Rice Small RNA miRNA Abundances

The data below are based on the microRNAs listed in the miRBase registry. Adjust libraries/reads to display on the control panel.


        miRNA         miRNA sequence Len Sum (norm) Average Max Min (>0)  YL9522_S3_1YL9522_S3_2YL9522_S3_3YL9522_S5_1YL9522_S5_2YL9522_S5_3YL9522_S7_1YL9522_S7_2YL9522_S7_3msp1_S3_1msp1_S3_2msp1_S3_3msp1_S5_1msp1_S5_2msp1_S5_3msp1_S7_1msp1_S7_2msp1_S7_3ostdl1a_S3_1ostdl1a_S3_2ostdl1a_S3_3ostdl1a_S5_1ostdl1a_S5_2ostdl1a_S5_3ostdl1a_S7_1ostdl1a_S7_2ostdl1a_S7_3
osa-miR11336-3p GAAUAUGGGAAAUGCUAGAAAGUCU 25 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR11336-5p GACUUUCUAGCGUUGCCCACAUUC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR11337-3p UAUCUCGUUAGAUUCGUCUCG 21 1 0 1 1    0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR11337-5p UGCGAGACGAAUCUAACGAGG 21 2 0 1 1    1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0
osa-miR11338-3p AUCUCGUUAGAUUCGUCUCGCAAA 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR11338-5p UUUGUGAGACGAAUCUAAUGAUAU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR11339-3p UAUGAAUGUGGGCAAUGCUAG 21 459 17 33 7    19 22 11 18 16 17 12 23 19 7 29 15 16 14 7 33 14 13 21 13 18 21 13 14 21 18 15
osa-miR11339-5p GCAUUGCCCACAUUCAUAUAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR11340-3p AAUAGUGUAAUCGGAUUAUAGAUC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR11340-5p AUCCGAUCUACGAUCCGAUUACAC 24 1 0 1 1    0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR11341-3p AUCUCGUUAGAUUCGUCUCGCAAA 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR11341-5p CCUAGGCUAUUUUGCGAGACGAAU 24 3 0 1 1    0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0
osa-miR11342-3p CUCGUUAGAUUCGUCUCGCAAA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR11342-5p CGAGACGAAUCUAACGAGAUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR11343-3p UGAAUGUGGGCAAUGUUAAAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR11343-5p CUUUCUAGCGUUGCCCACAUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR11344-3p CUGUGAGGUACCGGUACCUAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR11344-5p UAUCUCGAGAUAUCGGUACCUC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1319a AACCGGCAUCUGUAAUAUAUUAUA 24 5 0 1 1    0 0 0 1 0 0 0 1 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 0 0 1
osa-miR1319b CCUUUAAUAUAUUAUAGGUGUCGG 24 274 10 19 5    9 7 17 5 10 9 19 10 12 14 15 6 8 11 9 9 9 7 8 12 12 8 13 12 9 8 6
osa-miR1320-3p UGUAAAAUUCAUUCGUUCCAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1320-5p UGGAACGGAGGAAUUUUAUAG 21 1 0 1 1    0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1423-3p AGCGCCCAAGCGGUAGUUGUC 21 1 0 1 1    0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1423-5p AGGCAACUACACGUUGGGCGCUCG 24 621 23 36 8    34 25 24 26 26 9 8 18 15 29 26 28 23 25 36 20 21 20 33 25 29 31 22 24 19 12 13
osa-miR1424 AUGCACACUGAUGCUGAUUGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1425-3p CAGCAAGAACUGGAUCUUAAU 21 2,417 90 127 64    102 86 81 86 97 64 86 107 76 116 98 97 78 71 102 83 114 73 127 116 81 78 82 68 84 85 79
osa-miR1425-5p UAGGAUUCAAUCCUUGCUGCU 21 550 20 38 2    5 32 24 15 2 20 23 37 20 31 16 27 28 11 19 18 27 26 23 13 8 17 19 10 24 17 38
osa-miR1426 AGAAUCUUGAUGAUGAUUAAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1427 UGCGGAACCGUGCGGUGGCGC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1428a-3p UAAGAUAAAGCCGUGAAUUUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1428a-5p CGUUUUGCAAAUUCGCAGGCC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1428b UAAGAUAAUGCCAUGAAUUCG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1428c UAAGAUAAUGCCAUGAAUUCG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1428d UAAGAUAAUGCCAUGAAUUCG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1428e-3p UAAGAUAAUGCCAUGAAUUUG 21 3 0 2 1    0 0 0 0 0 0 0 1 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1428e-5p AAUUCACAGGCCCUAUCUUGUG 22 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0
osa-miR1428f-5p AAUUCACAGGCCCUAUCUUGUG 22 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0
osa-miR1428g-5p AAUUCACAGGCCCUAUCUUGUG 22 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0
osa-miR1429-3p GUUGCACGGGUUUGUAUGUUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1429-5p GUAAUAUACUAAUCCGUGCAU 21 1 0 1 1    0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1430 UGGUGAGCCUUCCUGGCUAAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1431 UUUGCGAGUUGGCCCGCUUGC 21 7 0 2 1    1 2 0 0 0 0 0 0 1 0 0 0 0 0 0 1 1 0 1 0 0 0 0 0 0 0 0
osa-miR1432-3p CAGGUGUCAUCUCCCCUGAAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1432-5p AUCAGGAGAGAUGACACCGAC 21 9 0 2 1    0 0 1 1 1 1 0 0 0 0 0 0 0 0 0 0 0 2 0 1 0 0 1 0 0 0 1
osa-miR1435 UUUCUUAAGUCAAACUUUUU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1436 ACAUUAUGGGACGGAGGGAGU 21 10 0 3 1    0 0 0 0 0 0 0 1 0 0 1 0 1 0 1 3 0 0 0 1 0 0 0 1 0 1 0
osa-miR1437a UCCGGCGCCGCACUAGGCACUG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1437b-3p GUGCUGGCGAGCUCCGGUGCCGCA 24 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0
osa-miR1437b-5p GGGAGGAAACAGUGCCUAGUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1438 AGGGUAAUUUUAUCAUUUUUAA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1439 UUUUGGAACGGAGUGAGUAUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1440a UGCUCAAAUACCACUCUCCU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1440b UUUAGGAGAGUGGUAUUUGAG 21 2 0 1 1    0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0
osa-miR1441 ACCGGAUGUCGGAAAAGGUUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1442 AUUCAUAGUACUAGAUGUGU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR156a UGACAGAAGAGAGUGAGCAC 20 58,499 2,167 3,816 968    3,345 3,032 3,404 1,775 1,315 1,398 2,504 3,816 3,004 2,630 2,438 2,630 1,344 1,504 1,146 2,000 1,605 1,790 3,183 2,710 1,961 1,660 968 1,073 2,025 2,133 2,106
osa-miR156b-3p GCUCACUCUCUAUCUGUCAGC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR156b-5p UGACAGAAGAGAGUGAGCAC 20 58,499 2,167 3,816 968    3,345 3,032 3,404 1,775 1,315 1,398 2,504 3,816 3,004 2,630 2,438 2,630 1,344 1,504 1,146 2,000 1,605 1,790 3,183 2,710 1,961 1,660 968 1,073 2,025 2,133 2,106
osa-miR156c-3p GCUCACUUCUCUCUCUGUCAGC 22 3 0 1 1    0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0
osa-miR156c-5p UGACAGAAGAGAGUGAGCAC 20 58,499 2,167 3,816 968    3,345 3,032 3,404 1,775 1,315 1,398 2,504 3,816 3,004 2,630 2,438 2,630 1,344 1,504 1,146 2,000 1,605 1,790 3,183 2,710 1,961 1,660 968 1,073 2,025 2,133 2,106
osa-miR156d UGACAGAAGAGAGUGAGCAC 20 58,499 2,167 3,816 968    3,345 3,032 3,404 1,775 1,315 1,398 2,504 3,816 3,004 2,630 2,438 2,630 1,344 1,504 1,146 2,000 1,605 1,790 3,183 2,710 1,961 1,660 968 1,073 2,025 2,133 2,106
osa-miR156e UGACAGAAGAGAGUGAGCAC 20 58,499 2,167 3,816 968    3,345 3,032 3,404 1,775 1,315 1,398 2,504 3,816 3,004 2,630 2,438 2,630 1,344 1,504 1,146 2,000 1,605 1,790 3,183 2,710 1,961 1,660 968 1,073 2,025 2,133 2,106
osa-miR156f-3p GCUCACUUCUCUUUCUGUCAGC 22 1 0 1 1    0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR156f-5p UGACAGAAGAGAGUGAGCAC 20 58,499 2,167 3,816 968    3,345 3,032 3,404 1,775 1,315 1,398 2,504 3,816 3,004 2,630 2,438 2,630 1,344 1,504 1,146 2,000 1,605 1,790 3,183 2,710 1,961 1,660 968 1,073 2,025 2,133 2,106
osa-miR156g-3p GCUCACUUCUCUCUCUGUCAGC 22 3 0 1 1    0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0
osa-miR156g-5p UGACAGAAGAGAGUGAGCAC 20 58,499 2,167 3,816 968    3,345 3,032 3,404 1,775 1,315 1,398 2,504 3,816 3,004 2,630 2,438 2,630 1,344 1,504 1,146 2,000 1,605 1,790 3,183 2,710 1,961 1,660 968 1,073 2,025 2,133 2,106
osa-miR156h-3p GCUCACUUCUCUUUCUGUCAGC 22 1 0 1 1    0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR156h-5p UGACAGAAGAGAGUGAGCAC 20 58,499 2,167 3,816 968    3,345 3,032 3,404 1,775 1,315 1,398 2,504 3,816 3,004 2,630 2,438 2,630 1,344 1,504 1,146 2,000 1,605 1,790 3,183 2,710 1,961 1,660 968 1,073 2,025 2,133 2,106
osa-miR156i UGACAGAAGAGAGUGAGCAC 20 58,499 2,167 3,816 968    3,345 3,032 3,404 1,775 1,315 1,398 2,504 3,816 3,004 2,630 2,438 2,630 1,344 1,504 1,146 2,000 1,605 1,790 3,183 2,710 1,961 1,660 968 1,073 2,025 2,133 2,106
osa-miR156j-3p GCUCGCUCCUCUUUCUGUCAGC 22 11 0 2 1    0 0 0 1 0 1 0 0 1 0 0 1 0 0 1 0 0 2 2 0 0 0 0 0 0 1 1
osa-miR156j-5p UGACAGAAGAGAGUGAGCAC 20 58,499 2,167 3,816 968    3,345 3,032 3,404 1,775 1,315 1,398 2,504 3,816 3,004 2,630 2,438 2,630 1,344 1,504 1,146 2,000 1,605 1,790 3,183 2,710 1,961 1,660 968 1,073 2,025 2,133 2,106
osa-miR156k UGACAGAAGAGAGAGAGCACA 21 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0
osa-miR156l-3p GCUCACUUCUCUUUCUGUCAGC 22 1 0 1 1    0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR156l-5p CGACAGAAGAGAGUGAGCAUA 21 5 0 2 1    0 0 0 0 1 0 1 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 2
osa-miR159a.1 UUUGGAUUGAAGGGAGCUCUG 21 5,268 195 408 78    185 251 189 122 156 113 78 198 157 150 408 182 185 181 152 148 149 130 322 333 138 313 155 148 173 285 267
osa-miR159a.2 UUGCAUGCCCCAGGAGCUGCA 21 67 2 14 1    3 4 4 1 1 0 2 3 1 4 1 1 0 0 14 8 2 5 1 0 6 0 0 0 2 2 2
osa-miR159b UUUGGAUUGAAGGGAGCUCUG 21 5,268 195 408 78    185 251 189 122 156 113 78 198 157 150 408 182 185 181 152 148 149 130 322 333 138 313 155 148 173 285 267
osa-miR159c AUUGGAUUGAAGGGAGCUCCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR159d AUUGGAUUGAAGGGAGCUCCG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR159e AUUGGAUUGAAGGGAGCUCCU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR159f CUUGGAUUGAAGGGAGCUCUA 21 52 2 7 1    1 7 2 0 2 1 1 2 1 3 5 2 1 1 1 1 0 0 3 7 3 0 5 1 0 0 2
osa-miR160a-3p GCGUGCAAGGAGCCAAGCAUG 21 3,226 119 183 80    183 155 145 118 131 92 121 150 120 117 100 115 92 86 138 114 139 132 80 95 117 101 108 88 133 118 138
osa-miR160a-5p UGCCUGGCUCCCUGUAUGCCA 21 1,436 53 144 5    28 83 81 64 5 52 37 59 27 144 49 56 61 38 116 49 47 60 88 32 13 19 11 5 58 55 99
osa-miR160b-3p GCGUGCAAGGAGCCAAGCAUG 21 3,226 119 183 80    183 155 145 118 131 92 121 150 120 117 100 115 92 86 138 114 139 132 80 95 117 101 108 88 133 118 138
osa-miR160b-5p UGCCUGGCUCCCUGUAUGCCA 21 1,436 53 144 5    28 83 81 64 5 52 37 59 27 144 49 56 61 38 116 49 47 60 88 32 13 19 11 5 58 55 99
osa-miR160c-3p GCGUGCACGGAGCCAAGCAUA 21 914 34 93 3    93 69 40 23 22 17 3 16 3 45 50 58 31 34 31 13 20 13 78 64 56 40 22 34 16 11 12
osa-miR160c-5p UGCCUGGCUCCCUGUAUGCCA 21 1,436 53 144 5    28 83 81 64 5 52 37 59 27 144 49 56 61 38 116 49 47 60 88 32 13 19 11 5 58 55 99
osa-miR160d-3p GCGUGCGAGGAGCCAAGCAUG 21 463 17 34 3    33 24 17 18 19 11 7 11 7 34 28 22 8 20 19 11 11 5 24 34 18 15 19 15 10 3 20
osa-miR160d-5p UGCCUGGCUCCCUGUAUGCCA 21 1,436 53 144 5    28 83 81 64 5 52 37 59 27 144 49 56 61 38 116 49 47 60 88 32 13 19 11 5 58 55 99
osa-miR160e-3p GCGUGCGAGGUGCCAAGCAUG 21 32 1 4 1    1 1 1 0 2 1 1 0 0 2 4 3 1 0 2 0 1 1 2 2 2 3 0 1 0 0 1
osa-miR160e-5p UGCCUGGCUCCCUGUAUGCCG 21 2,765 102 199 18    49 157 129 98 18 117 75 122 70 199 106 118 127 112 175 89 93 91 155 119 19 65 43 25 127 143 124
osa-miR160f-3p GCAUUGAGGGAGUCAUGCAGG 21 6 0 2 1    0 0 2 0 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0
osa-miR160f-5p UGCCUGGCUCCCUGAAUGCCA 21 15 1 3 1    0 1 1 1 0 0 0 0 0 3 0 0 1 0 2 1 0 0 2 2 0 0 0 0 1 0 0
osa-miR162a UCGAUAAACCUCUGCAUCCAG 21 1,778 66 137 35    37 41 35 60 53 50 75 123 67 38 52 36 54 55 60 84 124 84 69 53 40 62 56 48 93 137 92
osa-miR162b UCGAUAAGCCUCUGCAUCCAG 21 1,428 53 91 31    42 36 44 44 45 36 72 85 70 43 41 47 42 32 42 58 68 60 60 49 48 44 31 37 85 91 76
osa-miR164a UGGAGAAGCAGGGCACGUGCA 21 66,243 2,453 6,032 497    613 538 497 2,150 2,544 1,598 6,032 5,770 4,388 975 681 823 1,612 1,795 1,717 4,910 5,021 3,982 806 803 588 1,746 1,180 1,146 4,609 4,355 5,364
osa-miR164b UGGAGAAGCAGGGCACGUGCA 21 66,243 2,453 6,032 497    613 538 497 2,150 2,544 1,598 6,032 5,770 4,388 975 681 823 1,612 1,795 1,717 4,910 5,021 3,982 806 803 588 1,746 1,180 1,146 4,609 4,355 5,364
osa-miR164c UGGAGAAGCAGGGUACGUGCA 21 886 33 85 5    17 24 15 28 35 19 55 85 44 29 9 21 9 23 26 44 50 55 17 19 5 21 20 21 60 57 78
osa-miR164d UGGAGAAGCAGGGCACGUGCU 21 1,685 62 165 10    18 18 12 57 47 36 116 148 125 20 16 18 46 33 43 165 156 98 14 12 10 39 32 25 146 132 103
osa-miR164e UGGAGAAGCAGGGCACGUGAG 21 97 4 14 1    0 1 0 14 6 9 3 4 6 2 3 1 2 3 4 3 3 2 4 1 1 9 5 0 2 6 3
osa-miR164f UGGAGAAGCAGGGCACGUGCA 21 66,243 2,453 6,032 497    613 538 497 2,150 2,544 1,598 6,032 5,770 4,388 975 681 823 1,612 1,795 1,717 4,910 5,021 3,982 806 803 588 1,746 1,180 1,146 4,609 4,355 5,364
osa-miR166a-3p UCGGACCAGGCUUCAUUCCCC 21 1,625,790 60,214 92,938 33,012    76,610 67,214 67,608 77,150 64,959 55,555 33,012 48,419 36,859 74,216 68,995 70,015 60,862 53,716 68,853 42,574 49,067 44,607 92,938 65,100 58,022 65,254 50,349 59,105 51,378 70,463 52,890
osa-miR166a-5p GGAAUGUUGUCUGGUUCAAGG 21 159 6 12 1    12 6 3 3 5 5 7 4 1 3 9 9 8 2 5 4 6 6 9 9 8 7 6 2 6 7 7
osa-miR166b-3p UCGGACCAGGCUUCAUUCCCC 21 1,625,790 60,214 92,938 33,012    76,610 67,214 67,608 77,150 64,959 55,555 33,012 48,419 36,859 74,216 68,995 70,015 60,862 53,716 68,853 42,574 49,067 44,607 92,938 65,100 58,022 65,254 50,349 59,105 51,378 70,463 52,890
osa-miR166b-5p GGAAUGUUGUCUGGCUCGGGG 21 1,013 38 102 14    20 17 19 27 37 14 81 102 64 22 28 15 31 28 22 52 51 38 36 32 23 43 25 45 53 50 38
osa-miR166c-3p UCGGACCAGGCUUCAUUCCCC 21 1,625,790 60,214 92,938 33,012    76,610 67,214 67,608 77,150 64,959 55,555 33,012 48,419 36,859 74,216 68,995 70,015 60,862 53,716 68,853 42,574 49,067 44,607 92,938 65,100 58,022 65,254 50,349 59,105 51,378 70,463 52,890
osa-miR166c-5p GGAAUGUUGUCUGGUCCGAG 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR166d-3p UCGGACCAGGCUUCAUUCCCC 21 1,625,790 60,214 92,938 33,012    76,610 67,214 67,608 77,150 64,959 55,555 33,012 48,419 36,859 74,216 68,995 70,015 60,862 53,716 68,853 42,574 49,067 44,607 92,938 65,100 58,022 65,254 50,349 59,105 51,378 70,463 52,890
osa-miR166d-5p GGAAUGUUGUCUGGCUCGAGG 21 595 22 37 10    28 18 13 21 16 17 18 31 29 15 26 16 19 12 18 29 32 28 37 33 11 19 10 10 29 36 24
osa-miR166e-3p UCGAACCAGGCUUCAUUCCCC 21 1,978 73 132 30    45 42 42 110 105 62 75 74 56 75 45 63 94 79 121 50 76 76 68 42 30 80 86 91 64 95 132
osa-miR166e-5p GGAAUGUUGUCUGGUUCAAGG 21 159 6 12 1    12 6 3 3 5 5 7 4 1 3 9 9 8 2 5 4 6 6 9 9 8 7 6 2 6 7 7
osa-miR166f UCGGACCAGGCUUCAUUCCCC 21 1,625,790 60,214 92,938 33,012    76,610 67,214 67,608 77,150 64,959 55,555 33,012 48,419 36,859 74,216 68,995 70,015 60,862 53,716 68,853 42,574 49,067 44,607 92,938 65,100 58,022 65,254 50,349 59,105 51,378 70,463 52,890
osa-miR166g-3p UCGGACCAGGCUUCAUUCCUC 21 1,130,075 41,855 73,378 20,958    61,869 50,229 56,098 46,688 44,043 34,585 20,958 30,125 22,972 66,326 54,014 55,162 37,744 33,602 44,135 25,842 29,503 25,909 73,378 55,037 48,449 41,412 35,433 38,332 30,488 37,334 30,408
osa-miR166g-5p AAUGGAGGCUGAUCCAAGAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR166h-3p UCGGACCAGGCUUCAUUCCUC 21 1,130,075 41,855 73,378 20,958    61,869 50,229 56,098 46,688 44,043 34,585 20,958 30,125 22,972 66,326 54,014 55,162 37,744 33,602 44,135 25,842 29,503 25,909 73,378 55,037 48,449 41,412 35,433 38,332 30,488 37,334 30,408
osa-miR166h-5p GGAAUGUUGGCUGGCUCGAGG 21 3,350 124 251 60    125 93 89 83 71 60 99 135 125 166 210 139 84 84 85 117 123 93 251 232 156 127 126 124 104 149 100
osa-miR166i-3p UCGGAUCAGGCUUCAUUCCUC 21 371 14 25 5    25 17 21 15 6 6 12 13 17 18 14 14 19 12 13 12 23 9 18 14 13 5 5 9 11 22 8
osa-miR166i-5p AAUGCAGUUUGAUCCAAGAUC 21 16 1 2 1    1 1 0 0 1 0 1 1 2 0 0 0 1 0 0 1 1 1 0 0 0 0 1 0 2 1 1
osa-miR166j-3p UCGGACCAGGCUUCAUUCCCC 21 1,625,790 60,214 92,938 33,012    76,610 67,214 67,608 77,150 64,959 55,555 33,012 48,419 36,859 74,216 68,995 70,015 60,862 53,716 68,853 42,574 49,067 44,607 92,938 65,100 58,022 65,254 50,349 59,105 51,378 70,463 52,890
osa-miR166j-5p GAAUGACGUCCGGUCUGAAGA 21 1 0 1 1    0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR166k-3p UCGGACCAGGCUUCAAUCCCU 21 549,477 20,351 32,787 10,459    28,406 23,330 26,049 22,151 22,975 17,315 10,459 14,464 10,547 30,223 26,735 27,290 18,563 16,951 22,289 12,714 14,725 13,936 32,787 25,685 24,078 21,565 17,994 19,711 15,362 17,704 15,469
osa-miR166k-5p GGUUUGUUGUCUGGCUCGAGG 21 1,068 40 74 22    52 34 41 38 35 22 37 35 26 52 54 59 30 31 31 28 38 23 74 60 50 39 32 50 31 37 29
osa-miR166l-3p UCGGACCAGGCUUCAAUCCCU 21 549,477 20,351 32,787 10,459    28,406 23,330 26,049 22,151 22,975 17,315 10,459 14,464 10,547 30,223 26,735 27,290 18,563 16,951 22,289 12,714 14,725 13,936 32,787 25,685 24,078 21,565 17,994 19,711 15,362 17,704 15,469
osa-miR166l-5p GGAUUGUUGUCUGGUUCAAGG 21 32 1 3 1    1 0 0 1 2 1 0 1 1 3 1 3 2 1 2 2 0 2 2 3 0 0 1 1 1 1 0
osa-miR166m UCGGACCAGGCUUCAUUCCCU 21 1,801 67 96 41    80 68 83 63 62 68 42 60 41 79 65 96 57 63 79 59 61 64 83 77 73 68 48 63 62 68 69
osa-miR167a-3p AUCAUGCAUGACAGCCUCAUUU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR167a-5p UGAAGCUGCCAGCAUGAUCUA 21 516,107 19,115 41,265 7,915    34,436 28,418 25,485 11,138 11,928 7,915 11,985 14,801 11,024 31,386 25,566 32,753 10,548 11,948 13,636 14,183 14,859 12,977 41,265 37,728 25,596 17,694 11,566 11,931 16,035 15,681 13,625
osa-miR167b UGAAGCUGCCAGCAUGAUCUA 21 516,107 19,115 41,265 7,915    34,436 28,418 25,485 11,138 11,928 7,915 11,985 14,801 11,024 31,386 25,566 32,753 10,548 11,948 13,636 14,183 14,859 12,977 41,265 37,728 25,596 17,694 11,566 11,931 16,035 15,681 13,625
osa-miR167c-3p GGUCAUGCUGCGGCAGCCUCACU 23 267 10 30 1    25 30 20 1 7 10 3 3 3 21 20 21 5 3 9 1 3 2 5 29 19 7 6 8 1 2 3
osa-miR167c-5p UGAAGCUGCCAGCAUGAUCUA 21 516,107 19,115 41,265 7,915    34,436 28,418 25,485 11,138 11,928 7,915 11,985 14,801 11,024 31,386 25,566 32,753 10,548 11,948 13,636 14,183 14,859 12,977 41,265 37,728 25,596 17,694 11,566 11,931 16,035 15,681 13,625
osa-miR167d-3p GAUCAUGCUGUGCAGUUUCAUC 22 4 0 1 1    0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 1 0 0
osa-miR167d-5p UGAAGCUGCCAGCAUGAUCUG 21 20,876 773 1,955 63    115 96 74 752 838 652 1,563 1,955 1,328 116 96 98 582 623 914 1,643 1,674 1,444 117 95 63 562 402 367 1,622 1,542 1,543
osa-miR167e-3p AGAUCAUGUUGCAGCUUCACU 21 560 21 51 3    3 7 5 27 22 23 28 51 32 7 10 18 33 26 22 31 33 34 8 7 4 23 19 17 21 29 20
osa-miR167e-5p UGAAGCUGCCAGCAUGAUCUG 21 20,876 773 1,955 63    115 96 74 752 838 652 1,563 1,955 1,328 116 96 98 582 623 914 1,643 1,674 1,444 117 95 63 562 402 367 1,622 1,542 1,543
osa-miR167f UGAAGCUGCCAGCAUGAUCUG 21 20,876 773 1,955 63    115 96 74 752 838 652 1,563 1,955 1,328 116 96 98 582 623 914 1,643 1,674 1,444 117 95 63 562 402 367 1,622 1,542 1,543
osa-miR167g UGAAGCUGCCAGCAUGAUCUG 21 20,876 773 1,955 63    115 96 74 752 838 652 1,563 1,955 1,328 116 96 98 582 623 914 1,643 1,674 1,444 117 95 63 562 402 367 1,622 1,542 1,543
osa-miR167h-3p AGGUCAUGCUGUAGUUUCAUC 21 36 1 8 1    0 0 0 0 2 0 5 8 5 1 0 0 0 0 0 1 3 0 0 0 0 0 0 0 2 2 7
osa-miR167h-5p UGAAGCUGCCAGCAUGAUCUG 21 20,876 773 1,955 63    115 96 74 752 838 652 1,563 1,955 1,328 116 96 98 582 623 914 1,643 1,674 1,444 117 95 63 562 402 367 1,622 1,542 1,543
osa-miR167i-3p AGAUCAUGUUGCAGCUUCACU 21 560 21 51 3    3 7 5 27 22 23 28 51 32 7 10 18 33 26 22 31 33 34 8 7 4 23 19 17 21 29 20
osa-miR167i-5p UGAAGCUGCCAGCAUGAUCUG 21 20,876 773 1,955 63    115 96 74 752 838 652 1,563 1,955 1,328 116 96 98 582 623 914 1,643 1,674 1,444 117 95 63 562 402 367 1,622 1,542 1,543
osa-miR167j UGAAGCUGCCAGCAUGAUCUG 21 20,876 773 1,955 63    115 96 74 752 838 652 1,563 1,955 1,328 116 96 98 582 623 914 1,643 1,674 1,444 117 95 63 562 402 367 1,622 1,542 1,543
osa-miR168a-3p GAUCCCGCCUUGCACCAAGUGAAU 24 243 9 23 3    4 5 4 11 10 5 14 13 16 4 4 5 7 5 7 13 9 15 7 8 3 3 8 9 20 11 23
osa-miR168a-5p UCGCUUGGUGCAGAUCGGGAC 21 2,356,460 87,276 157,733 40,855    40,855 46,357 45,011 95,862 111,805 95,698 117,891 152,704 120,711 61,658 50,200 54,535 81,780 79,347 57,965 128,788 86,595 132,304 45,495 59,523 46,576 82,456 73,108 68,407 157,733 128,184 134,912
osa-miR168b AGGCUUGGUGCAGCUCGGGAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR169a CAGCCAAGGAUGACUUGCCGA 21 124 5 22 1    0 0 0 2 3 6 14 7 10 1 0 1 2 6 2 11 2 9 1 1 0 3 3 9 7 2 22
osa-miR169b CAGCCAAGGAUGACUUGCCGG 21 110 4 12 1    1 1 5 2 2 1 2 2 9 0 1 2 2 6 10 7 6 9 0 1 1 4 8 7 7 2 12
osa-miR169c CAGCCAAGGAUGACUUGCCGG 21 110 4 12 1    1 1 5 2 2 1 2 2 9 0 1 2 2 6 10 7 6 9 0 1 1 4 8 7 7 2 12
osa-miR169d UAGCCAAGGAUGAAUUGCCGG 21 153 6 17 1    9 15 8 3 0 3 1 0 1 16 14 11 1 2 0 0 3 1 8 17 15 2 5 5 6 1 6
osa-miR169e UAGCCAAGGAUGACUUGCCGG 21 1,460 54 124 14    81 100 105 22 30 20 14 18 25 122 99 124 45 41 37 16 16 24 101 109 102 39 42 66 21 17 24
osa-miR169f.1 UAGCCAAGGAUGACUUGCCUA 21 1 0 1 1    0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR169f.2 UGAGGACAAGAGCUGAUUCGG 21 38 1 6 1    0 0 0 0 1 0 1 3 1 3 0 1 0 0 2 3 3 6 0 1 0 0 3 1 2 4 3
osa-miR169g UAGCCAAGGAUGACUUGCCUA 21 1 0 1 1    0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR169h UAGCCAAGGAUGACUUGCCUG 21 3 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 1 0 1
osa-miR169i-3p UGAGUCGCUCUUAUCACUCAUG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR169i-5p.1 UAGCCAAGGAUGACUUGCCUG 21 3 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 1 0 1
osa-miR169i-5p.2 UGGUGAUAAGGGUGUAGCUCUG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR169j UAGCCAAGGAUGACUUGCCUG 21 3 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 1 0 1
osa-miR169k UAGCCAAGGAUGACUUGCCUG 21 3 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 1 0 1
osa-miR169l UAGCCAAGGAUGACUUGCCUG 21 3 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 1 0 1
osa-miR169m UAGCCAAGGAUGACUUGCCUG 21 3 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 1 0 1
osa-miR169n UAGCCAAGAAUGACUUGCCUA 21 8 0 2 1    0 0 0 1 1 1 0 2 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 2 0 0
osa-miR169o UAGCCAAGAAUGACUUGCCUA 21 8 0 2 1    0 0 0 1 1 1 0 2 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 2 0 0
osa-miR169p UAGCCAAGGACAAACUUGCCGG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR169q UAGCCAAGGAGACUGCCCAUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR169r-3p UGGCAAGUCUCCUCGGCUACC 21 3 0 1 1    0 0 0 0 0 0 0 1 0 0 0 0 1 0 0 0 0 0 0 1 0 0 0 0 0 0 0
osa-miR169r-5p UAGCCAAGGAUGAUUUGCCUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR171a UGAUUGAGCCGCGCCAAUAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR171b UGAUUGAGCCGUGCCAAUAUC 21 1,796 67 110 38    110 65 60 42 57 49 47 62 38 96 85 109 52 41 70 68 74 69 68 84 75 49 60 50 79 71 66
osa-miR171c-3p UGAUUGAGCCGUGCCAAUAUC 21 1,796 67 110 38    110 65 60 42 57 49 47 62 38 96 85 109 52 41 70 68 74 69 68 84 75 49 60 50 79 71 66
osa-miR171c-5p GGAUAUUGGUGCGGUUCAAUC 21 384 14 23 4    18 21 23 10 4 8 11 12 9 21 16 20 8 10 14 16 14 14 12 15 18 15 21 10 21 9 14
osa-miR171d-3p UGAUUGAGCCGUGCCAAUAUC 21 1,796 67 110 38    110 65 60 42 57 49 47 62 38 96 85 109 52 41 70 68 74 69 68 84 75 49 60 50 79 71 66
osa-miR171d-5p UGUUGGCCCGGCUCACUCAGA 21 477 18 35 8    20 18 16 17 24 17 20 35 16 17 8 15 13 15 12 22 26 20 13 12 10 18 9 11 24 33 16
osa-miR171e-3p UGAUUGAGCCGUGCCAAUAUC 21 1,796 67 110 38    110 65 60 42 57 49 47 62 38 96 85 109 52 41 70 68 74 69 68 84 75 49 60 50 79 71 66
osa-miR171e-5p UGUUGGCUCGGCUCACUCAGA 21 189 7 17 1    11 13 4 8 5 9 5 9 3 17 14 5 4 4 3 6 8 6 9 8 7 4 8 6 9 1 3
osa-miR171f-3p UGAUUGAGCCGUGCCAAUAUC 21 1,796 67 110 38    110 65 60 42 57 49 47 62 38 96 85 109 52 41 70 68 74 69 68 84 75 49 60 50 79 71 66
osa-miR171f-5p UGUUGGCAUGGUUCAAUCAAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR171g GAGGUGAGCCGAGCCAAUAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR171h GUGAGCCGAACCAAUAUCACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR171i-3p GGAUUGAGCCGCGUCAAUAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR171i-5p AGGUAUUGGCGUGCCUCAAUC 21 305 11 25 2    8 8 8 19 19 18 12 25 17 7 3 2 13 8 13 9 14 17 5 8 2 6 8 14 10 10 22
osa-miR172a AGAAUCUUGAUGAUGCUGCAU 21 10,575 392 1,045 91    1,045 872 640 193 185 131 206 198 161 860 813 953 208 170 196 91 108 94 907 992 796 132 126 155 130 103 110
osa-miR172b GGAAUCUUGAUGAUGCUGCAU 21 331 12 26 2    25 21 21 5 5 6 10 11 6 21 13 22 2 7 6 12 10 7 20 26 24 9 7 4 9 13 9
osa-miR172c UGAAUCUUGAUGAUGCUGCAC 21 2 0 1 1    0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR172d-3p AGAAUCUUGAUGAUGCUGCAU 21 10,575 392 1,045 91    1,045 872 640 193 185 131 206 198 161 860 813 953 208 170 196 91 108 94 907 992 796 132 126 155 130 103 110
osa-miR172d-5p GCAGCACCAUCAAGAUUCAC 20 11 0 3 1    0 0 1 0 0 1 2 0 3 0 0 1 0 0 0 1 0 0 0 1 1 0 0 0 0 0 0
osa-miR1846a-3p UGACCCCGUUCUCCUCGCCGG 21 2 0 1 1    0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0
osa-miR1846a-5p AGUGAGGAGGCCGGGGCCGCU 21 2 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 0 0 0 0
osa-miR1846b-3p UGACCCCGUUCUCCUCGCCGG 21 2 0 1 1    0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0
osa-miR1846b-5p AGUGAGGAGGCCGGGGCCGCU 21 2 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 0 0 0 0
osa-miR1846c-3p UGACCCCGGUCUGCUCGCUGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1846c-5p AGUGAGGAGGCCGGGGCCGCU 21 2 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 0 0 0 0
osa-miR1846d-3p UAUCCGGCGCCGCAGGGAGG 20 10 0 3 1    0 0 0 0 0 1 0 0 1 0 0 0 0 0 1 0 0 0 1 0 3 0 1 0 0 2 0
osa-miR1846d-5p UCCCACCGAGCAGCCGGAUCUC 22 78 3 12 1    1 2 3 4 1 3 6 4 3 2 2 1 2 0 2 4 1 5 0 2 1 2 2 2 12 3 8
osa-miR1846e CAACGAGGAGGCCGGGACCA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1847.1 UGCAGUUUGCAGUUGUGGCAC 21 10 0 2 1    0 0 0 1 2 1 0 1 0 0 1 0 0 1 0 0 2 0 0 0 0 0 0 0 1 0 0
osa-miR1847.2 UGGCCCACAUGUUAGUGCCACAAC 24 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1848 CCUCGCCGGCGCGCGCGUGCA 21 12 0 6 1    1 1 0 0 0 0 0 1 0 1 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 6
osa-miR1849 UAUCGUAUCCUAGGUUGGUUU 21 43 2 8 1    1 3 0 0 1 2 1 1 1 0 2 8 2 1 2 2 1 2 2 1 1 1 1 3 0 3 1
osa-miR1850.1 UGGAAAGUUGGGAGAUUGGGG 21 10,543 390 1,312 177    292 194 187 321 297 177 370 512 420 330 357 286 286 240 607 438 491 359 1,312 573 340 504 266 442 277 355 310
osa-miR1850.2 UUGUGUGUGAACUAAACGUGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1850.3 CUGUUUAGUUCACAUCAAUCUU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1851 CGUCUGGGAUGGCAUUUUGGC 21 37 1 5 1    0 2 2 3 2 2 2 1 1 2 0 0 0 2 1 0 2 1 5 2 0 1 0 0 4 1 1
osa-miR1852 AUAUGGAUUCAGAAUGCAGGU 21 73 3 6 1    3 2 2 6 4 3 2 2 3 2 6 2 2 4 4 3 2 1 3 5 2 1 0 2 4 3 0
osa-miR1853-3p UAAUUGGGGAUGUUCGGUUGCU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1853-5p AGCAUUCAAACAUUCCCAAUUACC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1854-3p UCCAAUUUGGGGAUUUGCUGAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1854-5p UGGUGAAAUUUGUAGAUUGGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1855 AGCACUGGAGUAGCCAAGAGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1856 UAUGCGUAAGACGGAUUCGUA 21 2 0 1 1    0 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1857-3p UCAUGCUCCAAGAAAACCAGG 21 23 1 3 1    1 2 0 1 0 3 0 3 0 0 1 2 0 0 0 0 1 1 3 1 0 0 2 0 1 0 1
osa-miR1857-5p UGGUUUUUUUGGAGCAUGAGG 21 19 1 2 1    2 1 0 2 0 0 1 0 2 2 1 0 0 0 0 0 1 1 0 1 0 0 1 1 1 0 2
osa-miR1858a GAGAGGAGGACGGAGUGGGGC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1858b GAGAGGAGGACGGAGUGGGGC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1859 UUUCCUAUGACGUCCAUUCCAA 22 38,747 1,435 3,192 412    2,882 2,096 2,203 963 1,052 651 412 687 519 2,960 2,637 2,702 1,100 1,053 1,176 685 644 714 3,192 2,581 2,210 1,238 1,114 1,010 722 831 713
osa-miR1860-3p AUCUGGAAGCUAGGUUUUCUCU 22 322 12 25 3    21 25 11 8 7 14 6 11 9 21 21 18 10 10 11 7 9 5 17 22 10 11 9 9 10 7 3
osa-miR1860-5p AGAAAACCAGCUUCCAGAUCU 21 118 4 9 1    7 6 4 2 6 2 3 6 3 2 8 5 3 4 9 1 2 3 6 6 2 6 4 6 4 6 2
osa-miR1861a UGAUCUUGAGGCAGAAACUGAG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1861b CGAUCUUGAGGCAGGAACUGAG 22 17 1 7 1    0 0 0 2 0 0 0 0 0 0 0 0 0 1 0 2 0 0 0 0 0 0 0 2 7 1 2
osa-miR1861c CGAUCUUGUAGCAAGAACUGAG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1861d UGGUCUUGAGGCAGGAACUGAG 22 2 0 1 1    0 0 1 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1861e CGGUCUUGUGGCAAGAACUGAG 22 6 0 1 1    0 0 0 0 1 0 0 1 0 0 0 0 0 1 0 0 1 0 0 0 0 0 0 1 0 0 1
osa-miR1861f CGAUCUUGAGGCAGGAACUGAG 22 17 1 7 1    0 0 0 2 0 0 0 0 0 0 0 0 0 1 0 2 0 0 0 0 0 0 0 2 7 1 2
osa-miR1861g CAGUCUUGUGGCAAGAACUGAG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1861h CGGUCUUGAGGCAGGAACUGAG 22 176 7 25 1    2 4 1 6 3 6 15 25 19 2 0 1 3 2 5 9 9 9 0 1 0 3 2 6 14 14 15
osa-miR1861i CGAUCUUGAGGCAGGAACUGAG 22 17 1 7 1    0 0 0 2 0 0 0 0 0 0 0 0 0 1 0 2 0 0 0 0 0 0 0 2 7 1 2
osa-miR1861j CGGUCUUGAGGCAGGAACUGAG 22 176 7 25 1    2 4 1 6 3 6 15 25 19 2 0 1 3 2 5 9 9 9 0 1 0 3 2 6 14 14 15
osa-miR1861k CGGUCUUGUGGCAAGAACUGAG 22 6 0 1 1    0 0 0 0 1 0 0 1 0 0 0 0 0 1 0 0 1 0 0 0 0 0 0 1 0 0 1
osa-miR1861l CGAUCUUGAGGCAGGAACUGAG 22 17 1 7 1    0 0 0 2 0 0 0 0 0 0 0 0 0 1 0 2 0 0 0 0 0 0 0 2 7 1 2
osa-miR1861m CGGUCUUGUGGCAAGAACUGAG 22 6 0 1 1    0 0 0 0 1 0 0 1 0 0 0 0 0 1 0 0 1 0 0 0 0 0 0 1 0 0 1
osa-miR1861n CGAUCUUGUGGCAGGAGCUGAG 22 11 0 2 1    1 0 2 0 0 2 0 1 0 0 0 0 0 0 0 0 0 0 1 1 2 0 0 0 1 0 0
osa-miR1861o UGAUCUUGAGGCAGAAACUGAG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1862a ACGAGGUUGGUUUAUUUUGGGACG 24 5,330 197 332 123    154 127 143 206 166 123 180 215 199 174 153 142 162 161 229 217 332 227 235 166 143 240 161 227 269 277 302
osa-miR1862b ACGAGGUUGGUUUAUUUUGGGACG 24 5,330 197 332 123    154 127 143 206 166 123 180 215 199 174 153 142 162 161 229 217 332 227 235 166 143 240 161 227 269 277 302
osa-miR1862c ACGAGGUUGGUUUAUUUUGGGACG 24 5,330 197 332 123    154 127 143 206 166 123 180 215 199 174 153 142 162 161 229 217 332 227 235 166 143 240 161 227 269 277 302
osa-miR1862d ACUAGGUUUGUUUAUUUUGGGACG 24 3,787 140 221 93    143 139 134 166 135 93 151 190 133 149 136 133 119 120 134 149 165 118 128 125 125 118 150 111 151 221 151
osa-miR1862e CUAGAUUUGUUUAUUUUGGGACGG 24 13,574 503 834 319    371 319 319 509 473 328 542 686 452 396 339 339 399 403 513 732 834 629 461 396 332 522 390 503 771 798 818
osa-miR1862f AUGAGGUUGGUUUAUUUUGG 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1862g AUGAGGUUGGUUUAUUUUGG 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1863a AGCUCUGAUACCAUGUUAGAUUAG 24 4,461 165 222 103    191 176 162 132 170 145 142 110 103 180 160 138 170 152 167 188 199 173 198 177 156 185 149 181 199 136 222
osa-miR1863b AGCUCUGAUACCAUGUUAACUGUU 24 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0
osa-miR1863b.2 AGAGACUUGGCUGAUGCAUUACU 23 2,188 81 137 37    99 66 50 86 99 63 60 79 37 63 48 54 80 58 82 98 117 110 99 62 55 108 70 90 106 137 112
osa-miR1863c UAGAAACUUGGCUGAUGCAUUACU 24 439 16 47 4    15 5 6 10 14 9 18 17 10 9 9 13 13 7 6 22 32 28 10 17 4 16 13 23 30 47 36
osa-miR1864 UUGUAGUAACGUGAUGGUCAAUGU 24 1,731 64 96 28    61 93 80 31 43 91 52 28 53 90 81 78 96 94 62 81 58 72 66 59 80 32 57 67 44 32 50
osa-miR1865-3p CGAAGAAUCGCAGUCACUAGUUGU 24 21 1 4 1    2 0 0 0 0 0 0 4 0 1 0 1 2 0 1 2 0 1 1 1 2 0 0 0 2 1 0
osa-miR1865-5p UGCUAGUGAUGGUGAUUCUUCGAC 24 156 6 14 2    3 2 5 7 3 2 10 12 8 6 2 2 3 6 2 4 14 8 0 0 2 8 3 7 13 14 10
osa-miR1866-3p UGAAAUUCCUGUAAAAUUCUUG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1866-5p GAGGGAUUUUGCGGGAAUUUCACG 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1868 UCACGGAAAACGAGGGAGCAGCCA 24 8,483 314 412 208    359 330 333 231 228 208 271 243 264 359 324 365 295 229 244 333 404 325 412 359 345 347 283 310 365 381 336
osa-miR1869 UGAGAACAAUAGGCAUGGGAGGUA 24 26 1 5 1    2 2 0 2 0 0 0 0 5 3 1 1 0 0 2 0 1 0 1 1 1 2 0 2 0 0 0
osa-miR1870-3p UUUAGGGCUAAUUCAGCAUGAACA 24 37 1 6 1    3 1 1 6 3 1 0 2 0 0 0 0 2 1 1 1 1 2 0 1 0 1 3 0 3 2 2
osa-miR1870-5p UGCUGAAUUAGACCUAGUGGGCAU 24 32,411 1,200 1,518 993    1,377 1,190 1,142 1,291 1,274 1,018 1,104 1,202 993 1,518 1,063 1,166 1,195 1,123 1,269 1,101 1,115 1,246 1,364 1,490 1,203 1,238 1,155 1,160 1,136 1,116 1,162
osa-miR1871 AUGGCUCUGAUAUCAUGUUGGUUU 24 666 25 51 12    25 17 23 31 26 15 12 25 20 25 17 17 23 22 15 35 35 33 27 20 21 36 19 24 22 51 30
osa-miR1872 GAACUGUAAGUCUGUGACGGGUAA 24 210 8 16 3    16 13 16 10 7 5 11 4 5 11 10 10 4 3 4 7 9 7 7 12 13 4 3 7 4 3 5
osa-miR1873 UCAACAUGGUAUCAGAGCUGGAAG 24 5,190 192 243 132    202 194 188 184 208 179 181 211 191 190 181 184 198 204 243 231 215 230 204 164 175 206 180 134 210 171 132
osa-miR1874-3p UAUGGAUGGAGGUGUAACCCGAUG 24 15 1 3 1    0 0 0 0 2 1 2 3 1 0 0 0 2 1 0 0 0 0 0 0 0 0 0 0 2 0 1
osa-miR1874-5p UAGGGCUACUACACCAUCCAUAAG 24 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1875 ACAAUGGAGUGAAGUGCAACAGAA 24 484 18 28 8    24 11 9 15 22 16 27 16 11 18 17 11 15 18 9 19 25 20 23 17 8 20 19 23 28 21 22
osa-miR1876 AUAAGUGGGUUUGUGGGCUGGCCC 24 334 12 28 6    6 16 9 10 12 9 19 19 8 13 14 6 8 8 7 10 18 16 9 14 7 7 8 17 19 28 17
osa-miR1877 AGAUGACAUGUGAAUGAUGAGGGG 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1878 ACUUAAUCUGGACACUAUAAAAGA 24 582 22 59 3    6 7 13 12 19 13 29 25 20 4 3 6 13 8 22 31 49 47 14 12 11 21 6 18 55 59 59
osa-miR1879 GUGUUUGGUUUAGGGAUGAGGUGG 24 1,850 69 143 42    67 54 50 76 49 43 46 55 42 43 66 52 56 48 112 103 95 70 143 92 46 104 59 69 74 87 49
osa-miR1880 UUCCAAGCGGGCCACUUAAGCAUU 24 528 20 37 6    15 23 20 8 9 37 20 10 23 10 32 30 27 14 24 20 14 16 16 28 23 9 27 26 19 6 22
osa-miR1881 AAUGUUAUUGUAGCGUGGUGGUGU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1882a AGAUUGCUUUCAAGGUCAUUUCUU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1882b AGAUUGCUUUCAAGGUCAUUUCUU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1882c AGAUUGCUUUCAAGGUCAUUUCUU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1882d AGAUUGCUUUCAAGGUCAUUUCUU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1882e-3p GAAAUGAUCUUGGACGUAAUCUAG 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1882e-5p AGAUUGCUUUCAAGGUCAUUUCUU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1882f AGAUUGCUUUCAAGGUCAUUUCUU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1882g AGAUUGCUUUCAAGGUCAUUUCUU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1882h AGAUUGCUUUCAAGGUCAUUUCUU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1883a ACCUGUGACGGGCCGAGAAUGGAA 24 2,239 83 130 49    128 130 130 65 72 74 51 49 55 96 112 122 99 69 67 76 65 60 89 119 121 60 83 70 69 55 53
osa-miR1883b ACCUGUGACGGGCCGAGAAUGGAA 24 2,239 83 130 49    128 130 130 65 72 74 51 49 55 96 112 122 99 69 67 76 65 60 89 119 121 60 83 70 69 55 53
osa-miR2055 UUUCCUUGGGAAGGUGGUUUC 21 386 14 22 5    21 20 14 18 20 10 5 6 16 22 12 17 18 11 16 11 12 13 19 20 12 10 15 9 14 13 12
osa-miR2090 AACUCUGAUUCUAGAAUUUUUG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2091-3p CAUACAUUGCCUCCUAGGCUUG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2091-5p UCAACCGAGCCGAGGAGGAGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2092-3p ACCAGCAUUCCAUUGGCAGAGG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2092-5p CAACUGAAGUCGGUGUUUACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2093-3p ACAUCUUCCAAUUAAUGCAU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2093-5p GUGCAUUAAUUGGAAGAACA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2094-3p CAGAGCUGUGGCAUCCACGUCG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2094-5p UGGCUGCUAGGCUCCUGGGUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2095-3p CUUCCAUUUAUGAUAAGUAU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2095-5p CUGAUAAUUUUACGAUGAAUAG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2096-3p CCUGAGGGGAAAUCGGCGGGA 21 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2096-5p UGCCGAUUUCCCCCUCGGGCG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2097-3p UUCUCUUCUUCGUGUCGCAUUU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2097-5p AGAGAUGGGACGGGCAGGGAAG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2098-3p CGGUUUGUCAAGCGGAGUGC 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2098-5p UCCCGUGGAGGCAGCCGAUG 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2099-3p ACAAAGCUGUAGCGUUAUUC 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2099-5p UGAAUAUGUUUGUACAAGCUUU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2100-3p AACCGCUGUUUAGGCGGAGUGG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2100-5p UUCUCUCAAGUUGCCAAACAAG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2101-3p AUUUAACUCAAGUGAGCAUUGU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2101-5p ACAUGUUUACAAGUUAAAAUGU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2102-3p CAUGGUGCCGGUUCCGGUGGCG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2102-5p GGGCAAGCCGCCGCCGCCAC 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2103 UUUCCCUCUCCGUGCGCGCUCG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2104 GCGGCGAGGGGAUGCGAGCGUG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2105 UUGUGAUGUGAAUGAUUCAU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2106 CCGAGGUUUUCUGGAUACAUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2118a UUCUCGAUGCCUCCCAUUCCUA 22 47 2 5 1    0 2 0 5 5 4 2 1 0 5 1 2 3 2 1 0 2 1 1 1 1 2 4 0 0 2 0
osa-miR2118b UUCCCGAUGCCUCCCAUUCCUA 22 608 23 71 2    14 10 7 35 71 28 9 13 17 19 13 20 35 34 38 10 17 22 8 13 2 22 40 41 19 22 29
osa-miR2118c UUCCCGAUGCCUCCUAUUCCUA 22 685 25 62 7    17 24 15 33 62 32 15 16 16 22 7 20 56 50 46 9 8 17 15 12 7 29 56 37 18 18 28
osa-miR2118d UUCCUGAUGCCUCCCAUGCCUA 22 539 20 40 3    8 7 3 32 40 30 14 20 21 10 13 7 40 38 28 20 12 20 8 17 6 34 32 26 16 13 24
osa-miR2118e UUCCCAAUGCCUCCCAUGCCUA 22 684 25 68 7    28 11 7 31 53 31 14 22 12 13 18 32 68 46 53 15 11 28 16 15 8 31 40 26 17 16 22
osa-miR2118f UUCCUGAUGCCUCCCAUUCCUA 22 712 26 61 6    20 17 11 27 56 28 12 16 19 25 17 19 61 56 44 13 12 18 15 6 13 26 46 48 16 38 33
osa-miR2118g UUCCUAAUGCCUCCCAUUCCUA 22 236 9 26 2    7 4 2 11 26 13 5 6 5 6 3 8 22 14 15 6 6 8 2 6 5 6 7 12 4 14 13
osa-miR2118h UUCCUGAUGCCUCUCAUUCCUA 22 993 37 84 11    17 22 12 57 73 58 27 40 29 18 15 27 84 64 69 21 23 42 18 18 11 59 57 57 19 26 30
osa-miR2118i UUCCUAGUGCCUCCCAUUCCUA 22 117 4 18 1    3 2 2 6 18 6 2 3 5 3 3 2 14 7 5 3 2 2 0 4 1 2 10 5 3 2 2
osa-miR2118j UUCCUGAUGCCUCCCAUUCCUA 22 712 26 61 6    20 17 11 27 56 28 12 16 19 25 17 19 61 56 44 13 12 18 15 6 13 26 46 48 16 38 33
osa-miR2118k UUCCUGAUGCCUCUCAUUCCUA 22 993 37 84 11    17 22 12 57 73 58 27 40 29 18 15 27 84 64 69 21 23 42 18 18 11 59 57 57 19 26 30
osa-miR2118l UUCCUAAUGCUUCCCAUUCCUA 22 181 7 16 1    6 3 2 5 16 9 2 6 1 10 3 4 13 14 5 7 4 10 5 1 2 10 16 12 4 6 5
osa-miR2118m UUCCUGAUGCCUCCCAUUCCUA 22 712 26 61 6    20 17 11 27 56 28 12 16 19 25 17 19 61 56 44 13 12 18 15 6 13 26 46 48 16 38 33
osa-miR2118n UUCCCGAUGCCUCCCAUUCCUA 22 608 23 71 2    14 10 7 35 71 28 9 13 17 19 13 20 35 34 38 10 17 22 8 13 2 22 40 41 19 22 29
osa-miR2118o CUCCUGAUGCCUCCCAAGCCUA 22 103 4 9 1    4 1 0 6 9 7 1 3 2 4 4 4 6 7 7 2 1 2 1 1 3 6 8 4 3 4 3
osa-miR2118p UUCCCGAUGCCUCCCAUGCCUA 22 239 9 20 2    5 6 7 20 16 5 6 3 2 6 7 9 20 20 14 6 4 7 9 6 5 15 17 8 4 3 9
osa-miR2118q UUCCCGAUGCCUCCUAUUCCUA 22 685 25 62 7    17 24 15 33 62 32 15 16 16 22 7 20 56 50 46 9 8 17 15 12 7 29 56 37 18 18 28
osa-miR2118r UUCCCAAUGCCUCCCAUGCCUA 22 684 25 68 7    28 11 7 31 53 31 14 22 12 13 18 32 68 46 53 15 11 28 16 15 8 31 40 26 17 16 22
osa-miR2120 AAAGAUCUUUAGUCCCGGUUGUUC 24 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0
osa-miR2120b-3p UUUAGUCGCGGUUGGUGUUA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2120b-5p ACACCAACCGCGACUAAAGA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2121a AAAACGGAGCGGUCCAUUAGCGCG 24 1,041 39 70 17    70 53 45 42 38 36 21 32 21 67 32 46 40 36 47 22 26 18 60 44 52 36 47 39 17 20 34
osa-miR2121b AAAACGGAGCGGUCCAUUAGCGCG 24 1,041 39 70 17    70 53 45 42 38 36 21 32 21 67 32 46 40 36 47 22 26 18 60 44 52 36 47 39 17 20 34
osa-miR2122 UUUCAAAAAUAACCUUUUGUUC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2275a UUUGGUUUCCUCCAAUAUCUCA 22 149 6 43 1    0 0 0 3 17 15 43 32 38 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1
osa-miR2275b UUUGGUUUCCUCCAAUAUCUCA 22 149 6 43 1    0 0 0 3 17 15 43 32 38 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1
osa-miR2275c AGAAUUGGAGGAAAACAAACUGA 23 3 0 1 1    0 0 0 1 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2275d CUUGUUUUUCUCCAAUAUCUCA 22 853 32 263 1    0 0 0 57 105 57 159 263 193 0 0 0 0 0 0 2 2 2 0 0 0 0 0 1 4 2 6
osa-miR2863a UUGUCCCAUUCUAGUUUAGCU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2863b UUCGUUUAUUUGGACUAGAGU 21 22 1 3 1    1 0 1 1 2 0 1 1 1 1 1 2 2 0 0 1 1 0 1 1 0 1 0 0 0 3 0
osa-miR2863c UUAGUAGGACUAGAAUGGGCCAAA 24 8,597 318 405 184    332 280 353 279 240 205 212 290 184 372 352 358 263 238 358 289 364 354 405 336 337 314 301 381 403 398 399
osa-miR2864.1 UUUUGCUGCCCUUGUUUUGCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2864.2 UUGUUUUGCAUUGUAUAGGUA 21 30 1 5 1    4 1 3 1 0 3 2 1 0 0 0 0 0 1 1 1 1 0 2 0 2 5 1 0 0 1 0
osa-miR2865 CUCAGCAGUCGACUGUACCGUG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2866 UCUAGUUUGUGUUCAGCAUC 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2867-3p CCAGGACGUGUGGGAUGGCA 20 415 15 31 6    31 26 13 8 12 6 14 16 15 17 14 20 13 17 14 17 17 14 19 23 15 9 10 13 12 20 10
osa-miR2867-5p UGUGCCAUCCCACACAUCCCGA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2868 UUGGUUUUGUGUAGUAGAAA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2869 UCCCGACAUUAAAUUCUGGGC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2870 UAAUCAGUUUGGGGAGACAAA 21 12 0 2 1    1 0 0 0 0 0 2 0 1 0 1 0 0 0 2 1 0 1 0 1 0 1 0 1 0 0 0
osa-miR2871a-3p UAUUUUAGUUUCUAUGGUCAC 21 297 11 21 3    15 7 8 11 6 3 10 15 11 10 17 10 12 5 7 10 19 11 13 8 11 10 7 12 21 13 15
osa-miR2871a-5p GACCGUAGAAACUAGCAUAGAAAA 24 789 29 72 12    30 13 13 31 16 16 35 58 37 16 16 16 15 17 19 47 35 31 24 28 12 31 20 34 50 57 72
osa-miR2871b-3p UAUUUUAGUUUCUAUGGUCAC 21 297 11 21 3    15 7 8 11 6 3 10 15 11 10 17 10 12 5 7 10 19 11 13 8 11 10 7 12 21 13 15
osa-miR2871b-5p CAUGGUGACCGUAGAAACUAACAU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2872 UGGGGUUCUACAAACCGAACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2873a AAGUUUGGACUUAAAUUUGGUAAC 24 17 1 3 1    0 0 0 1 2 2 1 1 0 0 0 0 1 0 0 1 3 0 0 0 1 0 0 1 0 1 2
osa-miR2873b UUGGACUUGAGAUUUGGUAUG 21 136 5 12 1    6 6 5 10 7 4 1 12 3 9 5 2 4 2 3 4 7 6 5 2 5 4 3 5 8 7 1
osa-miR2873c CAAAUGAAGUUGAGUUUGGAC 21 3 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 0 0 0 1 0 0
osa-miR2874 AUGUGAACAGUGUCAAACAGUGUC 24 36 1 5 1    2 3 1 2 1 0 1 2 1 1 0 1 0 0 1 0 4 0 1 1 4 2 2 0 0 1 5
osa-miR2875 AUUUACAGUCAUAUACAGUUUAUA 24 2 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 1 0
osa-miR2876-3p UUCCUAUAUGAACACUGUUGC 21 3 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 1 0 0 1 0
osa-miR2876-5p AAUUGCUGGCAGCACUGUUUA 21 38 1 5 1    1 1 2 5 1 2 1 1 2 4 1 0 0 0 0 0 4 1 3 3 1 1 1 1 0 2 0
osa-miR2877 UUGCAUCCUCUGCACUUUGGGCCU 24 21 1 3 1    1 0 0 0 2 2 1 0 1 0 1 1 1 2 2 0 0 0 0 1 1 1 0 3 0 1 0
osa-miR2878-3p CAGGAUUUUAUACAUGUAAAGAAU 24 191 7 21 1    8 4 1 12 3 3 6 9 9 5 7 1 4 7 5 9 12 6 3 3 4 11 8 3 7 21 20
osa-miR2878-5p UACAUGUAUAAAAUUCUGAGGAUG 24 281 10 26 1    3 11 5 13 11 12 14 12 10 8 1 14 5 10 5 19 20 14 2 7 3 8 6 7 22 13 26
osa-miR2879 GCCAGAUGUGUUAAAAUAAUGACC 24 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0
osa-miR2880 ACGGUAUCCCGUUCGGACAGGAUG 24 78 3 9 1    3 0 2 2 4 6 1 0 1 2 0 2 1 1 0 3 3 5 4 3 5 9 2 5 2 7 5
osa-miR2905 UACAUGUCAGUGACAAAGGCA 21 32 1 4 1    0 1 1 2 0 1 0 0 0 4 0 2 2 1 0 1 4 2 0 1 0 3 2 0 3 2 0
osa-miR2907a GGCAGCCGAGCGAGGGCCUCGG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2907b GGCAGCCGAGCGAGGGCCUCGG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2907c GGCAGCCGAGCGAGGGCCUCGG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2907d GGCAGCCGAGCGAGGGCCUCGG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2918 AUCCGUGUUGUCUGCGCUUUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2919 AAGGGGGGGGGGGGAAAGA 19 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2920 AAACAACAAUAUAACAUUUCAAA 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2921 AAGAACUUAAUAUAACUUUAAAGC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2922 AAUAAGUGAUUACCGAAAUU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2923 AGACAAAAAUAUAAAUAACAAA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2924 CUCGCUUGCUCCGGCCGCCAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2925 UGGCGGCCGCGGGCUUCGU 19 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2926 AGGUCGUCGACGUUGGUGCU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2927 UGUCGUCGUCGAUGGAGCCCAUG 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2928 AAGAAGACGACAUUUUGUUG 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2929 CUCAAGGGUGUUUGUGAAAUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2930 UUCUCUUCUCUCGCGCGUGGCC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2931 CUUUAUUGUUGAUGUCAAAA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2932 AGUAUGCCCACUACCUAUC 19 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR319a-3p ACUGGAUGACGCGGGAGCUAA 21 18,620 690 1,606 312    970 761 866 493 396 312 330 517 427 1,030 994 961 454 448 500 495 529 488 1,606 1,306 998 723 541 687 538 688 562
osa-miR319a-3p.2-3p UUGGACUGAAGGGUGCUCCC 20 46 2 8 1    1 7 2 0 0 1 0 1 0 1 5 3 0 3 0 3 0 1 3 8 0 2 2 0 2 0 1
osa-miR319a-5p AGCUGCCGAAUCAUCCAUUCA 21 49 2 7 1    2 7 2 0 3 0 0 0 0 7 0 7 1 1 2 0 1 0 5 6 2 2 0 0 1 0 0
osa-miR319b UUGGACUGAAGGGUGCUCCC 20 46 2 8 1    1 7 2 0 0 1 0 1 0 1 5 3 0 3 0 3 0 1 3 8 0 2 2 0 2 0 1
osa-miR390-3p CGCUAUCUAUCCUGAGCUCC 20 88 3 11 1    1 2 4 1 1 2 3 2 2 1 6 7 2 2 2 3 2 7 2 7 11 2 2 1 4 0 9
osa-miR390-5p AAGCUCAGGAGGGAUAGCGCC 21 14,178 525 828 313    612 521 481 445 344 313 497 533 485 587 663 733 395 373 370 600 489 483 828 735 698 577 353 428 616 522 497
osa-miR393a UCCAAAGGGAUCGCAUUGAUC 21 245 9 22 1    1 4 1 10 4 7 11 22 15 4 0 4 8 11 20 17 18 17 0 2 3 8 7 8 20 16 7
osa-miR393b-3p UCAGUGCAAUCCCUUUGGAAU 21 131 5 12 1    0 3 3 6 9 8 1 11 7 3 1 0 4 8 12 2 4 8 1 2 0 2 2 3 9 10 12
osa-miR393b-5p UCCAAAGGGAUCGCAUUGAUCU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR394 UUGGCAUUCUGUCCACCUCC 20 496 18 50 1    0 5 4 3 1 11 26 50 9 22 3 3 34 3 45 41 41 42 2 4 3 5 1 0 42 48 48
osa-miR395a GUGAAGUGCUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR395b GUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR395c GUGAAGUGUUUGGAGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR395d GUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR395e GUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR395f GUGAAUUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR395g GUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR395h GUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR395i GUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR395j GUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR395k GUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR395l GUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR395m GUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR395n GUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR395o AUGAAGUGUUUGGAGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR395p GUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR395q GUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR395r GUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR395s GUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR395t GUGAAGUGUUUGGGGAAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR395u GUGAAGCGUUUGGGGGAAAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR395v GUGAAGUAUUUGGCGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR395w GUGAAGUGUUUGGGGGAUUCUC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR395x GUGAAGUGUUUGGAGUAGCUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR395y GUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR396a-3p GUUCAAUAAAGCUGUGGGAA 20 1 0 1 1    0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR396a-5p UUCCACAGCUUUCUUGAACUG 21 555 21 35 10    22 23 18 22 26 23 24 26 11 28 35 19 16 22 28 19 16 18 24 18 17 24 22 18 10 13 13
osa-miR396b-3p GUUCAAUAAAGCUGUGGGAA 20 1 0 1 1    0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR396b-5p UUCCACAGCUUUCUUGAACUG 21 555 21 35 10    22 23 18 22 26 23 24 26 11 28 35 19 16 22 28 19 16 18 24 18 17 24 22 18 10 13 13
osa-miR396c-3p GGUCAAGAAAGCUGUGGGAAG 21 2,330 86 229 1    1 0 3 77 95 105 138 147 172 5 3 2 68 91 89 229 159 204 2 5 2 85 59 60 162 147 220
osa-miR396c-5p UUCCACAGCUUUCUUGAACUU 21 620 23 64 1    1 2 2 19 22 13 33 60 44 4 4 4 16 16 19 47 42 51 5 1 1 23 9 14 42 64 62
osa-miR396d UCCACAGGCUUUCUUGAACGG 21 3 0 2 1    0 0 0 0 0 0 0 0 0 2 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR396e-3p AUGGUUCAAGAAAGCCCAUGGAAA 24 107 4 35 1    0 0 0 1 5 3 18 10 3 0 0 0 0 1 1 2 1 2 0 0 0 0 2 2 19 2 35
osa-miR396e-5p UCCACAGGCUUUCUUGAACUG 21 5,118 190 560 6    19 17 9 126 146 100 434 560 407 19 14 19 107 100 120 371 414 312 25 17 6 116 95 105 483 508 469
osa-miR396f-3p AUAGUUCAAGAAAGUCCUUGGAAA 24 15 1 2 1    0 0 0 1 2 1 1 0 1 0 1 0 0 1 1 1 0 1 0 0 0 0 0 0 1 2 1
osa-miR396f-5p UCUCCACAGGCUUUCUUGAACU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR396g UCCACAGGCUUUCUUGAACGG 21 3 0 2 1    0 0 0 0 0 0 0 0 0 2 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR396h UCCACAGGCUUUCUUGAACGG 21 3 0 2 1    0 0 0 0 0 0 0 0 0 2 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR3979-3p CUUCGGGGGAGGAGAGAAGC 20 186 7 26 1    1 2 0 12 11 14 1 6 6 0 1 1 14 15 11 7 2 10 1 0 0 26 14 9 4 11 7
osa-miR3979-5p UCUCUCUCUCCCUUGAAGGC 20 24 1 3 1    0 0 0 3 0 1 0 0 0 0 1 0 1 1 2 1 2 3 0 0 0 1 2 2 1 2 1
osa-miR397a UCAUUGAGUGCAGCGUUGAUG 21 280 10 52 1    3 1 0 3 6 2 7 13 7 1 0 2 4 2 4 31 31 20 1 0 2 3 4 6 39 52 36
osa-miR397b UUAUUGAGUGCAGCGUUGAUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR3980a-3p CUGGCCGAGGCCGUCGAUUCU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR3980a-5p AAUCGACGGCCUCAGUCAGGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR3980b-3p CUGGCCGAGGCCGUCGAUUCU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR3980b-5p AAUCGACGGCCUCAGUCAGGG 21 0 0 0 0    0 0 0 0