Soybean miRNA Abundances

The data below are based on the microRNAs listed in the Sanger registry. Adjust libraries/reads to display on the control panel.


        miRNA         miRNA sequence Len Sum (norm) Average Max Min (>0)  SoySeedWW3023d_1WS3023d_1WW3309d_1WS3309d_1Coty1SdCo1Coty2Coty3
gma-miR1507a UCUCAUUCCAUACAUCGUCUGA 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR1507b UCUCAUUCCAUACAUCGUCUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR1507c-3p CCUCAUUCCAAACAUCAUCU 20 477 53 220 8    38 17 8 9 13 49 50 220 73
gma-miR1507c-5p GAGGUGUUUGGGAUGAGAGAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR1508a UCUAGAAAGGGAAAUAGCAGUUG 23 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR1508b UAGAAAGGGGAAUAGCAGUUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR1508c UAGAAAGGGAAAUAGCAGUUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR1509a UUAAUCAAGGAAAUCACGGUCG 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR1509b UUAAUCAAGGAAAUCACGGUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR1510a-3p UUGUUGUUUUACCUAUUCCACCC 23 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR1510a-5p AGGGAUAGGUAAAACAAUGACUGC 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR1510b-3p UGUUGUUUUACCUAUUCCACC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR1510b-5p AGGGAUAGGUAAAACAACUACU 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR1511 AACCAGGCUCUGAUACCAUG 20 779 130 323 7    56 302 323 47 44 0 0 0 7
gma-miR1512a-3p GCUUUAAGAAUUUCAGUUAUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR1512a-5p UAACUGAAAAUUCUUAAAGUAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR1512b UAACUGGAAAUUCUUAAAGCAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR1512c UAACUGAACAUUCUUAGAGCAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR1513a-3p UUUAAAUGUGUAUAAGUCAUGGU 23 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR1513a-5p UGAGAGAAAGCCAUGACUUAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR1513b UGAGAGAAAGCCAUGACUUAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR1513c UAUGAGAGAAAGCCAUGAC 19 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR1514a-3p AUGCCUAUUUUAAAAUGAAAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR1514a-5p UUCAUUUUUAAAAUAGGCAUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR1514b-3p AUGCCUAUUUUAAAAUGAAAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR1514b-5p UUCAUUUUUAAAAUAGACAUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR1515a UCAUUUUGCGUGCAAUGAUCUG 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR1515b UCAUUUUGCGUGCAAUGAUCUG 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR1516a-3p CAAAAGAGCUUAUGGCUUGUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR1516a-5p CAAGUUAUAAGCUCUUUUGAGAG 23 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR1516b AGCUUCUCUACAGAAAAUAUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR1516c AAUGUCUGGGCUUAGCGAGGCGGU 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR1516d GUACUUGUGGCUUGUAUCCAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR1517 AGUCUUGGUCAAUGUCGUUCGAAA 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR1518 UGUGUUGUAAAGUGAAUAUCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR1519 UAAGUGUUGCAAAAUAGUCAUU 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR1520a UAGAACAUGAUACAUGACAGUCA 23 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR1520b GUGACAGUCAUCAUUUAAUAAGA 23 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR1520c UUCAAUAAGAACGUGACACGUGA 23 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR1520d AUCAGAACAUGACACGUGACAA 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR1520e CAAUAAGAACGUGACAUAUGACAG 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR1520f-3p CAAUCAGAACAUGACACAUGACAA 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR1520f-5p AUUGUCACGUGUCAUGUUCUGAUU 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR1520g CAAUCAGAACAUGACACGUGACAA 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR1520h AACGUCCAAUCAGAACGUGACAUG 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR1520i AACGUGACACGUGACGGUCAACAU 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR1520j AAGAACGUGACACAUGACAAUCAA 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR1520k AAUCAGAACAUGACACAUGACAGU 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR1520l AAUCAGAACAUGACACGUGAUAGU 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR1520m AAUCAGAACAUGACAUGUGACAAU 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR1520n UCAAUCAGAACAUGACACGUGACA 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR1520o UCAUCGUCCAAUCAGAAUGUGACA 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR1520p AUGUUGUUAUUGGAUGAUGACGGU 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR1520q AUUGACCAAUCAGAACAUGACACA 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR1520r UGUCACAUCCUGGUUGGACAUGAA 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR1521a CUGUUAAUGGAAAAUGUUGA 20 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR1521b GACUGUCACGUGUCAUAAUCAUA 23 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR1522 UUUAUUGCUUAAAAUGAAAU 20 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR1523a AUGGGAUAAAUGUGAGCUCA 20 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR1523b UCAUCGCUCCUGAGCUCACA 20 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR1524 CGAGUCCGAGGAAGGAACUCC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR1525 UGGGUUAAUUAAGUUUUUAGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR1526 CCGGAAGAGGAAAAUUAAGCAA 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR1527 UAACUCAACCUUACAAAACC 20 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR1528 AUAGAUUAGAUCAAUAUAUUAGU 23 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR1529 UUAAAGGAAACAAUUAAUCGUUA 23 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR1530 UUUUCACAUAAAUUAAAAUAU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR1531-3p UCGUCCAUAUGGGAAGACUUGUC 23 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR1531-5p AUAUGGACGAAGAGAUAGGUAAAU 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR1532 AACACGCUAAGCGAGAGGAGCUC 23 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR1533 AUAAUAAAAAUAAUAAUGA 19 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR1534 UAUUUUGGGUAAAUAGUCAU 20 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR1535a CUUGUUUGUGGUGAUGUCU 19 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR1535b CUUGUUUGUGGUGAUGUCUAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR1536 AAGCAGAGACAAAUGUGUUUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR156a UGACAGAAGAGAGUGAGCAC 20 257 29 73 4    73 25 26 38 21 29 6 35 4
gma-miR156aa AUUGGAGUGAAGGGAGCU 18 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR156ab AUUUAAGUGAUGGGAGCUCCG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR156b UGACAGAAGAGAGAGAGCACA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR156c UUGACAGAAGAUAGAGAGCAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR156d UUGACAGAAGAUAGAGAGCAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR156e UUGACAGAAGAUAGAGAGCAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR156f UUGACAGAAGAGAGAGAGCACA 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR156g ACAGAAGAUAGAGAGCACAG 20 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR156h UGACAGAAGAGAGUGAGCAC 20 257 29 73 4    73 25 26 38 21 29 6 35 4
gma-miR156i UUGACAGAAGAUAGAGAGCAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR156j UUGACAGAAGAUAGAGAGCAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR156k UUGACAGAAGAGAGUGAGCAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR156l UUGACAGAAGAUAGAGAGCAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR156m UUGACAGAAGAUAGAGAGCAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR156n UUGACAGAAGAGAGUGAGCAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR156o UUGACAGAAGAGAGUGAGCAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR156p UUGACAGAAGAAAGGGAGCAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR156q UGACAGAAGAGAGUGAGCACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR156r CUGACAGAAGAUAGAGAGCAU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR156s UGACAGAAGAGAGUGAGCACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR156t UUGACAGAAGAAAGGGAGCAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR156u UGACAGAAGAGAGUGAGCAC 20 257 29 73 4    73 25 26 38 21 29 6 35 4
gma-miR156v UGACAGAAGAGAGUGAGCAC 20 257 29 73 4    73 25 26 38 21 29 6 35 4
gma-miR156w UGACAGAAGAGAGUGAGCAC 20 257 29 73 4    73 25 26 38 21 29 6 35 4
gma-miR156x UGACAGAAGAGAGUGAGCAC 20 257 29 73 4    73 25 26 38 21 29 6 35 4
gma-miR156y UGACAGAAGAGAGUGAGCAC 20 257 29 73 4    73 25 26 38 21 29 6 35 4
gma-miR156z AUUGGAGUGAAGGGAGCU 18 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR159a-3p UUUGGAUUGAAGGGAGCUCUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR159a-5p GAGCUCCUUGAAGUCCAAUUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR159b-3p AUUGGAGUGAAGGGAGCUCCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR159b-5p GAGUUCCCUGCACUCCAAGUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR159c AUUGGAGUGAAGGGAGCUCCG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR159d AGCUGCUUAGCUAUGGAUCCC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR159e-3p UUUGGAUUGAAGGGAGCUCUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR159e-5p GAGCUCCUUGAAGUCCAAUU 20 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR159f-3p AUUGGAGUGAAGGGAGCUCCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR159f-5p GAGUUCCCUGCACUCCAAGUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR160a-3p GCGUAUGAGGAGCCAAGCAUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR160a-5p UGCCUGGCUCCCUGUAUGCCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR160b UGCCUGGCUCCCUGUAUGCC 20 109 14 42 2    42 2 3 3 3 40 4 0 12
gma-miR160c UGCCUGGCUCCCUGUAUGCC 20 109 14 42 2    42 2 3 3 3 40 4 0 12
gma-miR160d UGCCUGGCUCCCUGUAUGCC 20 109 14 42 2    42 2 3 3 3 40 4 0 12
gma-miR160e UGCCUGGCUCCCUGUAUGCC 20 109 14 42 2    42 2 3 3 3 40 4 0 12
gma-miR160f UGCCUGGCUCCCUGUAUGCCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR162a UCGAUAAACCUCUGCAUCCA 20 2,001 222 1,124 72    1,124 101 77 85 72 205 85 108 144
gma-miR162b UCGAUAAACCUCUGCAUCCAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR162c UCGAUAAACCUCUGCAUCCAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR164a UGGAGAAGCAGGGCACGUGCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR164b UGGAGAAGCAGGGCACGUGC 20 702 88 190 4    53 190 130 146 144 12 23 0 4
gma-miR164c UGGAGAAGCAGGGCACGUGC 20 702 88 190 4    53 190 130 146 144 12 23 0 4
gma-miR164d UGGAGAAGCAGGGCACGUGC 20 702 88 190 4    53 190 130 146 144 12 23 0 4
gma-miR164e UGGAGAAGCAGGGCACGUGCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR164f UGGAGAAGCAGGGCACGUGCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR164g UGGAGAAGCAGGGCACGUGCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR164h UGGAGAAGCAGGGCACGUGCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR164i UGGAGAAGCAGGGCACGUGCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR164j UGGAGAAGCAGGGCACGUGCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR164k UGGAGAAGCAGGGCACGUGCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR166a-3p UCGGACCAGGCUUCAUUCCCC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR166a-5p GGAAUGUUGUCUGGCUCGAGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR166b UCGGACCAGGCUUCAUUCCCC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR166c-3p UCGGACCAGGCUUCAUUCCCC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR166c-5p GGAAUGUUGUCUGGCUCGAGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR166d UCGGACCAGGCUUCAUUCCCC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR166e UCGGACCAGGCUUCAUUCCCC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR166f UCGGACCAGGCUUCAUUCCCC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR166g UCGGACCAGGCUUCAUUCCCC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR166h-3p UCUCGGACCAGGCUUCAUUCC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR166h-5p GGAAUGUUGUUUGGCUCGAGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR166i-3p UCGGACCAGGCUUCAUUCCCC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR166i-5p GGAAUGUCGUCUGGUUCGAG 20 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR166j-3p UCGGACCAGGCUUCAUUCCCG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR166j-5p GGAAUGUUGUUUGGCUCGAGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR166k UCUCGGACCAGGCUUCAUUCC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR166l GGAAUGUUGUCUGGCUCGAGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR166m CGGACCAGGCUUCAUUCCCC 20 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR166n UCGGACCAGGCUUCAUUCCCC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR166o UCGGACCAGGCUUCAUUCCCC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR166p UCGGACCAGGCUUCAUUCCC 20 198 22 50 14    29 14 20 14 21 17 50 19 14
gma-miR166q UCGGACCAGGCUUCAUUCCC 20 198 22 50 14    29 14 20 14 21 17 50 19 14
gma-miR166r UCGGACCAGGCUUCAUUCCC 20 198 22 50 14    29 14 20 14 21 17 50 19 14
gma-miR166s UCGGACCAGGCUUCAUUCCC 20 198 22 50 14    29 14 20 14 21 17 50 19 14
gma-miR166t UCGGACCAGGCUUCAUUCCC 20 198 22 50 14    29 14 20 14 21 17 50 19 14
gma-miR166u UCUCGGACCAGGCUUCAUUC 20 22 6 11 1    11 0 0 0 0 4 6 0 1
gma-miR167a UGAAGCUGCCAGCAUGAUCUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR167b UGAAGCUGCCAGCAUGAUCUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR167c UGAAGCUGCCAGCAUGAUCUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR167d UGAAGCUGCCAGCAUGAUCUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR167e UGAAGCUGCCAGCAUGAUCUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR167f UGAAGCUGCCAGCAUGAUCUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR167g UGAAGCUGCCAGCAUGAUCUGA 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR167h AUCAUGCUGGCAGCUUCAACUGGU 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR167i UCAUGCUGGCAGCUUCAACUGGU 23 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR167j UGAAGCUGCCAGCAUGAUCUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR167k UGAAGCUGCCAGCCUGAUCUUA 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR168a UCGCUUGGUGCAGGUCGGGAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR168b UCGCUUGGUGCAGGUCGGG 19 79 20 36 5    0 5 36 23 15 0 0 0 0
gma-miR169a CAGCCAAGGAUGACUUGCCGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR169b CAGCCAAGGAUGACUUGCCGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR169c AAGCCAAGGAUGACUUGCCGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR169d UGAGCCAAGGAUGACUUGCCGGU 23 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR169e AGCCAAGGAUGACUUGCCGG 20 1 1 1 1    0 0 1 0 0 0 0 0 0
gma-miR169f CAGCCAAGGAUGACUUGCCGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR169g CAGCCAAGGAUGACUUGCCGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR169h GGCGAGACAUCUUGGCUCAUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR169i-3p CCGGUGCCAUCCCGUCUCAUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR169i-5p UGAGCCGGGAUGGCUUGCCGGCA 23 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR169j-3p UUUCGACGAGUUGUUCUUGGC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR169j-5p UAGCCAAGAAUGACUUGCCGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR169k CAGCCAAGAAUGACUUGCCGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR169l-3p CGGGCAAGUUGUUUUUGGCUAC 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR169l-5p CAGCCAAGAAUGACUUGCCGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR169m CAGCCAAGGAUGACUUGCCGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR169n-3p UGCCGGCAAGUUUCUCUUGGC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR169n-5p CAGCCAAGGGUGAUUUGCCGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR169o UGAGCCAGGAUGGCUUGCCGGC 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR169p UGAGCCAAGGAUGACUUGCCG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR169r UGAGCCAGGAUGGCUUGCCGGC 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR169s AAGCCAAGGAUGACUUGCCGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR169t UAGCCAAGGAUGGACUUGCCUA 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR169u CAGCCAAGGAUGACUUGCCGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR169v CAGCCAAGGAUGACUUGCC 19 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR171a UGAGCCGUGCCAAUAUCACGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR171b-3p CGAGCCGAAUCAAUAUCACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR171b-5p ACGGCGUGAUAUUGGUACGGCUC 23 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR171c-3p UUGAGCCGUGCCAAUAUCACA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR171c-5p AGAUAUUGGUGCGGUUCAAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR171d UGAUUGAGUCGUGUCAAUAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR171e UGAUUGAGCCGUGCCAAUAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR171f UGAUUGAGCCGUGCCAAUAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR171g UGAUUGAGCCGUGCCAAUAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR171h AUUGAGACGAGCCGAAUCAAU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR171i-3p UUGAGCCGUGCCAAUAUCACG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR171i-5p AUAAGAAAGCAAUGCUCAAA 20 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR171j-3p UGAUUGAGCCGUGCCAAUAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR171j-5p UAUUGGCCUGGUUCACUCAGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR171k-3p UUGAGCCGCGCCAAUAUCACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR171k-5p CGAUGUUGGUGAGGUUCAAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR171l CGAUGUUGGUGAGGUUCAAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR171m UUGAGCCGCGUCAAUAUCUCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR171n UUGAGCCGCGUCAAUAUCUUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR171o-3p UUGAGCCGUGCCAAUAUCACA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR171o-5p AGAUAUUGGUACGGUUCAAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR171p UUGAGCCGCGUCAAUAUCUUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR171q UUGAGCCGUGCCAAUAUCACA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR171r CGAGCCGAAUCAAUACCACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR171s CGAGCCGAAUCAAUACCACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR171t UUGAGCCGCGUCAAUAUCUCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR171u UGAUUGAGCCGUGCCAAUAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR172a AGAAUCUUGAUGAUGCUGCAU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR172b-3p AGAAUCUUGAUGAUGCUGCAU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR172b-5p GUAGCAUCAUCAAGAUUCAC 20 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR172c GGAAUCUUGAUGAUGCUGCAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR172d GGAAUCUUGAUGAUGCUGCAGCAG 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR172e GGAAUCUUGAUGAUGCUGCAGCAG 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR172f AGAAUCUUGAUGAUGCUGCA 20 3 2 2 1    0 2 1 0 0 0 0 0 0
gma-miR172g GCAGCACCAUCAAGAUUCAC 20 2 2 2 2    0 0 0 0 2 0 0 0 0
gma-miR172h-3p AGAAUCUUGAUGAUGCUGCAU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR172h-5p GCAGCAGCAUCAAGAUUCACA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR172i-3p GGAAUCUUGAUGAUGCUGCAU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR172i-5p GCAGCAGCAUCAAGAUUCACA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR172j GCAGCAGCAUCAAGAUUCACA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR172k UGAAUCUUGAUGAUGCUGCAU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR172l GGAAUCUUGAUGAUGCUGCAU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR2107 CAAACCUCCGUAGCCUGUAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR2108a UUAAUGUGUUGUGUUUGUCGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR2108b UUAAUGUGUUGUGUUUGUGAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR2109-3p GGAGGCGUAGAUACUCACACC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR2109-5p UGCGAGUGUCUUCGCCUCUG 20 67 13 29 3    29 3 16 4 15 0 0 0 0
gma-miR2111a GUCCUUGGGAUGCAGAUUACG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR2111b UAAUCUGCAUCCUGAGGUUUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR2111c UAAUCUGCAUCCUGAGGUUUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR2111d GUCCUUGGGAUGCAGAUUACG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR2111e UAAUCUGCAUCCUGAGGUUUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR2111f UAAUCUGCAUCCUGAGGUUUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR2118a-3p UUGCCGAUUCCACCCAUUCCU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR2118a-5p GGAGAUGGGAGGGUCGGUAAAG 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR2118b-3p UUGCCGAUUCCACCCAUUCCU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR2118b-5p GGAGAUGGGAGGGUCGGUAAAG 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR2119 UCAAAGGGAGUUGUAGGGGAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR2606a AAAAGCACUUAAGGAACGGUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR2606b AAAAGCACUUAAGGAACGGUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR319a UUGGACUGAAGGGAGCUCCC 20 85 85 85 85    85 0 0 0 0 0 0 0 0
gma-miR319b UUGGACUGAAGGGAGCUCCC 20 85 85 85 85    85 0 0 0 0 0 0 0 0
gma-miR319c UUGGACUGAAAGGAGCUCCU 20 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR319d UGGACUGAAGGGGAGCUCCUUC 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR319e UUGGACUGAAGGGAGCUCCC 20 85 85 85 85    85 0 0 0 0 0 0 0 0
gma-miR319f UUGGACUGAAGGGGCCUCUU 20 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR319g UUGGACUGAAGGGAGCUCCUUC 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR319h UUGGACUGAAGGGAGCUCCCU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR319i UUGGACUGAAGGGGAGCUCCUUC 23 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR319j UUGGACUGAAGGGAGCUCCCU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR319k UUGGACUGAAGGGAGCUCCCU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR319l UUGGACUGAAGGGAGCUCCUUC 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR319m UUGGACUGAAGGGAGCUCCCU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR319n UUUGGACCGAAGGGAGCCCCU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR319o UGGACUGAAGGGGAGCUCCUUC 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR319p UUUUGGACUGAAGGGAGCUCC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR319q UGGACUGAAGGGAGCUCCUUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR3522 AGACCAAAUGAGCAGCUGA 19 5 3 4 1    0 0 1 4 0 0 0 0 0
gma-miR390a-3p CGCUAUCCAUCCUGAGUUUC 20 8 3 5 1    0 2 1 0 5 0 0 0 0
gma-miR390a-5p AAGCUCAGGAGGGAUAGCGCC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR390b-3p UACUUGGCGCUAUCUAUCUUGA 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR390b-5p AAGCUCAGGAGGGAUAGCACC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR390c CGCUAUCCAUCCUGAGUUUC 20 8 3 5 1    0 2 1 0 5 0 0 0 0
gma-miR390d AAGCUCAGGAGGGAUAGCACC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR390e AGCUCAGGAGGGAUAGCGCC 20 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR390f AAGCUCAGGAGGGAUAGCGCC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR390g AAGCUCAGGAGGGAUAGCGCC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR393a UCCAAAGGGAUCGCAUUGAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR393b UUUGGGAUCAUGCUAUCCCUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR393c-3p AUCAUGCUAUCCCUUUGGAUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR393c-5p UCCAAAGGGAUCGCAUUGAUCC 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR393d UCCAAAGGGAUCGCAUUGAUCC 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR393e UCCAAAGGGAUCGCAUUGAUCC 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR393f UCCAAAGGGAUCGCAUUGAUCC 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR393g UCCAAAGGGAUCGCAUUGAUCC 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR393h UUCCAAAGGGAUCGCAUUGAUC 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR393i UUCCAAAGGGAUCGCAUUGAUC 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR393j UUCCAAAGGGAUCGCAUUGAUC 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR393k UUCCAAAGGGAUCGCAUUGAUC 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR394a-3p AGCUCUGUUGGCUACACUUU 20 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR394a-5p UUGGCAUUCUGUCCACCUCC 20 12 2 7 1    2 1 0 1 0 0 7 0 1
gma-miR394b-3p AGGUGGGCAUACUGUCAACU 20 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR394b-5p UUGGCAUUCUGUCCACCUCC 20 12 2 7 1    2 1 0 1 0 0 7 0 1
gma-miR394c-5p UUGGCAUUCUGUCCACCUCC 20 12 2 7 1    2 1 0 1 0 0 7 0 1
gma-miR394d UUGGCAUUCUGUCCACCUCC 20 12 2 7 1    2 1 0 1 0 0 7 0 1
gma-miR394e UUGGCAUUCUGUCCACCUCC 20 12 2 7 1    2 1 0 1 0 0 7 0 1
gma-miR394f UUGGCAUUCUGUCCACCUCC 20 12 2 7 1    2 1 0 1 0 0 7 0 1
gma-miR394g UUGGCAUUCUGUCCACCUCC 20 12 2 7 1    2 1 0 1 0 0 7 0 1
gma-miR395a CUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR395b CUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR395c CUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR395d UGAAGUGUUUGGGGGAACUUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR395e UGAAGUGUUUGGGGGAACUUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR395f UGAAGUGUUUGGGGGAACUUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR395g UGAAGUGUUUGGGGGAACUUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR395h AUGAAGUGUUUGGGAGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR395i AUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR395j AUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR395k AUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR395l AUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR395m AUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR396a-3p UUCAAUAAAGCUGUGGGAAG 20 5 5 5 5    0 0 0 0 5 0 0 0 0
gma-miR396a-5p UUCCACAGCUUUCUUGAACUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR396b-3p GCUCAAGAAAGCUGUGGGAGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR396b-5p UUCCACAGCUUUCUUGAACUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR396c UUCCACAGCUUUCUUGAACUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR396d AAGAAAGCUGUGGGAGAAUAUGGC 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR396e UUCCACAGCUUUCUUGAACUGU 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR396f AGCUUUCUUGAACUUCUUAUGCCUA 25 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR396g UUCUUGAACUUCUUAUGCAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR396h UCCACAGCUUUCUUGAACUG 20 1 1 1 1    0 0 1 0 0 0 0 0 0
gma-miR396i-3p GUUCAAUAAAGCUGUGGGAAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR396i-5p UUCCACAGCUUUCUUGAACUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR396j AUUCAAGAUAGCUGUGGAAAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR396k-3p GCUCAAGAAAGCUGUGGGAGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR396k-5p UUCCACAGCUUUCUUGAACUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR397a UCAUUGAGUGCAGCGUUGAUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR397b-3p UAUUGACGCUGCACUCAAUCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR397b-5p UCAUUGAGUGCAGCGUUGAUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR398a UGUGUUCUCAGGUCACCCCUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR398b UGUGUUCUCAGGUCACCCCUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR398c UGUGUUCUCAGGUCGCCCCUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR398d UGUGUUCUCAGGUCGCCCCUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR399a UGCCAAAGGAGAGUUGCCCUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR399b UGCCAAAGGAGAGUUGCCCUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR399c UGCCAAAGGAGAGUUGCCCUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR399d UGCCAAAGGAGAUUUGCCCAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR399e UGCCAAAGGAGAUUUGCCCAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR399f UGCCAAAGGAGAUUUGCCCAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR399g UGCCAAAGGAGAUUUGCCCAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR399h UGCCAAAGGAGAGUUGCCCUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR399i UGCCAAAGGAGAAUUGCCCUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR403a UUAGAUUCACGCACAAACUUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR403b UUAGAUUCACGCACAAACUUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR408a-3p AUGCACUGCCUCUUCCCUGGC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR408a-5p CAGGGGAACAGGCAGAGCAUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR408b-3p AUGCACUGCCUCUUCCCUGGC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR408b-5p CUGGGAACAGGCAGGGCACG 20 1,134 227 406 23    0 235 298 406 172 23 0 0 0
gma-miR408c-3p AUGCACUGCCUCUUCCCUGGC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR408c-5p CAGGGGAACAGGCAGAGCAUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR408d UGCACUGCCUCUUCCCUGGC 20 19,905 2,488 8,852 1    43 4,493 4,300 8,852 2,201 11 4 0 1
gma-miR4340 UGCAGAGAUAGGGACGCGCUUA 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4341 UGUGUUGAAAGUUUAACAUGACGG 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4342 AAUCGACUUAGAAUGUAGGAUGGU 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4343a AAAAAACUUACGGAUCAAGUUGAU 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4343b UCUUACAGAUCAAGUUGAUUCGGA 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4344 AAGUAGACAUUCUAAGACGUUGCU 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4345 UAAGACGGAACUUACAAAGAUU 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4346 GAAAGACCAAACGAGAAGCUGCAU 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4347 AAGCUUCUUACGGAUCAAGUUGAU 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4348a AAACUUGUAAGAUGGUGACAUU 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4348b UCUUUUGAAUUUGACUAUUAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4348c UGUUAAACUUGCAAGAUGACA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4349 UAUUGGCUAGAGAUAAGACAAAGA 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4350 UCAAAUGAUUUUGUGUCGUUGG 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4351 AUUGGGAUUCAGUUGGAGUUGG 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4352a AUUUCUAGGACAUACUACGACGGU 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4352b UAAAAUGUAGACAUUCUAAGACGG 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4353 CAAGUCGUAGCCGGUGUUAUUACU 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4354 CAAUUGGAUCGGUCCAACCGGC 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4355 CACUGUUGUGCUGGGUGUACCA 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4356 CAGGACUGUCUUAGAAAGCCAGGC 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4357 CAGUCGUGUGAUUGUACGGUUCAU 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4358 CAGUGCAUGACUAUAUCGCCAG 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4359a AACGAAGUGACUCUAACAUCGGUU 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4359b AACGCGUGAUAUGUUAACAUCGGU 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4360 CAGUUGACGUACGUACGGAUUGAC 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4361 CCGGAAGAGACUUACGGAUCAACU 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4362 CCUUAGGACAGACGUCAUGUAG 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4363 CGAUUACCAGAAGGCUUAUUAG 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4364a CGCGAGAUCGCACGGAAGAAGGUU 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4364b UAACAACAGCGGAAGAACCUUCUU 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4365 AAGAACUUCUUCCGCGAGAUCGCA 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4366 CUACUUAGUAGAGAUUUGUUGG 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4367 CUGAACCCUAGCGAAGUAAAUC 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4368a AAGACGGUACUUACCUCAGUAACA 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4368b AAGGACGGUACUUACGUAAGCAAC 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4369 GGAUCAAGCUGAUCCGGAAGUGGA 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4370 AGUAGACUCGUCCGAUUUUGCGUA 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4371a AAGUGAUGACAUGACAAGCGAAGU 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4371b AAGUGAUGACGUGGUAGACGGAGU 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4371c GACGUGACAGACGGAAUAUCACAU 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4372a UAAAAUCGUGACAUGUGACGGUCA 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4372b UAAUAAAAUCGUGACAUGUAAC 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4373 AAGUUGACGUACGUACGGAUUGAC 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4374a UAAGACGGUCGUGAUGUCAGCA 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4374b UACUUUCAAAGACGUUGUUGAG 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4375 UACCACUAGUGGUCGCGCCUGGCA 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4376-5p UACGCAGGAGAGAUGACGCUGU 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4376a-3p AGCAUCAUAUCUCCUGCAUAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4377 UACGUCAUCGCUGAAUGGAAGACG 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4378a AUAGGACUGUCUUAGAAUGGUGUA 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4378b UAGAACUGUCUUAGAAUGUGCUAC 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4379 UAGAGUGUAUACUGUGAGAGGCCU 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4380a CGGAUUGUUGAUCCGUAUGUGCAU 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4380b UAUGGUCAUACGGAUUGUUGAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4381 UAUGUGACGGUAAACGGUGACAAG 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4382 UAUGUUAACUGAUUUCAUGGAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4383 UAUUGGAUCUCAGUUGAACCGGUC 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4384 AAUCAGACACUGCAUUCAAAGACG 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4385 AAUCGAUGUAGAAAAGUGAUUGGU 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4386 UCGAAGGUUCUGGAGAGGACUGCA 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4387a AACAAGACGUGAUGACGUGACACU 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4387b AAGGUGUGAUGGCAUGACACUCUG 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4387c AGCGUGAUGACGUGACACUCCGUC 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4387d AUGUCACUGAUUAGGCAUGAUGAU 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4387e UGUUAGUGAUAAGGCGUGAUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4388 AAUCUUAGGGACCAAAUUGACAGC 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4389 UCGGUCGGACCGAUCCAAUCGGAA 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4390 UCGUACUCGUCGGGUAUCGGGUAU 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4391 UCUCGGCAAAGAACUAAGAAGAAG 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4392 UCUGCGAAAAUGUGAUUUCGGA 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4393a UGAGAAAAGGACGGCAGAAAAGCC 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4393b UUGAAAAGGGACAGCAGAGAAGCC 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4394 AAUGGACUAAAGAGAAAGGGGCCG 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4395 UGGAUAGGAGUAUGGGCUUGAG 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4396 UGUAGUUUCUAAGACGAUGCUGAC 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4397-3p UGUCAAAGAUGUGGCGAAUACU 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4397-5p CAUCGUUGACGCUGACUGUACG 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4398 UGUCAGCGGAGUGAGAAGACGAAA 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4399 UUAACGAAAAAGGACUAACGAC 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4400 UUCGGAAAAAUUCUGGAAGACGUC 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4401a ACAACGUCUUUGAAAGUAGGCAUU 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4401b UCAAAGACGUUGCUGAGGUAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4402 ACAUAUUAUGGGUCUCAGACGGAC 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4403 ACGGACACCGAACACGACACGGAC 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4404 AUUCGUGGAAGACUGGCGGAUCAA 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4405 AUUCUAAGACGGUUAUCUGGGACC 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4406 AUUGAUUCUGAGAGAACCGGUGUA 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4407 CAGAGGAAGCAGCACUUGUACC 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4408 UAACAACAUUGGAUGAGGGUUGGA 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4409 UAACAAGUGGGUUUGUUGACUG 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4410 UAUGUUGAUCCGUAUGAGUCGUAC 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4411 UUAUUGUAACUAAUUUGUCGGU 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4412-3p AGUGGCGUAGAUCCCCACAAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4412-5p UGUUGCGGGUAUCUUUGCCUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4413a AAGAGAAUUGUAAGUCACUG 20 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4413b UAAGAGAAUUGUAAGUCACU 20 1 1 1 1    0 0 0 1 0 0 0 0 0
gma-miR4414-3p UCCAACGAUGCGGGAGCUGC 20 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4414-5p AGCUGCUGACUCGUUGGCUC 20 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4415a-3p UUGAUUCUCAUCACAACAUGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4415a-5p AAGUUGUGAUGAGAAUCAAUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4415b-3p UUGAUUCUCAUCACAACAUGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4415b-5p AAGUUGUGAUGGGAAUCAAUGGCA 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4416a ACGGGUCGCUCUCACCUAGG 20 2 2 2 2    0 0 2 0 0 0 0 0 0
gma-miR4416b UGGGUGAGAGAAACGCGUAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4416c CUGGGUGAGAGAAACACGUAU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR482a-3p UCUUCCCAAUUCCGCCCAUUCCUA 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR482a-5p AGAAUUUGUGGGAAUGGGCUGA 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR482b-3p UCUUCCCUACACCUCCCAUACC 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR482b-5p UAUGGGGGGAUUGGGAAGGAAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR482c-3p UUCCCAAUUCCGCCCAUUCCU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR482c-5p AUUUGUGGGAAUGGGCUGAUUGG 23 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR482d-3p UCUUCCCUACACCUCCCAUACC 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR482d-5p UAUGGGGGGAUUGGGAAGGAAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR482e UAUGGGGGGAUUGGGAAGGAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4992 AUUCUAAGAUGGUUUUUGUUAG 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4993 GAGCGGCGGCGGUGGAGGAUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4994-3p UGAUAUCCUUGAGCUAAUACA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4994-5p GGUUAGCUCAAGGAUCUCAC 20 4 1 2 1    0 0 1 1 2 0 0 0 0
gma-miR4995 AGGCAGUGGCUUGGUUAAGGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4996 UAGAAGCUCCCCAUGUUCUC 20 2,790 399 964 1    6 622 770 425 964 0 2 0 1
gma-miR4997 GAUCGUCAAGCGCGAAGAUGAGG 23 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR4998 AGUUUCGUGACUACAACUUCUG 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5030 AGAACAAUUUGUGUUUUACCGG 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5031 UUAAUGAUUAACAUCUAAUUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5032 AGAGCCACUUUUGGGUUCCCUAU 23 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5033 GGCUGUACAAAAGGAAACUAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5034 GGUACCCUUUCAGAUAGUCUCA 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5035-3p UGUUUAGAAGCUCAUAGAAUAGAU 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5035-5p CUUCUAAACAUUUUUUCCCUUA 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5036 AGAGGCCCUUGGGGAGGAGUAA 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5037a GCCUCAAAGGCUUCCACUACUG 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5037b AACCCUCAAAGGCUUCCUAG 20 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5037c AGUGGAACUUUGAGGCCUGC 20 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5037d CGGGAGCCUAUGAAGGUUAAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5038a UGAGAAUUUGGCCUCUGUCCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5038b UGAGAAUUUGGCCUCUGUCCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5039 CCCUUUUUUAAUCGUUGCAUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5040 AUGAUAUAUAACAAGCAUGAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5041-3p GUUGAGCAAGUUGAAGAUGAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5041-5p UUUCAUCUUCAACUUGCUCAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5042-3p UGGGGCUUGAUCCAAGAUAGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5042-5p UAUCUUGGAUCACAGCCCCAUU 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5043 UGUCCCCUUCUCUGCACCACC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5044 GUAGUGGAUGCCUAGAGGUCCA 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5225 CCUGUCGUAGGAGAGAUGACGC 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR530a UGCAUUUGCACCUGCACUUU 20 10 3 8 1    8 1 1 0 0 0 0 0 0
gma-miR530b UGCAUUUGCACCUGCACUUUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR530c UGCAUUUGCACCUGCACUUUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR530d UGCAUUUGCACCUGCACUUUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR530e UGCAUUUGCACCUGCACUUUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5368 GGACAGUCUCAGGUAGACA 19 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5369 UGAGAAAAGGAGGAUGUCA 19 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5370 CUAAAGAUUGUCCAAAAGGAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5371-3p UCUCAGUGACUAAUUUCUAGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5371-5p UAGGAAUUAGUCACUCAGAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5372 UUGUUCGAUAAAACUGUUGUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5373 UCUCUUGAUUCUAGAUGAUGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5374-3p UUCAAAUGUCAGAUUAUAAAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5374-5p UUAUAGUCUGACAUCUGGAAU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5375 ACUAUAGAAGUACUUGUGGAGC 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5376 UGAAGAUUUGAAGAAUUUGGGA 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5377 CUGAAGGAUCGAUGUAGAAUGCU 23 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5378 CAUCUGAAGGAUAGAACACAUA 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5379 AUGAAAAUCAUUCAUUAUGAUAUC 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5380a GAAAAUGAAUGAUGAGGAUGGGGA 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5380b GAAAAUGAAUGAUGAGGAUGGGGA 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5380c AUGAAUGGUGAAGAUGAAGAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5559 UACUUGGUGAAUUGUUGGAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5667-3p AAACAGAUCUAAAUGGAUUCC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5667-5p AAUCCAUUCAGAUCUGUUUCG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5668 AGCAAUGGAAUUAUAGACUGC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5669 CAAUGUAGUGUGGUAAGUGGUC 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5670a CAUCAUACCAUAUUUGCUUCAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5670b CACAUCAUACCAUAUUUGCUUC 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5671a CAUGGAAGUGAAUCGGGUGAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5671b UACCCGAAUUUGCUUCCAUGAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5672 CAUGGUAGUGGAAGAAAUGGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5673 CGUGGAAUCUCGCGGAAGACAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5674a UAAUUGUGUUGUACAUUAUCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5674b UAAUUGUGUUGUACAUUAUCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5675 UAGAGACGACAACAAUGGAAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5676 UCGACACCAUAUGUAGAGGCAG 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5677 UUUGGUCUUUAAUCAAGCUGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5678 UUCCAUGAUAAGAUCUUUGAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5679 UUGGUGACCCAGAAGAAGUUGA 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5761a UUUUGUGUCGUGAAGCUUUUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5761b UUUUGUGUCGUGAAGCUUUUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5762 UCAUAGGAGGAAUCAACUGGC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5763a UGAACUAUACAAAGACGGUUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5763b UGAACUAUACAAAGACGGUUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5763c UGAACUAUACAAAGACGGUUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5764 UCCAUUCGCGGACAUGAUGGAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5765 CGAAACGUUGAGGUAUAUGUGGAC 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5766 UUGAGGCUGAGAAGAGGCAAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5767 UGGAGGACCUUUGAAGGUGCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5768 AAGUGCAAUACUGAUCUUCGGAAC 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5769 UGAGGGAAAUGAAGACGACGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5770a UUAGGACUAUGGUUUGGACGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5770b UUAGGACUAUGGUUUGGACAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5771 AUCUCAAGUGGAUUGCUUAAGGAC 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5772 AGAAUGUGAGUUAGAGUGAGCAUC 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5773 UUUUUAAAAGGUUCAGUUAGGU 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5774a GCUGGCGUCGACACGUGGCAU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5774b GCUGGCGUCGACACGUGGCAU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5775 AUAAGCUCUUUUGAGAGCUUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5776 AACUUGGGCUGAGCUUAGGUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5777 CUAGCAAUAAUGUUGGAUGCAC 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5778 CGACGAACUCUUCGUCGGCAUC 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5779 CAAGUCCAAAGUAGGAAUGUUGCA 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5780a AUCACUUAGCUGACGGUAGGGAC 23 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5780b UCUGAGUCCAUGAUAUAUUAAA 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5780c UUUAAUAUAUCAGGGACUUGGA 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5780d UGUUUUGAGUUUCUGAUAAAUU 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5781 CUGAAACUGAGACUGCAUCUGG 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5782 UAGCUGGUAGGAGAAGUUCAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5783 GACGACGACGGGGAGGACGCGC 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5784 AAUUAGCUAAUGGUUAGCUAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5785 UAGUGUUGUCCUGUCGAACACGGA 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR5786 UGUCGCAGGAUAGAGGGCACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR6299 AUUUAAAAUUAUUGAUUUGUCA 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR6300 GUCGUUGUAGUAUAGUGG 18 2 2 2 2    0 0 0 0 2 0 0 0 0
gma-miR828a UCUUGCUCAAAUGAGUAUUCCA 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR828b UCUUGCUCAAAUGAGUAUUCCA 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR862a UGCUGGAUGUCUUUGAAGGAAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR862b GCUGGAUGUCUUUGAAGGA 19 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR9722 UAAUAGAGGGAAGAAGAUGAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR9723 CAAAGGAGAUUUGGACAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR9724 UAGAGAUAGUGUCAAAAUAGAA 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR9725 UUAAUUUUUUUGGAUCAGCAU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR9726 UAUAGGCAUUAUUUUUUUCUUC 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR9727 UGAAGUUACUCUGAGCACUGAG 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR9728 CGCAGAACUGAAACAAGUUGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR9729 GUAAUGAGUAGAAACAUUUAGAAG 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR9730 CGAUUGCUGUCAUAACUGCUGC 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR9731 AUACAUAUCGUGUUGCCAAGC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR9732 CAAGGGUAUGAUGUGCAAUCU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR9733 UAACAGACUUAGAUUAACAGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR9734 UCGUGAAUGAGAUUUGUGUUGCUU 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR9735 UACGGCUUAAGUUCAACUUUGGAG 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR9736 UGAAAGACAAACAAAGGUGGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR9737 UUGUGGCUGAAAUCACUGUUGC 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR9738 UGAAACAUGAUGUGGACUCUUC 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR9739 UUUGAAUGUCCAGAUACGUAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR9740 UGUAGGUUCCAGUGAGGGAAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR9741 AAUGUGUUGAACUGAGUGAAGACA 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR9742 UGUGUUGUUUGUUUUGUAGCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR9743 AGAGAGUGCUUUGAAGAAAAUGCC 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR9744 AAUGGAUAUGAGCUGCAUACA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR9745 AGAAUUAAAUUUGGACCGUAUAAC 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR9746a AAAGUGUUUGAAUCUCAAUUAGAU 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR9746b AAAGUGUUUGAAUCUCAAUUAGAU 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR9746c AAAGUGUUUGAAUCUCAAUUAGAU 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR9746d AAAGUGUUUGAAUCUCAAUUAGAU 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR9746e AAAGUGUUUGAAUCUCAAUUAGAU 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR9746f AAAGUGUUUGAAUCUCAAUUAGAU 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR9746g AAAGUGUUUGAAUCUCAAUUAGAU 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR9746h AAAGUGUUUGAAUCUCAAUUAGAU 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR9746i AAAGUGUUUGAAUUUCAAUUAGAU 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR9747 CAUGCGAUGAUUUAAAUACUUU 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR9748 GAAGGAAGUGUAGAGGGAUGAC 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR9749 UUAGCUUCUUUCACCUUUCCC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR9750 UGUAAGUCCAUAUGUGCUCUCU 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR9751 GUAAUUUUAAACCUAAACCCUAAA 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR9752 UGCUUCUUCUUUUCCCUGUUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR9753 ACAAUUUGGGACUUAGGGCUACAA 24 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR9754 UGACCACAUUAGACUGAAAGUA 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR9755 UGAUCCAGGAACUUUUCAUCU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR9756 UGAGAACUUUAUCCAAACAGAG 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR9757 CAACCCUCCUCAGUUAGAUCUC 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR9758 UGUUUAGUCAUGCAAGUUUAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR9759 UAUAAGCAAGUAGAAUUUAAU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR9760 UGGAUGAUGUAGUUUUGAUUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR9761 UGAAGGUCUAGGAUAUUUUGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR9762 UACAGAUCUUUGGAAACAGGC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR9763 ACCCAUCCAACUCUGAAGAUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR9764 UGGAUACACUCUUACUUUCUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR9765 UAAUACAGAAUUCGGAGACAAC 22 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR9766 UUUGAAGGGAAGGAAUGAAAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0
gma-miR9767 AUGGAAUGGUUACUUAUGAAAAGA 24 0 0 0 0    0 0 0 0 0 0 0 0 0