Rice miRNA Abundances

The data below are based on the microRNAs listed in the Sanger registry. Adjust libraries/reads to display on the control panel.


        miRNA         miRNA sequence Len Sum (norm) Average Max Min (>0)  WT2003sWT2007sWT2011sT2iZ11RT2iZ11ST4iZ11ST4iZ11RT6iZ11RT6P9RT6Sp1RAGO18IP-RSV-1AGO18IP/RSV-2AGO1bIP-RSV-2AGO1aIP-RSV-1AGO1aIP-RSV-2AGO1bIP-RSV-1
osa-miR11336-3p GAAUAUGGGAAAUGCUAGAAAGUCU 25 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR11336-5p GACUUUCUAGCGUUGCCCACAUUC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR11337-3p UAUCUCGUUAGAUUCGUCUCG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR11337-5p UGCGAGACGAAUCUAACGAGG 21 20 4 7 1    1 0 0 4 0 1 0 7 0 7 0 0 0 0 0 0
osa-miR11338-3p AUCUCGUUAGAUUCGUCUCGCAAA 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR11338-5p UUUGUGAGACGAAUCUAAUGAUAU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR11339-3p UAUGAAUGUGGGCAAUGCUAG 21 8 2 2 1    0 0 0 0 0 0 2 0 0 0 0 2 0 1 1 2
osa-miR11339-5p GCAUUGCCCACAUUCAUAUAG 21 1 1 1 1    0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0
osa-miR11340-3p AAUAGUGUAAUCGGAUUAUAGAUC 24 25 3 5 1    2 4 4 2 1 1 3 3 5 0 0 0 0 0 0 0
osa-miR11340-5p AUCCGAUCUACGAUCCGAUUACAC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR11341-3p AUCUCGUUAGAUUCGUCUCGCAAA 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR11341-5p CCUAGGCUAUUUUGCGAGACGAAU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR11342-3p CUCGUUAGAUUCGUCUCGCAAA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR11342-5p CGAGACGAAUCUAACGAGAUA 21 2 1 1 1    1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR11343-3p UGAAUGUGGGCAAUGUUAAAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR11343-5p CUUUCUAGCGUUGCCCACAUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR11344-3p CUGUGAGGUACCGGUACCUAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR11344-5p UAUCUCGAGAUAUCGGUACCUC 22 43 5 13 1    3 6 3 13 8 7 1 0 2 0 0 0 0 0 0 0
osa-miR1319a AACCGGCAUCUGUAAUAUAUUAUA 24 16 3 5 1    0 0 0 5 0 1 1 0 5 4 0 0 0 0 0 0
osa-miR1319b CCUUUAAUAUAUUAUAGGUGUCGG 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1320-3p UGUAAAAUUCAUUCGUUCCAA 21 94 8 26 1    1 0 1 2 0 0 4 3 18 0 16 26 18 1 3 1
osa-miR1320-5p UGGAACGGAGGAAUUUUAUAG 21 120 12 32 1    0 0 3 4 0 0 0 7 1 0 32 25 18 10 8 12
osa-miR1423-3p AGCGCCCAAGCGGUAGUUGUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1423-5p AGGCAACUACACGUUGGGCGCUCG 24 383 26 60 2    49 25 38 26 60 44 39 42 22 21 3 5 0 2 3 4
osa-miR1424 AUGCACACUGAUGCUGAUUGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1425-3p CAGCAAGAACUGGAUCUUAAU 21 625 39 343 2    12 22 11 6 13 34 24 14 10 3 123 343 2 3 3 2
osa-miR1425-5p UAGGAUUCAAUCCUUGCUGCU 21 150,836 9,427 21,739 15    10,497 10,739 19,948 14,171 15,144 19,562 20,558 7,714 21,739 10,451 39 26 18 18 197 15
osa-miR1426 AGAAUCUUGAUGAUGAUUAAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1427 UGCGGAACCGUGCGGUGGCGC 21 88 10 20 2    19 6 20 0 2 8 8 0 11 11 3 0 0 0 0 0
osa-miR1428a-3p UAAGAUAAAGCCGUGAAUUUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1428a-5p CGUUUUGCAAAUUCGCAGGCC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1428b UAAGAUAAUGCCAUGAAUUCG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1428c UAAGAUAAUGCCAUGAAUUCG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1428d UAAGAUAAUGCCAUGAAUUCG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1428e-3p UAAGAUAAUGCCAUGAAUUUG 21 178 12 25 2    25 13 17 10 6 9 4 7 17 25 2 0 18 3 13 9
osa-miR1428e-5p AAUUCACAGGCCCUAUCUUGUG 22 46 6 16 1    0 12 16 5 5 5 1 0 0 1 1 0 0 0 0 0
osa-miR1428f-5p AAUUCACAGGCCCUAUCUUGUG 22 46 6 16 1    0 12 16 5 5 5 1 0 0 1 1 0 0 0 0 0
osa-miR1428g-5p AAUUCACAGGCCCUAUCUUGUG 22 46 6 16 1    0 12 16 5 5 5 1 0 0 1 1 0 0 0 0 0
osa-miR1429-3p GUUGCACGGGUUUGUAUGUUG 21 2 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1
osa-miR1429-5p GUAAUAUACUAAUCCGUGCAU 21 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1
osa-miR1430 UGGUGAGCCUUCCUGGCUAAG 21 142 14 28 3    5 3 7 16 19 28 14 10 26 14 0 0 0 0 0 0
osa-miR1431 UUUGCGAGUUGGCCCGCUUGC 21 83 8 20 1    11 0 4 4 8 13 20 10 5 7 1 0 0 0 0 0
osa-miR1432-3p CAGGUGUCAUCUCCCCUGAAC 21 9 3 4 2    0 0 0 0 0 2 0 0 0 4 3 0 0 0 0 0
osa-miR1432-5p AUCAGGAGAGAUGACACCGAC 21 1,747 109 472 1    109 147 113 335 83 126 472 191 90 49 5 9 13 1 3 1
osa-miR1435 UUUCUUAAGUCAAACUUUUU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1436 ACAUUAUGGGACGGAGGGAGU 21 7 4 5 2    0 0 0 2 0 5 0 0 0 0 0 0 0 0 0 0
osa-miR1437a UCCGGCGCCGCACUAGGCACUG 22 3 2 2 1    0 1 0 0 0 0 2 0 0 0 0 0 0 0 0 0
osa-miR1437b-3p GUGCUGGCGAGCUCCGGUGCCGCA 24 13 2 6 1    2 6 0 0 1 1 1 0 2 0 0 0 0 0 0 0
osa-miR1437b-5p GGGAGGAAACAGUGCCUAGUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1438 AGGGUAAUUUUAUCAUUUUUAA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1439 UUUUGGAACGGAGUGAGUAUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1440a UGCUCAAAUACCACUCUCCU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1440b UUUAGGAGAGUGGUAUUUGAG 21 2 2 2 2    0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0
osa-miR1441 ACCGGAUGUCGGAAAAGGUUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1442 AUUCAUAGUACUAGAUGUGU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR156a UGACAGAAGAGAGUGAGCAC 20 128,832 8,052 18,831 29    16,956 16,272 9,578 18,831 10,349 10,117 15,701 11,023 11,157 7,999 163 104 29 148 225 180
osa-miR156b-3p GCUCACUCUCUAUCUGUCAGC 21 631 49 94 2    94 36 33 59 50 78 42 32 57 68 41 39 2 0 0 0
osa-miR156b-5p UGACAGAAGAGAGUGAGCAC 20 128,832 8,052 18,831 29    16,956 16,272 9,578 18,831 10,349 10,117 15,701 11,023 11,157 7,999 163 104 29 148 225 180
osa-miR156c-3p GCUCACUUCUCUCUCUGUCAGC 22 1,520 109 207 2    115 143 101 164 144 197 207 147 170 78 18 30 0 2 0 4
osa-miR156c-5p UGACAGAAGAGAGUGAGCAC 20 128,832 8,052 18,831 29    16,956 16,272 9,578 18,831 10,349 10,117 15,701 11,023 11,157 7,999 163 104 29 148 225 180
osa-miR156d UGACAGAAGAGAGUGAGCAC 20 128,832 8,052 18,831 29    16,956 16,272 9,578 18,831 10,349 10,117 15,701 11,023 11,157 7,999 163 104 29 148 225 180
osa-miR156e UGACAGAAGAGAGUGAGCAC 20 128,832 8,052 18,831 29    16,956 16,272 9,578 18,831 10,349 10,117 15,701 11,023 11,157 7,999 163 104 29 148 225 180
osa-miR156f-3p GCUCACUUCUCUUUCUGUCAGC 22 475 34 65 2    43 43 31 53 65 28 46 64 41 42 12 2 0 3 0 2
osa-miR156f-5p UGACAGAAGAGAGUGAGCAC 20 128,832 8,052 18,831 29    16,956 16,272 9,578 18,831 10,349 10,117 15,701 11,023 11,157 7,999 163 104 29 148 225 180
osa-miR156g-3p GCUCACUUCUCUCUCUGUCAGC 22 1,520 109 207 2    115 143 101 164 144 197 207 147 170 78 18 30 0 2 0 4
osa-miR156g-5p UGACAGAAGAGAGUGAGCAC 20 128,832 8,052 18,831 29    16,956 16,272 9,578 18,831 10,349 10,117 15,701 11,023 11,157 7,999 163 104 29 148 225 180
osa-miR156h-3p GCUCACUUCUCUUUCUGUCAGC 22 475 34 65 2    43 43 31 53 65 28 46 64 41 42 12 2 0 3 0 2
osa-miR156h-5p UGACAGAAGAGAGUGAGCAC 20 128,832 8,052 18,831 29    16,956 16,272 9,578 18,831 10,349 10,117 15,701 11,023 11,157 7,999 163 104 29 148 225 180
osa-miR156i UGACAGAAGAGAGUGAGCAC 20 128,832 8,052 18,831 29    16,956 16,272 9,578 18,831 10,349 10,117 15,701 11,023 11,157 7,999 163 104 29 148 225 180
osa-miR156j-3p GCUCGCUCCUCUUUCUGUCAGC 22 407 34 50 3    38 45 31 46 50 33 48 37 37 34 5 3 0 0 0 0
osa-miR156j-5p UGACAGAAGAGAGUGAGCAC 20 128,832 8,052 18,831 29    16,956 16,272 9,578 18,831 10,349 10,117 15,701 11,023 11,157 7,999 163 104 29 148 225 180
osa-miR156k UGACAGAAGAGAGAGAGCACA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR156l-3p GCUCACUUCUCUUUCUGUCAGC 22 475 34 65 2    43 43 31 53 65 28 46 64 41 42 12 2 0 3 0 2
osa-miR156l-5p CGACAGAAGAGAGUGAGCAUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR159a.1 UUUGGAUUGAAGGGAGCUCUG 21 419,772 26,236 45,913 4,385    44,534 22,030 25,211 26,367 36,089 45,878 45,913 42,892 31,878 20,574 4,385 10,547 39,777 4,445 12,145 7,107
osa-miR159a.2 UUGCAUGCCCCAGGAGCUGCA 21 17 3 7 1    0 0 0 3 0 7 5 0 0 0 1 0 0 0 1 0
osa-miR159b UUUGGAUUGAAGGGAGCUCUG 21 419,772 26,236 45,913 4,385    44,534 22,030 25,211 26,367 36,089 45,878 45,913 42,892 31,878 20,574 4,385 10,547 39,777 4,445 12,145 7,107
osa-miR159c AUUGGAUUGAAGGGAGCUCCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR159d AUUGGAUUGAAGGGAGCUCCG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR159e AUUGGAUUGAAGGGAGCUCCU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR159f CUUGGAUUGAAGGGAGCUCUA 21 34 3 7 1    1 1 4 0 1 0 0 3 4 0 0 0 2 7 7 4
osa-miR160a-3p GCGUGCAAGGAGCCAAGCAUG 21 48 5 14 1    14 6 1 1 6 7 3 8 0 1 0 1 0 0 0 0
osa-miR160a-5p UGCCUGGCUCCCUGUAUGCCA 21 1,477 92 223 1    174 87 140 113 195 223 194 142 95 71 3 1 11 4 23 1
osa-miR160b-3p GCGUGCAAGGAGCCAAGCAUG 21 48 5 14 1    14 6 1 1 6 7 3 8 0 1 0 1 0 0 0 0
osa-miR160b-5p UGCCUGGCUCCCUGUAUGCCA 21 1,477 92 223 1    174 87 140 113 195 223 194 142 95 71 3 1 11 4 23 1
osa-miR160c-3p GCGUGCACGGAGCCAAGCAUA 21 7 2 3 1    0 0 0 0 0 0 0 0 0 0 0 0 0 3 3 1
osa-miR160c-5p UGCCUGGCUCCCUGUAUGCCA 21 1,477 92 223 1    174 87 140 113 195 223 194 142 95 71 3 1 11 4 23 1
osa-miR160d-3p GCGUGCGAGGAGCCAAGCAUG 21 1 1 1 1    0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0
osa-miR160d-5p UGCCUGGCUCCCUGUAUGCCA 21 1,477 92 223 1    174 87 140 113 195 223 194 142 95 71 3 1 11 4 23 1
osa-miR160e-3p GCGUGCGAGGUGCCAAGCAUG 21 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1
osa-miR160e-5p UGCCUGGCUCCCUGUAUGCCG 21 848 57 126 2    67 70 87 88 126 101 76 54 74 75 0 2 2 3 17 6
osa-miR160f-3p GCAUUGAGGGAGUCAUGCAGG 21 27 7 14 2    0 0 0 0 0 0 0 0 0 0 7 14 0 4 0 2
osa-miR160f-5p UGCCUGGCUCCCUGAAUGCCA 21 425 27 63 1    25 25 38 63 43 44 53 52 41 18 5 1 7 2 7 1
osa-miR162a UCGAUAAACCUCUGCAUCCAG 21 32,674 2,042 4,429 39    2,949 3,718 3,142 4,429 3,492 3,102 3,289 3,221 2,752 1,662 75 39 161 161 359 123
osa-miR162b UCGAUAAGCCUCUGCAUCCAG 21 1,670 104 233 1    93 183 166 192 233 159 203 161 167 38 3 1 2 16 46 7
osa-miR164a UGGAGAAGCAGGGCACGUGCA 21 13,615 851 6,356 93    279 266 461 400 513 524 432 295 603 632 93 195 272 619 6,356 1,675
osa-miR164b UGGAGAAGCAGGGCACGUGCA 21 13,615 851 6,356 93    279 266 461 400 513 524 432 295 603 632 93 195 272 619 6,356 1,675
osa-miR164c UGGAGAAGCAGGGUACGUGCA 21 83 10 58 1    0 0 1 0 0 0 0 0 1 0 1 3 4 2 58 13
osa-miR164d UGGAGAAGCAGGGCACGUGCU 21 507 32 283 3    14 3 20 13 12 23 4 8 18 4 5 3 4 30 283 63
osa-miR164e UGGAGAAGCAGGGCACGUGAG 21 18 4 6 1    0 0 0 0 0 0 0 0 0 0 6 3 2 1 6 0
osa-miR164f UGGAGAAGCAGGGCACGUGCA 21 13,615 851 6,356 93    279 266 461 400 513 524 432 295 603 632 93 195 272 619 6,356 1,675
osa-miR166a-3p UCGGACCAGGCUUCAUUCCCC 21 1,622,601 101,413 201,117 275    190,985 160,622 116,426 186,204 178,356 173,385 201,117 191,768 116,110 101,203 630 495 3,945 478 602 275
osa-miR166a-5p GGAAUGUUGUCUGGUUCAAGG 21 763 59 347 1    37 51 57 41 19 75 24 15 59 28 9 347 0 0 1 0
osa-miR166b-3p UCGGACCAGGCUUCAUUCCCC 21 1,622,601 101,413 201,117 275    190,985 160,622 116,426 186,204 178,356 173,385 201,117 191,768 116,110 101,203 630 495 3,945 478 602 275
osa-miR166b-5p GGAAUGUUGUCUGGCUCGGGG 21 486 32 59 1    34 43 44 59 57 36 42 29 57 51 2 23 0 2 6 1
osa-miR166c-3p UCGGACCAGGCUUCAUUCCCC 21 1,622,601 101,413 201,117 275    190,985 160,622 116,426 186,204 178,356 173,385 201,117 191,768 116,110 101,203 630 495 3,945 478 602 275
osa-miR166c-5p GGAAUGUUGUCUGGUCCGAG 20 114 19 41 2    0 0 0 0 0 2 0 0 0 0 0 5 4 31 31 41
osa-miR166d-3p UCGGACCAGGCUUCAUUCCCC 21 1,622,601 101,413 201,117 275    190,985 160,622 116,426 186,204 178,356 173,385 201,117 191,768 116,110 101,203 630 495 3,945 478 602 275
osa-miR166d-5p GGAAUGUUGUCUGGCUCGAGG 21 1,522 101 256 5    109 143 149 146 89 98 134 117 256 174 23 61 9 5 0 9
osa-miR166e-3p UCGAACCAGGCUUCAUUCCCC 21 908 70 197 1    44 39 44 16 42 187 197 151 118 66 0 1 2 0 1 0
osa-miR166e-5p GGAAUGUUGUCUGGUUCAAGG 21 763 59 347 1    37 51 57 41 19 75 24 15 59 28 9 347 0 0 1 0
osa-miR166f UCGGACCAGGCUUCAUUCCCC 21 1,622,601 101,413 201,117 275    190,985 160,622 116,426 186,204 178,356 173,385 201,117 191,768 116,110 101,203 630 495 3,945 478 602 275
osa-miR166g-3p UCGGACCAGGCUUCAUUCCUC 21 35,830 2,239 4,157 81    2,953 3,494 3,105 4,157 4,116 3,577 3,910 3,505 2,799 2,938 151 110 551 94 289 81
osa-miR166g-5p AAUGGAGGCUGAUCCAAGAUC 21 29 6 9 2    0 0 0 0 0 0 0 0 0 0 0 2 9 6 3 9
osa-miR166h-3p UCGGACCAGGCUUCAUUCCUC 21 35,830 2,239 4,157 81    2,953 3,494 3,105 4,157 4,116 3,577 3,910 3,505 2,799 2,938 151 110 551 94 289 81
osa-miR166h-5p GGAAUGUUGGCUGGCUCGAGG 21 124 8 35 1    0 14 4 5 12 3 9 5 10 35 2 15 2 3 1 4
osa-miR166i-3p UCGGAUCAGGCUUCAUUCCUC 21 17 2 4 1    3 0 1 3 1 0 1 0 0 0 1 1 0 1 4 1
osa-miR166i-5p AAUGCAGUUUGAUCCAAGAUC 21 334 28 43 1    17 35 43 33 40 38 28 17 43 34 5 1 0 0 0 0
osa-miR166j-3p UCGGACCAGGCUUCAUUCCCC 21 1,622,601 101,413 201,117 275    190,985 160,622 116,426 186,204 178,356 173,385 201,117 191,768 116,110 101,203 630 495 3,945 478 602 275
osa-miR166j-5p GAAUGACGUCCGGUCUGAAGA 21 9,625 642 1,535 2    610 666 933 604 875 1,203 851 649 1,535 848 371 469 0 2 3 6
osa-miR166k-3p UCGGACCAGGCUUCAAUCCCU 21 101,782 6,361 12,745 3    12,745 9,261 7,817 9,794 11,067 12,671 12,114 12,120 6,956 6,805 34 31 348 3 7 9
osa-miR166k-5p GGUUUGUUGUCUGGCUCGAGG 21 51 4 11 1    0 5 7 9 11 1 1 2 2 1 1 9 0 0 1 1
osa-miR166l-3p UCGGACCAGGCUUCAAUCCCU 21 101,782 6,361 12,745 3    12,745 9,261 7,817 9,794 11,067 12,671 12,114 12,120 6,956 6,805 34 31 348 3 7 9
osa-miR166l-5p GGAUUGUUGUCUGGUUCAAGG 21 82 21 69 1    0 0 0 0 0 0 0 8 0 1 4 69 0 0 0 0
osa-miR166m UCGGACCAGGCUUCAUUCCCU 21 4,565 326 561 1    561 515 377 526 408 377 536 517 437 291 2 1 16 1 0 0
osa-miR167a-3p AUCAUGCAUGACAGCCUCAUUU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR167a-5p UGAAGCUGCCAGCAUGAUCUA 21 20,748 1,297 3,521 76    531 1,036 2,407 457 1,134 2,843 1,308 891 1,176 454 93 76 2,316 1,116 3,521 1,389
osa-miR167b UGAAGCUGCCAGCAUGAUCUA 21 20,748 1,297 3,521 76    531 1,036 2,407 457 1,134 2,843 1,308 891 1,176 454 93 76 2,316 1,116 3,521 1,389
osa-miR167c-3p GGUCAUGCUGCGGCAGCCUCACU 23 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0
osa-miR167c-5p UGAAGCUGCCAGCAUGAUCUA 21 20,748 1,297 3,521 76    531 1,036 2,407 457 1,134 2,843 1,308 891 1,176 454 93 76 2,316 1,116 3,521 1,389
osa-miR167d-3p GAUCAUGCUGUGCAGUUUCAUC 22 239 16 63 1    10 1 14 11 19 18 6 0 15 16 6 17 2 11 30 63
osa-miR167d-5p UGAAGCUGCCAGCAUGAUCUG 21 32,806 2,050 3,350 22    3,350 2,408 2,068 2,412 2,846 3,324 3,200 3,004 2,631 2,345 49 22 1,263 334 3,070 480
osa-miR167e-3p AGAUCAUGUUGCAGCUUCACU 21 524 33 70 10    54 19 14 11 38 36 30 14 12 10 33 39 54 70 42 48
osa-miR167e-5p UGAAGCUGCCAGCAUGAUCUG 21 32,806 2,050 3,350 22    3,350 2,408 2,068 2,412 2,846 3,324 3,200 3,004 2,631 2,345 49 22 1,263 334 3,070 480
osa-miR167f UGAAGCUGCCAGCAUGAUCUG 21 32,806 2,050 3,350 22    3,350 2,408 2,068 2,412 2,846 3,324 3,200 3,004 2,631 2,345 49 22 1,263 334 3,070 480
osa-miR167g UGAAGCUGCCAGCAUGAUCUG 21 32,806 2,050 3,350 22    3,350 2,408 2,068 2,412 2,846 3,324 3,200 3,004 2,631 2,345 49 22 1,263 334 3,070 480
osa-miR167h-3p AGGUCAUGCUGUAGUUUCAUC 21 5,617 351 949 7    476 410 611 449 471 949 609 378 626 337 127 130 7 10 14 13
osa-miR167h-5p UGAAGCUGCCAGCAUGAUCUG 21 32,806 2,050 3,350 22    3,350 2,408 2,068 2,412 2,846 3,324 3,200 3,004 2,631 2,345 49 22 1,263 334 3,070 480
osa-miR167i-3p AGAUCAUGUUGCAGCUUCACU 21 524 33 70 10    54 19 14 11 38 36 30 14 12 10 33 39 54 70 42 48
osa-miR167i-5p UGAAGCUGCCAGCAUGAUCUG 21 32,806 2,050 3,350 22    3,350 2,408 2,068 2,412 2,846 3,324 3,200 3,004 2,631 2,345 49 22 1,263 334 3,070 480
osa-miR167j UGAAGCUGCCAGCAUGAUCUG 21 32,806 2,050 3,350 22    3,350 2,408 2,068 2,412 2,846 3,324 3,200 3,004 2,631 2,345 49 22 1,263 334 3,070 480
osa-miR168a-3p GAUCCCGCCUUGCACCAAGUGAAU 24 6,834 427 1,219 2    657 678 745 850 663 514 1,219 581 445 315 11 12 2 60 38 44
osa-miR168a-5p UCGCUUGGUGCAGAUCGGGAC 21 354,266 22,142 55,625 1,550    39,603 23,239 27,616 22,465 29,515 44,563 55,625 40,741 27,006 17,007 5,516 8,464 7,297 2,492 1,550 1,567
osa-miR168b AGGCUUGGUGCAGCUCGGGAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR169a CAGCCAAGGAUGACUUGCCGA 21 827 52 306 7    19 22 23 16 13 21 38 7 11 11 40 58 31 92 306 119
osa-miR169b CAGCCAAGGAUGACUUGCCGG 21 1,000 63 307 1    6 1 17 11 14 28 12 22 10 6 248 307 263 10 32 13
osa-miR169c CAGCCAAGGAUGACUUGCCGG 21 1,000 63 307 1    6 1 17 11 14 28 12 22 10 6 248 307 263 10 32 13
osa-miR169d UAGCCAAGGAUGAAUUGCCGG 21 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0
osa-miR169e UAGCCAAGGAUGACUUGCCGG 21 34 3 5 1    1 5 4 2 4 4 0 3 0 1 1 4 0 3 0 2
osa-miR169f.1 UAGCCAAGGAUGACUUGCCUA 21 541 34 102 2    25 27 79 28 69 102 66 24 39 18 26 29 2 2 3 2
osa-miR169f.2 UGAGGACAAGAGCUGAUUCGG 21 154 10 23 1    6 5 3 23 19 15 13 14 7 16 14 5 11 2 0 1
osa-miR169g UAGCCAAGGAUGACUUGCCUA 21 541 34 102 2    25 27 79 28 69 102 66 24 39 18 26 29 2 2 3 2
osa-miR169h UAGCCAAGGAUGACUUGCCUG 21 4,976 332 905 13    334 401 556 266 555 905 456 364 592 308 13 18 0 43 135 30
osa-miR169i-3p UGAGUCGCUCUUAUCACUCAUG 22 428 29 78 1    32 25 30 29 48 57 78 25 46 25 14 8 9 1 0 1
osa-miR169i-5p.1 UAGCCAAGGAUGACUUGCCUG 21 4,976 332 905 13    334 401 556 266 555 905 456 364 592 308 13 18 0 43 135 30
osa-miR169i-5p.2 UGGUGAUAAGGGUGUAGCUCUG 22 148 10 40 1    2 5 6 5 10 17 40 14 28 10 4 4 0 1 1 1
osa-miR169j UAGCCAAGGAUGACUUGCCUG 21 4,976 332 905 13    334 401 556 266 555 905 456 364 592 308 13 18 0 43 135 30
osa-miR169k UAGCCAAGGAUGACUUGCCUG 21 4,976 332 905 13    334 401 556 266 555 905 456 364 592 308 13 18 0 43 135 30
osa-miR169l UAGCCAAGGAUGACUUGCCUG 21 4,976 332 905 13    334 401 556 266 555 905 456 364 592 308 13 18 0 43 135 30
osa-miR169m UAGCCAAGGAUGACUUGCCUG 21 4,976 332 905 13    334 401 556 266 555 905 456 364 592 308 13 18 0 43 135 30
osa-miR169n UAGCCAAGAAUGACUUGCCUA 21 1,100 69 203 1    78 57 106 79 111 203 107 97 143 59 26 6 22 1 3 2
osa-miR169o UAGCCAAGAAUGACUUGCCUA 21 1,100 69 203 1    78 57 106 79 111 203 107 97 143 59 26 6 22 1 3 2
osa-miR169p UAGCCAAGGACAAACUUGCCGG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR169q UAGCCAAGGAGACUGCCCAUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR169r-3p UGGCAAGUCUCCUCGGCUACC 21 531 41 108 1    38 22 45 51 63 108 50 39 65 44 0 0 0 4 1 1
osa-miR169r-5p UAGCCAAGGAUGAUUUGCCUG 21 116 9 31 1    4 4 9 10 11 7 13 22 31 1 1 1 2 0 0 0
osa-miR171a UGAUUGAGCCGCGCCAAUAUC 21 104 35 80 8    0 0 0 0 0 0 0 0 0 0 0 0 0 16 80 8
osa-miR171b UGAUUGAGCCGUGCCAAUAUC 21 2,513 157 393 13    119 99 261 234 231 273 199 119 234 140 65 13 16 63 393 54
osa-miR171c-3p UGAUUGAGCCGUGCCAAUAUC 21 2,513 157 393 13    119 99 261 234 231 273 199 119 234 140 65 13 16 63 393 54
osa-miR171c-5p GGAUAUUGGUGCGGUUCAAUC 21 55 8 30 1    0 1 0 0 2 4 0 0 0 0 0 2 0 30 6 10
osa-miR171d-3p UGAUUGAGCCGUGCCAAUAUC 21 2,513 157 393 13    119 99 261 234 231 273 199 119 234 140 65 13 16 63 393 54
osa-miR171d-5p UGUUGGCCCGGCUCACUCAGA 21 41 5 13 1    2 1 6 0 0 2 0 0 2 1 13 12 2 0 0 0
osa-miR171e-3p UGAUUGAGCCGUGCCAAUAUC 21 2,513 157 393 13    119 99 261 234 231 273 199 119 234 140 65 13 16 63 393 54
osa-miR171e-5p UGUUGGCUCGGCUCACUCAGA 21 93 9 39 1    0 0 1 0 1 3 2 0 2 3 39 37 4 0 1 0
osa-miR171f-3p UGAUUGAGCCGUGCCAAUAUC 21 2,513 157 393 13    119 99 261 234 231 273 199 119 234 140 65 13 16 63 393 54
osa-miR171f-5p UGUUGGCAUGGUUCAAUCAAA 21 69 14 36 1    0 0 0 0 0 2 0 0 0 0 21 36 9 1 0 0
osa-miR171g GAGGUGAGCCGAGCCAAUAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR171h GUGAGCCGAACCAAUAUCACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR171i-3p GGAUUGAGCCGCGUCAAUAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR171i-5p AGGUAUUGGCGUGCCUCAAUC 21 18 4 7 1    0 0 0 2 0 0 0 0 0 0 0 1 0 1 7 7
osa-miR172a AGAAUCUUGAUGAUGCUGCAU 21 6,117 382 3,234 4    13 4 14 31 17 41 23 8 39 6 105 34 107 701 3,234 1,740
osa-miR172b GGAAUCUUGAUGAUGCUGCAU 21 40 8 20 1    0 0 0 0 0 0 0 2 0 0 1 0 0 2 20 15
osa-miR172c UGAAUCUUGAUGAUGCUGCAC 21 43 5 13 1    0 4 0 0 0 3 8 7 0 0 1 0 2 3 13 2
osa-miR172d-3p AGAAUCUUGAUGAUGCUGCAU 21 6,117 382 3,234 4    13 4 14 31 17 41 23 8 39 6 105 34 107 701 3,234 1,740
osa-miR172d-5p GCAGCACCAUCAAGAUUCAC 20 78 10 37 1    0 0 0 4 0 3 0 3 0 0 1 1 0 21 8 37
osa-miR1846a-3p UGACCCCGUUCUCCUCGCCGG 21 19 3 6 1    1 4 6 0 0 0 2 0 2 0 2 2 0 0 0 0
osa-miR1846a-5p AGUGAGGAGGCCGGGGCCGCU 21 7 2 4 1    0 0 4 1 0 0 0 0 0 0 0 1 0 1 0 0
osa-miR1846b-3p UGACCCCGUUCUCCUCGCCGG 21 19 3 6 1    1 4 6 0 0 0 2 0 2 0 2 2 0 0 0 0
osa-miR1846b-5p AGUGAGGAGGCCGGGGCCGCU 21 7 2 4 1    0 0 4 1 0 0 0 0 0 0 0 1 0 1 0 0
osa-miR1846c-3p UGACCCCGGUCUGCUCGCUGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1846c-5p AGUGAGGAGGCCGGGGCCGCU 21 7 2 4 1    0 0 4 1 0 0 0 0 0 0 0 1 0 1 0 0
osa-miR1846d-3p UAUCCGGCGCCGCAGGGAGG 20 27 2 5 1    2 5 0 1 2 3 3 2 2 0 2 1 0 3 0 1
osa-miR1846d-5p UCCCACCGAGCAGCCGGAUCUC 22 41 4 13 1    7 1 1 6 13 3 5 3 0 1 1 0 0 0 0 0
osa-miR1846e CAACGAGGAGGCCGGGACCA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1847.1 UGCAGUUUGCAGUUGUGGCAC 21 19 3 5 1    1 0 0 0 5 2 5 0 5 1 0 0 0 0 0 0
osa-miR1847.2 UGGCCCACAUGUUAGUGCCACAAC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1848 CCUCGCCGGCGCGCGCGUGCA 21 6 2 3 1    0 0 0 0 0 3 0 0 0 0 0 0 0 2 1 0
osa-miR1849 UAUCGUAUCCUAGGUUGGUUU 21 219 18 36 1    27 17 23 24 15 36 23 14 24 14 1 1 0 0 0 0
osa-miR1850.1 UGGAAAGUUGGGAGAUUGGGG 21 822 51 177 18    24 34 60 31 44 52 40 36 105 20 177 116 22 22 21 18
osa-miR1850.2 UUGUGUGUGAACUAAACGUGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1850.3 CUGUUUAGUUCACAUCAAUCUU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1851 CGUCUGGGAUGGCAUUUUGGC 21 10 3 4 1    0 0 1 4 0 0 0 0 2 3 0 0 0 0 0 0
osa-miR1852 AUAUGGAUUCAGAAUGCAGGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1853-3p UAAUUGGGGAUGUUCGGUUGCU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1853-5p AGCAUUCAAACAUUCCCAAUUACC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1854-3p UCCAAUUUGGGGAUUUGCUGAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1854-5p UGGUGAAAUUUGUAGAUUGGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1855 AGCACUGGAGUAGCCAAGAGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1856 UAUGCGUAAGACGGAUUCGUA 21 1,145 88 160 7    60 43 99 93 151 115 90 149 160 140 7 7 31 0 0 0
osa-miR1857-3p UCAUGCUCCAAGAAAACCAGG 21 143 10 26 1    8 9 11 18 21 15 26 12 9 7 3 2 0 1 1 0
osa-miR1857-5p UGGUUUUUUUGGAGCAUGAGG 21 19 2 5 1    0 0 0 0 2 2 3 0 5 0 1 1 4 0 1 0
osa-miR1858a GAGAGGAGGACGGAGUGGGGC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1858b GAGAGGAGGACGGAGUGGGGC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1859 UUUCCUAUGACGUCCAUUCCAA 22 83 6 18 1    2 10 9 1 1 18 8 8 1 0 0 0 18 2 1 4
osa-miR1860-3p AUCUGGAAGCUAGGUUUUCUCU 22 18 3 6 1    0 0 1 0 2 5 0 2 6 0 0 1 0 0 0 1
osa-miR1860-5p AGAAAACCAGCUUCCAGAUCU 21 2 2 2 2    0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0
osa-miR1861a UGAUCUUGAGGCAGAAACUGAG 22 9 2 5 1    0 0 0 0 0 0 0 0 0 0 1 5 0 1 1 1
osa-miR1861b CGAUCUUGAGGCAGGAACUGAG 22 11 4 7 1    0 0 0 7 1 0 0 0 0 0 3 0 0 0 0 0
osa-miR1861c CGAUCUUGUAGCAAGAACUGAG 22 4 2 2 2    0 0 0 0 2 0 0 0 0 0 2 0 0 0 0 0
osa-miR1861d UGGUCUUGAGGCAGGAACUGAG 22 2 2 2 2    0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0
osa-miR1861e CGGUCUUGUGGCAAGAACUGAG 22 43 22 38 5    0 0 0 0 0 0 0 0 0 0 38 5 0 0 0 0
osa-miR1861f CGAUCUUGAGGCAGGAACUGAG 22 11 4 7 1    0 0 0 7 1 0 0 0 0 0 3 0 0 0 0 0
osa-miR1861g CAGUCUUGUGGCAAGAACUGAG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1861h CGGUCUUGAGGCAGGAACUGAG 22 13 3 9 1    0 0 1 9 2 0 0 0 0 0 0 1 0 0 0 0
osa-miR1861i CGAUCUUGAGGCAGGAACUGAG 22 11 4 7 1    0 0 0 7 1 0 0 0 0 0 3 0 0 0 0 0
osa-miR1861j CGGUCUUGAGGCAGGAACUGAG 22 13 3 9 1    0 0 1 9 2 0 0 0 0 0 0 1 0 0 0 0
osa-miR1861k CGGUCUUGUGGCAAGAACUGAG 22 43 22 38 5    0 0 0 0 0 0 0 0 0 0 38 5 0 0 0 0
osa-miR1861l CGAUCUUGAGGCAGGAACUGAG 22 11 4 7 1    0 0 0 7 1 0 0 0 0 0 3 0 0 0 0 0
osa-miR1861m CGGUCUUGUGGCAAGAACUGAG 22 43 22 38 5    0 0 0 0 0 0 0 0 0 0 38 5 0 0 0 0
osa-miR1861n CGAUCUUGUGGCAGGAGCUGAG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1861o UGAUCUUGAGGCAGAAACUGAG 22 9 2 5 1    0 0 0 0 0 0 0 0 0 0 1 5 0 1 1 1
osa-miR1862a ACGAGGUUGGUUUAUUUUGGGACG 24 7,034 469 1,148 1    523 682 658 827 608 702 567 644 1,148 658 1 1 0 5 6 4
osa-miR1862b ACGAGGUUGGUUUAUUUUGGGACG 24 7,034 469 1,148 1    523 682 658 827 608 702 567 644 1,148 658 1 1 0 5 6 4
osa-miR1862c ACGAGGUUGGUUUAUUUUGGGACG 24 7,034 469 1,148 1    523 682 658 827 608 702 567 644 1,148 658 1 1 0 5 6 4
osa-miR1862d ACUAGGUUUGUUUAUUUUGGGACG 24 15,381 961 2,029 21    1,377 1,128 1,576 1,324 1,483 1,826 1,549 1,463 2,029 1,424 28 37 38 54 24 21
osa-miR1862e CUAGAUUUGUUUAUUUUGGGACGG 24 1,270 79 199 1    109 106 133 93 150 124 126 127 199 86 1 1 4 1 7 3
osa-miR1862f AUGAGGUUGGUUUAUUUUGG 20 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0
osa-miR1862g AUGAGGUUGGUUUAUUUUGG 20 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0
osa-miR1863a AGCUCUGAUACCAUGUUAGAUUAG 24 830 52 173 1    24 25 28 39 35 43 44 17 43 1 173 156 89 44 34 35
osa-miR1863b AGCUCUGAUACCAUGUUAACUGUU 24 85 7 19 1    5 8 11 3 19 17 5 2 4 3 1 3 4 0 0 0
osa-miR1863b.2 AGAGACUUGGCUGAUGCAUUACU 23 12 2 3 1    0 0 3 1 0 2 0 2 0 0 0 1 0 2 1 0
osa-miR1863c UAGAAACUUGGCUGAUGCAUUACU 24 82 6 14 1    2 5 9 5 11 11 2 7 0 0 1 4 0 3 8 14
osa-miR1864 UUGUAGUAACGUGAUGGUCAAUGU 24 12 3 5 1    0 5 1 2 0 0 0 0 4 0 0 0 0 0 0 0
osa-miR1865-3p CGAAGAAUCGCAGUCACUAGUUGU 24 39 4 10 1    2 1 10 4 10 2 3 3 1 3 0 0 0 0 0 0
osa-miR1865-5p UGCUAGUGAUGGUGAUUCUUCGAC 24 136 12 26 1    5 26 6 12 23 7 13 10 17 16 0 0 0 1 0 0
osa-miR1866-3p UGAAAUUCCUGUAAAAUUCUUG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1866-5p GAGGGAUUUUGCGGGAAUUUCACG 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1868 UCACGGAAAACGAGGGAGCAGCCA 24 44 4 11 1    11 3 1 7 7 3 0 5 1 0 1 2 0 2 1 0
osa-miR1869 UGAGAACAAUAGGCAUGGGAGGUA 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1870-3p UUUAGGGCUAAUUCAGCAUGAACA 24 79 5 12 1    5 3 6 9 7 11 12 3 4 6 2 7 0 1 1 2
osa-miR1870-5p UGCUGAAUUAGACCUAGUGGGCAU 24 39 4 11 1    0 4 4 5 11 1 2 0 0 0 3 8 0 1 0 0
osa-miR1871 AUGGCUCUGAUAUCAUGUUGGUUU 24 4,117 257 507 21    424 351 262 492 505 507 430 389 250 175 41 65 98 34 73 21
osa-miR1872 GAACUGUAAGUCUGUGACGGGUAA 24 1 1 1 1    0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1873 UCAACAUGGUAUCAGAGCUGGAAG 24 63 5 13 1    1 5 9 6 2 2 8 2 5 3 1 6 13 0 0 0
osa-miR1874-3p UAUGGAUGGAGGUGUAACCCGAUG 24 73 7 26 2    0 0 3 5 26 0 2 0 0 0 2 8 4 11 10 2
osa-miR1874-5p UAGGGCUACUACACCAUCCAUAAG 24 88 7 33 1    2 5 0 33 23 1 10 0 2 0 3 2 0 2 3 2
osa-miR1875 ACAAUGGAGUGAAGUGCAACAGAA 24 2 1 1 1    0 0 0 0 0 1 0 0 0 0 0 1 0 0 0 0
osa-miR1876 AUAAGUGGGUUUGUGGGCUGGCCC 24 24,433 1,527 3,196 9    2,729 1,759 1,953 1,615 2,199 2,865 2,873 2,869 3,196 2,076 32 99 9 73 58 28
osa-miR1877 AGAUGACAUGUGAAUGAUGAGGGG 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1878 ACUUAAUCUGGACACUAUAAAAGA 24 1,520 95 226 4    113 141 148 226 146 173 141 139 165 89 10 8 7 6 4 4
osa-miR1879 GUGUUUGGUUUAGGGAUGAGGUGG 24 101 7 20 1    0 9 1 11 1 20 1 7 10 4 5 6 0 10 7 9
osa-miR1880 UUCCAAGCGGGCCACUUAAGCAUU 24 105 11 18 2    6 12 11 13 15 2 10 14 4 18 0 0 0 0 0 0
osa-miR1881 AAUGUUAUUGUAGCGUGGUGGUGU 24 13 3 5 1    2 0 0 0 1 0 0 0 0 0 0 0 0 5 3 2
osa-miR1882a AGAUUGCUUUCAAGGUCAUUUCUU 24 339 23 70 1    17 27 37 28 44 70 37 25 23 6 0 1 20 2 1 1
osa-miR1882b AGAUUGCUUUCAAGGUCAUUUCUU 24 339 23 70 1    17 27 37 28 44 70 37 25 23 6 0 1 20 2 1 1
osa-miR1882c AGAUUGCUUUCAAGGUCAUUUCUU 24 339 23 70 1    17 27 37 28 44 70 37 25 23 6 0 1 20 2 1 1
osa-miR1882d AGAUUGCUUUCAAGGUCAUUUCUU 24 339 23 70 1    17 27 37 28 44 70 37 25 23 6 0 1 20 2 1 1
osa-miR1882e-3p GAAAUGAUCUUGGACGUAAUCUAG 24 70,154 5,846 8,554 2    6,505 7,794 7,665 7,753 5,983 6,858 8,238 5,340 8,554 5,458 0 2 4 0 0 0
osa-miR1882e-5p AGAUUGCUUUCAAGGUCAUUUCUU 24 339 23 70 1    17 27 37 28 44 70 37 25 23 6 0 1 20 2 1 1
osa-miR1882f AGAUUGCUUUCAAGGUCAUUUCUU 24 339 23 70 1    17 27 37 28 44 70 37 25 23 6 0 1 20 2 1 1
osa-miR1882g AGAUUGCUUUCAAGGUCAUUUCUU 24 339 23 70 1    17 27 37 28 44 70 37 25 23 6 0 1 20 2 1 1
osa-miR1882h AGAUUGCUUUCAAGGUCAUUUCUU 24 339 23 70 1    17 27 37 28 44 70 37 25 23 6 0 1 20 2 1 1
osa-miR1883a ACCUGUGACGGGCCGAGAAUGGAA 24 126 10 23 1    3 6 13 13 23 18 4 8 18 10 0 1 7 0 0 2
osa-miR1883b ACCUGUGACGGGCCGAGAAUGGAA 24 126 10 23 1    3 6 13 13 23 18 4 8 18 10 0 1 7 0 0 2
osa-miR2055 UUUCCUUGGGAAGGUGGUUUC 21 45 4 15 1    15 1 3 0 4 3 4 5 2 3 0 0 0 2 3 0
osa-miR2090 AACUCUGAUUCUAGAAUUUUUG 22 4 2 3 1    0 0 0 3 0 0 0 0 0 0 1 0 0 0 0 0
osa-miR2091-3p CAUACAUUGCCUCCUAGGCUUG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2091-5p UCAACCGAGCCGAGGAGGAGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2092-3p ACCAGCAUUCCAUUGGCAGAGG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2092-5p CAACUGAAGUCGGUGUUUACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2093-3p ACAUCUUCCAAUUAAUGCAU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2093-5p GUGCAUUAAUUGGAAGAACA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2094-3p CAGAGCUGUGGCAUCCACGUCG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2094-5p UGGCUGCUAGGCUCCUGGGUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2095-3p CUUCCAUUUAUGAUAAGUAU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2095-5p CUGAUAAUUUUACGAUGAAUAG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2096-3p CCUGAGGGGAAAUCGGCGGGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2096-5p UGCCGAUUUCCCCCUCGGGCG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2097-3p UUCUCUUCUUCGUGUCGCAUUU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2097-5p AGAGAUGGGACGGGCAGGGAAG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2098-3p CGGUUUGUCAAGCGGAGUGC 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2098-5p UCCCGUGGAGGCAGCCGAUG 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2099-3p ACAAAGCUGUAGCGUUAUUC 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2099-5p UGAAUAUGUUUGUACAAGCUUU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2100-3p AACCGCUGUUUAGGCGGAGUGG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2100-5p UUCUCUCAAGUUGCCAAACAAG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2101-3p AUUUAACUCAAGUGAGCAUUGU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2101-5p ACAUGUUUACAAGUUAAAAUGU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2102-3p CAUGGUGCCGGUUCCGGUGGCG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2102-5p GGGCAAGCCGCCGCCGCCAC 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2103 UUUCCCUCUCCGUGCGCGCUCG 22 19 3 4 2    4 4 3 2 0 3 0 0 0 3 0 0 0 0 0 0
osa-miR2104 GCGGCGAGGGGAUGCGAGCGUG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2105 UUGUGAUGUGAAUGAUUCAU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2106 CCGAGGUUUUCUGGAUACAUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2118a UUCUCGAUGCCUCCCAUUCCUA 22 2 1 1 1    0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 1
osa-miR2118b UUCCCGAUGCCUCCCAUUCCUA 22 593 46 117 1    57 75 61 83 45 117 53 30 35 30 0 0 0 3 3 1
osa-miR2118c UUCCCGAUGCCUCCUAUUCCUA 22 18 3 7 1    0 0 0 0 2 0 1 0 0 7 0 0 0 3 4 1
osa-miR2118d UUCCUGAUGCCUCCCAUGCCUA 22 2 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0
osa-miR2118e UUCCCAAUGCCUCCCAUGCCUA 22 99 7 20 1    1 3 11 8 20 17 14 7 2 10 0 0 2 1 1 2
osa-miR2118f UUCCUGAUGCCUCCCAUUCCUA 22 11 3 6 1    0 0 0 1 0 0 0 0 0 0 0 0 0 1 3 6
osa-miR2118g UUCCUAAUGCCUCCCAUUCCUA 22 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1
osa-miR2118h UUCCUGAUGCCUCUCAUUCCUA 22 6 2 3 1    0 0 0 0 0 0 0 0 0 0 0 0 0 3 1 2
osa-miR2118i UUCCUAGUGCCUCCCAUUCCUA 22 4 4 4 4    0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 0
osa-miR2118j UUCCUGAUGCCUCCCAUUCCUA 22 11 3 6 1    0 0 0 1 0 0 0 0 0 0 0 0 0 1 3 6
osa-miR2118k UUCCUGAUGCCUCUCAUUCCUA 22 6 2 3 1    0 0 0 0 0 0 0 0 0 0 0 0 0 3 1 2
osa-miR2118l UUCCUAAUGCUUCCCAUUCCUA 22 3 2 2 1    0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 1
osa-miR2118m UUCCUGAUGCCUCCCAUUCCUA 22 11 3 6 1    0 0 0 1 0 0 0 0 0 0 0 0 0 1 3 6
osa-miR2118n UUCCCGAUGCCUCCCAUUCCUA 22 593 46 117 1    57 75 61 83 45 117 53 30 35 30 0 0 0 3 3 1
osa-miR2118o CUCCUGAUGCCUCCCAAGCCUA 22 1,534 153 315 44    100 117 149 142 212 315 170 137 148 44 0 0 0 0 0 0
osa-miR2118p UUCCCGAUGCCUCCCAUGCCUA 22 4 1 1 1    0 0 0 0 0 1 0 0 1 0 0 0 0 0 1 1
osa-miR2118q UUCCCGAUGCCUCCUAUUCCUA 22 18 3 7 1    0 0 0 0 2 0 1 0 0 7 0 0 0 3 4 1
osa-miR2118r UUCCCAAUGCCUCCCAUGCCUA 22 99 7 20 1    1 3 11 8 20 17 14 7 2 10 0 0 2 1 1 2
osa-miR2120 AAAGAUCUUUAGUCCCGGUUGUUC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2120b-3p UUUAGUCGCGGUUGGUGUUA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2120b-5p ACACCAACCGCGACUAAAGA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2121a AAAACGGAGCGGUCCAUUAGCGCG 24 28 3 10 1    0 0 0 0 2 3 1 0 10 0 2 1 0 7 1 1
osa-miR2121b AAAACGGAGCGGUCCAUUAGCGCG 24 28 3 10 1    0 0 0 0 2 3 1 0 10 0 2 1 0 7 1 1
osa-miR2122 UUUCAAAAAUAACCUUUUGUUC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2275a UUUGGUUUCCUCCAAUAUCUCA 22 3 2 2 1    0 0 0 0 0 0 0 0 0 0 0 1 2 0 0 0
osa-miR2275b UUUGGUUUCCUCCAAUAUCUCA 22 3 2 2 1    0 0 0 0 0 0 0 0 0 0 0 1 2 0 0 0
osa-miR2275c AGAAUUGGAGGAAAACAAACUGA 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2275d CUUGUUUUUCUCCAAUAUCUCA 22 25 3 9 1    3 3 0 0 0 0 9 2 2 3 0 1 0 2 0 0
osa-miR2863a UUGUCCCAUUCUAGUUUAGCU 21 51 6 10 2    5 8 4 9 2 10 8 0 0 3 0 0 2 0 0 0
osa-miR2863b UUCGUUUAUUUGGACUAGAGU 21 54 5 17 1    2 5 7 17 5 3 5 0 5 1 1 1 2 0 0 0
osa-miR2863c UUAGUAGGACUAGAAUGGGCCAAA 24 79 7 13 1    0 8 1 7 10 6 6 12 5 8 1 2 13 0 0 0
osa-miR2864.1 UUUUGCUGCCCUUGUUUUGCA 21 98 7 17 1    17 1 4 8 8 16 15 17 1 1 2 3 4 1 0 0
osa-miR2864.2 UUGUUUUGCAUUGUAUAGGUA 21 148 11 33 1    7 1 21 13 5 20 14 8 12 6 4 3 33 0 0 1
osa-miR2865 CUCAGCAGUCGACUGUACCGUG 22 29 4 6 2    2 0 4 3 4 5 6 3 0 0 0 0 2 0 0 0
osa-miR2866 UCUAGUUUGUGUUCAGCAUC 20 5 2 2 1    1 0 0 0 2 0 0 2 0 0 0 0 0 0 0 0
osa-miR2867-3p CCAGGACGUGUGGGAUGGCA 20 159 13 38 2    16 12 9 9 2 38 15 7 26 20 0 0 2 0 3 0
osa-miR2867-5p UGUGCCAUCCCACACAUCCCGA 22 3 2 2 1    0 1 0 0 0 0 0 2 0 0 0 0 0 0 0 0
osa-miR2868 UUGGUUUUGUGUAGUAGAAA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2869 UCCCGACAUUAAAUUCUGGGC 21 72 6 14 1    8 10 1 9 5 6 14 7 6 0 3 0 2 0 1 0
osa-miR2870 UAAUCAGUUUGGGGAGACAAA 21 40 4 14 1    1 0 3 0 0 0 13 14 1 1 1 5 0 0 1 0
osa-miR2871a-3p UAUUUUAGUUUCUAUGGUCAC 21 3,270 204 454 3    264 268 397 265 337 454 377 281 255 182 10 7 163 3 4 3
osa-miR2871a-5p GACCGUAGAAACUAGCAUAGAAAA 24 252 25 42 10    26 26 24 38 31 32 13 42 10 10 0 0 0 0 0 0
osa-miR2871b-3p UAUUUUAGUUUCUAUGGUCAC 21 3,270 204 454 3    264 268 397 265 337 454 377 281 255 182 10 7 163 3 4 3
osa-miR2871b-5p CAUGGUGACCGUAGAAACUAACAU 24 1 1 1 1    0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0
osa-miR2872 UGGGGUUCUACAAACCGAACU 21 6 2 3 1    0 0 0 0 0 0 0 0 0 0 1 3 2 0 0 0
osa-miR2873a AAGUUUGGACUUAAAUUUGGUAAC 24 9,635 642 1,490 2    1,490 1,128 1,024 1,153 1,133 926 1,098 662 625 377 6 4 4 3 0 2
osa-miR2873b UUGGACUUGAGAUUUGGUAUG 21 72 6 13 1    7 13 4 3 6 3 2 10 11 10 0 1 2 0 0 0
osa-miR2873c CAAAUGAAGUUGAGUUUGGAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2874 AUGUGAACAGUGUCAAACAGUGUC 24 33 3 10 1    1 0 4 2 2 5 0 0 1 10 3 1 2 0 1 1
osa-miR2875 AUUUACAGUCAUAUACAGUUUAUA 24 12 4 5 3    0 0 0 0 0 3 0 5 0 4 0 0 0 0 0 0
osa-miR2876-3p UUCCUAUAUGAACACUGUUGC 21 83 8 19 1    13 6 1 3 1 13 3 19 7 17 0 0 0 0 0 0
osa-miR2876-5p AAUUGCUGGCAGCACUGUUUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2877 UUGCAUCCUCUGCACUUUGGGCCU 24 23,846 1,703 4,418 1    4,418 2,006 1,268 2,291 2,333 1,671 3,094 3,443 1,572 1,744 1 1 0 3 1 0
osa-miR2878-3p CAGGAUUUUAUACAUGUAAAGAAU 24 141 13 24 1    16 5 14 16 12 23 14 12 24 4 0 1 0 0 0 0
osa-miR2878-5p UACAUGUAUAAAAUUCUGAGGAUG 24 1,614 101 251 1    143 131 162 189 251 216 194 110 142 49 7 8 2 1 3 6
osa-miR2879 GCCAGAUGUGUUAAAAUAAUGACC 24 65 7 14 1    0 12 3 8 14 12 6 7 0 1 0 0 0 1 1 0
osa-miR2880 ACGGUAUCCCGUUCGGACAGGAUG 24 2,661 242 333 3    262 246 244 260 284 333 254 271 271 233 0 0 0 0 3 0
osa-miR2905 UACAUGUCAGUGACAAAGGCA 21 15 3 7 1    2 1 0 3 0 0 0 0 1 0 0 1 7 0 0 0
osa-miR2907a GGCAGCCGAGCGAGGGCCUCGG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2907b GGCAGCCGAGCGAGGGCCUCGG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2907c GGCAGCCGAGCGAGGGCCUCGG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2907d GGCAGCCGAGCGAGGGCCUCGG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2918 AUCCGUGUUGUCUGCGCUUUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2919 AAGGGGGGGGGGGGAAAGA 19 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2920 AAACAACAAUAUAACAUUUCAAA 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2921 AAGAACUUAAUAUAACUUUAAAGC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2922 AAUAAGUGAUUACCGAAAUU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2923 AGACAAAAAUAUAAAUAACAAA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2924 CUCGCUUGCUCCGGCCGCCAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2925 UGGCGGCCGCGGGCUUCGU 19 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2926 AGGUCGUCGACGUUGGUGCU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2927 UGUCGUCGUCGAUGGAGCCCAUG 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2928 AAGAAGACGACAUUUUGUUG 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2929 CUCAAGGGUGUUUGUGAAAUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2930 UUCUCUUCUCUCGCGCGUGGCC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2931 CUUUAUUGUUGAUGUCAAAA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2932 AGUAUGCCCACUACCUAUC 19 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR319a-3p ACUGGAUGACGCGGGAGCUAA 21 31 8 14 2    2 0 0 0 0 0 0 0 0 0 0 0 0 5 10 14
osa-miR319a-3p.2-3p UUGGACUGAAGGGUGCUCCC 20 483 32 63 5    57 27 31 44 56 44 42 32 52 63 5 5 0 8 11 6
osa-miR319a-5p AGCUGCCGAAUCAUCCAUUCA 21 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1
osa-miR319b UUGGACUGAAGGGUGCUCCC 20 483 32 63 5    57 27 31 44 56 44 42 32 52 63 5 5 0 8 11 6
osa-miR390-3p CGCUAUCUAUCCUGAGCUCC 20 182 13 39 1    5 0 9 24 29 22 1 12 39 13 1 1 0 16 6 4
osa-miR390-5p AAGCUCAGGAGGGAUAGCGCC 21 1,756 117 218 3    107 67 125 212 218 144 83 125 185 165 3 4 0 74 130 114
osa-miR393a UCCAAAGGGAUCGCAUUGAUC 21 13,807 863 1,926 7    1,101 1,028 1,688 937 1,474 1,926 1,308 904 1,459 1,688 14 207 7 17 35 14
osa-miR393b-3p UCAGUGCAAUCCCUUUGGAAU 21 4,457 279 601 16    397 248 377 356 601 558 324 222 309 302 256 161 286 16 24 20
osa-miR393b-5p UCCAAAGGGAUCGCAUUGAUCU 22 248 19 38 1    25 12 23 23 26 38 25 12 34 21 0 5 0 3 1 0
osa-miR394 UUGGCAUUCUGUCCACCUCC 20 1,837 115 263 1    127 176 186 164 144 261 263 152 206 114 7 2 16 8 10 1
osa-miR395a GUGAAGUGCUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR395b GUGAAGUGUUUGGGGGAACUC 21 3 2 2 1    0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 1
osa-miR395c GUGAAGUGUUUGGAGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR395d GUGAAGUGUUUGGGGGAACUC 21 3 2 2 1    0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 1
osa-miR395e GUGAAGUGUUUGGGGGAACUC 21 3 2 2 1    0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 1
osa-miR395f GUGAAUUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR395g GUGAAGUGUUUGGGGGAACUC 21 3 2 2 1    0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 1
osa-miR395h GUGAAGUGUUUGGGGGAACUC 21 3 2 2 1    0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 1
osa-miR395i GUGAAGUGUUUGGGGGAACUC 21 3 2 2 1    0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 1
osa-miR395j GUGAAGUGUUUGGGGGAACUC 21 3 2 2 1    0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 1
osa-miR395k GUGAAGUGUUUGGGGGAACUC 21 3 2 2 1    0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 1
osa-miR395l GUGAAGUGUUUGGGGGAACUC 21 3 2 2 1    0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 1
osa-miR395m GUGAAGUGUUUGGGGGAACUC 21 3 2 2 1    0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 1
osa-miR395n GUGAAGUGUUUGGGGGAACUC 21 3 2 2 1    0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 1
osa-miR395o AUGAAGUGUUUGGAGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR395p GUGAAGUGUUUGGGGGAACUC 21 3 2 2 1    0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 1
osa-miR395q GUGAAGUGUUUGGGGGAACUC 21 3 2 2 1    0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 1
osa-miR395r GUGAAGUGUUUGGGGGAACUC 21 3 2 2 1    0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 1
osa-miR395s GUGAAGUGUUUGGGGGAACUC 21 3 2 2 1    0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 1
osa-miR395t GUGAAGUGUUUGGGGAAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR395u GUGAAGCGUUUGGGGGAAAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR395v GUGAAGUAUUUGGCGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR395w GUGAAGUGUUUGGGGGAUUCUC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR395x GUGAAGUGUUUGGAGUAGCUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR395y GUGAAGUGUUUGGGGGAACUC 21 3 2 2 1    0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 1
osa-miR396a-3p GUUCAAUAAAGCUGUGGGAA 20 335 56 146 2    0 0 0 0 0 0 0 0 0 0 3 2 9 88 87 146
osa-miR396a-5p UUCCACAGCUUUCUUGAACUG 21 2,390 149 519 2    136 102 88 166 194 83 127 120 76 203 70 40 2 152 519 312
osa-miR396b-3p GUUCAAUAAAGCUGUGGGAA 20 335 56 146 2    0 0 0 0 0 0 0 0 0 0 3 2 9 88 87 146
osa-miR396b-5p UUCCACAGCUUUCUUGAACUG 21 2,390 149 519 2    136 102 88 166 194 83 127 120 76 203 70 40 2 152 519 312
osa-miR396c-3p GGUCAAGAAAGCUGUGGGAAG 21 122 14 43 1    2 0 1 0 1 0 0 0 0 0 28 30 4 43 7 6
osa-miR396c-5p UUCCACAGCUUUCUUGAACUU 21 43,723 2,733 6,257 483    6,257 5,249 2,841 5,574 3,629 2,120 3,820 3,187 3,069 2,394 580 830 2,254 557 879 483
osa-miR396d UCCACAGGCUUUCUUGAACGG 21 3,276 298 458 1    458 382 314 425 430 289 358 298 212 109 1 0 0 0 0 0
osa-miR396e-3p AUGGUUCAAGAAAGCCCAUGGAAA 24 17 3 4 2    0 0 0 0 0 3 0 2 0 0 3 2 4 0 3 0
osa-miR396e-5p UCCACAGGCUUUCUUGAACUG 21 1,324,118 82,757 165,653 1,032    121,705 123,951 113,675 165,653 161,928 104,467 136,059 130,936 137,438 91,546 4,380 3,219 25,299 1,032 1,565 1,265
osa-miR396f-3p AUAGUUCAAGAAAGUCCUUGGAAA 24 115 16 43 1    0 0 0 1 1 0 0 0 0 0 43 24 40 3 0 3
osa-miR396f-5p UCUCCACAGGCUUUCUUGAACU 22 2 1 1 1    0 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0
osa-miR396g UCCACAGGCUUUCUUGAACGG 21 3,276 298 458 1    458 382 314 425 430 289 358 298 212 109 1 0 0 0 0 0
osa-miR396h UCCACAGGCUUUCUUGAACGG 21 3,276 298 458 1    458 382 314 425 430 289 358 298 212 109 1 0 0 0 0 0
osa-miR3979-3p CUUCGGGGGAGGAGAGAAGC 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR3979-5p UCUCUCUCUCCCUUGAAGGC 20 18 3 4 1    0 0 3 0 4 2 0 0 4 0 0 1 0 3 1 0
osa-miR397a UCAUUGAGUGCAGCGUUGAUG 21 708 44 84 10    10 39 43 52 52 84 45 58 84 35 19 20 29 36 44 58
osa-miR397b UUAUUGAGUGCAGCGUUGAUG 21 13 3 4 1    4 0 0 3 0 4 0 0 0 0 1 1 0 0 0 0
osa-miR3980a-3p CUGGCCGAGGCCGUCGAUUCU 21 9 2 3 1    0 0 0 0 0 0 0 0 0 0 0 0 2 1 3 3
osa-miR3980a-5p AAUCGACGGCCUCAGUCAGGG 21 250 50 57 40    0 0 0 0 0 0 0 0 0 0 48 50 0 57 55 40
osa-miR3980b-3p CUGGCCGAGGCCGUCGAUUCU 21 9 2 3 1    0 0 0 0 0 0 0 0 0 0 0 0 2 1 3 3
osa-miR3980b-5p AAUCGACGGCCUCAGUCAGGG 21 250 50 57 40    0 0 0 0 0 0 0 0 0 0 48 50 0 57 55 40
osa-miR3981-3p AGUAUUAGGAUACGUCUCAUC 21 12 4 5 3    0 0 4 0 0 3 5 0 0 0 0 0 0 0 0 0
osa-miR3981-5p UGGGACGUAUCCUAUUACUAU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR3982-3p AGUUGCCUACAUGGAGCGCCA 21 28 5 9 2    5 0 0 0 2 5 9 2 0 0 0 5 0 0 0 0
osa-miR3982-5p GCGCUCCACGUAGGCAACAAU 21 5 3 3 2    0 3 0 0 0 0 0 0 2 0 0 0 0 0 0 0
osa-miR398a UGUGUUCUCAGGUCACCCCUU 21 52 9 14 4    0 0 0 0 0 0 0 0 0 0 10 4 7 6 11 14
osa-miR398b UGUGUUCUCAGGUCGCCCCUG 21 93,159 5,822 17,804 22    10,143 8,518 3,989 9,672 5,724 13,508 17,804 10,552 6,369 4,723 553 671 22 183 348 380
osa-miR399a UGCCAAAGGAGAAUUGCCCUG 21 47 5 10 1    10 1 6 8 2 6 8 2 4 0 0 0 0 0 0 0
osa-miR399b UGCCAAAGGAGAAUUGCCCUG 21 47 5 10 1    10 1 6 8 2 6 8 2 4 0 0 0 0 0 0 0
osa-miR399c UGCCAAAGGAGAAUUGCCCUG 21 47 5 10 1    10 1 6 8 2 6 8 2 4 0 0 0 0 0 0 0
osa-miR399d UGCCAAAGGAGAGUUGCCCUG 21 7,030 439 1,057 2    704 716 565 519 619 758 894 555 1,057 600 3 26 4 2 6 2
osa-miR399e UGCCAAAGGAGAUUUGCCCAG 21 2 1 1 1    0 0 0 0 0 1 0 0 0 0 0 1 0 0 0 0
osa-miR399f UGCCAAAGGAGAUUUGCCCAG 21 2 1 1 1    0 0 0 0 0 1 0 0 0 0 0 1 0 0 0 0
osa-miR399g UGCCAAAGGAGAUUUGCCCAG 21 2 1 1 1    0 0 0 0 0 1 0 0 0 0 0 1 0 0 0 0
osa-miR399h UGCCAAAGGAGACUUGCCCAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR399i UGCCAAAGGAGAGCUGCCCUG 21 2 1 1 1    0 0 0 0 0 1 0 0 0 1 0 0 0 0 0 0
osa-miR399j UGCCAAAGGAGAGUUGCCCUA 21 40 4 11 1    0 1 0 1 7 0 1 0 0 0 3 11 11 3 1 1
osa-miR399k UGCCAAAGGAAAUUUGCCCCG 21 36 4 10 1    4 3 10 3 1 4 6 3 2 0 0 0 0 0 0 0
osa-miR408-3p CUGCACUGCCUCUUCCCUGGC 21 23,489 1,468 3,493 39    1,812 3,284 1,292 3,160 2,005 2,446 3,493 2,210 1,790 1,250 39 78 69 287 151 123
osa-miR408-5p CAGGGAUGAGGCAGAGCAUGG 21 2,143 143 324 19    110 136 40 212 173 223 187 169 201 120 36 19 0 324 108 85
osa-miR413 CUAGUUUCACUUGUUCUGCAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR414 UCAUCCUCAUCAUCAUCGUCC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR415 AACAGAACAGAAGCAGAGCAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR416 UGUUCGUCCGUACACUGUUCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR417 GAAUGUAGUGAAUUUGUUCCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR418 UAAUGUGAUGAUGAAAUGACG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR419 UGAUGAAUGCUGACGAUGUUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR426 UUUUGGAAGUUUGUCCUUACG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR435 UUAUCCGGUAUUGGAGUUGA 20 374 27 225 1    3 1 3 3 0 15 9 5 22 0 49 36 225 1 1 1
osa-miR437 AAAGUUAGAGAAGUUUGACUU 21 11 6 6 5    0 0 6 5 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR438 UUCCCACGCGUUAUAGUGAAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR439a UGUCGAACCGCGGUUGUUCGA 21 4 2 2 2    0 0 0 0 0 0 0 0 0 0 2 0 2 0 0 0
osa-miR439b UGUCGAACCGCGGUUGUUCGA 21 4 2 2 2    0 0 0 0 0 0 0 0 0 0 2 0 2 0 0 0
osa-miR439c UGUCGAACCGCGGUUGUUCGA 21 4 2 2 2    0 0 0 0 0 0 0 0 0 0 2 0 2 0 0 0
osa-miR439d UGUCGAACCGCGGUUGUUCGA 21 4 2 2 2    0 0 0 0 0 0 0 0 0 0 2 0 2 0 0 0
osa-miR439e UGUCGAACCGCGGUUGUUCGA 21 4 2 2 2    0 0 0 0 0 0 0 0 0 0 2 0 2 0 0 0
osa-miR439f UGUCGAACCGCGGUUGUUCGA 21 4 2 2 2    0 0 0 0 0 0 0 0 0 0 2 0 2 0 0 0
osa-miR439g UGUCGAACCGCGGUUGUUCGA 21 4 2 2 2    0 0 0 0 0 0 0 0 0 0 2 0 2 0 0 0
osa-miR439h UGUCGAACCGCGGUUGUUCGA 21 4 2 2 2    0 0 0 0 0 0 0 0 0 0 2 0 2 0 0 0
osa-miR439i UGUCGAACCGCGGUUGUUCGA 21 4 2 2 2    0 0 0 0 0 0 0 0 0 0 2 0 2 0 0 0
osa-miR440 AGUGUCUCCUGAUGAUCGGGACAA 24 15 4 11 1    0 0 1 0 0 0 0 0 0 0 1 2 11 0 0 0
osa-miR443 AUCACAAUACAAUAAAUCUGGA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR444a-3p.1 UUGCUGCCUCAAGCUUGCUGC 21 61 6 15 1    1 5 6 6 2 15 9 5 9 3 0 0 0 0 0 0
osa-miR444a-3p.2 UGCAGUUGCUGCCUCAAGCUU 21 4,344 290 676 5    483 468 481 353 440 676 573 278 376 169 20 5 0 10 6 6
osa-miR444a-5p GCUAGAGGUGGCAACUGCAUA 21 150 12 25 1    6 14 10 3 1 24 5 25 23 20 1 0 0 12 0 6
osa-miR444b.1 UGUUGUCUCAAGCUUGCUGCC 21 12,759 797 1,732 27    1,208 1,276 1,548 1,179 905 1,326 1,732 1,026 1,109 871 99 81 27 119 209 44
osa-miR444b.2 UGCAGUUGUUGUCUCAAGCUU 21 25,860 1,616 3,476 22    2,594 2,205 2,511 2,545 2,745 3,318 3,476 2,552 1,949 1,134 266 224 22 153 104 62
osa-miR444c.1 UGUUGUCUCAAGCUUGCUGCC 21 12,759 797 1,732 27    1,208 1,276 1,548 1,179 905 1,326 1,732 1,026 1,109 871 99 81 27 119 209 44
osa-miR444c.2 UGCAGUUGUUGUCUCAAGCUU 21 25,860 1,616 3,476 22    2,594 2,205 2,511 2,545 2,745 3,318 3,476 2,552 1,949 1,134 266 224 22 153 104 62
osa-miR444d.1 UUGCUGCCUCAAGCUUGCUGC 21 61 6 15 1    1 5 6 6 2 15 9 5 9 3 0 0 0 0 0 0
osa-miR444d.2 UGCAGUUGCUGCCUCAAGCUU 21 4,344 290 676 5    483 468 481 353 440 676 573 278 376 169 20 5 0 10 6 6
osa-miR444d.3 UUGUGGCUUUCUUGCAAGUUG 21 362 23 47 1    20 30 41 29 39 47 33 14 24 1 24 13 29 2 14 2
osa-miR444e UGCAGUUGCUGCCUCAAGCUU 21 4,344 290 676 5    483 468 481 353 440 676 573 278 376 169 20 5 0 10 6 6
osa-miR444f UGCAGUUGUUGCCUCAAGCUU 21 160 12 34 1    21 9 23 8 11 34 28 10 1 7 4 3 0 1 0 0
osa-miR5071 UCAAGCAUCAUAUCGUGGACA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR5072 CGAUUCCCCAGCGGAGUCGCCA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR5073 GUUUGGUGAAUCGGAAACUAUUU 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR5074 GAAGGCCACCGUCGGGAUCGC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR5075 UUCUCCGUCGCCGCCGUCCGC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR5076 GAAAUGGGAGCAGAGCAGGUUU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR5077 GUUCGCGUCGGGUUCACCA 19 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR5078 CCUCGUUCGACCGUGGCAUUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR5079a UUUGGAUCUGUUAUUUUGGUAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR5079b UUUGGAUCUGUUAUUUUGGUAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR5080 AAAAGGAUCAUACCGUGACAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR5081 UAAUUUGUAGCAAAUUGAUAGU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR5082 UGCGAUGAUGGCCGCGCGGGUUCA 24 4 2 3 1    0 0 3 0 0 0 0 0 0 0 0 1 0 0 0 0
osa-miR5083 AGACUACAAUUAUCUGAUCA 20 8 3 5 1    0 0 0 0 0 0 0 5 0 0 1 0 2 0 0 0
osa-miR5143a UGUGGUAUGUUGGCAAUGUAGGAA 24 105 8 20 1    20 14 14 10 12 8 5 3 10 1 2 4 0 1 0 1
osa-miR5143b UGUGGUAUGUUGGCAAUGUAGGAA 24 105 8 20 1    20 14 14 10 12 8 5 3 10 1 2 4 0 1 0 1
osa-miR5144-3p UCUCCUCAGCAGCACAAGAAG 21 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1
osa-miR5144-5p UUCUUGUGCUGCUGAAGAGAC 21 661 41 199 8    31 38 40 32 49 28 48 41 55 8 25 26 199 10 18 13
osa-miR5145 ACCUGUUUGGAUUCUUGAGGGCUA 24 12 2 5 1    1 5 0 0 1 2 1 0 2 0 0 0 0 0 0 0
osa-miR5146 UUUAACUAAUGAACCGGCACCUAU 24 11 3 6 1    0 3 0 0 6 0 1 0 1 0 0 0 0 0 0 0
osa-miR5147 ACAACUCUUGUGGAUGGAGGG 21 13 3 8 1    0 0 0 0 0 2 8 0 0 0 1 2 0 0 0 0
osa-miR5148a UGAGGGGUAGAAAUGUCAUAUCAU 24 5 5 5 5    0 0 0 0 0 0 0 5 0 0 0 0 0 0 0 0
osa-miR5148b UGAGGGGUAGAAAUGUCAUAUCAU 24 5 5 5 5    0 0 0 0 0 0 0 5 0 0 0 0 0 0 0 0
osa-miR5148c UGAGGGGUAGAAAUGUCAUAUCAU 24 5 5 5 5    0 0 0 0 0 0 0 5 0 0 0 0 0 0 0 0
osa-miR5149 GAGGAGCUGUGACGAUUUGGGA 22 13 3 7 1    0 0 4 1 0 0 0 0 0 7 1 0 0 0 0 0
osa-miR5150-3p AGAAGCUGCAGCUGUCAGAAGCUC 24 6,336 422 817 1    785 609 447 664 676 704 817 633 577 409 1 3 0 3 6 2
osa-miR5150-5p AGCUUCUGACAGCUGCAGUUUCUC 24 276 23 48 1    23 13 20 31 48 44 17 25 39 14 1 0 0 0 0 1
osa-miR5151 UAAUGAUGUGGGUACGAAUGAA 22 2 2 2 2    0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0
osa-miR5152-3p AGACCAUGCCUAUACCUACCA 21 15 3 5 2    4 0 0 0 2 5 2 2 0 0 0 0 0 0 0 0
osa-miR5152-5p GUAGGGAUAGGCAUGAUCUCU 21 3 2 2 1    0 0 0 0 1 0 0 0 0 0 0 0 2 0 0 0
osa-miR5153 UGGAUUCCACUGACACGUAGACGU 24 12 4 10 1    0 0 1 0 0 0 0 0 10 0 1 0 0 0 0 0
osa-miR5154 AGCACCAGUUGACGUGACGCUGAG 24 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0
osa-miR5155 ACUUUAAUACCAUUGGAAGAUUGC 24 1 1 1 1    0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0
osa-miR5156 AGCCUGUAAAACUGCAAAAAGGAA 24 16 3 5 1    4 5 0 0 0 3 0 3 0 0 1 0 0 0 0 0
osa-miR5157a-3p AGAAGUUGUGGCUAUCAAAAAGUU 24 2 1 1 1    0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0
osa-miR5157a-5p AACUUUUUAAUAGCUACAACUUCU 24 17 3 6 1    6 0 0 1 0 2 3 0 5 0 0 0 0 0 0 0
osa-miR5157b-3p AGAAGUUGUGGCUAUCAAAAAGUU 24 2 1 1 1    0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0
osa-miR5157b-5p AACUUUUUAAUAGCUACAACUUCU 24 17 3 6 1    6 0 0 1 0 2 3 0 5 0 0 0 0 0 0 0
osa-miR5158 UGAGCCACUGGGAUGAGGAUGAAU 24 2 2 2 2    0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR5159 AACUAGAGUGGGUCAACGGGUACC 24 257 18 40 1    16 13 23 23 40 35 13 22 23 35 0 8 2 3 0 1
osa-miR5160 CGAGAUCGAUGGUAUAUUUCUG 22 4 1 2 1    0 0 0 0 0 1 1 2 0 0 0 0 0 0 0 0
osa-miR5161 UCUGGAUCAGAGGGAGUAUA 20 12 2 4 1    2 0 0 0 0 4 1 0 2 3 0 0 0 0 0 0
osa-miR5162 AAAUGACCAAAAUACCCCUAGAAC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR5179 UUUUGCUCAAGACCGCGCAAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR528-3p CCUGUGCUUGCCUCUUCCAUU 21 10,644 710 1,751 117    674 609 475 925 681 1,751 1,443 828 936 454 768 431 0 417 117 135
osa-miR528-5p UGGAAGGGGCAUGCAGAGGAG 21 105,635 6,602 43,631 472    472 766 523 1,374 687 1,284 949 715 691 547 11,504 43,631 1,468 8,394 25,949 6,681
osa-miR529a CUGUACCCUCUCUCUUCUUC 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR529b AGAAGAGAGAGAGUACAGCUU 21 63 6 17 1    6 0 4 7 17 13 4 5 5 1 0 0 0 1 0 0
osa-miR530-3p AGGUGCAGAGGCAGAUGCAAC 21 932 186 344 33    0 0 0 0 0 0 0 0 0 0 86 33 0 144 325 344
osa-miR530-5p UGCAUUUGCACCUGCACCUA 20 37 7 19 1    0 0 0 0 0 0 0 0 0 0 1 1 0 19 14 2
osa-miR531a CUCGCCGGGGCUGCGUGCCGCCAU 24 70 5 16 1    8 8 16 0 1 3 16 2 7 0 1 1 0 3 3 1
osa-miR531b CUCGCCGGGGCUGCGUGCCG 20 27 9 25 1    1 0 0 0 0 0 0 0 0 0 0 1 0 25 0 0
osa-miR531c CUCGCCGGGGCUGCGUGCCGCCAU 24 70 5 16 1    8 8 16 0 1 3 16 2 7 0 1 1 0 3 3 1
osa-miR5337a AAAUUACUUGUCGUUCUAGCU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR5337b CUAGAACGGCAAGCAAUUUGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR5338 UGAAGCUUCAGUUGGUUGUAU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR5339 CAGAUAGAGAAUCUUCUCAGA 21 74 15 34 1    0 0 0 1 0 1 0 0 0 0 34 29 9 0 0 0
osa-miR5340 UGAUGACGUGGAUGAAUUUCAAA 23 3 3 3 3    0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0
osa-miR535-3p GUGCUUUCUCCCGUUGUCACU 21 1,147 76 205 6    108 76 115 96 205 116 106 75 96 45 30 49 0 11 6 13
osa-miR535-5p UGACAACGAGAGAGAGCACGC 21 2,519 157 375 4    261 311 264 375 294 106 196 185 134 111 134 112 4 7 20 5
osa-miR5484 AACCGAGCGCGCUGUUGAUUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR5485 UGACAACUGGUAGCAGAGCAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR5486 AGGGGCUUGCAUAUUCUACCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR5487 AAAGAUGUGCAUGUAGUUCCG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR5488 UGAAGGCGACUGAUGAUUUCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR5489 CAGGUGUUCUCGAUGGCUUCC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR5490 UUGGAUUUUUAUUUAGGACGG 21 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1
osa-miR5491 UGAAAUGGAGGCUCGUUGUAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR5492 AGAAGGAGAAUAGAUAUGGUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR5493 AGCCGGGCUCGGUCGCGCGUG 21 269 45 141 5    0 0 0 0 0 0 0 0 0 0 11 5 18 141 31 63
osa-miR5494 UUAUAGGAGGUAUAGACGGUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR5495 AGAGGUCCGGAUCGAACGUAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR5496 CCAGCCGGUGGCAUAGUUCUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR5497 CAGAAUAUCUGGGACGAGCAU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR5498 UGAGCUGUAACACUUGAAGAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR5499 GAAGGAAGAAUCGUUAUGGAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR5500 AUCACUGAUGAAAUCUUGCGGC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR5501 UCUUGUGGCUAGAAGGGUGAG 21 5 2 3 1    0 1 3 1 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR5502 UACGGAUACGGAUACGCGAUAC 22 4 1 2 1    0 1 0 0 0 1 2 0 0 0 0 0 0 0 0 0
osa-miR5503 UUCGGAUCUUUCUAGAGGCAUU 22 6 3 4 2    0 4 0 0 0 0 0 2 0 0 0 0 0 0 0 0
osa-miR5504 AGUGACGGGAGGACUGCAAGG 21 1 1 1 1    0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0
osa-miR5505 GAGGAUUCGGUAUUGAUCGCUA 22 1 1 1 1    0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0
osa-miR5506 UGGAUCGCUUCGUCUGAUGGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR5507 AAUGAGAAUGAUGACCCGGUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR5508 UAGAUGGCUGAUCUGGUGUGG 21 151 11 22 1    6 12 13 13 13 11 12 22 5 1 10 12 18 0 3 0
osa-miR5509 UAGGCAUUUUCUCUUGGCAUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR5510 AGGCUGAUCCACUCCAGAGGA 21 12 6 6 6    6 0 0 0 0 6 0 0 0 0 0 0 0 0 0 0
osa-miR5511 CAUAUCCCAGCUGUUUCGGCC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR5512a UAGGAUAUGGUAAUGCUAAAA 21 25 3 5 1    2 1 0 4 1 3 2 5 0 0 0 1 4 2 0 0
osa-miR5512b UAGGAUAUGGUAAUGCUAAAA 21 25 3 5 1    2 1 0 4 1 3 2 5 0 0 0 1 4 2 0 0
osa-miR5513 UAACAAAGGACAACAGACUGA 21 133 10 28 1    4 16 9 14 10 24 10 3 28 8 1 2 4 0 0 0
osa-miR5514 UCCCAGAGCUUUGGCCGUCGC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR5515 CCGAUGGUUGUUCUACAGGUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR5516a CUCAUUGCUUCGGUAGGCUGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR5516b CUCAUUGCUUCGGUAGGCUGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR5517 UGCAUCACGGCGCAUAUGUAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR5518 AUACUCAAACAGGGCAUUGCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR5519 UGGCAGAAGUACUGGACUUAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR5521 AGUGGCUGCAUAUCUGAUGAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR5522 AACAAUAGGAAUGGGAGGCAU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR5523 UGAGGAGGAACAUAUUUACUAG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR5524 UGGAAAAUGUGUUCAUGACGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR5525 UGAACCUUGGGAGCGAUCUGAA 22 2 2 2 2    0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0
osa-miR5526 AAAGGUAGAGUCAGGUAUGAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR5527 UCUCAGCCAGGGCAGUAACAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR5528 AAGACGGUUUUAGAUGUUGCC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR5529 GUUUCAUCCAUGGACACCGCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR5530 AGUGGUGUCGUAUUACCUGCC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR5531 ACUGACUGCCUUGAGCUCCGGG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR5532 AUGGAAUAUAUGACAAAGGUGG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR5533 CUUUGCCAGAAGCCCUCAUGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR5534a UGACGACAACAGCUAGAAUGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR5534b CGAUGACAACAGCUAGAAUGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR5535 UCUGCGUGAUUGAAGUCUGCAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR5536 AAUGGUAGUGACAUUAUGGUAG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR5537 AAUGUUUGUAUGGAUCGUUUGU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR5538 ACUGAACUCAAUCACUUGCUGC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR5539a AAGAAAACGGAUGCGCGUGCUA 22 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0
osa-miR5539b AAGAAAACGGAUGCGCGUGCUA 22 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0
osa-miR5540 UUGUGCGAGAUCGACGGUAUA 21 154 15 56 5    19 5 10 8 7 10 15 14 10 56 0 0 0 0 0 0
osa-miR5541 UCAAGUGGUGUACUCUAAAGA 21 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0
osa-miR5542 UUUGAGAAGGUAUCAUGAGAU 21 356 27 64 1    12 26 55 20 64 64 41 22 35 8 1 1 7 0 0 0
osa-miR5543 UAUGAAUGGUAUAUUUUCUUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR5544 AGAACACGGAGUAGAAGUUGGU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR5788 UGGAUGUGACAUACUCUAGUA 21 448 28 103 1    7 13 37 23 15 29 16 22 103 75 32 22 47 2 4 1
osa-miR5789 UGACUGAGCUUCGUUCGGUAU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR5790 AAGACGAUCCUAGCAGAGCUUCAU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR5791 UUGCAGGAGACUAGAGACCAG 21 2 1 1 1    0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0
osa-miR5792 GAUGACAGCGGUGGUUCGGACAUC 24 7 1 3 1    0 0 1 0 0 0 0 0 0 0 0 1 0 1 1 3
osa-miR5793 CGAGGACGAGAUACAGUGCAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR5794 UGAGGAAUCACUAGUAGUCGU 21 36,595 2,287 4,716 10    3,792 3,852 4,257 3,375 3,422 4,602 4,716 2,628 3,239 2,301 63 44 243 10 32 19
osa-miR5795 AUGUCGAGGUCGAGUUCCCGGC 22 217 22 38 8    21 38 14 11 29 28 27 8 31 10 0 0 0 0 0 0
osa-miR5796 UCAUUCAGGAUUGAAGCCGCC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0