Soybean miRNA Abundances

The data below are based on the microRNAs listed in the Sanger registry. Adjust libraries/reads to display on the control panel.

        

        miRNA         miRNA sequence Len Sum (norm) Average Max Min (>0)  RImSCsWImSCsWImCOs55ImSCsemsSCsemsWSs15dAFsRSLIsAntW82_1OvaW82_1FlBW82_1OpFlW82_1WW3023_1WW3023_2WW3023_3WW3309_2WW3309_3WS3023_1WS3023_2WS3023_3WS3309_1WS3309_2WS3309_3W82CChi_1WW3309_1W82Chi_1DasCChi_1DasChi_1VicCChi_1VicChi_1W82CFlag_1W82Flag_1DasCFlag_1DasFlag_1VinCFlag_1VinFlag_1
gma-miR1507a UCUCAUUCCAUACAUCGUCUGA 22 14,882,554 413,404 1,162,551 120    115,476 81,959 88,900 37,488 120 461 71,189 163,858 89,302 124,002 152,976 225,489 65,742 352,737 223,347 684,301 378,966 78,215 496,267 458,864 211,587 559,987 333,965 798,709 59,577 940,883 794,855 616,936 820,039 748,704 714,937 741,270 645,366 884,886 958,643 1,162,551
gma-miR1507b UCUCAUUCCAUACAUCGUCUG 21 16,338 454 1,590 2    418 356 200 300 2 10 84 205 415 797 1,102 1,590 936 340 502 302 218 427 432 546 313 247 191 548 328 496 408 411 579 469 455 502 425 352 705 727
gma-miR1507c-3p CCUCAUUCCAAACAUCAUCU 20 3,094 119 323 1    0 0 0 0 0 0 0 0 1 1 0 2 3 193 24 74 61 7 323 266 0 128 113 162 3 93 159 133 211 217 290 254 116 85 92 83
gma-miR1507c-5p GAGGUGUUUGGGAUGAGAGAA 21 2,008 59 426 8    37 31 26 29 0 0 8 79 31 30 31 37 338 10 15 41 30 218 11 58 182 10 45 22 426 20 35 36 16 27 38 40 9 9 19 14
gma-miR1508a UCUAGAAAGGGAAAUAGCAGUUG 23 4 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 1 0 0 0 1 0
gma-miR1508b UAGAAAGGGGAAUAGCAGUUG 21 59 3 11 1    0 0 0 0 6 11 0 3 0 0 0 0 0 2 2 1 2 0 3 5 1 1 6 0 0 0 3 4 1 1 0 4 0 1 1 1
gma-miR1508c UAGAAAGGGAAAUAGCAGUUG 21 99,273 2,758 8,056 14    1,232 627 4,520 362 604 4,023 738 5,540 33 26 14 21 99 3,709 1,324 2,103 1,947 253 3,636 3,185 158 2,656 5,116 4,751 115 4,680 4,200 7,311 4,607 3,926 3,807 4,058 4,620 4,072 8,056 3,144
gma-miR1509a UUAAUCAAGGAAAUCACGGUCG 22 260,169 7,652 59,263 51    59,263 46,258 57,395 10,365 0 0 28,353 30,384 3,265 1,623 616 2,615 1,061 138 51 146 83 1,285 85 141 3,848 66 285 889 1,309 956 1,249 806 808 710 712 740 936 585 2,346 797
gma-miR1509b UUAAUCAAGGAAAUCACGGUU 21 473 15 45 2    13 10 25 0 0 0 45 45 23 5 7 8 6 14 2 4 2 0 5 7 9 3 9 24 0 13 22 19 20 13 25 11 19 17 33 15
gma-miR1510a-3p UUGUUGUUUUACCUAUUCCACCC 23 43 3 8 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 1 1 0 0 2 1 0 1 5 5 5 8 1 0 3 2 4 2
gma-miR1510a-5p AGGGAUAGGUAAAACAAUGACUGC 24 1,728 102 707 1    0 54 114 230 707 312 0 109 0 0 0 0 16 13 32 0 0 16 13 13 0 0 0 19 0 21 0 1 0 0 27 31 0 0 0 0
gma-miR1510b-3p UGUUGUUUUACCUAUUCCACC 21 81,568 2,266 8,213 59    134 97 655 459 478 296 59 160 1,570 751 1,277 1,480 1,462 2,776 250 1,174 831 1,123 1,762 2,237 2,103 962 3,125 3,226 1,013 2,490 8,213 7,526 4,134 6,837 4,713 4,265 4,195 2,641 4,291 2,803
gma-miR1510b-5p AGGGAUAGGUAAAACAACUACU 22 173,312 4,814 31,711 34    5,655 2,800 24,206 31,711 34 54 511 907 1,028 871 997 1,579 3,700 4,258 697 3,020 2,096 5,139 1,808 5,519 4,520 1,927 3,389 4,611 4,151 5,931 8,460 5,299 3,796 4,693 5,310 5,065 4,519 3,901 5,270 5,880
gma-miR1511 AACCAGGCUCUGAUACCAUG 20 2,839 84 240 4    35 0 10 24 14 0 4 25 100 117 124 109 143 35 44 28 9 96 28 31 24 5 11 119 35 105 170 211 240 222 147 131 64 104 134 141
gma-miR1512a-3p GCUUUAAGAAUUUCAGUUAUG 21 15 2 5 1    0 0 0 0 5 0 2 1 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 1 0 0 1 0 0 0
gma-miR1512a-5p UAACUGAAAAUUCUUAAAGUAU 22 1 1 1 1    0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1512b UAACUGGAAAUUCUUAAAGCAU 22 1,879 57 173 3    20 12 0 21 0 0 4 23 23 65 20 173 41 37 3 66 16 83 8 24 18 9 25 123 135 108 32 21 63 83 87 87 98 29 172 150
gma-miR1512c UAACUGAACAUUCUUAGAGCAU 22 959,928 106,659 334,398 1    242,823 334,398 360 310,875 0 0 70,513 757 0 0 1 199 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2
gma-miR1513a-3p UUUAAAUGUGUAUAAGUCAUGGU 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1513a-5p UGAGAGAAAGCCAUGACUUAC 21 14,855 424 1,687 7    35 54 69 13 0 7 30 131 39 19 24 40 38 167 50 212 153 36 106 156 41 167 119 1,012 36 630 1,687 1,478 1,168 1,329 802 822 925 1,291 1,053 916
gma-miR1513b UGAGAGAAAGCCAUGACUUAC 21 14,855 424 1,687 7    35 54 69 13 0 7 30 131 39 19 24 40 38 167 50 212 153 36 106 156 41 167 119 1,012 36 630 1,687 1,478 1,168 1,329 802 822 925 1,291 1,053 916
gma-miR1513c UAUGAGAGAAAGCCAUGAC 19 2 1 1 1    0 0 0 0 0 0 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1514a-3p AUGCCUAUUUUAAAAUGAAAA 21 300 12 36 1    0 0 0 0 0 0 0 0 7 0 2 0 6 5 1 1 2 4 3 4 3 2 4 18 1 17 19 33 26 17 36 24 16 9 23 17
gma-miR1514a-5p UUCAUUUUUAAAAUAGGCAUU 21 216 8 20 1    0 0 0 0 0 0 0 0 10 5 2 4 4 7 0 4 1 18 3 5 20 3 3 10 7 9 16 3 7 13 9 3 12 11 8 19
gma-miR1514b-3p AUGCCUAUUUUAAAAUGAAAA 21 300 12 36 1    0 0 0 0 0 0 0 0 7 0 2 0 6 5 1 1 2 4 3 4 3 2 4 18 1 17 19 33 26 17 36 24 16 9 23 17
gma-miR1514b-5p UUCAUUUUUAAAAUAGACAUU 21 7 1 2 1    0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 1 0 1 0 1 0
gma-miR1515a UCAUUUUGCGUGCAAUGAUCUG 22 6,844 207 759 6    77 64 38 0 0 0 6 27 261 214 92 316 686 116 270 106 132 759 102 118 673 106 150 135 574 150 149 210 160 165 227 187 174 134 145 121
gma-miR1515b UCAUUUUGCGUGCAAUGAUCUG 22 6,844 207 759 6    77 64 38 0 0 0 6 27 261 214 92 316 686 116 270 106 132 759 102 118 673 106 150 135 574 150 149 210 160 165 227 187 174 134 145 121
gma-miR1516a-3p CAAAAGAGCUUAUGGCUUGUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1516a-5p CAAGUUAUAAGCUCUUUUGAGAG 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1516b AGCUUCUCUACAGAAAAUAUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1516c AAUGUCUGGGCUUAGCGAGGCGGU 24 6 2 3 1    0 0 0 0 1 3 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1516d GUACUUGUGGCUUGUAUCCAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1517 AGUCUUGGUCAAUGUCGUUCGAAA 24 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1
gma-miR1518 UGUGUUGUAAAGUGAAUAUCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1519 UAAGUGUUGCAAAAUAGUCAUU 22 3 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 1 0 0 0 0 0 0 0 0 0 0
gma-miR1520a UAGAACAUGAUACAUGACAGUCA 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1520b GUGACAGUCAUCAUUUAAUAAGA 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1520c UUCAAUAAGAACGUGACACGUGA 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1520d AUCAGAACAUGACACGUGACAA 22 2 1 1 1    0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1520e CAAUAAGAACGUGACAUAUGACAG 24 27 7 12 1    11 0 0 12 0 0 3 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1520f-3p CAAUCAGAACAUGACACAUGACAA 24 34 4 21 1    0 0 0 21 0 0 2 4 0 1 1 0 0 0 0 0 0 0 0 0 2 0 0 1 0 0 0 1 0 0 0 1 0 0 0 0
gma-miR1520f-5p AUUGUCACGUGUCAUGUUCUGAUU 24 810 27 62 1    0 0 0 0 2 0 1 0 39 57 20 43 53 11 13 34 16 24 6 16 36 11 8 38 57 62 21 25 35 23 22 20 22 34 28 33
gma-miR1520g CAAUCAGAACAUGACACGUGACAA 24 80 13 36 1    20 0 15 36 0 0 7 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 1 0
gma-miR1520h AACGUCCAAUCAGAACGUGACAUG 24 1 1 1 1    0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1520i AACGUGACACGUGACGGUCAACAU 24 4 4 4 4    0 0 0 0 0 0 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1520j AAGAACGUGACACAUGACAAUCAA 24 7 2 3 1    0 0 0 0 0 0 2 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 0 0 0 0
gma-miR1520k AAUCAGAACAUGACACAUGACAGU 24 191 6 30 1    0 0 15 14 1 19 5 6 9 30 7 6 3 2 0 7 3 0 2 3 1 2 2 8 0 7 4 10 1 5 4 4 3 5 1 2
gma-miR1520l AAUCAGAACAUGACACGUGAUAGU 24 281 9 33 1    18 9 23 23 0 11 10 10 7 33 9 3 8 7 0 5 2 5 1 5 3 3 7 3 2 11 10 9 0 8 5 5 7 6 6 7
gma-miR1520m AAUCAGAACAUGACAUGUGACAAU 24 10 2 3 1    0 0 0 0 0 1 3 0 0 1 2 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0
gma-miR1520n UCAAUCAGAACAUGACACGUGACA 24 106 4 10 1    0 0 10 0 0 0 10 6 1 4 2 1 2 4 1 4 0 0 1 1 1 1 1 4 0 7 3 6 6 7 5 2 2 3 4 7
gma-miR1520o UCAUCGUCCAAUCAGAAUGUGACA 24 18 1 3 1    0 0 0 0 0 0 0 0 1 1 1 1 1 0 0 2 0 0 0 0 0 0 0 0 0 1 3 0 1 3 1 1 0 0 1 0
gma-miR1520p AUGUUGUUAUUGGAUGAUGACGGU 24 3 3 3 3    0 0 0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1520q AUUGACCAAUCAGAACAUGACACA 24 17 1 3 1    0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 1 0 0 1 0 0 0 2 1 0 1 1 1 0 1 1 1 0 1 1 1
gma-miR1520r UGUCACAUCCUGGUUGGACAUGAA 24 2 1 1 1    0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0
gma-miR1521a CUGUUAAUGGAAAAUGUUGA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1521b GACUGUCACGUGUCAUAAUCAUA 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1522 UUUAUUGCUUAAAAUGAAAU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1523a AUGGGAUAAAUGUGAGCUCA 20 15 2 5 1    0 0 0 0 0 0 0 0 0 0 0 0 5 0 0 1 1 0 0 1 0 0 0 0 0 2 0 1 0 1 0 0 2 1 0 0
gma-miR1523b UCAUCGCUCCUGAGCUCACA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1524 CGAGUCCGAGGAAGGAACUCC 21 23 2 4 1    0 0 0 0 0 0 0 0 0 3 0 0 1 0 1 0 0 0 0 0 1 0 0 1 0 1 0 2 2 4 4 1 1 0 1 0
gma-miR1525 UGGGUUAAUUAAGUUUUUAGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1526 CCGGAAGAGGAAAAUUAAGCAA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1527 UAACUCAACCUUACAAAACC 20 2 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0
gma-miR1528 AUAGAUUAGAUCAAUAUAUUAGU 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1529 UUAAAGGAAACAAUUAAUCGUUA 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1530 UUUUCACAUAAAUUAAAAUAU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1531-3p UCGUCCAUAUGGGAAGACUUGUC 23 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1531-5p AUAUGGACGAAGAGAUAGGUAAAU 24 441 13 76 1    0 0 40 21 3 5 15 1 47 42 9 11 1 3 0 76 25 1 1 3 26 9 26 5 31 6 3 3 2 2 4 4 2 2 4 8
gma-miR1532 AACACGCUAAGCGAGAGGAGCUC 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1533 AUAAUAAAAAUAAUAAUGA 19 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1534 UAUUUUGGGUAAAUAGUCAU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR1535a CUUGUUUGUGGUGAUGUCU 19 21 2 5 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 1 0 3 0 0 5 0 2 0 0 2 4 1 2 0
gma-miR1535b CUUGUUUGUGGUGAUGUCUAG 21 5,556 185 965 1    26 0 0 0 0 1 3 89 0 0 1 2 20 138 965 388 431 114 382 159 59 356 289 178 98 214 131 145 170 193 252 271 267 79 78 57
gma-miR1536 AAGCAGAGACAAAUGUGUUUA 21 6 1 2 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 0 2 0 0 1 0 0 0
gma-miR156a UGACAGAAGAGAGUGAGCAC 20 499,401 14,269 102,873 46    14,186 11,414 102,873 59,047 0 1,214 56,622 75,297 192 46 234 565 16,960 1,281 1,459 1,892 1,786 15,054 2,451 2,168 10,377 1,853 1,215 9,226 19,428 9,020 9,882 8,197 9,568 7,833 8,597 7,868 7,046 5,751 10,461 8,338
gma-miR156aa AUUGGAGUGAAGGGAGCU 18 49 16 45 1    0 0 0 0 0 0 0 45 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0
gma-miR156ab AUUUAAGUGAUGGGAGCUCCG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR156b UGACAGAAGAGAGAGAGCACA 21 38 8 28 1    0 0 28 0 0 0 7 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0
gma-miR156c UUGACAGAAGAUAGAGAGCAC 21 145,758 4,049 28,906 31    28,906 10,702 124 20,158 31 46 6,815 12,995 9,991 114 1,006 543 800 747 474 1,340 983 1,043 1,362 1,006 1,592 1,183 889 3,396 1,009 3,553 4,169 2,756 3,353 4,031 2,865 2,913 3,711 2,361 4,358 4,433
gma-miR156d UUGACAGAAGAUAGAGAGCAC 21 145,758 4,049 28,906 31    28,906 10,702 124 20,158 31 46 6,815 12,995 9,991 114 1,006 543 800 747 474 1,340 983 1,043 1,362 1,006 1,592 1,183 889 3,396 1,009 3,553 4,169 2,756 3,353 4,031 2,865 2,913 3,711 2,361 4,358 4,433
gma-miR156e UUGACAGAAGAUAGAGAGCAC 21 145,758 4,049 28,906 31    28,906 10,702 124 20,158 31 46 6,815 12,995 9,991 114 1,006 543 800 747 474 1,340 983 1,043 1,362 1,006 1,592 1,183 889 3,396 1,009 3,553 4,169 2,756 3,353 4,031 2,865 2,913 3,711 2,361 4,358 4,433
gma-miR156f UUGACAGAAGAGAGAGAGCACA 22 143 36 99 2    0 0 99 0 0 2 31 11 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR156g ACAGAAGAUAGAGAGCACAG 20 1,454 50 702 1    702 99 0 149 0 0 89 170 4 0 1 0 3 1 0 5 0 1 1 5 1 3 4 18 1 23 19 13 11 16 10 8 21 26 26 24
gma-miR156h UGACAGAAGAGAGUGAGCAC 20 499,401 14,269 102,873 46    14,186 11,414 102,873 59,047 0 1,214 56,622 75,297 192 46 234 565 16,960 1,281 1,459 1,892 1,786 15,054 2,451 2,168 10,377 1,853 1,215 9,226 19,428 9,020 9,882 8,197 9,568 7,833 8,597 7,868 7,046 5,751 10,461 8,338
gma-miR156i UUGACAGAAGAUAGAGAGCAC 21 145,758 4,049 28,906 31    28,906 10,702 124 20,158 31 46 6,815 12,995 9,991 114 1,006 543 800 747 474 1,340 983 1,043 1,362 1,006 1,592 1,183 889 3,396 1,009 3,553 4,169 2,756 3,353 4,031 2,865 2,913 3,711 2,361 4,358 4,433
gma-miR156j UUGACAGAAGAUAGAGAGCAC 21 145,758 4,049 28,906 31    28,906 10,702 124 20,158 31 46 6,815 12,995 9,991 114 1,006 543 800 747 474 1,340 983 1,043 1,362 1,006 1,592 1,183 889 3,396 1,009 3,553 4,169 2,756 3,353 4,031 2,865 2,913 3,711 2,361 4,358 4,433
gma-miR156k UUGACAGAAGAGAGUGAGCAC 21 23,179 662 3,355 1    103 109 3,355 79 1 0 814 1,614 14 8 8 12 2,027 325 152 341 278 2,279 708 736 993 508 380 598 2,170 541 594 438 564 462 546 468 434 316 612 592
gma-miR156l UUGACAGAAGAUAGAGAGCAC 21 145,758 4,049 28,906 31    28,906 10,702 124 20,158 31 46 6,815 12,995 9,991 114 1,006 543 800 747 474 1,340 983 1,043 1,362 1,006 1,592 1,183 889 3,396 1,009 3,553 4,169 2,756 3,353 4,031 2,865 2,913 3,711 2,361 4,358 4,433
gma-miR156m UUGACAGAAGAUAGAGAGCAC 21 145,758 4,049 28,906 31    28,906 10,702 124 20,158 31 46 6,815 12,995 9,991 114 1,006 543 800 747 474 1,340 983 1,043 1,362 1,006 1,592 1,183 889 3,396 1,009 3,553 4,169 2,756 3,353 4,031 2,865 2,913 3,711 2,361 4,358 4,433
gma-miR156n UUGACAGAAGAGAGUGAGCAC 21 23,179 662 3,355 1    103 109 3,355 79 1 0 814 1,614 14 8 8 12 2,027 325 152 341 278 2,279 708 736 993 508 380 598 2,170 541 594 438 564 462 546 468 434 316 612 592
gma-miR156o UUGACAGAAGAGAGUGAGCAC 21 23,179 662 3,355 1    103 109 3,355 79 1 0 814 1,614 14 8 8 12 2,027 325 152 341 278 2,279 708 736 993 508 380 598 2,170 541 594 438 564 462 546 468 434 316 612 592
gma-miR156p UUGACAGAAGAAAGGGAGCAC 21 9,096 268 4,970 2    1,353 1,603 0 4,970 60 26 761 126 2 5 6 5 0 7 5 7 6 13 10 5 8 5 4 4 7 2 2 4 6 6 16 18 8 8 20 8
gma-miR156q UGACAGAAGAGAGUGAGCACU 21 14,169 394 2,213 5    827 865 46 2,213 11 5 337 179 10 20 53 103 987 113 96 161 222 674 74 133 617 83 91 431 1,228 383 641 462 448 474 396 385 361 245 408 387
gma-miR156r CUGACAGAAGAUAGAGAGCAU 21 704 26 203 1    112 12 0 0 0 0 9 58 0 0 12 42 0 1 0 1 0 15 4 8 3 1 5 2 2 16 2 3 1 4 203 122 50 2 8 6
gma-miR156s UGACAGAAGAGAGUGAGCACU 21 14,169 394 2,213 5    827 865 46 2,213 11 5 337 179 10 20 53 103 987 113 96 161 222 674 74 133 617 83 91 431 1,228 383 641 462 448 474 396 385 361 245 408 387
gma-miR156t UUGACAGAAGAAAGGGAGCAC 21 9,096 268 4,970 2    1,353 1,603 0 4,970 60 26 761 126 2 5 6 5 0 7 5 7 6 13 10 5 8 5 4 4 7 2 2 4 6 6 16 18 8 8 20 8
gma-miR156u UGACAGAAGAGAGUGAGCAC 20 499,401 14,269 102,873 46    14,186 11,414 102,873 59,047 0 1,214 56,622 75,297 192 46 234 565 16,960 1,281 1,459 1,892 1,786 15,054 2,451 2,168 10,377 1,853 1,215 9,226 19,428 9,020 9,882 8,197 9,568 7,833 8,597 7,868 7,046 5,751 10,461 8,338
gma-miR156v UGACAGAAGAGAGUGAGCAC 20 499,401 14,269 102,873 46    14,186 11,414 102,873 59,047 0 1,214 56,622 75,297 192 46 234 565 16,960 1,281 1,459 1,892 1,786 15,054 2,451 2,168 10,377 1,853 1,215 9,226 19,428 9,020 9,882 8,197 9,568 7,833 8,597 7,868 7,046 5,751 10,461 8,338
gma-miR156w UGACAGAAGAGAGUGAGCAC 20 499,401 14,269 102,873 46    14,186 11,414 102,873 59,047 0 1,214 56,622 75,297 192 46 234 565 16,960 1,281 1,459 1,892 1,786 15,054 2,451 2,168 10,377 1,853 1,215 9,226 19,428 9,020 9,882 8,197 9,568 7,833 8,597 7,868 7,046 5,751 10,461 8,338
gma-miR156x UGACAGAAGAGAGUGAGCAC 20 499,401 14,269 102,873 46    14,186 11,414 102,873 59,047 0 1,214 56,622 75,297 192 46 234 565 16,960 1,281 1,459 1,892 1,786 15,054 2,451 2,168 10,377 1,853 1,215 9,226 19,428 9,020 9,882 8,197 9,568 7,833 8,597 7,868 7,046 5,751 10,461 8,338
gma-miR156y UGACAGAAGAGAGUGAGCAC 20 499,401 14,269 102,873 46    14,186 11,414 102,873 59,047 0 1,214 56,622 75,297 192 46 234 565 16,960 1,281 1,459 1,892 1,786 15,054 2,451 2,168 10,377 1,853 1,215 9,226 19,428 9,020 9,882 8,197 9,568 7,833 8,597 7,868 7,046 5,751 10,461 8,338
gma-miR156z AUUGGAGUGAAGGGAGCU 18 49 16 45 1    0 0 0 0 0 0 0 45 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0
gma-miR159a-3p UUUGGAUUGAAGGGAGCUCUA 21 7,203,070 200,085 478,806 56    315 373 394 129 11,771 69,952 56 332 35,822 111,434 40,827 121,387 75,030 301,463 114,598 199,530 261,137 135,459 244,058 364,636 161,053 276,524 312,833 423,858 81,358 242,536 284,198 299,017 356,104 361,807 458,125 411,527 284,146 291,443 478,806 391,032
gma-miR159a-5p GAGCUCCUUGAAGUCCAAUUG 21 2,654 76 353 3    13 9 8 13 0 9 3 40 44 89 154 72 353 36 3 28 15 152 12 18 185 8 25 36 267 70 311 133 73 122 118 99 62 17 43 14
gma-miR159b-3p AUUGGAGUGAAGGGAGCUCCA 21 702 702 702 702    0 0 0 0 0 0 0 702 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR159b-5p GAGUUCCCUGCACUCCAAGUC 21 3 3 3 3    0 0 0 0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR159c AUUGGAGUGAAGGGAGCUCCG 21 3 3 3 3    0 0 0 0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR159d AGCUGCUUAGCUAUGGAUCCC 21 6,772 193 963 2    40 33 40 0 5 17 8 273 47 60 118 123 38 61 2 43 24 36 27 27 68 21 42 516 53 476 963 515 697 515 464 381 318 130 339 252
gma-miR159e-3p UUUGGAUUGAAGGGAGCUCUA 21 7,203,070 200,085 478,806 56    315 373 394 129 11,771 69,952 56 332 35,822 111,434 40,827 121,387 75,030 301,463 114,598 199,530 261,137 135,459 244,058 364,636 161,053 276,524 312,833 423,858 81,358 242,536 284,198 299,017 356,104 361,807 458,125 411,527 284,146 291,443 478,806 391,032
gma-miR159e-5p GAGCUCCUUGAAGUCCAAUU 20 1,239 35 225 1    24 12 0 22 1 1 1 8 1 3 7 10 6 225 1 34 46 4 33 57 25 16 70 19 8 24 161 137 27 74 64 62 27 20 6 3
gma-miR159f-3p AUUGGAGUGAAGGGAGCUCCA 21 702 702 702 702    0 0 0 0 0 0 0 702 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR159f-5p GAGUUCCCUGCACUCCAAGUC 21 3 3 3 3    0 0 0 0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR160a-3p GCGUAUGAGGAGCCAAGCAUA 21 1,940 59 779 1    18 10 203 19 0 8 334 779 0 0 1 6 5 8 2 6 3 5 3 3 12 1 5 17 3 16 115 71 17 68 76 69 26 9 13 9
gma-miR160a-5p UGCCUGGCUCCCUGUAUGCCA 21 158,681 4,667 19,149 6    62 66 71 24 0 0 23 341 96 243 95 150 6 7,604 591 5,092 4,962 16 1,386 4,648 32 2,130 5,678 10,888 9 8,074 12,670 19,149 12,099 13,337 11,156 10,156 7,422 5,909 8,558 5,938
gma-miR160b UGCCUGGCUCCCUGUAUGCC 20 521 19 58 2    0 0 0 0 0 0 0 0 12 18 14 14 3 16 0 13 7 4 8 18 2 7 16 36 2 17 57 58 27 32 25 17 24 17 33 24
gma-miR160c UGCCUGGCUCCCUGUAUGCC 20 521 19 58 2    0 0 0 0 0 0 0 0 12 18 14 14 3 16 0 13 7 4 8 18 2 7 16 36 2 17 57 58 27 32 25 17 24 17 33 24
gma-miR160d UGCCUGGCUCCCUGUAUGCC 20 521 19 58 2    0 0 0 0 0 0 0 0 12 18 14 14 3 16 0 13 7 4 8 18 2 7 16 36 2 17 57 58 27 32 25 17 24 17 33 24
gma-miR160e UGCCUGGCUCCCUGUAUGCC 20 521 19 58 2    0 0 0 0 0 0 0 0 12 18 14 14 3 16 0 13 7 4 8 18 2 7 16 36 2 17 57 58 27 32 25 17 24 17 33 24
gma-miR160f UGCCUGGCUCCCUGUAUGCCA 21 158,681 4,667 19,149 6    62 66 71 24 0 0 23 341 96 243 95 150 6 7,604 591 5,092 4,962 16 1,386 4,648 32 2,130 5,678 10,888 9 8,074 12,670 19,149 12,099 13,337 11,156 10,156 7,422 5,909 8,558 5,938
gma-miR162a UCGAUAAACCUCUGCAUCCA 20 2,185 73 201 1    0 0 0 0 0 1 0 13 22 16 14 44 55 61 21 42 26 48 36 72 60 24 34 84 59 55 201 142 167 152 119 98 115 116 133 155
gma-miR162b UCGAUAAACCUCUGCAUCCAG 21 62,293 1,780 4,093 51    108 90 226 62 0 51 67 855 1,003 531 590 1,230 1,695 1,449 488 1,230 425 2,568 1,420 1,637 1,903 1,122 889 3,025 1,613 4,073 3,886 2,248 3,321 2,466 3,183 3,079 4,087 3,495 4,085 4,093
gma-miR162c UCGAUAAACCUCUGCAUCCAG 21 62,293 1,780 4,093 51    108 90 226 62 0 51 67 855 1,003 531 590 1,230 1,695 1,449 488 1,230 425 2,568 1,420 1,637 1,903 1,122 889 3,025 1,613 4,073 3,886 2,248 3,321 2,466 3,183 3,079 4,087 3,495 4,085 4,093
gma-miR164a UGGAGAAGCAGGGCACGUGCA 21 42,363 1,177 8,046 62    2,864 8,046 797 1,748 705 739 4,022 1,761 354 159 62 223 63 559 256 261 552 78 188 554 236 351 610 1,697 66 1,059 1,448 1,713 1,448 1,345 1,251 1,066 869 1,016 2,904 1,293
gma-miR164b UGGAGAAGCAGGGCACGUGC 20 116 4 17 1    0 17 0 12 0 11 4 3 0 1 1 2 2 1 0 1 1 0 0 2 0 3 2 7 0 3 5 6 3 8 4 4 2 2 6 3
gma-miR164c UGGAGAAGCAGGGCACGUGC 20 116 4 17 1    0 17 0 12 0 11 4 3 0 1 1 2 2 1 0 1 1 0 0 2 0 3 2 7 0 3 5 6 3 8 4 4 2 2 6 3
gma-miR164d UGGAGAAGCAGGGCACGUGC 20 116 4 17 1    0 17 0 12 0 11 4 3 0 1 1 2 2 1 0 1 1 0 0 2 0 3 2 7 0 3 5 6 3 8 4 4 2 2 6 3
gma-miR164e UGGAGAAGCAGGGCACGUGCA 21 42,363 1,177 8,046 62    2,864 8,046 797 1,748 705 739 4,022 1,761 354 159 62 223 63 559 256 261 552 78 188 554 236 351 610 1,697 66 1,059 1,448 1,713 1,448 1,345 1,251 1,066 869 1,016 2,904 1,293
gma-miR164f UGGAGAAGCAGGGCACGUGCA 21 42,363 1,177 8,046 62    2,864 8,046 797 1,748 705 739 4,022 1,761 354 159 62 223 63 559 256 261 552 78 188 554 236 351 610 1,697 66 1,059 1,448 1,713 1,448 1,345 1,251 1,066 869 1,016 2,904 1,293
gma-miR164g UGGAGAAGCAGGGCACGUGCA 21 42,363 1,177 8,046 62    2,864 8,046 797 1,748 705 739 4,022 1,761 354 159 62 223 63 559 256 261 552 78 188 554 236 351 610 1,697 66 1,059 1,448 1,713 1,448 1,345 1,251 1,066 869 1,016 2,904 1,293
gma-miR164h UGGAGAAGCAGGGCACGUGCA 21 42,363 1,177 8,046 62    2,864 8,046 797 1,748 705 739 4,022 1,761 354 159 62 223 63 559 256 261 552 78 188 554 236 351 610 1,697 66 1,059 1,448 1,713 1,448 1,345 1,251 1,066 869 1,016 2,904 1,293
gma-miR164i UGGAGAAGCAGGGCACGUGCA 21 42,363 1,177 8,046 62    2,864 8,046 797 1,748 705 739 4,022 1,761 354 159 62 223 63 559 256 261 552 78 188 554 236 351 610 1,697 66 1,059 1,448 1,713 1,448 1,345 1,251 1,066 869 1,016 2,904 1,293
gma-miR164j UGGAGAAGCAGGGCACGUGCA 21 42,363 1,177 8,046 62    2,864 8,046 797 1,748 705 739 4,022 1,761 354 159 62 223 63 559 256 261 552 78 188 554 236 351 610 1,697 66 1,059 1,448 1,713 1,448 1,345 1,251 1,066 869 1,016 2,904 1,293
gma-miR164k UGGAGAAGCAGGGCACGUGCA 21 42,363 1,177 8,046 62    2,864 8,046 797 1,748 705 739 4,022 1,761 354 159 62 223 63 559 256 261 552 78 188 554 236 351 610 1,697 66 1,059 1,448 1,713 1,448 1,345 1,251 1,066 869 1,016 2,904 1,293
gma-miR166a-3p UCGGACCAGGCUUCAUUCCCC 21 40,941,229 1,204,154 3,734,326 21,059    76,253 154,951 61,169 116,280 0 0 21,059 34,181 357,159 445,836 275,146 388,886 667,559 694,837 3,734,326 1,836,058 1,519,430 568,846 1,810,511 1,536,989 542,183 2,162,440 1,089,927 1,900,438 508,037 2,093,605 1,534,269 1,278,048 2,023,679 1,704,574 1,950,923 1,920,358 1,422,171 1,533,924 2,221,716 2,755,461
gma-miR166a-5p GGAAUGUUGUCUGGCUCGAGG 21 74,199 2,182 13,338 131    1,016 1,311 1,138 3,490 0 0 398 2,363 1,314 1,307 1,329 2,022 9,537 502 188 354 504 8,689 462 609 8,967 255 1,361 285 13,338 494 2,438 3,470 684 1,222 1,173 1,680 610 131 1,418 140
gma-miR166b UCGGACCAGGCUUCAUUCCCC 21 40,941,229 1,204,154 3,734,326 21,059    76,253 154,951 61,169 116,280 0 0 21,059 34,181 357,159 445,836 275,146 388,886 667,559 694,837 3,734,326 1,836,058 1,519,430 568,846 1,810,511 1,536,989 542,183 2,162,440 1,089,927 1,900,438 508,037 2,093,605 1,534,269 1,278,048 2,023,679 1,704,574 1,950,923 1,920,358 1,422,171 1,533,924 2,221,716 2,755,461
gma-miR166c-3p UCGGACCAGGCUUCAUUCCCC 21 40,941,229 1,204,154 3,734,326 21,059    76,253 154,951 61,169 116,280 0 0 21,059 34,181 357,159 445,836 275,146 388,886 667,559 694,837 3,734,326 1,836,058 1,519,430 568,846 1,810,511 1,536,989 542,183 2,162,440 1,089,927 1,900,438 508,037 2,093,605 1,534,269 1,278,048 2,023,679 1,704,574 1,950,923 1,920,358 1,422,171 1,533,924 2,221,716 2,755,461
gma-miR166c-5p GGAAUGUUGUCUGGCUCGAGG 21 74,199 2,182 13,338 131    1,016 1,311 1,138 3,490 0 0 398 2,363 1,314 1,307 1,329 2,022 9,537 502 188 354 504 8,689 462 609 8,967 255 1,361 285 13,338 494 2,438 3,470 684 1,222 1,173 1,680 610 131 1,418 140
gma-miR166d UCGGACCAGGCUUCAUUCCCC 21 40,941,229 1,204,154 3,734,326 21,059    76,253 154,951 61,169 116,280 0 0 21,059 34,181 357,159 445,836 275,146 388,886 667,559 694,837 3,734,326 1,836,058 1,519,430 568,846 1,810,511 1,536,989 542,183 2,162,440 1,089,927 1,900,438 508,037 2,093,605 1,534,269 1,278,048 2,023,679 1,704,574 1,950,923 1,920,358 1,422,171 1,533,924 2,221,716 2,755,461
gma-miR166e UCGGACCAGGCUUCAUUCCCC 21 40,941,229 1,204,154 3,734,326 21,059    76,253 154,951 61,169 116,280 0 0 21,059 34,181 357,159 445,836 275,146 388,886 667,559 694,837 3,734,326 1,836,058 1,519,430 568,846 1,810,511 1,536,989 542,183 2,162,440 1,089,927 1,900,438 508,037 2,093,605 1,534,269 1,278,048 2,023,679 1,704,574 1,950,923 1,920,358 1,422,171 1,533,924 2,221,716 2,755,461
gma-miR166f UCGGACCAGGCUUCAUUCCCC 21 40,941,229 1,204,154 3,734,326 21,059    76,253 154,951 61,169 116,280 0 0 21,059 34,181 357,159 445,836 275,146 388,886 667,559 694,837 3,734,326 1,836,058 1,519,430 568,846 1,810,511 1,536,989 542,183 2,162,440 1,089,927 1,900,438 508,037 2,093,605 1,534,269 1,278,048 2,023,679 1,704,574 1,950,923 1,920,358 1,422,171 1,533,924 2,221,716 2,755,461
gma-miR166g UCGGACCAGGCUUCAUUCCCC 21 40,941,229 1,204,154 3,734,326 21,059    76,253 154,951 61,169 116,280 0 0 21,059 34,181 357,159 445,836 275,146 388,886 667,559 694,837 3,734,326 1,836,058 1,519,430 568,846 1,810,511 1,536,989 542,183 2,162,440 1,089,927 1,900,438 508,037 2,093,605 1,534,269 1,278,048 2,023,679 1,704,574 1,950,923 1,920,358 1,422,171 1,533,924 2,221,716 2,755,461
gma-miR166h-3p UCUCGGACCAGGCUUCAUUCC 21 7,578,347 216,524 579,883 17    1,698 1,202 1,379 1,298 17 0 886 2,801 268,666 344,325 321,194 579,883 89,294 163,245 506,924 306,829 293,890 72,670 280,766 280,202 76,337 265,912 211,208 298,514 65,732 256,313 288,866 302,493 320,348 307,913 317,446 342,267 187,758 231,847 312,342 275,882
gma-miR166h-5p GGAAUGUUGUUUGGCUCGAGG 21 574 19 136 1    0 0 0 0 0 136 1 124 15 33 32 58 5 3 2 4 3 7 8 10 8 1 14 1 24 3 19 21 4 6 6 14 6 1 4 1
gma-miR166i-3p UCGGACCAGGCUUCAUUCCCC 21 40,941,229 1,204,154 3,734,326 21,059    76,253 154,951 61,169 116,280 0 0 21,059 34,181 357,159 445,836 275,146 388,886 667,559 694,837 3,734,326 1,836,058 1,519,430 568,846 1,810,511 1,536,989 542,183 2,162,440 1,089,927 1,900,438 508,037 2,093,605 1,534,269 1,278,048 2,023,679 1,704,574 1,950,923 1,920,358 1,422,171 1,533,924 2,221,716 2,755,461
gma-miR166i-5p GGAAUGUCGUCUGGUUCGAG 20 2,635 94 874 1    0 0 0 0 0 0 0 163 3 0 2 8 669 20 23 11 40 171 3 2 388 4 20 7 874 8 78 67 16 19 2 9 16 7 4 1
gma-miR166j-3p UCGGACCAGGCUUCAUUCCCG 21 184,657 5,276 15,187 57    57 61 447 60 0 103 129 3,697 7,934 13,862 6,874 15,187 8,638 2,678 3,183 3,725 2,664 6,532 3,582 5,549 9,466 3,855 5,554 7,790 6,055 7,597 6,731 6,859 6,868 6,083 6,218 5,439 5,861 4,758 5,043 5,518
gma-miR166j-5p GGAAUGUUGUUUGGCUCGAGG 21 574 19 136 1    0 0 0 0 0 136 1 124 15 33 32 58 5 3 2 4 3 7 8 10 8 1 14 1 24 3 19 21 4 6 6 14 6 1 4 1
gma-miR166k UCUCGGACCAGGCUUCAUUCC 21 7,578,347 216,524 579,883 17    1,698 1,202 1,379 1,298 17 0 886 2,801 268,666 344,325 321,194 579,883 89,294 163,245 506,924 306,829 293,890 72,670 280,766 280,202 76,337 265,912 211,208 298,514 65,732 256,313 288,866 302,493 320,348 307,913 317,446 342,267 187,758 231,847 312,342 275,882
gma-miR166l GGAAUGUUGUCUGGCUCGAGG 21 74,199 2,182 13,338 131    1,016 1,311 1,138 3,490 0 0 398 2,363 1,314 1,307 1,329 2,022 9,537 502 188 354 504 8,689 462 609 8,967 255 1,361 285 13,338 494 2,438 3,470 684 1,222 1,173 1,680 610 131 1,418 140
gma-miR166m CGGACCAGGCUUCAUUCCCC 20 4,167 116 980 1    523 980 45 290 7 1 21 113 18 25 18 51 94 39 69 93 13 56 90 48 72 95 35 73 58 148 173 103 98 109 116 105 111 66 93 118
gma-miR166n UCGGACCAGGCUUCAUUCCCC 21 40,941,229 1,204,154 3,734,326 21,059    76,253 154,951 61,169 116,280 0 0 21,059 34,181 357,159 445,836 275,146 388,886 667,559 694,837 3,734,326 1,836,058 1,519,430 568,846 1,810,511 1,536,989 542,183 2,162,440 1,089,927 1,900,438 508,037 2,093,605 1,534,269 1,278,048 2,023,679 1,704,574 1,950,923 1,920,358 1,422,171 1,533,924 2,221,716 2,755,461
gma-miR166o UCGGACCAGGCUUCAUUCCCC 21 40,941,229 1,204,154 3,734,326 21,059    76,253 154,951 61,169 116,280 0 0 21,059 34,181 357,159 445,836 275,146 388,886 667,559 694,837 3,734,326 1,836,058 1,519,430 568,846 1,810,511 1,536,989 542,183 2,162,440 1,089,927 1,900,438 508,037 2,093,605 1,534,269 1,278,048 2,023,679 1,704,574 1,950,923 1,920,358 1,422,171 1,533,924 2,221,716 2,755,461
gma-miR166p UCGGACCAGGCUUCAUUCCC 20 118,188 3,283 6,693 2    380 752 340 1,108 2 60 135 406 1,238 2,812 1,522 2,225 4,432 2,045 4,561 3,419 2,727 3,117 3,721 3,124 4,272 3,797 2,212 5,123 4,093 5,138 6,278 5,340 6,693 6,154 5,406 4,985 3,859 3,937 6,199 6,576
gma-miR166q UCGGACCAGGCUUCAUUCCC 20 118,188 3,283 6,693 2    380 752 340 1,108 2 60 135 406 1,238 2,812 1,522 2,225 4,432 2,045 4,561 3,419 2,727 3,117 3,721 3,124 4,272 3,797 2,212 5,123 4,093 5,138 6,278 5,340 6,693 6,154 5,406 4,985 3,859 3,937 6,199 6,576
gma-miR166r UCGGACCAGGCUUCAUUCCC 20 118,188 3,283 6,693 2    380 752 340 1,108 2 60 135 406 1,238 2,812 1,522 2,225 4,432 2,045 4,561 3,419 2,727 3,117 3,721 3,124 4,272 3,797 2,212 5,123 4,093 5,138 6,278 5,340 6,693 6,154 5,406 4,985 3,859 3,937 6,199 6,576
gma-miR166s UCGGACCAGGCUUCAUUCCC 20 118,188 3,283 6,693 2    380 752 340 1,108 2 60 135 406 1,238 2,812 1,522 2,225 4,432 2,045 4,561 3,419 2,727 3,117 3,721 3,124 4,272 3,797 2,212 5,123 4,093 5,138 6,278 5,340 6,693 6,154 5,406 4,985 3,859 3,937 6,199 6,576
gma-miR166t UCGGACCAGGCUUCAUUCCC 20 118,188 3,283 6,693 2    380 752 340 1,108 2 60 135 406 1,238 2,812 1,522 2,225 4,432 2,045 4,561 3,419 2,727 3,117 3,721 3,124 4,272 3,797 2,212 5,123 4,093 5,138 6,278 5,340 6,693 6,154 5,406 4,985 3,859 3,937 6,199 6,576
gma-miR166u UCUCGGACCAGGCUUCAUUC 20 57,610 1,694 7,263 9    40 9 48 41 0 0 54 99 4,141 7,263 5,330 6,994 1,082 659 2,260 1,837 1,320 362 680 956 545 688 609 1,759 882 1,439 2,538 2,387 1,993 1,690 1,571 1,643 1,068 2,342 1,631 1,650
gma-miR167a UGAAGCUGCCAGCAUGAUCUA 21 13,602 378 5,670 4    341 396 2,956 100 4 4 5,670 2,677 8 10 7 22 6 50 26 18 35 18 21 26 22 22 39 82 6 71 106 110 103 112 124 104 88 66 90 62
gma-miR167b UGAAGCUGCCAGCAUGAUCUA 21 13,602 378 5,670 4    341 396 2,956 100 4 4 5,670 2,677 8 10 7 22 6 50 26 18 35 18 21 26 22 22 39 82 6 71 106 110 103 112 124 104 88 66 90 62
gma-miR167c UGAAGCUGCCAGCAUGAUCUG 21 615,733 17,592 36,265 65    2,723 1,466 3,870 260 0 723 2,166 23,054 995 65 311 1,142 16,550 13,222 23,066 16,348 18,043 28,715 17,784 18,557 22,356 18,038 17,242 27,576 21,070 27,030 26,130 25,502 30,784 24,927 36,265 34,437 22,211 27,528 29,751 35,826
gma-miR167d UGAAGCUGCCAGCAUGAUCUA 21 13,602 378 5,670 4    341 396 2,956 100 4 4 5,670 2,677 8 10 7 22 6 50 26 18 35 18 21 26 22 22 39 82 6 71 106 110 103 112 124 104 88 66 90 62
gma-miR167e UGAAGCUGCCAGCAUGAUCUU 21 1,067,280 30,494 375,275 44    356,997 375,275 7,624 62,860 0 240 226,106 5,111 10,622 1,478 586 757 106 557 44 234 171 205 396 582 263 253 607 1,462 88 1,172 1,613 1,765 1,485 1,452 1,183 1,114 1,395 1,328 1,258 891
gma-miR167f UGAAGCUGCCAGCAUGAUCUU 21 1,067,280 30,494 375,275 44    356,997 375,275 7,624 62,860 0 240 226,106 5,111 10,622 1,478 586 757 106 557 44 234 171 205 396 582 263 253 607 1,462 88 1,172 1,613 1,765 1,485 1,452 1,183 1,114 1,395 1,328 1,258 891
gma-miR167g UGAAGCUGCCAGCAUGAUCUGA 22 6,300 197 456 4    119 71 58 35 0 4 73 285 4 0 0 0 30 252 63 176 149 40 387 310 41 221 238 285 42 223 268 333 306 361 447 456 204 233 315 271
gma-miR167h AUCAUGCUGGCAGCUUCAACUGGU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR167i UCAUGCUGGCAGCUUCAACUGGU 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR167j UGAAGCUGCCAGCAUGAUCUG 21 615,733 17,592 36,265 65    2,723 1,466 3,870 260 0 723 2,166 23,054 995 65 311 1,142 16,550 13,222 23,066 16,348 18,043 28,715 17,784 18,557 22,356 18,038 17,242 27,576 21,070 27,030 26,130 25,502 30,784 24,927 36,265 34,437 22,211 27,528 29,751 35,826
gma-miR167k UGAAGCUGCCAGCCUGAUCUUA 22 4,861 540 2,534 1    2,127 2,534 36 35 0 0 99 27 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 1
gma-miR168a UCGCUUGGUGCAGGUCGGGAA 21 272,303 8,009 31,204 464    23,520 16,906 5,681 13,192 0 0 29,658 31,204 3,462 1,489 1,723 5,167 2,787 2,981 464 2,004 798 5,491 2,839 6,708 3,600 1,341 2,978 8,149 3,023 6,964 11,985 6,961 8,280 8,237 10,578 9,866 7,553 7,642 9,203 9,869
gma-miR168b UCGCUUGGUGCAGGUCGGG 19 124 4 22 1    22 0 0 12 0 0 2 7 4 1 2 5 0 1 2 2 2 2 0 2 3 2 4 1 1 3 6 4 3 7 3 5 1 2 9 4
gma-miR169a CAGCCAAGGAUGACUUGCCGG 21 2,737 81 1,834 1    53 96 0 85 10 38 77 1,834 40 11 22 36 0 13 2 12 6 3 2 8 6 1 11 27 3 34 60 77 17 45 14 12 31 12 21 18
gma-miR169b CAGCCAAGGAUGACUUGCCGA 21 371 16 68 1    57 68 0 55 0 0 60 42 20 3 2 4 0 1 0 1 0 0 1 0 0 0 0 7 0 3 9 15 4 6 1 3 5 0 2 2
gma-miR169c AAGCCAAGGAUGACUUGCCGA 21 266 13 100 1    44 31 0 12 0 0 33 100 2 0 4 0 0 3 0 4 2 0 2 6 1 2 9 0 0 0 1 6 0 1 0 0 2 1 0 0
gma-miR169d UGAGCCAAGGAUGACUUGCCGGU 23 56 3 17 1    0 0 0 0 0 0 6 17 2 0 6 3 0 1 0 1 2 0 0 0 0 0 1 0 2 3 5 1 0 0 0 0 2 2 1 1
gma-miR169e AGCCAAGGAUGACUUGCCGG 20 150 9 96 1    0 0 0 17 4 0 6 96 0 0 1 1 0 0 0 0 0 0 0 0 3 0 1 1 0 0 6 3 1 4 1 2 3 0 0 0
gma-miR169f CAGCCAAGGAUGACUUGCCGG 21 2,737 81 1,834 1    53 96 0 85 10 38 77 1,834 40 11 22 36 0 13 2 12 6 3 2 8 6 1 11 27 3 34 60 77 17 45 14 12 31 12 21 18
gma-miR169g CAGCCAAGGAUGACUUGCCGG 21 2,737 81 1,834 1    53 96 0 85 10 38 77 1,834 40 11 22 36 0 13 2 12 6 3 2 8 6 1 11 27 3 34 60 77 17 45 14 12 31 12 21 18
gma-miR169h GGCGAGACAUCUUGGCUCAUU 21 12 6 11 1    11 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0
gma-miR169i-3p CCGGUGCCAUCCCGUCUCAUA 21 81 5 17 1    11 0 0 0 0 0 0 1 0 0 0 0 0 7 0 7 6 0 3 5 1 5 17 0 0 1 3 4 1 2 3 0 2 2 0 0
gma-miR169i-5p UGAGCCGGGAUGGCUUGCCGGCA 23 326 33 117 1    117 36 0 0 0 0 73 92 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 1 0 0 2 0 0 0 0 0 0 2 1 0
gma-miR169j-3p UUUCGACGAGUUGUUCUUGGC 21 311 11 25 1    0 0 0 0 0 0 0 4 10 5 6 13 1 8 0 17 4 1 11 12 4 9 16 13 4 15 12 25 20 16 15 8 12 22 14 14
gma-miR169j-5p UAGCCAAGAAUGACUUGCCGG 21 536 18 121 1    121 12 0 35 0 0 36 95 2 3 6 14 0 7 0 2 1 0 1 1 0 1 6 15 1 11 24 36 12 28 8 18 13 6 16 5
gma-miR169k CAGCCAAGAAUGACUUGCCGG 21 457 14 103 1    66 28 0 0 2 52 17 103 10 5 5 5 1 18 2 14 3 4 0 10 4 7 19 10 3 3 15 21 5 7 1 1 7 7 1 1
gma-miR169l-3p CGGGCAAGUUGUUUUUGGCUAC 22 72 9 40 1    40 24 0 0 0 1 1 1 0 1 0 0 0 0 0 0 0 0 0 0 3 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR169l-5p CAGCCAAGAAUGACUUGCCGG 21 457 14 103 1    66 28 0 0 2 52 17 103 10 5 5 5 1 18 2 14 3 4 0 10 4 7 19 10 3 3 15 21 5 7 1 1 7 7 1 1
gma-miR169m CAGCCAAGGAUGACUUGCCGG 21 2,737 81 1,834 1    53 96 0 85 10 38 77 1,834 40 11 22 36 0 13 2 12 6 3 2 8 6 1 11 27 3 34 60 77 17 45 14 12 31 12 21 18
gma-miR169n-3p UGCCGGCAAGUUUCUCUUGGC 21 1,431 49 166 1    0 0 0 0 0 0 0 1 7 5 5 10 26 93 60 67 62 16 166 150 18 122 69 30 19 17 57 58 53 78 39 38 44 58 32 31
gma-miR169n-5p CAGCCAAGGGUGAUUUGCCGG 21 557 21 102 1    0 0 0 0 0 0 1 102 0 0 0 0 6 36 8 9 18 7 7 33 5 7 29 11 3 12 53 46 19 37 7 11 26 32 19 13
gma-miR169o UGAGCCAGGAUGGCUUGCCGGC 22 4,740 153 489 9    0 9 0 0 0 0 9 61 298 198 264 190 390 172 12 421 111 76 55 161 162 100 146 112 489 163 402 225 38 80 13 18 132 199 21 13
gma-miR169p UGAGCCAAGGAUGACUUGCCG 21 231 14 122 1    64 17 0 0 2 0 11 122 0 0 0 0 0 1 0 0 0 0 1 0 0 1 1 1 0 0 3 1 0 3 0 0 1 1 1 0
gma-miR169r UGAGCCAGGAUGGCUUGCCGGC 22 4,740 153 489 9    0 9 0 0 0 0 9 61 298 198 264 190 390 172 12 421 111 76 55 161 162 100 146 112 489 163 402 225 38 80 13 18 132 199 21 13
gma-miR169s AAGCCAAGGAUGACUUGCCGG 21 230 10 82 1    37 9 0 0 3 5 45 82 7 0 6 3 0 2 2 1 1 0 1 2 1 0 2 1 1 1 6 9 0 0 1 0 2 0 0 0
gma-miR169t UAGCCAAGGAUGGACUUGCCUA 22 17 2 7 1    0 0 0 0 0 0 1 7 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 0 4 0 0 1 0 1 0 0 1 0 0 0
gma-miR169u CAGCCAAGGAUGACUUGCCGU 21 131 6 79 1    0 0 0 0 0 0 0 79 0 0 2 0 3 1 0 1 0 3 2 2 0 1 2 2 0 2 4 5 5 4 1 3 2 0 1 6
gma-miR169v CAGCCAAGGAUGACUUGCC 19 10 2 3 1    0 0 0 0 0 0 2 3 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 0 0 0 0 0 0 0 0 0
gma-miR171a UGAGCCGUGCCAAUAUCACGA 21 2 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 0 0 0 0
gma-miR171b-3p CGAGCCGAAUCAAUAUCACUC 21 1,264 41 168 2    18 56 0 0 0 0 168 65 2 0 12 17 24 67 9 145 44 12 59 75 39 83 67 31 8 24 46 29 14 43 10 16 39 33 6 3
gma-miR171b-5p ACGGCGUGAUAUUGGUACGGCUC 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR171c-3p UUGAGCCGUGCCAAUAUCACA 21 8,630 288 908 2    0 0 0 0 0 0 2 160 50 34 12 64 10 194 52 500 154 17 75 266 29 136 132 700 45 470 908 679 507 591 427 429 449 708 448 382
gma-miR171c-5p AGAUAUUGGUGCGGUUCAAUC 21 457 14 172 1    0 0 10 40 0 0 8 172 1 10 6 3 7 13 2 8 3 3 6 9 16 6 6 7 13 9 20 7 2 8 13 11 12 8 9 9
gma-miR171d UGAUUGAGUCGUGUCAAUAUC 21 140 10 55 1    55 21 0 20 0 0 3 0 2 16 6 8 0 0 0 0 1 0 0 0 0 0 0 0 0 2 0 0 3 0 0 1 0 1 1 0
gma-miR171e UGAUUGAGCCGUGCCAAUAUC 21 4,592 131 366 4    57 52 25 14 0 4 29 250 76 59 68 104 39 88 16 75 23 14 51 106 109 50 81 343 21 253 305 366 289 364 220 192 207 153 311 178
gma-miR171f UGAUUGAGCCGUGCCAAUAUC 21 4,592 131 366 4    57 52 25 14 0 4 29 250 76 59 68 104 39 88 16 75 23 14 51 106 109 50 81 343 21 253 305 366 289 364 220 192 207 153 311 178
gma-miR171g UGAUUGAGCCGUGCCAAUAUC 21 4,592 131 366 4    57 52 25 14 0 4 29 250 76 59 68 104 39 88 16 75 23 14 51 106 109 50 81 343 21 253 305 366 289 364 220 192 207 153 311 178
gma-miR171h AUUGAGACGAGCCGAAUCAAU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR171i-3p UUGAGCCGUGCCAAUAUCACG 21 859 30 80 1    0 0 0 0 0 0 0 10 1 8 7 10 5 21 4 30 5 9 9 29 4 4 15 69 6 75 71 80 56 68 28 26 40 69 45 55
gma-miR171i-5p AUAAGAAAGCAAUGCUCAAA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR171j-3p UGAUUGAGCCGUGCCAAUAUC 21 4,592 131 366 4    57 52 25 14 0 4 29 250 76 59 68 104 39 88 16 75 23 14 51 106 109 50 81 343 21 253 305 366 289 364 220 192 207 153 311 178
gma-miR171j-5p UAUUGGCCUGGUUCACUCAGA 21 4,004 138 311 16    0 0 0 0 0 0 0 103 197 134 90 91 140 89 16 107 25 62 54 125 23 61 60 311 82 310 179 181 273 238 176 158 166 167 165 221
gma-miR171k-3p UUGAGCCGCGCCAAUAUCACU 21 1,183 39 90 1    0 0 0 0 0 0 1 7 4 18 8 18 6 76 1 75 18 9 21 78 9 14 49 90 9 76 73 63 76 64 42 45 45 56 75 57
gma-miR171k-5p CGAUGUUGGUGAGGUUCAAUC 21 245 8 38 1    11 0 0 0 12 0 0 11 0 0 2 6 9 5 1 6 1 8 1 6 2 2 6 10 10 11 19 10 7 8 10 11 7 9 38 6
gma-miR171l CGAUGUUGGUGAGGUUCAAUC 21 245 8 38 1    11 0 0 0 12 0 0 11 0 0 2 6 9 5 1 6 1 8 1 6 2 2 6 10 10 11 19 10 7 8 10 11 7 9 38 6
gma-miR171m UUGAGCCGCGUCAAUAUCUCA 21 7,704 227 2,498 6    1,942 2,498 0 128 0 7 382 71 8 16 29 75 14 157 6 82 30 11 59 157 12 34 108 168 9 175 169 161 175 164 153 164 122 155 119 144
gma-miR171n UUGAGCCGCGUCAAUAUCUUA 21 3,554 108 310 2    310 248 12 0 0 0 10 33 16 10 2 23 86 235 10 88 28 190 209 201 113 61 173 137 86 120 116 108 96 119 154 144 142 125 74 75
gma-miR171o-3p UUGAGCCGUGCCAAUAUCACA 21 8,630 288 908 2    0 0 0 0 0 0 2 160 50 34 12 64 10 194 52 500 154 17 75 266 29 136 132 700 45 470 908 679 507 591 427 429 449 708 448 382
gma-miR171o-5p AGAUAUUGGUACGGUUCAAUC 21 1,106 36 144 6    0 0 12 0 0 0 14 144 7 10 12 6 30 34 12 36 17 14 21 52 13 26 9 50 20 38 63 97 37 61 47 44 38 36 63 43
gma-miR171p UUGAGCCGCGUCAAUAUCUUA 21 3,554 108 310 2    310 248 12 0 0 0 10 33 16 10 2 23 86 235 10 88 28 190 209 201 113 61 173 137 86 120 116 108 96 119 154 144 142 125 74 75
gma-miR171q UUGAGCCGUGCCAAUAUCACA 21 8,630 288 908 2    0 0 0 0 0 0 2 160 50 34 12 64 10 194 52 500 154 17 75 266 29 136 132 700 45 470 908 679 507 591 427 429 449 708 448 382
gma-miR171r CGAGCCGAAUCAAUACCACUC 21 531 19 79 1    0 0 0 0 0 0 45 55 0 1 1 1 3 24 12 79 24 8 51 52 9 35 51 7 1 4 17 6 7 12 1 6 12 6 0 1
gma-miR171s CGAGCCGAAUCAAUACCACUC 21 531 19 79 1    0 0 0 0 0 0 45 55 0 1 1 1 3 24 12 79 24 8 51 52 9 35 51 7 1 4 17 6 7 12 1 6 12 6 0 1
gma-miR171t UUGAGCCGCGUCAAUAUCUCA 21 7,704 227 2,498 6    1,942 2,498 0 128 0 7 382 71 8 16 29 75 14 157 6 82 30 11 59 157 12 34 108 168 9 175 169 161 175 164 153 164 122 155 119 144
gma-miR171u UGAUUGAGCCGUGCCAAUAUC 21 4,592 131 366 4    57 52 25 14 0 4 29 250 76 59 68 104 39 88 16 75 23 14 51 106 109 50 81 343 21 253 305 366 289 364 220 192 207 153 311 178
gma-miR172a AGAAUCUUGAUGAUGCUGCAU 21 25,969 764 17,498 3    209 132 41 72 3 0 147 17,498 4 0 20 19 82 370 26 150 53 63 68 154 79 64 167 473 64 447 870 976 463 556 587 501 504 352 453 302
gma-miR172b-3p AGAAUCUUGAUGAUGCUGCAU 21 25,969 764 17,498 3    209 132 41 72 3 0 147 17,498 4 0 20 19 82 370 26 150 53 63 68 154 79 64 167 473 64 447 870 976 463 556 587 501 504 352 453 302
gma-miR172b-5p GUAGCAUCAUCAAGAUUCAC 20 886 32 121 1    0 0 0 0 0 0 1 27 0 0 1 4 96 18 5 7 12 97 9 2 109 7 9 14 121 20 84 82 24 49 22 25 10 9 16 6
gma-miR172c GGAAUCUUGAUGAUGCUGCAG 21 3,774 180 3,043 1    218 198 0 33 108 3,043 7 59 51 14 15 10 0 1 0 1 0 0 0 1 0 1 0 2 0 3 1 1 0 0 2 5 0 0 0 0
gma-miR172d GGAAUCUUGAUGAUGCUGCAGCAG 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR172e GGAAUCUUGAUGAUGCUGCAGCAG 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR172f AGAAUCUUGAUGAUGCUGCA 20 428 17 302 1    0 0 0 0 0 0 0 302 1 1 0 1 2 5 0 2 0 0 1 6 6 2 2 3 13 6 12 10 6 6 7 6 8 6 12 2
gma-miR172g GCAGCACCAUCAAGAUUCAC 20 45 2 11 1    0 0 0 0 0 0 0 1 0 1 1 0 0 5 5 1 11 0 1 0 1 3 2 2 0 1 3 3 0 0 1 1 1 0 1 0
gma-miR172h-3p AGAAUCUUGAUGAUGCUGCAU 21 25,969 764 17,498 3    209 132 41 72 3 0 147 17,498 4 0 20 19 82 370 26 150 53 63 68 154 79 64 167 473 64 447 870 976 463 556 587 501 504 352 453 302
gma-miR172h-5p GCAGCAGCAUCAAGAUUCACA 21 265 11 59 1    0 0 0 0 0 0 0 59 0 0 0 0 1 16 2 4 6 3 2 5 5 2 5 8 1 7 43 32 4 15 20 12 8 3 1 1
gma-miR172i-3p GGAAUCUUGAUGAUGCUGCAU 21 35 3 16 1    0 0 0 0 0 4 0 16 0 0 0 1 0 2 0 1 0 0 1 0 0 1 0 1 0 1 2 0 0 0 1 2 0 2 0 0
gma-miR172i-5p GCAGCAGCAUCAAGAUUCACA 21 265 11 59 1    0 0 0 0 0 0 0 59 0 0 0 0 1 16 2 4 6 3 2 5 5 2 5 8 1 7 43 32 4 15 20 12 8 3 1 1
gma-miR172j GCAGCAGCAUCAAGAUUCACA 21 265 11 59 1    0 0 0 0 0 0 0 59 0 0 0 0 1 16 2 4 6 3 2 5 5 2 5 8 1 7 43 32 4 15 20 12 8 3 1 1
gma-miR172k UGAAUCUUGAUGAUGCUGCAU 21 1,249 54 1,156 1    20 0 0 0 0 0 9 1,156 3 0 0 0 0 6 0 5 0 5 1 4 3 1 1 1 3 3 3 11 1 2 2 2 5 2 0 0
gma-miR172l GGAAUCUUGAUGAUGCUGCAU 21 35 3 16 1    0 0 0 0 0 4 0 16 0 0 0 1 0 2 0 1 0 0 1 0 0 1 0 1 0 1 2 0 0 0 1 2 0 2 0 0
gma-miR2107 CAAACCUCCGUAGCCUGUAUC 21 3 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1
gma-miR2108a UUAAUGUGUUGUGUUUGUCGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR2108b UUAAUGUGUUGUGUUUGUGAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR2109-3p GGAGGCGUAGAUACUCACACC 21 136,814 4,024 16,131 5    97 122 28 93 0 0 5 20 1,964 1,955 6,696 5,678 11,840 479 468 854 1,298 11,433 432 383 15,490 744 394 2,217 13,901 4,154 16,131 6,865 3,180 7,437 5,989 5,801 4,965 1,113 3,267 1,321
gma-miR2109-5p UGCGAGUGUCUUCGCCUCUG 20 197 7 23 1    11 0 0 0 0 0 0 6 3 7 8 17 14 0 0 3 1 23 1 1 21 1 0 1 18 3 10 14 6 8 3 6 2 2 4 3
gma-miR2111a GUCCUUGGGAUGCAGAUUACG 21 1,332 58 601 1    315 219 0 601 7 1 40 72 0 0 0 0 8 1 0 0 0 3 0 0 0 0 1 2 0 3 3 9 2 8 5 11 7 2 9 3
gma-miR2111b UAAUCUGCAUCCUGAGGUUUA 21 8,559 295 1,083 2    40 0 0 30 0 0 3 16 16 5 7 16 2 42 29 84 30 0 44 106 0 29 287 453 0 321 547 903 381 481 1,065 980 659 315 1,083 585
gma-miR2111c UAAUCUGCAUCCUGAGGUUUA 21 8,559 295 1,083 2    40 0 0 30 0 0 3 16 16 5 7 16 2 42 29 84 30 0 44 106 0 29 287 453 0 321 547 903 381 481 1,065 980 659 315 1,083 585
gma-miR2111d GUCCUUGGGAUGCAGAUUACG 21 1,332 58 601 1    315 219 0 601 7 1 40 72 0 0 0 0 8 1 0 0 0 3 0 0 0 0 1 2 0 3 3 9 2 8 5 11 7 2 9 3
gma-miR2111e UAAUCUGCAUCCUGAGGUUUA 21 8,559 295 1,083 2    40 0 0 30 0 0 3 16 16 5 7 16 2 42 29 84 30 0 44 106 0 29 287 453 0 321 547 903 381 481 1,065 980 659 315 1,083 585
gma-miR2111f UAAUCUGCAUCCUGAGGUUUA 21 8,559 295 1,083 2    40 0 0 30 0 0 3 16 16 5 7 16 2 42 29 84 30 0 44 106 0 29 287 453 0 321 547 903 381 481 1,065 980 659 315 1,083 585
gma-miR2118a-3p UUGCCGAUUCCACCCAUUCCU 21 3,399 103 309 1    0 0 10 0 15 3 1 13 31 22 13 22 8 250 42 81 54 21 234 309 27 102 251 182 23 135 150 239 177 176 155 161 137 111 140 104
gma-miR2118a-5p GGAGAUGGGAGGGUCGGUAAAG 22 35,240 1,036 4,776 143    1,977 1,087 2,968 4,776 0 0 1,591 1,638 194 183 441 392 1,783 280 153 272 333 1,260 254 405 812 143 373 443 1,664 836 2,564 1,496 895 1,538 1,220 1,250 862 260 612 285
gma-miR2118b-3p UUGCCGAUUCCACCCAUUCCU 21 3,399 103 309 1    0 0 10 0 15 3 1 13 31 22 13 22 8 250 42 81 54 21 234 309 27 102 251 182 23 135 150 239 177 176 155 161 137 111 140 104
gma-miR2118b-5p GGAGAUGGGAGGGUCGGUAAAG 22 35,240 1,036 4,776 143    1,977 1,087 2,968 4,776 0 0 1,591 1,638 194 183 441 392 1,783 280 153 272 333 1,260 254 405 812 143 373 443 1,664 836 2,564 1,496 895 1,538 1,220 1,250 862 260 612 285
gma-miR2119 UCAAAGGGAGUUGUAGGGGAA 21 2,511 78 313 2    84 99 0 44 0 0 33 174 37 0 2 8 14 55 148 207 166 313 215 74 83 127 161 15 173 16 20 23 41 42 23 20 6 23 31 34
gma-miR2606a AAAAGCACUUAAGGAACGGUA 21 61 20 33 1    0 0 0 27 0 1 33 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR2606b AAAAGCACUUAAGGAACGGUA 21 61 20 33 1    0 0 0 27 0 1 33 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR319a UUGGACUGAAGGGAGCUCCC 20 72,361 2,193 22,262 1    0 0 8 0 5 146 1 4 4,404 12,315 16,349 22,262 261 359 116 852 495 233 274 1,677 422 251 717 765 194 1,193 1,675 500 454 1,505 805 797 826 310 1,257 929
gma-miR319b UUGGACUGAAGGGAGCUCCC 20 72,361 2,193 22,262 1    0 0 8 0 5 146 1 4 4,404 12,315 16,349 22,262 261 359 116 852 495 233 274 1,677 422 251 717 765 194 1,193 1,675 500 454 1,505 805 797 826 310 1,257 929
gma-miR319c UUGGACUGAAAGGAGCUCCU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR319d UGGACUGAAGGGGAGCUCCUUC 22 29,957 999 6,287 20    0 0 0 0 0 25 0 20 1,157 5,303 4,818 6,287 1,081 136 361 242 166 489 80 513 903 56 372 550 596 1,017 974 301 308 609 147 235 579 211 1,651 770
gma-miR319e UUGGACUGAAGGGAGCUCCC 20 72,361 2,193 22,262 1    0 0 8 0 5 146 1 4 4,404 12,315 16,349 22,262 261 359 116 852 495 233 274 1,677 422 251 717 765 194 1,193 1,675 500 454 1,505 805 797 826 310 1,257 929
gma-miR319f UUGGACUGAAGGGGCCUCUU 20 2,546 88 1,070 1    0 0 0 0 1 0 0 37 139 312 1,070 859 2 8 2 8 3 1 1 27 1 1 22 1 1 6 11 6 1 3 0 4 3 9 1 6
gma-miR319g UUGGACUGAAGGGAGCUCCUUC 22 3,912 130 612 1    0 0 0 0 1 6 0 0 67 504 332 612 65 35 62 138 105 100 59 148 62 52 88 104 84 170 172 71 59 155 85 90 88 53 177 168
gma-miR319h UUGGACUGAAGGGAGCUCCCU 21 70,293 2,197 30,717 1    0 0 0 0 4 133 1 40 6,572 6,628 22,569 30,717 126 74 18 143 73 94 24 240 115 19 105 177 100 324 406 137 110 294 177 175 229 70 224 175
gma-miR319i UUGGACUGAAGGGGAGCUCCUUC 23 1,823 65 248 9    0 0 0 0 0 0 0 0 22 248 104 131 46 18 30 73 48 12 9 38 18 11 32 85 21 185 122 36 44 130 38 39 86 29 78 90
gma-miR319j UUGGACUGAAGGGAGCUCCCU 21 70,293 2,197 30,717 1    0 0 0 0 4 133 1 40 6,572 6,628 22,569 30,717 126 74 18 143 73 94 24 240 115 19 105 177 100 324 406 137 110 294 177 175 229 70 224 175
gma-miR319k UUGGACUGAAGGGAGCUCCCU 21 70,293 2,197 30,717 1    0 0 0 0 4 133 1 40 6,572 6,628 22,569 30,717 126 74 18 143 73 94 24 240 115 19 105 177 100 324 406 137 110 294 177 175 229 70 224 175
gma-miR319l UUGGACUGAAGGGAGCUCCUUC 22 3,912 130 612 1    0 0 0 0 1 6 0 0 67 504 332 612 65 35 62 138 105 100 59 148 62 52 88 104 84 170 172 71 59 155 85 90 88 53 177 168
gma-miR319m UUGGACUGAAGGGAGCUCCCU 21 70,293 2,197 30,717 1    0 0 0 0 4 133 1 40 6,572 6,628 22,569 30,717 126 74 18 143 73 94 24 240 115 19 105 177 100 324 406 137 110 294 177 175 229 70 224 175
gma-miR319n UUUGGACCGAAGGGAGCCCCU 21 5,800 193 863 1    0 0 0 0 0 0 1 6 46 863 251 737 82 257 20 227 75 176 86 272 91 61 117 134 72 221 241 102 150 174 313 253 259 123 171 219
gma-miR319o UGGACUGAAGGGGAGCUCCUUC 22 29,957 999 6,287 20    0 0 0 0 0 25 0 20 1,157 5,303 4,818 6,287 1,081 136 361 242 166 489 80 513 903 56 372 550 596 1,017 974 301 308 609 147 235 579 211 1,651 770
gma-miR319p UUUUGGACUGAAGGGAGCUCC 21 5,396 169 2,040 1    13 12 0 0 532 0 1 0 2,040 920 474 865 32 12 9 21 12 4 13 20 32 5 14 20 10 28 53 48 26 29 26 27 31 24 23 20
gma-miR319q UGGACUGAAGGGAGCUCCUUC 21 49,660 1,655 12,758 4    0 0 0 0 0 1,128 0 4 1,827 7,775 7,263 12,758 1,041 158 626 268 392 1,300 125 522 1,599 133 430 711 1,082 1,083 1,150 563 654 819 306 514 768 314 3,078 1,269
gma-miR3522 AGACCAAAUGAGCAGCUGA 19 874 31 209 1    0 9 209 0 1 21 7 167 0 0 0 1 56 11 12 12 6 86 3 11 96 15 19 3 100 3 6 5 6 1 1 0 2 5 0 0
gma-miR390a-3p CGCUAUCCAUCCUGAGUUUC 20 153 5 31 1    31 17 0 0 3 1 1 4 13 4 5 20 10 7 0 1 1 2 1 1 0 1 4 1 4 2 4 1 0 5 3 2 2 0 1 1
gma-miR390a-5p AAGCUCAGGAGGGAUAGCGCC 21 73,158 2,032 8,759 40    768 591 1,361 1,162 226 40 334 958 800 1,044 875 3,058 211 693 541 2,296 788 157 1,788 2,986 630 1,150 3,045 3,067 387 1,844 3,176 7,209 5,036 2,951 6,217 8,759 944 1,029 4,693 2,344
gma-miR390b-3p UACUUGGCGCUAUCUAUCUUGA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR390b-5p AAGCUCAGGAGGGAUAGCACC 21 2,273 63 757 1    37 12 757 16 2 9 172 226 65 12 27 207 7 6 12 22 5 1 9 12 6 4 9 45 11 114 98 47 30 68 28 33 66 26 31 41
gma-miR390c CGCUAUCCAUCCUGAGUUUC 20 153 5 31 1    31 17 0 0 3 1 1 4 13 4 5 20 10 7 0 1 1 2 1 1 0 1 4 1 4 2 4 1 0 5 3 2 2 0 1 1
gma-miR390d AAGCUCAGGAGGGAUAGCACC 21 2,273 63 757 1    37 12 757 16 2 9 172 226 65 12 27 207 7 6 12 22 5 1 9 12 6 4 9 45 11 114 98 47 30 68 28 33 66 26 31 41
gma-miR390e AGCUCAGGAGGGAUAGCGCC 20 1,554 43 252 1    176 73 74 252 37 1 22 51 50 22 54 149 9 10 2 17 9 23 26 41 54 12 28 11 6 14 46 77 23 43 34 58 7 2 33 8
gma-miR390f AAGCUCAGGAGGGAUAGCGCC 21 73,158 2,032 8,759 40    768 591 1,361 1,162 226 40 334 958 800 1,044 875 3,058 211 693 541 2,296 788 157 1,788 2,986 630 1,150 3,045 3,067 387 1,844 3,176 7,209 5,036 2,951 6,217 8,759 944 1,029 4,693 2,344
gma-miR390g AAGCUCAGGAGGGAUAGCGCC 21 73,158 2,032 8,759 40    768 591 1,361 1,162 226 40 334 958 800 1,044 875 3,058 211 693 541 2,296 788 157 1,788 2,986 630 1,150 3,045 3,067 387 1,844 3,176 7,209 5,036 2,951 6,217 8,759 944 1,029 4,693 2,344
gma-miR393a UCCAAAGGGAUCGCAUUGAUC 21 4,474 149 438 1    0 0 0 0 0 0 1 3 438 69 283 186 57 96 7 36 12 38 29 72 201 37 47 185 75 180 428 431 215 237 250 217 165 164 197 118
gma-miR393b UUUGGGAUCAUGCUAUCCCUU 21 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1
gma-miR393c-3p AUCAUGCUAUCCCUUUGGAUU 21 1,557 46 142 3    64 49 0 70 3 0 43 35 13 5 27 29 82 31 3 8 7 25 8 25 142 8 21 65 35 54 107 114 72 96 59 47 69 39 52 50
gma-miR393c-5p UCCAAAGGGAUCGCAUUGAUCC 22 2,555 85 340 1    13 0 0 0 0 1 0 4 2 7 11 28 10 169 0 32 21 3 30 90 18 17 64 153 6 130 340 295 147 284 125 117 179 93 83 83
gma-miR393d UCCAAAGGGAUCGCAUUGAUCC 22 2,555 85 340 1    13 0 0 0 0 1 0 4 2 7 11 28 10 169 0 32 21 3 30 90 18 17 64 153 6 130 340 295 147 284 125 117 179 93 83 83
gma-miR393e UCCAAAGGGAUCGCAUUGAUCC 22 2,555 85 340 1    13 0 0 0 0 1 0 4 2 7 11 28 10 169 0 32 21 3 30 90 18 17 64 153 6 130 340 295 147 284 125 117 179 93 83 83
gma-miR393f UCCAAAGGGAUCGCAUUGAUCC 22 2,555 85 340 1    13 0 0 0 0 1 0 4 2 7 11 28 10 169 0 32 21 3 30 90 18 17 64 153 6 130 340 295 147 284 125 117 179 93 83 83
gma-miR393g UCCAAAGGGAUCGCAUUGAUCC 22 2,555 85 340 1    13 0 0 0 0 1 0 4 2 7 11 28 10 169 0 32 21 3 30 90 18 17 64 153 6 130 340 295 147 284 125 117 179 93 83 83
gma-miR393h UUCCAAAGGGAUCGCAUUGAUC 22 79,071 2,326 8,420 1    26 10 0 0 4 1 6 38 2,344 72 429 185 1,574 2,324 122 1,069 660 1,521 1,740 1,813 4,376 1,602 1,707 2,823 950 2,718 5,667 5,084 4,545 5,378 4,724 4,625 4,390 2,740 8,420 5,384
gma-miR393i UUCCAAAGGGAUCGCAUUGAUC 22 79,071 2,326 8,420 1    26 10 0 0 4 1 6 38 2,344 72 429 185 1,574 2,324 122 1,069 660 1,521 1,740 1,813 4,376 1,602 1,707 2,823 950 2,718 5,667 5,084 4,545 5,378 4,724 4,625 4,390 2,740 8,420 5,384
gma-miR393j UUCCAAAGGGAUCGCAUUGAUC 22 79,071 2,326 8,420 1    26 10 0 0 4 1 6 38 2,344 72 429 185 1,574 2,324 122 1,069 660 1,521 1,740 1,813 4,376 1,602 1,707 2,823 950 2,718 5,667 5,084 4,545 5,378 4,724 4,625 4,390 2,740 8,420 5,384
gma-miR393k UUCCAAAGGGAUCGCAUUGAUC 22 79,071 2,326 8,420 1    26 10 0 0 4 1 6 38 2,344 72 429 185 1,574 2,324 122 1,069 660 1,521 1,740 1,813 4,376 1,602 1,707 2,823 950 2,718 5,667 5,084 4,545 5,378 4,724 4,625 4,390 2,740 8,420 5,384
gma-miR394a-3p AGCUCUGUUGGCUACACUUU 20 611 102 188 1    97 54 0 188 0 0 108 163 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR394a-5p UUGGCAUUCUGUCCACCUCC 20 26,244 729 3,258 13    677 766 66 499 65 13 65 550 857 1,064 613 886 157 1,017 19 239 138 183 318 576 104 195 792 1,154 79 1,020 2,249 3,258 1,430 1,844 1,094 1,022 1,070 732 850 583
gma-miR394b-3p AGGUGGGCAUACUGUCAACU 20 2,801 147 1,418 1    530 620 0 1,418 2 0 166 13 5 1 15 14 3 0 0 0 0 0 1 5 0 0 0 0 0 1 0 3 0 1 0 0 1 0 1 1
gma-miR394b-5p UUGGCAUUCUGUCCACCUCC 20 26,244 729 3,258 13    677 766 66 499 65 13 65 550 857 1,064 613 886 157 1,017 19 239 138 183 318 576 104 195 792 1,154 79 1,020 2,249 3,258 1,430 1,844 1,094 1,022 1,070 732 850 583
gma-miR394c-5p UUGGCAUUCUGUCCACCUCC 20 26,244 729 3,258 13    677 766 66 499 65 13 65 550 857 1,064 613 886 157 1,017 19 239 138 183 318 576 104 195 792 1,154 79 1,020 2,249 3,258 1,430 1,844 1,094 1,022 1,070 732 850 583
gma-miR394d UUGGCAUUCUGUCCACCUCC 20 26,244 729 3,258 13    677 766 66 499 65 13 65 550 857 1,064 613 886 157 1,017 19 239 138 183 318 576 104 195 792 1,154 79 1,020 2,249 3,258 1,430 1,844 1,094 1,022 1,070 732 850 583
gma-miR394e UUGGCAUUCUGUCCACCUCC 20 26,244 729 3,258 13    677 766 66 499 65 13 65 550 857 1,064 613 886 157 1,017 19 239 138 183 318 576 104 195 792 1,154 79 1,020 2,249 3,258 1,430 1,844 1,094 1,022 1,070 732 850 583
gma-miR394f UUGGCAUUCUGUCCACCUCC 20 26,244 729 3,258 13    677 766 66 499 65 13 65 550 857 1,064 613 886 157 1,017 19 239 138 183 318 576 104 195 792 1,154 79 1,020 2,249 3,258 1,430 1,844 1,094 1,022 1,070 732 850 583
gma-miR394g UUGGCAUUCUGUCCACCUCC 20 26,244 729 3,258 13    677 766 66 499 65 13 65 550 857 1,064 613 886 157 1,017 19 239 138 183 318 576 104 195 792 1,154 79 1,020 2,249 3,258 1,430 1,844 1,094 1,022 1,070 732 850 583
gma-miR395a CUGAAGUGUUUGGGGGAACUC 21 227 8 38 1    0 0 0 16 38 11 1 1 4 3 9 10 0 3 0 3 2 2 0 0 6 2 6 5 8 21 23 6 4 8 5 5 3 13 4 5
gma-miR395b CUGAAGUGUUUGGGGGAACUC 21 227 8 38 1    0 0 0 16 38 11 1 1 4 3 9 10 0 3 0 3 2 2 0 0 6 2 6 5 8 21 23 6 4 8 5 5 3 13 4 5
gma-miR395c CUGAAGUGUUUGGGGGAACUC 21 227 8 38 1    0 0 0 16 38 11 1 1 4 3 9 10 0 3 0 3 2 2 0 0 6 2 6 5 8 21 23 6 4 8 5 5 3 13 4 5
gma-miR395d UGAAGUGUUUGGGGGAACUUU 21 599 37 548 1    0 0 0 0 2 0 0 0 548 1 29 4 0 1 0 1 0 0 1 1 0 0 3 0 0 0 0 0 2 2 1 0 1 0 1 1
gma-miR395e UGAAGUGUUUGGGGGAACUUU 21 599 37 548 1    0 0 0 0 2 0 0 0 548 1 29 4 0 1 0 1 0 0 1 1 0 0 3 0 0 0 0 0 2 2 1 0 1 0 1 1
gma-miR395f UGAAGUGUUUGGGGGAACUUU 21 599 37 548 1    0 0 0 0 2 0 0 0 548 1 29 4 0 1 0 1 0 0 1 1 0 0 3 0 0 0 0 0 2 2 1 0 1 0 1 1
gma-miR395g UGAAGUGUUUGGGGGAACUUU 21 599 37 548 1    0 0 0 0 2 0 0 0 548 1 29 4 0 1 0 1 0 0 1 1 0 0 3 0 0 0 0 0 2 2 1 0 1 0 1 1
gma-miR395h AUGAAGUGUUUGGGAGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR395i AUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR395j AUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR395k AUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR395l AUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR395m AUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR396a-3p UUCAAUAAAGCUGUGGGAAG 20 8,145 233 1,842 5    18 24 0 74 83 114 12 243 40 5 20 41 41 144 119 92 209 100 77 59 162 84 142 313 105 388 357 291 399 356 340 428 485 375 1,842 563
gma-miR396a-5p UUCCACAGCUUUCUUGAACUG 21 861,093 24,603 66,618 17    950 629 0 188 17 20 61 574 26,049 1,417 9,454 22,173 13,474 30,468 13,539 12,644 10,779 13,368 20,999 23,535 15,062 12,248 22,364 37,727 13,325 25,153 52,730 51,106 60,127 66,618 59,155 52,116 58,951 38,523 46,857 48,693
gma-miR396b-3p GCUCAAGAAAGCUGUGGGAGA 21 38,973 1,114 19,221 13    3,314 3,717 407 19,221 311 0 501 4,793 13 20 92 42 588 199 44 133 114 155 121 233 1,764 91 226 162 468 229 511 339 136 214 177 156 184 131 93 74
gma-miR396b-5p UUCCACAGCUUUCUUGAACUU 21 612,083 17,002 60,825 8    119 97 48 133 16 8 9 21 17,066 2,725 3,207 10,161 60,825 7,879 3,042 7,594 5,762 19,334 4,344 11,727 24,699 5,092 10,501 34,892 41,480 51,866 30,014 17,296 29,284 20,240 20,505 17,541 26,216 37,928 34,010 56,402
gma-miR396c UUCCACAGCUUUCUUGAACUU 21 612,083 17,002 60,825 8    119 97 48 133 16 8 9 21 17,066 2,725 3,207 10,161 60,825 7,879 3,042 7,594 5,762 19,334 4,344 11,727 24,699 5,092 10,501 34,892 41,480 51,866 30,014 17,296 29,284 20,240 20,505 17,541 26,216 37,928 34,010 56,402
gma-miR396d AAGAAAGCUGUGGGAGAAUAUGGC 24 467 17 49 1    0 0 0 0 28 15 12 6 1 0 0 2 0 14 5 36 49 0 9 13 1 30 40 24 1 20 8 16 19 16 17 12 14 17 23 19
gma-miR396e UUCCACAGCUUUCUUGAACUGU 22 6,156 220 538 3    0 0 0 0 0 0 0 0 54 3 16 52 103 156 32 96 82 102 85 78 77 73 71 287 126 277 494 395 472 490 290 323 459 425 500 538
gma-miR396f AGCUUUCUUGAACUUCUUAUGCCUA 25 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR396g UUCUUGAACUUCUUAUGCAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
gma-miR396h UCCACAGCUUUCUUGAACUG 20 1,627 58 114 3    0 0 0 0 0 0 0 3 51 0 15 25 34 59 40 31 33 52 79 50 50 49 71 50 36 61 92 60 81 114 94 76 99 60 81 81
gma-miR396i-3p GUUCAAUAAAGCUGUGGGAAG 21 27,694 791 3,597 22    189 193 0 433 1,515 3,597 198 2,531 59 22 98 105 532 324 347 229 647 871 160 104 1,525 174 244 416 1,632 829 1,654 1,159 800 1,180 898 987 799 374 2,267 602
gma-miR396i-5p UUCCACAGCUUUCUUGAACUG 21 861,093 24,603 66,618 17    950 629 0 188 17 20 61 574 26,049 1,417 9,454 22,173 13,474 30,468 13,539 12,644 10,779 13,368 20,999 23,535 15,062 12,248 22,364 37,727 13,325 25,153 52,730 51,106 60,127 66,618 59,155 52,116 58,951 38,523 46,857 48,693
gma-miR396j AUUCAAGAUAGCUGUGGAAAA 21 9,949 284 2,632 7    77 64 0 210 7 7 10 179 39 7 16 58 400 133 131 143 127 1,406 145 153 2,632 155 130 243 1,347 200 203 210 211 210 197 199 191 132 182 195
gma-miR396k-3p GCUCAAGAAAGCUGUGGGAGA 21 38,973 1,114 19,221 13    3,314 3,717 407 19,221 311 0 501 4,793 13 20 92 42 588 199 44 133 114 155 121 233 1,764 91 226 162 468 229 511 339 136 214 177 156 184 131 93 74
gma-miR396k-5p UUCCACAGCUUUCUUGAACUU 21 612,083 17,002 60,825 8    119 97 48 133 16 8 9 21 17,066 2,725 3,207 10,161 60,825 7,879 3,042 7,594 5,762 19,334 4,344 11,727 24,699 5,092 10,501 34,892 41,480 51,866 30,014 17,296 29,284 20,240 20,505 17,541 26,216 37,928 34,010 56,402
gma-miR397a UCAUUGAGUGCAGCGUUGAUG 21 163,431 5,107 21,056 11    13 0 64 0 0 0 35 382 35 11 11 51 7,538 20,243 4,941 13,740 21,056 12,860 9,598 4,473 17,236 9,841 17,533 549 12,682 358 3,024 3,048 887 676 169 176 382 1,790 16 13
gma-miR397b-3p UAUUGACGCUGCACUCAAUCA 21 14,859 495 3,784 1    473 177 1,076 127 0 0 145 700 3 0 4 18 352 1,563 81 543 457 696 1,004 1,427 987 587 3,784 5 535 1 12 87 8 3 0 1 0 2 0 1
gma-miR397b-5p UCAUUGAGUGCAGCGUUGAUG 21 163,431 5,107 21,056 11    13 0 64 0 0 0 35 382 35 11 11 51 7,538 20,243 4,941 13,740 21,056 12,860 9,598 4,473 17,236 9,841 17,533 549 12,682 358 3,024 3,048 887 676 169 176 382 1,790 16 13
gma-miR398a UGUGUUCUCAGGUCACCCCUU 21 670 28 146 1    0 0 0 0 0 0 0 0 1 0 1 3 1 43 12 112 52 43 91 36 5 36 146 4 54 3 4 9 6 4 1 0 2 1 0 0
gma-miR398b UGUGUUCUCAGGUCACCCCUU 21 670 28 146 1    0 0 0 0 0 0 0 0 1 0 1 3 1 43 12 112 52 43 91 36 5 36 146 4 54 3 4 9 6 4 1 0 2 1 0 0
gma-miR398c UGUGUUCUCAGGUCGCCCCUG 21 18,580,950 599,385 3,385,969 10    0 0 0 0 0 150 10 40 8,324 1,661 3,366 25,939 3,256,685 590,653 893,201 1,112,281 1,497,544 2,666,382 412,253 653,761 1,845,664 840,315 839,167 54,160 3,385,969 62,783 115,931 82,080 40,753 25,206 10,222 10,384 26,090 115,502 2,126 2,348
gma-miR398d UGUGUUCUCAGGUCGCCCCUG 21 18,580,950 599,385 3,385,969 10    0 0 0 0 0 150 10 40 8,324 1,661 3,366 25,939 3,256,685 590,653 893,201 1,112,281 1,497,544 2,666,382 412,253 653,761 1,845,664 840,315 839,167 54,160 3,385,969 62,783 115,931 82,080 40,753 25,206 10,222 10,384 26,090 115,502 2,126 2,348
gma-miR399a UGCCAAAGGAGAGUUGCCCUG 21 4,782 154 1,368 1    0 0 0 0 0 1 25 184 54 1,368 192 157 118 80 46 146 188 63 54 104 76 91 120 135 158 126 66 100 353 286 108 79 55 122 48 79
gma-miR399b UGCCAAAGGAGAGUUGCCCUG 21 4,782 154 1,368 1    0 0 0 0 0 1 25 184 54 1,368 192 157 118 80 46 146 188 63 54 104 76 91 120 135 158 126 66 100 353 286 108 79 55 122 48 79
gma-miR399c UGCCAAAGGAGAGUUGCCCUG 21 4,782 154 1,368 1    0 0 0 0 0 1 25 184 54 1,368 192 157 118 80 46 146 188 63 54 104 76 91 120 135 158 126 66 100 353 286 108 79 55 122 48 79
gma-miR399d UGCCAAAGGAGAUUUGCCCAG 21 576 22 229 1    0 0 0 0 0 5 79 229 134 14 22 16 0 1 0 3 2 0 2 7 0 1 9 12 0 4 2 3 1 7 1 6 10 2 3 1
gma-miR399e UGCCAAAGGAGAUUUGCCCAG 21 576 22 229 1    0 0 0 0 0 5 79 229 134 14 22 16 0 1 0 3 2 0 2 7 0 1 9 12 0 4 2 3 1 7 1 6 10 2 3 1
gma-miR399f UGCCAAAGGAGAUUUGCCCAG 21 576 22 229 1    0 0 0 0 0 5 79 229 134 14 22 16 0 1 0 3 2 0 2 7 0 1 9 12 0 4 2 3 1 7 1 6 10 2 3 1
gma-miR399g UGCCAAAGGAGAUUUGCCCAG 21 576 22 229 1    0 0 0 0 0 5 79 229 134 14 22 16 0 1 0 3 2 0 2 7 0 1 9 12 0 4 2 3 1 7 1 6 10 2 3 1
gma-miR399h UGCCAAAGGAGAGUUGCCCUG 21 4,782 154 1,368 1    0 0 0 0 0 1 25 184 54 1,368 192 157 118 80 46 146 188 63 54 104 76 91 120 135 158 126 66 100 353 286 108 79 55 122 48 79
gma-miR399i UGCCAAAGGAGAAUUGCCCUG 21 2,962 129 652 1    0 0 12 0 0 0 0 58 0 0 5 0 0 3 2 2 1 0 1 1 0 1 0 196 4 154 17 54 378 540 652 599 163 10 76 33
gma-miR403a UUAGAUUCACGCACAAACUUG 21 30,818 906 4,050 3    0 9 15 0 3 19 3 13 248 112 45 191 1,237 1,099 99 721 435 1,554 831 661 760 809 704 1,663 912 1,715 1,539 1,476 1,709 1,370 1,188 1,382 1,191 1,267 4,050 1,788
gma-miR403b UUAGAUUCACGCACAAACUUG 21 30,818 906 4,050 3    0 9 15 0 3 19 3 13 248 112 45 191 1,237 1,099 99 721 435 1,554 831 661 760 809 704 1,663 912 1,715 1,539 1,476 1,709 1,370 1,188 1,382 1,191 1,267 4,050 1,788
gma-miR408a-3p AUGCACUGCCUCUUCCCUGGC 21 1,237,199 34,367 277,112 13    13 17 23 13 159 328 50 417 185 240 462 1,611 47,529 96,680 64,914 99,628 90,160 28,958 99,298 104,806 45,467 78,080 277,112 17,638 48,964 14,260 22,034 28,313 14,822 11,633 8,505 8,393 6,714 18,226 626 921
gma-miR408a-5p CAGGGGAACAGGCAGAGCAUG 21 3,793 126 795 1    0 0 112 83 12 124 458 355 0 0 1 3 240 123 46 78 187 268 70 42 427 43 125 12 795 11 55 61 19 25 5 6 2 5 0 0
gma-miR408b-3p AUGCACUGCCUCUUCCCUGGC 21 1,237,199 34,367 277,112 13    13 17 23 13 159 328 50 417 185 240 462 1,611 47,529 96,680 64,914 99,628 90,160 28,958 99,298 104,806 45,467 78,080 277,112 17,638 48,964 14,260 22,034 28,313 14,822 11,633 8,505 8,393 6,714 18,226 626 921
gma-miR408b-5p CUGGGAACAGGCAGGGCACG 20 42,953 1,263 11,597 11    31 28 31 80 0 0 56 171 12 19 53 164 9,489 896 196 281 505 5,500 200 213 6,669 199 222 456 11,597 752 1,431 1,205 609 730 262 290 424 152 19 11
gma-miR408c-3p AUGCACUGCCUCUUCCCUGGC 21 1,237,199 34,367 277,112 13    13 17 23 13 159 328 50 417 185 240 462 1,611 47,529 96,680 64,914 99,628 90,160 28,958 99,298 104,806 45,467 78,080 277,112 17,638 48,964 14,260 22,034 28,313 14,822 11,633 8,505 8,393 6,714 18,226 626 921
gma-miR408c-5p CAGGGGAACAGGCAGAGCAUG 21 3,793 126 795 1    0 0 112 83 12 124 458 355 0 0 1 3 240 123 46 78 187 268 70 42 427 43 125 12 795 11 55 61 19 25 5 6 2 5 0 0
gma-miR408d UGCACUGCCUCUUCCCUGGC 20 250,088 7,815 44,266 1    0 0 8 0 33 0 1 18 38 45 64 217 9,497 24,610 12,126 21,217 22,010 5,905 24,678 23,368 8,461 21,642 44,266 2,299 10,556 2,007 3,695 3,879 2,050 1,676 1,068 1,098 1,015 2,315 88 138
gma-miR4340 UGCAGAGAUAGGGACGCGCUUA 22 31 2 4 1    0 0 0 0 0 0 4 0 0 1 0 0 0 0 1 1 1 0 2 3 0 2 3 1 0 1 0 4 0 1 3 1 0 1 0 1
gma-miR4341 UGUGUUGAAAGUUUAACAUGACGG 24 12 3 7 1    0 0 0 0 0 0 7 1 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0
gma-miR4342 AAUCGACUUAGAAUGUAGGAUGGU 24 122 4 22 1    22 14 10 15 3 5 14 4 1 4 4 3 0 0 0 3 1 0 1 0 1 1 1 1 0 1 2 1 1 2 1 2 2 1 0 1
gma-miR4343a AAAAAACUUACGGAUCAAGUUGAU 24 2 2 2 2    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0
gma-miR4343b UCUUACAGAUCAAGUUGAUUCGGA 24 4 1 2 1    0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0
gma-miR4344 AAGUAGACAUUCUAAGACGUUGCU 24 111 4 26 1    26 10 0 17 3 0 7 0 1 4 1 0 3 1 2 3 2 0 2 1 2 2 2 3 2 1 1 1 2 1 1 1 2 4 1