
gma-miR166f UCGGACCAGGCUUCAUUCCCC 21 40,941,229 1,137,256 3,734,326 21,059    76,253 154,951 61,169 116,280 0 0 21,059 34,181 357,159 445,836 275,146 388,886 667,559 694,837 3,734,326 1,836,058 1,519,430 568,846 1,810,511 1,536,989 542,183 2,162,440 1,089,927 1,900,438 508,037 2,093,605 1,534,269 1,278,048 2,023,679 1,704,574 1,950,923 1,920,358 1,422,171 1,533,924 2,221,716 2,755,461
gma-miR166g UCGGACCAGGCUUCAUUCCCC 21 40,941,229 1,137,256 3,734,326 21,059    76,253 154,951 61,169 116,280 0 0 21,059 34,181 357,159 445,836 275,146 388,886 667,559 694,837 3,734,326 1,836,058 1,519,430 568,846 1,810,511 1,536,989 542,183 2,162,440 1,089,927 1,900,438 508,037 2,093,605 1,534,269 1,278,048 2,023,679 1,704,574 1,950,923 1,920,358 1,422,171 1,533,924 2,221,716 2,755,461
gma-miR166h-3p UCUCGGACCAGGCUUCAUUCC 21 7,578,347 210,510 579,883 17    1,698 1,202 1,379 1,298 17 0 886 2,801 268,666 344,325 321,194 579,883 89,294 163,245 506,924 306,829 293,890 72,670 280,766 280,202 76,337 265,912 211,208 298,514 65,732 256,313 288,866 302,493 320,348 307,913 317,446 342,267 187,758 231,847 312,342 275,882
gma-miR166h-5p GGAAUGUUGUUUGGCUCGAGG 21 574 16 136 1    0 0 0 0 0 136 1 124 15 33 32 58 5 3 2 4 3 7 8 10 8 1 14 1 24 3 19 21 4 6 6 14 6 1 4 1
gma-miR166i-3p UCGGACCAGGCUUCAUUCCCC 21 40,941,229 1,137,256 3,734,326 21,059    76,253 154,951 61,169 116,280 0 0 21,059 34,181 357,159 445,836 275,146 388,886 667,559 694,837 3,734,326 1,836,058 1,519,430 568,846 1,810,511 1,536,989 542,183 2,162,440 1,089,927 1,900,438 508,037 2,093,605 1,534,269 1,278,048 2,023,679 1,704,574 1,950,923 1,920,358 1,422,171 1,533,924 2,221,716 2,755,461
gma-miR166i-5p GGAAUGUCGUCUGGUUCGAG 20 2,635 73 874 1    0 0 0 0 0 0 0 163 3 0 2 8 669 20 23 11 40 171 3 2 388 4 20 7 874 8 78 67 16 19 2 9 16 7 4 1
gma-miR166j-3p UCGGACCAGGCUUCAUUCCCG 21 184,657 5,129 15,187 57    57 61 447 60 0 103 129 3,697 7,934 13,862 6,874 15,187 8,638 2,678 3,183 3,725 2,664 6,532 3,582 5,549 9,466 3,855 5,554 7,790 6,055 7,597 6,731 6,859 6,868 6,083 6,218 5,439 5,861 4,758 5,043 5,518
gma-miR166j-5p GGAAUGUUGUUUGGCUCGAGG 21 574 16 136 1    0 0 0 0 0 136 1 124 15 33 32 58 5 3 2 4 3 7 8 10 8 1 14 1 24 3 19 21 4 6 6 14 6 1 4 1
gma-miR166k UCUCGGACCAGGCUUCAUUCC 21 7,578,347 210,510 579,883 17    1,698 1,202 1,379 1,298 17 0 886 2,801 268,666 344,325 321,194 579,883 89,294 163,245 506,924 306,829 293,890 72,670 280,766 280,202 76,337 265,912 211,208 298,514 65,732 256,313 288,866 302,493 320,348 307,913 317,446 342,267 187,758 231,847 312,342 275,882
gma-miR166l GGAAUGUUGUCUGGCUCGAGG 21 74,199 2,061 13,338 131    1,016 1,311 1,138 3,490 0 0 398 2,363 1,314 1,307 1,329 2,022 9,537 502 188 354 504 8,689 462 609 8,967 255 1,361 285 13,338 494 2,438 3,470 684 1,222 1,173 1,680 610 131 1,418 140
gma-miR166m CGGACCAGGCUUCAUUCCCC 20 4,167 116 980 1    523 980 45 290 7 1 21 113 18 25 18 51 94 39 69 93 13 56 90 48 72 95 35 73 58 148 173 103 98 109 116 105 111 66 93 118
gma-miR166n UCGGACCAGGCUUCAUUCCCC 21 40,941,229 1,137,256 3,734,326 21,059    76,253 154,951 61,169 116,280 0 0 21,059 34,181 357,159 445,836 275,146 388,886 667,559 694,837 3,734,326 1,836,058 1,519,430 568,846 1,810,511 1,536,989 542,183 2,162,440 1,089,927 1,900,438 508,037 2,093,605 1,534,269 1,278,048 2,023,679 1,704,574 1,950,923 1,920,358 1,422,171 1,533,924 2,221,716 2,755,461
gma-miR166o UCGGACCAGGCUUCAUUCCCC 21 40,941,229 1,137,256 3,734,326 21,059    76,253 154,951 61,169 116,280 0 0 21,059 34,181 357,159 445,836 275,146 388,886 667,559 694,837 3,734,326 1,836,058 1,519,430 568,846 1,810,511 1,536,989 542,183 2,162,440 1,089,927 1,900,438 508,037 2,093,605 1,534,269 1,278,048 2,023,679 1,704,574 1,950,923 1,920,358 1,422,171 1,533,924 2,221,716 2,755,461
gma-miR166p UCGGACCAGGCUUCAUUCCC 20 118,188 3,283 6,693 2    380 752 340 1,108 2 60 135 406 1,238 2,812 1,522 2,225 4,432 2,045 4,561 3,419 2,727 3,117 3,721 3,124 4,272 3,797 2,212 5,123 4,093 5,138 6,278 5,340 6,693 6,154 5,406 4,985 3,859 3,937 6,199 6,576
gma-miR166q UCGGACCAGGCUUCAUUCCC 20 118,188 3,283 6,693 2    380 752 340 1,108 2 60 135 406 1,238 2,812 1,522 2,225 4,432 2,045 4,561 3,419 2,727 3,117 3,721 3,124 4,272 3,797 2,212 5,123 4,093 5,138 6,278 5,340 6,693 6,154 5,406 4,985 3,859 3,937 6,199 6,576
gma-miR166r UCGGACCAGGCUUCAUUCCC 20 118,188 3,283 6,693 2    380 752 340 1,108 2 60 135 406 1,238 2,812 1,522 2,225 4,432 2,045 4,561 3,419 2,727 3,117 3,721 3,124 4,272 3,797 2,212 5,123 4,093 5,138 6,278 5,340 6,693 6,154 5,406 4,985 3,859 3,937 6,199 6,576
gma-miR166s UCGGACCAGGCUUCAUUCCC 20 118,188 3,283 6,693 2    380 752 340 1,108 2 60 135 406 1,238 2,812 1,522 2,225 4,432 2,045 4,561 3,419 2,727 3,117 3,721 3,124 4,272 3,797 2,212 5,123 4,093 5,138 6,278 5,340 6,693 6,154 5,406 4,985 3,859 3,937 6,199 6,576
gma-miR166t UCGGACCAGGCUUCAUUCCC 20 118,188 3,283 6,693 2    380 752 340 1,108 2 60 135 406 1,238 2,812 1,522 2,225 4,432 2,045 4,561 3,419 2,727 3,117 3,721 3,124 4,272 3,797 2,212 5,123 4,093 5,138 6,278 5,340 6,693 6,154 5,406 4,985 3,859 3,937 6,199 6,576
gma-miR166u UCUCGGACCAGGCUUCAUUC 20 57,610 1,600 7,263 9    40 9 48 41 0 0 54 99 4,141 7,263 5,330 6,994 1,082 659 2,260 1,837 1,320 362 680 956 545 688 609 1,759 882 1,439 2,538 2,387 1,993 1,690 1,571 1,643 1,068 2,342 1,631 1,650
gma-miR167a UGAAGCUGCCAGCAUGAUCUA 21 13,602 378 5,670 4    341 396 2,956 100 4 4 5,670 2,677 8 10 7 22 6 50 26 18 35 18 21 26 22 22 39 82 6 71 106 110 103 112 124 104 88 66 90 62
gma-miR167b UGAAGCUGCCAGCAUGAUCUA 21 13,602 378 5,670 4    341 396 2,956 100 4 4 5,670 2,677 8 10 7 22 6 50 26 18 35 18 21 26 22 22 39 82 6 71 106 110 103 112 124 104 88 66 90 62
gma-miR167c UGAAGCUGCCAGCAUGAUCUG 21 615,733 17,104 36,265 65    2,723 1,466 3,870 260 0 723 2,166 23,054 995 65 311 1,142 16,550 13,222 23,066 16,348 18,043 28,715 17,784 18,557 22,356 18,038 17,242 27,576 21,070 27,030 26,130 25,502 30,784 24,927 36,265 34,437 22,211 27,528 29,751 35,826
gma-miR167d UGAAGCUGCCAGCAUGAUCUA 21 13,602 378 5,670 4    341 396 2,956 100 4 4 5,670 2,677 8 10 7 22 6 50 26 18 35 18 21 26 22 22 39 82 6 71 106 110 103 112 124 104 88 66 90 62
gma-miR167e UGAAGCUGCCAGCAUGAUCUU 21 1,067,280 29,647 375,275 44    356,997 375,275 7,624 62,860 0 240 226,106 5,111 10,622 1,478 586 757 106 557 44 234 171 205 396 582 263 253 607 1,462 88 1,172 1,613 1,765 1,485 1,452 1,183 1,114 1,395 1,328 1,258 891
gma-miR167f UGAAGCUGCCAGCAUGAUCUU 21 1,067,280 29,647 375,275 44    356,997 375,275 7,624 62,860 0 240 226,106 5,111 10,622 1,478 586 757 106 557 44 234 171 205 396 582 263 253 607 1,462 88 1,172 1,613 1,765 1,485 1,452 1,183 1,114 1,395 1,328 1,258 891
gma-miR167g UGAAGCUGCCAGCAUGAUCUGA 22 6,300 175 456 4    119 71 58 35 0 4 73 285 4 0 0 0 30 252 63 176 149 40 387 310 41 221 238 285 42 223 268 333 306 361 447 456 204 233 315 271
gma-miR167h AUCAUGCUGGCAGCUUCAACUGGU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR167i UCAUGCUGGCAGCUUCAACUGGU 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR167j UGAAGCUGCCAGCAUGAUCUG 21 615,733 17,104 36,265 65    2,723 1,466 3,870 260 0 723 2,166 23,054 995 65 311 1,142 16,550 13,222 23,066 16,348 18,043 28,715 17,784 18,557 22,356 18,038 17,242 27,576 21,070 27,030 26,130 25,502 30,784 24,927 36,265 34,437 22,211 27,528 29,751 35,826
gma-miR167k UGAAGCUGCCAGCCUGAUCUUA 22 4,861 135 2,534 1    2,127 2,534 36 35 0 0 99 27 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 1
gma-miR167l UGAAGCUGCCAGCAUGAUCU 20 19,969 555 4,535 11    3,559 4,535 490 1,537 0 11 3,507 393 345 90 34 62 34 137 68 107 70 50 166 128 27 162 105 330 62 246 483 436 480 356 347 330 285 346 368 283
gma-miR168a UCGCUUGGUGCAGGUCGGGAA 21 272,303 7,564 31,204 464    23,520 16,906 5,681 13,192 0 0 29,658 31,204 3,462 1,489 1,723 5,167 2,787 2,981 464 2,004 798 5,491 2,839 6,708 3,600 1,341 2,978 8,149 3,023 6,964 11,985 6,961 8,280 8,237 10,578 9,866 7,553 7,642 9,203 9,869
gma-miR168b UCGCUUGGUGCAGGUCGGG 19 124 3 22 1    22 0 0 12 0 0 2 7 4 1 2 5 0 1 2 2 2 2 0 2 3 2 4 1 1 3 6 4 3 7 3 5 1 2 9 4
gma-miR169a CAGCCAAGGAUGACUUGCCGG 21 2,737 76 1,834 1    53 96 0 85 10 38 77 1,834 40 11 22 36 0 13 2 12 6 3 2 8 6 1 11 27 3 34 60 77 17 45 14 12 31 12 21 18
gma-miR169b CAGCCAAGGAUGACUUGCCGA 21 371 10 68 1    57 68 0 55 0 0 60 42 20 3 2 4 0 1 0 1 0 0 1 0 0 0 0 7 0 3 9 15 4 6 1 3 5 0 2 2
gma-miR169c AAGCCAAGGAUGACUUGCCGA 21 266 7 100 1    44 31 0 12 0 0 33 100 2 0 4 0 0 3 0 4 2 0 2 6 1 2 9 0 0 0 1 6 0 1 0 0 2 1 0 0
gma-miR169d UGAGCCAAGGAUGACUUGCCGGU 23 56 2 17 1    0 0 0 0 0 0 6 17 2 0 6 3 0 1 0 1 2 0 0 0 0 0 1 0 2 3 5 1 0 0 0 0 2 2 1 1
gma-miR169e AGCCAAGGAUGACUUGCCGG 20 150 4 96 1    0 0 0 17 4 0 6 96 0 0 1 1 0 0 0 0 0 0 0 0 3 0 1 1 0 0 6 3 1 4 1 2 3 0 0 0
gma-miR169f CAGCCAAGGAUGACUUGCCGG 21 2,737 76 1,834 1    53 96 0 85 10 38 77 1,834 40 11 22 36 0 13 2 12 6 3 2 8 6 1 11 27 3 34 60 77 17 45 14 12 31 12 21 18
gma-miR169g CAGCCAAGGAUGACUUGCCGG 21 2,737 76 1,834 1    53 96 0 85 10 38 77 1,834 40 11 22 36 0 13 2 12 6 3 2 8 6 1 11 27 3 34 60 77 17 45 14 12 31 12 21 18
gma-miR169h GGCGAGACAUCUUGGCUCAUU 21 12 0 11 1    11 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0
gma-miR169i-3p CCGGUGCCAUCCCGUCUCAUA 21 81 2 17 1    11 0 0 0 0 0 0 1 0 0 0 0 0 7 0 7 6 0 3 5 1 5 17 0 0 1 3 4 1 2 3 0 2 2 0 0
gma-miR169i-5p UGAGCCGGGAUGGCUUGCCGGCA 23 326 9 117 1    117 36 0 0 0 0 73 92 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 1 0 0 2 0 0 0 0 0 0 2 1 0
gma-miR169j-3p UUUCGACGAGUUGUUCUUGGC 21 311 9 25 1    0 0 0 0 0 0 0 4 10 5 6 13 1 8 0 17 4 1 11 12 4 9 16 13 4 15 12 25 20 16 15 8 12 22 14 14
gma-miR169j-5p UAGCCAAGAAUGACUUGCCGG 21 536 15 121 1    121 12 0 35 0 0 36 95 2 3 6 14 0 7 0 2 1 0 1 1 0 1 6 15 1 11 24 36 12 28 8 18 13 6 16 5
gma-miR169k CAGCCAAGAAUGACUUGCCGG 21 457 13 103 1    66 28 0 0 2 52 17 103 10 5 5 5 1 18 2 14 3 4 0 10 4 7 19 10 3 3 15 21 5 7 1 1 7 7 1 1
gma-miR169l-3p CGGGCAAGUUGUUUUUGGCUAC 22 72 2 40 1    40 24 0 0 0 1 1 1 0 1 0 0 0 0 0 0 0 0 0 0 3 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR169l-5p CAGCCAAGAAUGACUUGCCGG 21 457 13 103 1    66 28 0 0 2 52 17 103 10 5 5 5 1 18 2 14 3 4 0 10 4 7 19 10 3 3 15 21 5 7 1 1 7 7 1 1
gma-miR169m CAGCCAAGGAUGACUUGCCGG 21 2,737 76 1,834 1    53 96 0 85 10 38 77 1,834 40 11 22 36 0 13 2 12 6 3 2 8 6 1 11 27 3 34 60 77 17 45 14 12 31 12 21 18
gma-miR169n-3p UGCCGGCAAGUUUCUCUUGGC 21 1,431 40 166 1    0 0 0 0 0 0 0 1 7 5 5 10 26 93 60 67 62 16 166 150 18 122 69 30 19 17 57 58 53 78 39 38 44 58 32 31
gma-miR169n-5p CAGCCAAGGGUGAUUUGCCGG 21 557 15 102 1    0 0 0 0 0 0 1 102 0 0 0 0 6 36 8 9 18 7 7 33 5 7 29 11 3 12 53 46 19 37 7 11 26 32 19 13
gma-miR169o UGAGCCAGGAUGGCUUGCCGGC 22 4,740 132 489 9    0 9 0 0 0 0 9 61 298 198 264 190 390 172 12 421 111 76 55 161 162 100 146 112 489 163 402 225 38 80 13 18 132 199 21 13
gma-miR169p UGAGCCAAGGAUGACUUGCCG 21 231 6 122 1    64 17 0 0 2 0 11 122 0 0 0 0 0 1 0 0 0 0 1 0 0 1 1 1 0 0 3 1 0 3 0 0 1 1 1 0
gma-miR169r UGAGCCAGGAUGGCUUGCCGGC 22 4,740 132 489 9    0 9 0 0 0 0 9 61 298 198 264 190 390 172 12 421 111 76 55 161 162 100 146 112 489 163 402 225 38 80 13 18 132 199 21 13
gma-miR169s-3p CGGCAAGUAAUCUUUGGCUGC 21 1,207 34 823 1    0 0 0 0 0 0 0 1 823 1 269 0 0 1 0 0 0 0 0 1 0 0 0 4 0 9 42 12 0 23 5 6 6 1 2 1
gma-miR169s-5p AAGCCAAGGAUGACUUGCCGG 21 230 6 82 1    37 9 0 0 3 5 45 82 7 0 6 3 0 2 2 1 1 0 1 2 1 0 2 1 1 1 6 9 0 0 1 0 2 0 0 0
gma-miR169t UAGCCAAGGAUGGACUUGCCUA 22 17 0 7 1    0 0 0 0 0 0 1 7 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 0 4 0 0 1 0 1 0 0 1 0 0 0
gma-miR169u CAGCCAAGGAUGACUUGCCGU 21 131 4 79 1    0 0 0 0 0 0 0 79 0 0 2 0 3 1 0 1 0 3 2 2 0 1 2 2 0 2 4 5 5 4 1 3 2 0 1 6
gma-miR169v CAGCCAAGGAUGACUUGCC 19 10 0 3 1    0 0 0 0 0 0 2 3 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 0 0 0 0 0 0 0 0 0
gma-miR169w CAAGGAUGACUUGCCGGCAUU 21 1,461 41 140 2    29 31 0 15 2 7 4 8 0 3 4 5 53 39 2 50 15 28 21 45 30 25 47 95 106 115 140 76 70 64 48 45 90 72 35 42
gma-miR171a UGAGCCGUGCCAAUAUCACGA 21 2 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 0 0 0 0
gma-miR171b-3p CGAGCCGAAUCAAUAUCACUC 21 1,264 35 168 2    18 56 0 0 0 0 168 65 2 0 12 17 24 67 9 145 44 12 59 75 39 83 67 31 8 24 46 29 14 43 10 16 39 33 6 3
gma-miR171b-5p ACGGCGUGAUAUUGGUACGGCUC 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR171c-3p UUGAGCCGUGCCAAUAUCACA 21 8,630 240 908 2    0 0 0 0 0 0 2 160 50 34 12 64 10 194 52 500 154 17 75 266 29 136 132 700 45 470 908 679 507 591 427 429 449 708 448 382
gma-miR171c-5p AGAUAUUGGUGCGGUUCAAUC 21 457 13 172 1    0 0 10 40 0 0 8 172 1 10 6 3 7 13 2 8 3 3 6 9 16 6 6 7 13 9 20 7 2 8 13 11 12 8 9 9
gma-miR171d UGAUUGAGUCGUGUCAAUAUC 21 140 4 55 1    55 21 0 20 0 0 3 0 2 16 6 8 0 0 0 0 1 0 0 0 0 0 0 0 0 2 0 0 3 0 0 1 0 1 1 0
gma-miR171e UGAUUGAGCCGUGCCAAUAUC 21 4,592 128 366 4    57 52 25 14 0 4 29 250 76 59 68 104 39 88 16 75 23 14 51 106 109 50 81 343 21 253 305 366 289 364 220 192 207 153 311 178
gma-miR171f UGAUUGAGCCGUGCCAAUAUC 21 4,592 128 366 4    57 52 25 14 0 4 29 250 76 59 68 104 39 88 16 75 23 14 51 106 109 50 81 343 21 253 305 366 289 364 220 192 207 153 311 178
gma-miR171g UGAUUGAGCCGUGCCAAUAUC 21 4,592 128 366 4    57 52 25 14 0 4 29 250 76 59 68 104 39 88 16 75 23 14 51 106 109 50 81 343 21 253 305 366 289 364 220 192 207 153 311 178
gma-miR171h AUUGAGACGAGCCGAAUCAAU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR171i-3p UUGAGCCGUGCCAAUAUCACG 21 859 24 80 1    0 0 0 0 0 0 0 10 1 8 7 10 5 21 4 30 5 9 9 29 4 4 15 69 6 75 71 80 56 68 28 26 40 69 45 55
gma-miR171i-5p AUAAGAAAGCAAUGCUCAAA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR171j-3p UGAUUGAGCCGUGCCAAUAUC 21 4,592 128 366 4    57 52 25 14 0 4 29 250 76 59 68 104 39 88 16 75 23 14 51 106 109 50 81 343 21 253 305 366 289 364 220 192 207 153 311 178
gma-miR171j-5p UAUUGGCCUGGUUCACUCAGA 21 4,004 111 311 16    0 0 0 0 0 0 0 103 197 134 90 91 140 89 16 107 25 62 54 125 23 61 60 311 82 310 179 181 273 238 176 158 166 167 165 221
gma-miR171k-3p UUGAGCCGCGCCAAUAUCACU 21 1,183 33 90 1    0 0 0 0 0 0 1 7 4 18 8 18 6 76 1 75 18 9 21 78 9 14 49 90 9 76 73 63 76 64 42 45 45 56 75 57
gma-miR171k-5p CGAUGUUGGUGAGGUUCAAUC 21 245 7 38 1    11 0 0 0 12 0 0 11 0 0 2 6 9 5 1 6 1 8 1 6 2 2 6 10 10 11 19 10 7 8 10 11 7 9 38 6
gma-miR171l CGAUGUUGGUGAGGUUCAAUC 21 245 7 38 1    11 0 0 0 12 0 0 11 0 0 2 6 9 5 1 6 1 8 1 6 2 2 6 10 10 11 19 10 7 8 10 11 7 9 38 6
gma-miR171m UUGAGCCGCGUCAAUAUCUCA 21 7,704 214 2,498 6    1,942 2,498 0 128 0 7 382 71 8 16 29 75 14 157 6 82 30 11 59 157 12 34 108 168 9 175 169 161 175 164 153 164 122 155 119 144
gma-miR171n UUGAGCCGCGUCAAUAUCUUA 21 3,554 99 310 2    310 248 12 0 0 0 10 33 16 10 2 23 86 235 10 88 28 190 209 201 113 61 173 137 86 120 116 108 96 119 154 144 142 125 74 75
gma-miR171o-3p UUGAGCCGUGCCAAUAUCACA 21 8,630 240 908 2    0 0 0 0 0 0 2 160 50 34 12 64 10 194 52 500 154 17 75 266 29 136 132 700 45 470 908 679 507 591 427 429 449 708 448 382
gma-miR171o-5p AGAUAUUGGUACGGUUCAAUC 21 1,106 31 144 6    0 0 12 0 0 0 14 144 7 10 12 6 30 34 12 36 17 14 21 52 13 26 9 50 20 38 63 97 37 61 47 44 38 36 63 43
gma-miR171p UUGAGCCGCGUCAAUAUCUUA 21 3,554 99 310 2    310 248 12 0 0 0 10 33 16 10 2 23 86 235 10 88 28 190 209 201 113 61 173 137 86 120 116 108 96 119 154 144 142 125 74 75
gma-miR171q UUGAGCCGUGCCAAUAUCACA 21 8,630 240 908 2    0 0 0 0 0 0 2 160 50 34 12 64 10 194 52 500 154 17 75 266 29 136 132 700 45 470 908 679 507 591 427 429 449 708 448 382
gma-miR171r CGAGCCGAAUCAAUACCACUC 21 531 15 79 1    0 0 0 0 0 0 45 55 0 1 1 1 3 24 12 79 24 8 51 52 9 35 51 7 1 4 17 6 7 12 1 6 12 6 0 1
gma-miR171s CGAGCCGAAUCAAUACCACUC 21 531 15 79 1    0 0 0 0 0 0 45 55 0 1 1 1 3 24 12 79 24 8 51 52 9 35 51 7 1 4 17 6 7 12 1 6 12 6 0 1
gma-miR171t UUGAGCCGCGUCAAUAUCUCA 21 7,704 214 2,498 6    1,942 2,498 0 128 0 7 382 71 8 16 29 75 14 157 6 82 30 11 59 157 12 34 108 168 9 175 169 161 175 164 153 164 122 155 119 144
gma-miR171u UGAUUGAGCCGUGCCAAUAUC 21 4,592 128 366 4    57 52 25 14 0 4 29 250 76 59 68 104 39 88 16 75 23 14 51 106 109 50 81 343 21 253 305 366 289 364 220 192 207 153 311 178
gma-miR172a AGAAUCUUGAUGAUGCUGCAU 21 25,969 721 17,498 3    209 132 41 72 3 0 147 17,498 4 0 20 19 82 370 26 150 53 63 68 154 79 64 167 473 64 447 870 976 463 556 587 501 504 352 453 302
gma-miR172b-3p AGAAUCUUGAUGAUGCUGCAU 21 25,969 721 17,498 3    209 132 41 72 3 0 147 17,498 4 0 20 19 82 370 26 150 53 63 68 154 79 64 167 473 64 447 870 976 463 556 587 501 504 352 453 302
gma-miR172b-5p GUAGCAUCAUCAAGAUUCAC 20 886 25 121 1    0 0 0 0 0 0 1 27 0 0 1 4 96 18 5 7 12 97 9 2 109 7 9 14 121 20 84 82 24 49 22 25 10 9 16 6
gma-miR172c GGAAUCUUGAUGAUGCUGCAG 21 3,774 105 3,043 1    218 198 0 33 108 3,043 7 59 51 14 15 10 0 1 0 1 0 0 0 1 0 1 0 2 0 3 1 1 0 0 2 5 0 0 0 0
gma-miR172d GGAAUCUUGAUGAUGCUGCAGCAG 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR172e GGAAUCUUGAUGAUGCUGCAGCAG 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR172f AGAAUCUUGAUGAUGCUGCA 20 428 12 302 1    0 0 0 0 0 0 0 302 1 1 0 1 2 5 0 2 0 0 1 6 6 2 2 3 13 6 12 10 6 6 7 6 8 6 12 2
gma-miR172g GCAGCACCAUCAAGAUUCAC 20 45 1 11 1    0 0 0 0 0 0 0 1 0 1 1 0 0 5 5 1 11 0 1 0 1 3 2 2 0 1 3 3 0 0 1 1 1 0 1 0
gma-miR172h-3p AGAAUCUUGAUGAUGCUGCAU 21 25,969 721 17,498 3    209 132 41 72 3 0 147 17,498 4 0 20 19 82 370 26 150 53 63 68 154 79 64 167 473 64 447 870 976 463 556 587 501 504 352 453 302
gma-miR172h-5p GCAGCAGCAUCAAGAUUCACA 21 265 7 59 1    0 0 0 0 0 0 0 59 0 0 0 0 1 16 2 4 6 3 2 5 5 2 5 8 1 7 43 32 4 15 20 12 8 3 1 1
gma-miR172i-3p GGAAUCUUGAUGAUGCUGCAU 21 35 1 16 1    0 0 0 0 0 4 0 16 0 0 0 1 0 2 0 1 0 0 1 0 0 1 0 1 0 1 2 0 0 0 1 2 0 2 0 0
gma-miR172i-5p GCAGCAGCAUCAAGAUUCACA 21 265 7 59 1    0 0 0 0 0 0 0 59 0 0 0 0 1 16 2 4 6 3 2 5 5 2 5 8 1 7 43 32 4 15 20 12 8 3 1 1
gma-miR172j GCAGCAGCAUCAAGAUUCACA 21 265 7 59 1    0 0 0 0 0 0 0 59 0 0 0 0 1 16 2 4 6 3 2 5 5 2 5 8 1 7 43 32 4 15 20 12 8 3 1 1
gma-miR172k UGAAUCUUGAUGAUGCUGCAU 21 1,249 35 1,156 1    20 0 0 0 0 0 9 1,156 3 0 0 0 0 6 0 5 0 5 1 4 3 1 1 1 3 3 3 11 1 2 2 2 5 2 0 0
gma-miR172l GGAAUCUUGAUGAUGCUGCAU 21 35 1 16 1    0 0 0 0 0 4 0 16 0 0 0 1 0 2 0 1 0 0 1 0 0 1 0 1 0 1 2 0 0 0 1 2 0 2 0 0
gma-miR2107 CAAACCUCCGUAGCCUGUAUC 21 3 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1
gma-miR2108a UUAAUGUGUUGUGUUUGUCGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR2108b UUAAUGUGUUGUGUUUGUGAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR2109-3p GGAGGCGUAGAUACUCACACC 21 136,814 3,800 16,131 5    97 122 28 93 0 0 5 20 1,964 1,955 6,696 5,678 11,840 479 468 854 1,298 11,433 432 383 15,490 744 394 2,217 13,901 4,154 16,131 6,865 3,180 7,437 5,989 5,801 4,965 1,113 3,267 1,321
gma-miR2109-5p UGCGAGUGUCUUCGCCUCUG 20 197 5 23 1    11 0 0 0 0 0 0 6 3 7 8 17 14 0 0 3 1 23 1 1 21 1 0 1 18 3 10 14 6 8 3 6 2 2 4 3
gma-miR2111a GUCCUUGGGAUGCAGAUUACG 21 1,332 37 601 1    315 219 0 601 7 1 40 72 0 0 0 0 8 1 0 0 0 3 0 0 0 0 1 2 0 3 3 9 2 8 5 11 7 2 9 3
gma-miR2111b UAAUCUGCAUCCUGAGGUUUA 21 8,559 238 1,083 2    40 0 0 30 0 0 3 16 16 5 7 16 2 42 29 84 30 0 44 106 0 29 287 453 0 321 547 903 381 481 1,065 980 659 315 1,083 585
gma-miR2111c UAAUCUGCAUCCUGAGGUUUA 21 8,559 238 1,083 2    40 0 0 30 0 0 3 16 16 5 7 16 2 42 29 84 30 0 44 106 0 29 287 453 0 321 547 903 381 481 1,065 980 659 315 1,083 585
gma-miR2111d GUCCUUGGGAUGCAGAUUACG 21 1,332 37 601 1    315 219 0 601 7 1 40 72 0 0 0 0 8 1 0 0 0 3 0 0 0 0 1 2 0 3 3 9 2 8 5 11 7 2 9 3
gma-miR2111e UAAUCUGCAUCCUGAGGUUUA 21 8,559 238 1,083 2    40 0 0 30 0 0 3 16 16 5 7 16 2 42 29 84 30 0 44 106 0 29 287 453 0 321 547 903 381 481 1,065 980 659 315 1,083 585
gma-miR2111f UAAUCUGCAUCCUGAGGUUUA 21 8,559 238 1,083 2    40 0 0 30 0 0 3 16 16 5 7 16 2 42 29 84 30 0 44 106 0 29 287 453 0 321 547 903 381 481 1,065 980 659 315 1,083 585
gma-miR2118a-3p UUGCCGAUUCCACCCAUUCCU 21 3,399 94 309 1    0 0 10 0 15 3 1 13 31 22 13 22 8 250 42 81 54 21 234 309 27 102 251 182 23 135 150 239 177 176 155 161 137 111 140 104
gma-miR2118a-5p GGAGAUGGGAGGGUCGGUAAAG 22 35,240 979 4,776 143    1,977 1,087 2,968 4,776 0 0 1,591 1,638 194 183 441 392 1,783 280 153 272 333 1,260 254 405 812 143 373 443 1,664 836 2,564 1,496 895 1,538 1,220 1,250 862 260 612 285
gma-miR2118b-3p UUGCCGAUUCCACCCAUUCCU 21 3,399 94 309 1    0 0 10 0 15 3 1 13 31 22 13 22 8 250 42 81 54 21 234 309 27 102 251 182 23 135 150 239 177 176 155 161 137 111 140 104
gma-miR2118b-5p GGAGAUGGGAGGGUCGGUAAAG 22 35,240 979 4,776 143    1,977 1,087 2,968 4,776 0 0 1,591 1,638 194 183 441 392 1,783 280 153 272 333 1,260 254 405 812 143 373 443 1,664 836 2,564 1,496 895 1,538 1,220 1,250 862 260 612 285
gma-miR2119 UCAAAGGGAGUUGUAGGGGAA 21 2,511 70 313 2    84 99 0 44 0 0 33 174 37 0 2 8 14 55 148 207 166 313 215 74 83 127 161 15 173 16 20 23 41 42 23 20 6 23 31 34
gma-miR2606a AAAAGCACUUAAGGAACGGUA 21 61 2 33 1    0 0 0 27 0 1 33 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR2606b AAAAGCACUUAAGGAACGGUA 21 61 2 33 1    0 0 0 27 0 1 33 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR319a UUGGACUGAAGGGAGCUCCC 20 72,361 2,010 22,262 1    0 0 8 0 5 146 1 4 4,404 12,315 16,349 22,262 261 359 116 852 495 233 274 1,677 422 251 717 765 194 1,193 1,675 500 454 1,505 805 797 826 310 1,257 929
gma-miR319b UUGGACUGAAGGGAGCUCCC 20 72,361 2,010 22,262 1    0 0 8 0 5 146 1 4 4,404 12,315 16,349 22,262 261 359 116 852 495 233 274 1,677 422 251 717 765 194 1,193 1,675 500 454 1,505 805 797 826 310 1,257 929
gma-miR319c UUGGACUGAAGGGAGCUCCU 20 288 8 73 1    0 0 0 0 1 1 0 0 52 67 52 73 0 0 1 1 2 5 1 5 1 0 2 2 5 2 1 3 1 2 2 2 1 0 1 2
gma-miR319d UGGACUGAAGGGGAGCUCCUUC 22 29,957 832 6,287 20    0 0 0 0 0 25 0 20 1,157 5,303 4,818 6,287 1,081 136 361 242 166 489 80 513 903 56 372 550 596 1,017 974 301 308 609 147 235 579 211 1,651 770
gma-miR319e UUGGACUGAAGGGAGCUCCC 20 72,361 2,010 22,262 1    0 0 8 0 5 146 1 4 4,404 12,315 16,349 22,262 261 359 116 852 495 233 274 1,677 422 251 717 765 194 1,193 1,675 500 454 1,505 805 797 826 310 1,257 929
gma-miR319f UUGGACUGAAGGGGCCUCUU 20 2,546 71 1,070 1    0 0 0 0 1 0 0 37 139 312 1,070 859 2 8 2 8 3 1 1 27 1 1 22 1 1 6 11 6 1 3 0 4 3 9 1 6
gma-miR319g UUGGACUGAAGGGAGCUCCUUC 22 3,912 109 612 1    0 0 0 0 1 6 0 0 67 504 332 612 65 35 62 138 105 100 59 148 62 52 88 104 84 170 172 71 59 155 85 90 88 53 177 168
gma-miR319h UUGGACUGAAGGGAGCUCCCU 21 70,293 1,953 30,717 1    0 0 0 0 4 133 1 40 6,572 6,628 22,569 30,717 126 74 18 143 73 94 24 240 115 19 105 177 100 324 406 137 110 294 177 175 229 70 224 175
gma-miR319i UUGGACUGAAGGGGAGCUCCUUC 23 1,823 51 248 9    0 0 0 0 0 0 0 0 22 248 104 131 46 18 30 73 48 12 9 38 18 11 32 85 21 185 122 36 44 130 38 39 86 29 78 90
gma-miR319j UUGGACUGAAGGGAGCUCCCU 21 70,293 1,953 30,717 1    0 0 0 0 4 133 1 40 6,572 6,628 22,569 30,717 126 74 18 143 73 94 24 240 115 19 105 177 100 324 406 137 110 294 177 175 229 70 224 175
gma-miR319k UUGGACUGAAGGGAGCUCCCU 21 70,293 1,953 30,717 1    0 0 0 0 4 133 1 40 6,572 6,628 22,569 30,717 126 74 18 143 73 94 24 240 115 19 105 177 100 324 406 137 110 294 177 175 229 70 224 175
gma-miR319l UUGGACUGAAGGGAGCUCCUUC 22 3,912 109 612 1    0 0 0 0 1 6 0 0 67 504 332 612 65 35 62 138 105 100 59 148 62 52 88 104 84 170 172 71 59 155 85 90 88 53 177 168
gma-miR319m UUGGACUGAAGGGAGCUCCCU 21 70,293 1,953 30,717 1    0 0 0 0 4 133 1 40 6,572 6,628 22,569 30,717 126 74 18 143 73 94 24 240 115 19 105 177 100 324 406 137 110 294 177 175 229 70 224 175
gma-miR319n UUUGGACCGAAGGGAGCCCCU 21 5,800 161 863 1    0 0 0 0 0 0 1 6 46 863 251 737 82 257 20 227 75 176 86 272 91 61 117 134 72 221 241 102 150 174 313 253 259 123 171 219
gma-miR319o UGGACUGAAGGGGAGCUCCUUC 22 29,957 832 6,287 20    0 0 0 0 0 25 0 20 1,157 5,303 4,818 6,287 1,081 136 361 242 166 489 80 513 903 56 372 550 596 1,017 974 301 308 609 147 235 579 211 1,651 770
gma-miR319p UUUUGGACUGAAGGGAGCUCC 21 5,396 150 2,040 1    13 12 0 0 532 0 1 0 2,040 920 474 865 32 12 9 21 12 4 13 20 32 5 14 20 10 28 53 48 26 29 26 27 31 24 23 20
gma-miR319q UGGACUGAAGGGAGCUCCUUC 21 49,660 1,379 12,758 4    0 0 0 0 0 1,128 0