Rice small RNA miRNA Abundances

The data below are based on the microRNAs listed in the miRBase registry. Adjust libraries/reads to display on the control panel.


        miRNA         miRNA sequence Len Sum (norm) Average Max Min (>0)  WT2003sWT2007sWT2011sT2iZ11RT2iZ11ST4iZ11ST4iZ11RT6iZ11RT6P9RT6Sp1RAGO18IP-RSV-1AGO18IP/RSV-2AGO1bIP-RSV-2AGO1aIP-RSV-1AGO1aIP-RSV-2AGO1bIP-RSV-1wt_kit_adultmiR2_adultmiR7b_adultmiR8_adultmiR390_KO1miR390_KO2wt390r1wt390r2
osa-miR11336-3p GAAUAUGGGAAAUGCUAGAAAGUCU 25 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR11336-5p GACUUUCUAGCGUUGCCCACAUUC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR11337-3p UAUCUCGUUAGAUUCGUCUCG 21 19 1 6 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 5 6 3 0 0 1 0
osa-miR11337-5p UGCGAGACGAAUCUAACGAGG 21 43 2 11 1    1 0 0 4 0 1 0 7 0 7 0 0 0 0 0 0 4 1 11 4 0 0 3 0
osa-miR11338-3p AUCUCGUUAGAUUCGUCUCGCAAA 24 5 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 0 0 0 1 1
osa-miR11338-5p UUUGUGAGACGAAUCUAAUGAUAU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR11339-3p UAUGAAUGUGGGCAAUGCUAG 21 11 0 2 1    0 0 0 0 0 0 2 0 0 0 0 2 0 1 1 2 0 1 0 0 2 0 0 0
osa-miR11339-5p GCAUUGCCCACAUUCAUAUAG 21 1 0 1 1    0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR11340-3p AAUAGUGUAAUCGGAUUAUAGAUC 24 39 2 5 1    2 4 4 2 1 1 3 3 5 0 0 0 0 0 0 0 0 0 0 0 4 3 2 5
osa-miR11340-5p AUCCGAUCUACGAUCCGAUUACAC 24 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0
osa-miR11341-3p AUCUCGUUAGAUUCGUCUCGCAAA 24 5 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 0 0 0 1 1
osa-miR11341-5p CCUAGGCUAUUUUGCGAGACGAAU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR11342-3p CUCGUUAGAUUCGUCUCGCAAA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR11342-5p CGAGACGAAUCUAACGAGAUA 21 4 0 1 1    1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1
osa-miR11343-3p UGAAUGUGGGCAAUGUUAAAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR11343-5p CUUUCUAGCGUUGCCCACAUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR11344-3p CUGUGAGGUACCGGUACCUAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR11344-5p UAUCUCGAGAUAUCGGUACCUC 22 68 3 13 1    3 6 3 13 8 7 1 0 2 0 0 0 0 0 0 0 3 1 4 7 0 4 0 6
osa-miR1319a AACCGGCAUCUGUAAUAUAUUAUA 24 45 2 10 1    0 0 0 5 0 1 1 0 5 4 0 0 0 0 0 0 0 0 1 0 5 7 10 6
osa-miR1319b CCUUUAAUAUAUUAUAGGUGUCGG 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1320-3p UGUAAAAUUCAUUCGUUCCAA 21 165 7 26 1    1 0 1 2 0 0 4 3 18 0 16 26 18 1 3 1 3 15 16 22 1 8 2 4
osa-miR1320-5p UGGAACGGAGGAAUUUUAUAG 21 290 12 108 1    0 0 3 4 0 0 0 7 1 0 32 25 18 10 8 12 10 32 108 18 0 0 1 1
osa-miR1423-3p AGCGCCCAAGCGGUAGUUGUC 21 3 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1
osa-miR1423-5p AGGCAACUACACGUUGGGCGCUCG 24 2,896 121 640 2    49 25 38 26 60 44 39 42 22 21 3 5 0 2 3 4 81 52 52 70 507 491 640 620
osa-miR1424 AUGCACACUGAUGCUGAUUGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1425-3p CAGCAAGAACUGGAUCUUAAU 21 830 35 343 2    12 22 11 6 13 34 24 14 10 3 123 343 2 3 3 2 6 6 8 11 37 40 51 46
osa-miR1425-5p UAGGAUUCAAUCCUUGCUGCU 21 162,505 6,771 21,739 15    10,497 10,739 19,948 14,171 15,144 19,562 20,558 7,714 21,739 10,451 39 26 18 18 197 15 1,047 545 530 623 2,627 1,991 2,217 2,089
osa-miR1426 AGAAUCUUGAUGAUGAUUAAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1427 UGCGGAACCGUGCGGUGGCGC 21 192 8 30 2    19 6 20 0 2 8 8 0 11 11 3 0 0 0 0 0 6 5 4 4 20 30 20 15
osa-miR1428a-3p UAAGAUAAAGCCGUGAAUUUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1428a-5p CGUUUUGCAAAUUCGCAGGCC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1428b UAAGAUAAUGCCAUGAAUUCG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1428c UAAGAUAAUGCCAUGAAUUCG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1428d UAAGAUAAUGCCAUGAAUUCG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1428e-3p UAAGAUAAUGCCAUGAAUUUG 21 706 29 205 1    25 13 17 10 6 9 4 7 17 25 2 0 18 3 13 9 141 205 86 91 0 0 4 1
osa-miR1428e-5p AAUUCACAGGCCCUAUCUUGUG 22 68 3 16 1    0 12 16 5 5 5 1 0 0 1 1 0 0 0 0 0 7 4 6 4 0 0 1 0
osa-miR1428f-5p AAUUCACAGGCCCUAUCUUGUG 22 68 3 16 1    0 12 16 5 5 5 1 0 0 1 1 0 0 0 0 0 7 4 6 4 0 0 1 0
osa-miR1428g-5p AAUUCACAGGCCCUAUCUUGUG 22 68 3 16 1    0 12 16 5 5 5 1 0 0 1 1 0 0 0 0 0 7 4 6 4 0 0 1 0
osa-miR1429-3p GUUGCACGGGUUUGUAUGUUG 21 6 0 3 1    0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 3 0 1
osa-miR1429-5p GUAAUAUACUAAUCCGUGCAU 21 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0
osa-miR1430 UGGUGAGCCUUCCUGGCUAAG 21 142 6 28 3    5 3 7 16 19 28 14 10 26 14 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1431 UUUGCGAGUUGGCCCGCUUGC 21 119 5 20 1    11 0 4 4 8 13 20 10 5 7 1 0 0 0 0 0 3 0 0 0 12 7 5 9
osa-miR1432-3p CAGGUGUCAUCUCCCCUGAAC 21 12 1 4 1    0 0 0 0 0 2 0 0 0 4 3 0 0 0 0 0 0 0 0 0 0 0 2 1
osa-miR1432-5p AUCAGGAGAGAUGACACCGAC 21 8,284 345 1,930 1    109 147 113 335 83 126 472 191 90 49 5 9 13 1 3 1 910 1,930 1,500 1,638 123 129 137 170
osa-miR1435 UUUCUUAAGUCAAACUUUUU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1436 ACAUUAUGGGACGGAGGGAGU 21 7 0 5 2    0 0 0 2 0 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1437a UCCGGCGCCGCACUAGGCACUG 22 4 0 2 1    0 1 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0
osa-miR1437b-3p GUGCUGGCGAGCUCCGGUGCCGCA 24 18 1 6 1    2 6 0 0 1 1 1 0 2 0 0 0 0 0 0 0 1 0 3 1 0 0 0 0
osa-miR1437b-5p GGGAGGAAACAGUGCCUAGUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1438 AGGGUAAUUUUAUCAUUUUUAA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1439 UUUUGGAACGGAGUGAGUAUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1440a UGCUCAAAUACCACUCUCCU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1440b UUUAGGAGAGUGGUAUUUGAG 21 2 0 2 2    0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1441 ACCGGAUGUCGGAAAAGGUUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1442 AUUCAUAGUACUAGAUGUGU 20 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0
osa-miR156a UGACAGAAGAGAGUGAGCAC 20 707,380 29,474 205,184 29    16,956 16,272 9,578 18,831 10,349 10,117 15,701 11,023 11,157 7,999 163 104 29 148 225 180 7,573 3,600 3,996 2,699 164,814 205,184 100,325 90,357
osa-miR156b-3p GCUCACUCUCUAUCUGUCAGC 21 47,278 1,970 14,272 1    94 36 33 59 50 78 42 32 57 68 41 39 2 0 0 0 1 1 6 0 11,556 14,272 10,651 10,160
osa-miR156b-5p UGACAGAAGAGAGUGAGCAC 20 707,380 29,474 205,184 29    16,956 16,272 9,578 18,831 10,349 10,117 15,701 11,023 11,157 7,999 163 104 29 148 225 180 7,573 3,600 3,996 2,699 164,814 205,184 100,325 90,357
osa-miR156c-3p GCUCACUUCUCUCUCUGUCAGC 22 19,798 825 6,054 1    115 143 101 164 144 197 207 147 170 78 18 30 0 2 0 4 1 5 3 1 4,726 6,054 3,948 3,540
osa-miR156c-5p UGACAGAAGAGAGUGAGCAC 20 707,380 29,474 205,184 29    16,956 16,272 9,578 18,831 10,349 10,117 15,701 11,023 11,157 7,999 163 104 29 148 225 180 7,573 3,600 3,996 2,699 164,814 205,184 100,325 90,357
osa-miR156d UGACAGAAGAGAGUGAGCAC 20 707,380 29,474 205,184 29    16,956 16,272 9,578 18,831 10,349 10,117 15,701 11,023 11,157 7,999 163 104 29 148 225 180 7,573 3,600 3,996 2,699 164,814 205,184 100,325 90,357
osa-miR156e UGACAGAAGAGAGUGAGCAC 20 707,380 29,474 205,184 29    16,956 16,272 9,578 18,831 10,349 10,117 15,701 11,023 11,157 7,999 163 104 29 148 225 180 7,573 3,600 3,996 2,699 164,814 205,184 100,325 90,357
osa-miR156f-3p GCUCACUUCUCUUUCUGUCAGC 22 491 20 65 1    43 43 31 53 65 28 46 64 41 42 12 2 0 3 0 2 0 0 4 0 1 3 5 3
osa-miR156f-5p UGACAGAAGAGAGUGAGCAC 20 707,380 29,474 205,184 29    16,956 16,272 9,578 18,831 10,349 10,117 15,701 11,023 11,157 7,999 163 104 29 148 225 180 7,573 3,600 3,996 2,699 164,814 205,184 100,325 90,357
osa-miR156g-3p GCUCACUUCUCUCUCUGUCAGC 22 19,798 825 6,054 1    115 143 101 164 144 197 207 147 170 78 18 30 0 2 0 4 1 5 3 1 4,726 6,054 3,948 3,540
osa-miR156g-5p UGACAGAAGAGAGUGAGCAC 20 707,380 29,474 205,184 29    16,956 16,272 9,578 18,831 10,349 10,117 15,701 11,023 11,157 7,999 163 104 29 148 225 180 7,573 3,600 3,996 2,699 164,814 205,184 100,325 90,357
osa-miR156h-3p GCUCACUUCUCUUUCUGUCAGC 22 491 20 65 1    43 43 31 53 65 28 46 64 41 42 12 2 0 3 0 2 0 0 4 0 1 3 5 3
osa-miR156h-5p UGACAGAAGAGAGUGAGCAC 20 707,380 29,474 205,184 29    16,956 16,272 9,578 18,831 10,349 10,117 15,701 11,023 11,157 7,999 163 104 29 148 225 180 7,573 3,600 3,996 2,699 164,814 205,184 100,325 90,357
osa-miR156i UGACAGAAGAGAGUGAGCAC 20 707,380 29,474 205,184 29    16,956 16,272 9,578 18,831 10,349 10,117 15,701 11,023 11,157 7,999 163 104 29 148 225 180 7,573 3,600 3,996 2,699 164,814 205,184 100,325 90,357
osa-miR156j-3p GCUCGCUCCUCUUUCUGUCAGC 22 577 24 50 1    38 45 31 46 50 33 48 37 37 34 5 3 0 0 0 0 4 1 3 1 37 46 45 33
osa-miR156j-5p UGACAGAAGAGAGUGAGCAC 20 707,380 29,474 205,184 29    16,956 16,272 9,578 18,831 10,349 10,117 15,701 11,023 11,157 7,999 163 104 29 148 225 180 7,573 3,600 3,996 2,699 164,814 205,184 100,325 90,357
osa-miR156k UGACAGAAGAGAGAGAGCACA 21 3 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 1 0
osa-miR156l-3p GCUCACUUCUCUUUCUGUCAGC 22 491 20 65 1    43 43 31 53 65 28 46 64 41 42 12 2 0 3 0 2 0 0 4 0 1 3 5 3
osa-miR156l-5p CGACAGAAGAGAGUGAGCAUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR159a.1 UUUGGAUUGAAGGGAGCUCUG 21 748,551 31,190 78,566 4,385    44,534 22,030 25,211 26,367 36,089 45,878 45,913 42,892 31,878 20,574 4,385 10,547 39,777 4,445 12,145 7,107 54,022 45,178 78,566 65,283 18,353 20,767 22,068 24,542
osa-miR159a.2 UUGCAUGCCCCAGGAGCUGCA 21 24 1 7 1    0 0 0 3 0 7 5 0 0 0 1 0 0 0 1 0 0 0 0 0 1 3 2 1
osa-miR159b UUUGGAUUGAAGGGAGCUCUG 21 748,551 31,190 78,566 4,385    44,534 22,030 25,211 26,367 36,089 45,878 45,913 42,892 31,878 20,574 4,385 10,547 39,777 4,445 12,145 7,107 54,022 45,178 78,566 65,283 18,353 20,767 22,068 24,542
osa-miR159c AUUGGAUUGAAGGGAGCUCCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR159d AUUGGAUUGAAGGGAGCUCCG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR159e AUUGGAUUGAAGGGAGCUCCU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR159f CUUGGAUUGAAGGGAGCUCUA 21 90 4 19 1    1 1 4 0 1 0 0 3 4 0 0 0 2 7 7 4 4 5 1 0 5 10 12 19
osa-miR160a-3p GCGUGCAAGGAGCCAAGCAUG 21 228 10 61 1    14 6 1 1 6 7 3 8 0 1 0 1 0 0 0 0 1 0 1 2 31 30 61 54
osa-miR160a-5p UGCCUGGCUCCCUGUAUGCCA 21 1,778 74 223 1    174 87 140 113 195 223 194 142 95 71 3 1 11 4 23 1 24 37 31 56 15 18 68 52
osa-miR160b-3p GCGUGCAAGGAGCCAAGCAUG 21 228 10 61 1    14 6 1 1 6 7 3 8 0 1 0 1 0 0 0 0 1 0 1 2 31 30 61 54
osa-miR160b-5p UGCCUGGCUCCCUGUAUGCCA 21 1,778 74 223 1    174 87 140 113 195 223 194 142 95 71 3 1 11 4 23 1 24 37 31 56 15 18 68 52
osa-miR160c-3p GCGUGCACGGAGCCAAGCAUA 21 7 0 3 1    0 0 0 0 0 0 0 0 0 0 0 0 0 3 3 1 0 0 0 0 0 0 0 0
osa-miR160c-5p UGCCUGGCUCCCUGUAUGCCA 21 1,778 74 223 1    174 87 140 113 195 223 194 142 95 71 3 1 11 4 23 1 24 37 31 56 15 18 68 52
osa-miR160d-3p GCGUGCGAGGAGCCAAGCAUG 21 2 0 1 1    0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1
osa-miR160d-5p UGCCUGGCUCCCUGUAUGCCA 21 1,778 74 223 1    174 87 140 113 195 223 194 142 95 71 3 1 11 4 23 1 24 37 31 56 15 18 68 52
osa-miR160e-3p GCGUGCGAGGUGCCAAGCAUG 21 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0
osa-miR160e-5p UGCCUGGCUCCCUGUAUGCCG 21 1,068 45 126 1    67 70 87 88 126 101 76 54 74 75 0 2 2 3 17 6 26 34 28 60 5 1 34 32
osa-miR160f-3p GCAUUGAGGGAGUCAUGCAGG 21 27 1 14 2    0 0 0 0 0 0 0 0 0 0 7 14 0 4 0 2 0 0 0 0 0 0 0 0
osa-miR160f-5p UGCCUGGCUCCCUGAAUGCCA 21 462 19 63 1    25 25 38 63 43 44 53 52 41 18 5 1 7 2 7 1 7 5 13 12 0 0 0 0
osa-miR162a UCGAUAAACCUCUGCAUCCAG 21 69,510 2,896 7,009 39    2,949 3,718 3,142 4,429 3,492 3,102 3,289 3,221 2,752 1,662 75 39 161 161 359 123 6,306 4,681 4,945 7,009 3,968 3,749 3,105 3,073
osa-miR162b UCGAUAAGCCUCUGCAUCCAG 21 7,400 308 2,206 1    93 183 166 192 233 159 203 161 167 38 3 1 2 16 46 7 1,147 766 925 2,206 175 199 159 153
osa-miR164a UGGAGAAGCAGGGCACGUGCA 21 14,212 592 6,356 1    279 266 461 400 513 524 432 295 603 632 93 195 272 619 6,356 1,675 47 194 191 141 1 1 12 10
osa-miR164b UGGAGAAGCAGGGCACGUGCA 21 14,212 592 6,356 1    279 266 461 400 513 524 432 295 603 632 93 195 272 619 6,356 1,675 47 194 191 141 1 1 12 10
osa-miR164c UGGAGAAGCAGGGUACGUGCA 21 85 4 58 1    0 0 1 0 0 0 0 0 1 0 1 3 4 2 58 13 0 1 0 1 0 0 0 0
osa-miR164d UGGAGAAGCAGGGCACGUGCU 21 610 25 283 1    14 3 20 13 12 23 4 8 18 4 5 3 4 30 283 63 7 14 34 39 0 3 1 5
osa-miR164e UGGAGAAGCAGGGCACGUGAG 21 44 2 21 1    0 0 0 0 0 0 0 0 0 0 6 3 2 1 6 0 0 1 21 0 0 0 1 3
osa-miR164f UGGAGAAGCAGGGCACGUGCA 21 14,212 592 6,356 1    279 266 461 400 513 524 432 295 603 632 93 195 272 619 6,356 1,675 47 194 191 141 1 1 12 10
osa-miR166a-3p UCGGACCAGGCUUCAUUCCCC 21 15,456,251 644,010 2,907,545 275    190,985 160,622 116,426 186,204 178,356 173,385 201,117 191,768 116,110 101,203 630 495 3,945 478 602 275 2,907,545 2,047,095 2,694,275 2,701,996 875,737 1,099,840 813,507 693,655
osa-miR166a-5p GGAAUGUUGUCUGGUUCAAGG 21 2,189 91 472 1    37 51 57 41 19 75 24 15 59 28 9 347 0 0 1 0 0 7 16 21 472 416 274 220
osa-miR166b-3p UCGGACCAGGCUUCAUUCCCC 21 15,456,251 644,010 2,907,545 275    190,985 160,622 116,426 186,204 178,356 173,385 201,117 191,768 116,110 101,203 630 495 3,945 478 602 275 2,907,545 2,047,095 2,694,275 2,701,996 875,737 1,099,840 813,507 693,655
osa-miR166b-5p GGAAUGUUGUCUGGCUCGGGG 21 626 26 59 1    34 43 44 59 57 36 42 29 57 51 2 23 0 2 6 1 7 9 24 26 17 17 19 21
osa-miR166c-3p UCGGACCAGGCUUCAUUCCCC 21 15,456,251 644,010 2,907,545 275    190,985 160,622 116,426 186,204 178,356 173,385 201,117 191,768 116,110 101,203 630 495 3,945 478 602 275 2,907,545 2,047,095 2,694,275 2,701,996 875,737 1,099,840 813,507 693,655
osa-miR166c-5p GGAAUGUUGUCUGGUCCGAG 20 114 5 41 2    0 0 0 0 0 2 0 0 0 0 0 5 4 31 31 41 0 0 0 0 0 0 0 0
osa-miR166d-3p UCGGACCAGGCUUCAUUCCCC 21 15,456,251 644,010 2,907,545 275    190,985 160,622 116,426 186,204 178,356 173,385 201,117 191,768 116,110 101,203 630 495 3,945 478 602 275 2,907,545 2,047,095 2,694,275 2,701,996 875,737 1,099,840 813,507 693,655
osa-miR166d-5p GGAAUGUUGUCUGGCUCGAGG 21 1,654 69 256 4    109 143 149 146 89 98 134 117 256 174 23 61 9 5 0 9 11 26 42 19 6 4 13 11
osa-miR166e-3p UCGAACCAGGCUUCAUUCCCC 21 5,984 249 1,059 1    44 39 44 16 42 187 197 151 118 66 0 1 2 0 1 0 1,059 774 956 981 287 345 358 316
osa-miR166e-5p GGAAUGUUGUCUGGUUCAAGG 21 2,189 91 472 1    37 51 57 41 19 75 24 15 59 28 9 347 0 0 1 0 0 7 16 21 472 416 274 220
osa-miR166f UCGGACCAGGCUUCAUUCCCC 21 15,456,251 644,010 2,907,545 275    190,985 160,622 116,426 186,204 178,356 173,385 201,117 191,768 116,110 101,203 630 495 3,945 478 602 275 2,907,545 2,047,095 2,694,275 2,701,996 875,737 1,099,840 813,507 693,655
osa-miR166g-3p UCGGACCAGGCUUCAUUCCUC 21 92,544 3,856 18,618 81    2,953 3,494 3,105 4,157 4,116 3,577 3,910 3,505 2,799 2,938 151 110 551 94 289 81 13,468 10,402 13,307 18,618 418 189 166 146
osa-miR166g-5p AAUGGAGGCUGAUCCAAGAUC 21 33 1 9 2    0 0 0 0 0 0 0 0 0 0 0 2 9 6 3 9 0 0 0 0 0 0 2 2
osa-miR166h-3p UCGGACCAGGCUUCAUUCCUC 21 92,544 3,856 18,618 81    2,953 3,494 3,105 4,157 4,116 3,577 3,910 3,505 2,799 2,938 151 110 551 94 289 81 13,468 10,402 13,307 18,618 418 189 166 146
osa-miR166h-5p GGAAUGUUGGCUGGCUCGAGG 21 169 7 35 1    0 14 4 5 12 3 9 5 10 35 2 15 2 3 1 4 7 6 13 18 0 0 0 1
osa-miR166i-3p UCGGAUCAGGCUUCAUUCCUC 21 31 1 4 1    3 0 1 3 1 0 1 0 0 0 1 1 0 1 4 1 4 4 3 3 0 0 0 0
osa-miR166i-5p AAUGCAGUUUGAUCCAAGAUC 21 410 17 43 1    17 35 43 33 40 38 28 17 43 34 5 1 0 0 0 0 20 9 6 13 4 4 15 5
osa-miR166j-3p UCGGACCAGGCUUCAUUCCCC 21 15,456,251 644,010 2,907,545 275    190,985 160,622 116,426 186,204 178,356 173,385 201,117 191,768 116,110 101,203 630 495 3,945 478 602 275 2,907,545 2,047,095 2,694,275 2,701,996 875,737 1,099,840 813,507 693,655
osa-miR166j-5p GAAUGACGUCCGGUCUGAAGA 21 9,744 406 1,535 2    610 666 933 604 875 1,203 851 649 1,535 848 371 469 0 2 3 6 31 29 30 29 0 0 0 0
osa-miR166k-3p UCGGACCAGGCUUCAAUCCCU 21 281,041 11,710 40,503 3    12,745 9,261 7,817 9,794 11,067 12,671 12,114 12,120 6,956 6,805 34 31 348 3 7 9 15,542 9,360 11,361 15,220 34,927 40,503 25,358 26,988
osa-miR166k-5p GGUUUGUUGUCUGGCUCGAGG 21 101 4 14 1    0 5 7 9 11 1 1 2 2 1 1 9 0 0 1 1 7 12 14 14 0 1 1 1
osa-miR166l-3p UCGGACCAGGCUUCAAUCCCU 21 281,041 11,710 40,503 3    12,745 9,261 7,817 9,794 11,067 12,671 12,114 12,120 6,956 6,805 34 31 348 3 7 9 15,542 9,360 11,361 15,220 34,927 40,503 25,358 26,988
osa-miR166l-5p GGAUUGUUGUCUGGUUCAAGG 21 189 8 69 1    0 0 0 0 0 0 0 8 0 1 4 69 0 0 0 0 0 0 1 0 30 23 27 26
osa-miR166m UCGGACCAGGCUUCAUUCCCU 21 9,925 414 1,147 1    561 515 377 526 408 377 536 517 437 291 2 1 16 1 0 0 1,147 1,017 1,089 970 286 353 264 234
osa-miR167a-3p AUCAUGCAUGACAGCCUCAUUU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR167a-5p UGAAGCUGCCAGCAUGAUCUA 21 24,767 1,032 3,521 48    531 1,036 2,407 457 1,134 2,843 1,308 891 1,176 454 93 76 2,316 1,116 3,521 1,389 80 48 68 104 1,051 959 899 810
osa-miR167b UGAAGCUGCCAGCAUGAUCUA 21 24,767 1,032 3,521 48    531 1,036 2,407 457 1,134 2,843 1,308 891 1,176 454 93 76 2,316 1,116 3,521 1,389 80 48 68 104 1,051 959 899 810
osa-miR167c-3p GGUCAUGCUGCGGCAGCCUCACU 23 117 5 44 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 27 16 29 44
osa-miR167c-5p UGAAGCUGCCAGCAUGAUCUA 21 24,767 1,032 3,521 48    531 1,036 2,407 457 1,134 2,843 1,308 891 1,176 454 93 76 2,316 1,116 3,521 1,389 80 48 68 104 1,051 959 899 810
osa-miR167d-3p GAUCAUGCUGUGCAGUUUCAUC 22 239 10 63 1    10 1 14 11 19 18 6 0 15 16 6 17 2 11 30 63 0 0 0 0 0 0 0 0
osa-miR167d-5p UGAAGCUGCCAGCAUGAUCUG 21 57,719 2,405 7,958 22    3,350 2,408 2,068 2,412 2,846 3,324 3,200 3,004 2,631 2,345 49 22 1,263 334 3,070 480 7,958 5,017 4,608 6,850 175 164 61 80
osa-miR167e-3p AGAUCAUGUUGCAGCUUCACU 21 1,460 61 215 10    54 19 14 11 38 36 30 14 12 10 33 39 54 70 42 48 193 101 85 86 168 215 46 42
osa-miR167e-5p UGAAGCUGCCAGCAUGAUCUG 21 57,719 2,405 7,958 22    3,350 2,408 2,068 2,412 2,846 3,324 3,200 3,004 2,631 2,345 49 22 1,263 334 3,070 480 7,958 5,017 4,608 6,850 175 164 61 80
osa-miR167f UGAAGCUGCCAGCAUGAUCUG 21 57,719 2,405 7,958 22    3,350 2,408 2,068 2,412 2,846 3,324 3,200 3,004 2,631 2,345 49 22 1,263 334 3,070 480 7,958 5,017 4,608 6,850 175 164 61 80
osa-miR167g UGAAGCUGCCAGCAUGAUCUG 21 57,719 2,405 7,958 22    3,350 2,408 2,068 2,412 2,846 3,324 3,200 3,004 2,631 2,345 49 22 1,263 334 3,070 480 7,958 5,017 4,608 6,850 175 164 61 80
osa-miR167h-3p AGGUCAUGCUGUAGUUUCAUC 21 5,962 248 949 7    476 410 611 449 471 949 609 378 626 337 127 130 7 10 14 13 28 36 40 13 94 68 41 25
osa-miR167h-5p UGAAGCUGCCAGCAUGAUCUG 21 57,719 2,405 7,958 22    3,350 2,408 2,068 2,412 2,846 3,324 3,200 3,004 2,631 2,345 49 22 1,263 334 3,070 480 7,958 5,017 4,608 6,850 175 164 61 80
osa-miR167i-3p AGAUCAUGUUGCAGCUUCACU 21 1,460 61 215 10    54 19 14 11 38 36 30 14 12 10 33 39 54 70 42 48 193 101 85 86 168 215 46 42
osa-miR167i-5p UGAAGCUGCCAGCAUGAUCUG 21 57,719 2,405 7,958 22    3,350 2,408 2,068 2,412 2,846 3,324 3,200 3,004 2,631 2,345 49 22 1,263 334 3,070 480 7,958 5,017 4,608 6,850 175 164 61 80
osa-miR167j UGAAGCUGCCAGCAUGAUCUG 21 57,719 2,405 7,958 22    3,350 2,408 2,068 2,412 2,846 3,324 3,200 3,004 2,631 2,345 49 22 1,263 334 3,070 480 7,958 5,017 4,608 6,850 175 164 61 80
osa-miR168a-3p GAUCCCGCCUUGCACCAAGUGAAU 24 11,506 479 1,271 2    657 678 745 850 663 514 1,219 581 445 315 11 12 2 60 38 44 1,271 610 818 960 299 278 208 228
osa-miR168a-5p UCGCUUGGUGCAGAUCGGGAC 21 475,350 19,806 55,625 1,550    39,603 23,239 27,616 22,465 29,515 44,563 55,625 40,741 27,006 17,007 5,516 8,464 7,297 2,492 1,550 1,567 9,752 7,065 8,217 9,804 25,230 27,110 15,727 18,179
osa-miR168b AGGCUUGGUGCAGCUCGGGAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR169a CAGCCAAGGAUGACUUGCCGA 21 830 35 306 1    19 22 23 16 13 21 38 7 11 11 40 58 31 92 306 119 0 0 1 1 0 0 0 1
osa-miR169b CAGCCAAGGAUGACUUGCCGG 21 1,017 42 307 1    6 1 17 11 14 28 12 22 10 6 248 307 263 10 32 13 0 0 0 1 7 0 3 6
osa-miR169c CAGCCAAGGAUGACUUGCCGG 21 1,017 42 307 1    6 1 17 11 14 28 12 22 10 6 248 307 263 10 32 13 0 0 0 1 7 0 3 6
osa-miR169d UAGCCAAGGAUGAAUUGCCGG 21 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0
osa-miR169e UAGCCAAGGAUGACUUGCCGG 21 35 1 5 1    1 5 4 2 4 4 0 3 0 1 1 4 0 3 0 2 0 1 0 0 0 0 0 0
osa-miR169f.1 UAGCCAAGGAUGACUUGCCUA 21 543 23 102 1    25 27 79 28 69 102 66 24 39 18 26 29 2 2 3 2 1 1 0 0 0 0 0 0
osa-miR169f.2 UGAGGACAAGAGCUGAUUCGG 21 171 7 23 1    6 5 3 23 19 15 13 14 7 16 14 5 11 2 0 1 3 2 4 5 0 1 2 0
osa-miR169g UAGCCAAGGAUGACUUGCCUA 21 543 23 102 1    25 27 79 28 69 102 66 24 39 18 26 29 2 2 3 2 1 1 0 0 0 0 0 0
osa-miR169h UAGCCAAGGAUGACUUGCCUG 21 5,283 220 905 13    334 401 556 266 555 905 456 364 592 308 13 18 0 43 135 30 45 36 40 24 37 51 38 36
osa-miR169i-3p UGAGUCGCUCUUAUCACUCAUG 22 512 21 78 1    32 25 30 29 48 57 78 25 46 25 14 8 9 1 0 1 10 6 1 13 19 8 14 13
osa-miR169i-5p.1 UAGCCAAGGAUGACUUGCCUG 21 5,283 220 905 13    334 401 556 266 555 905 456 364 592 308 13 18 0 43 135 30 45 36 40 24 37 51 38 36
osa-miR169i-5p.2 UGGUGAUAAGGGUGUAGCUCUG 22 149 6 40 1    2 5 6 5 10 17 40 14 28 10 4 4 0 1 1 1 0 0 0 0 0 0 1 0
osa-miR169j UAGCCAAGGAUGACUUGCCUG 21 5,283 220 905 13    334 401 556 266 555 905 456 364 592 308 13 18 0 43 135 30 45 36 40 24 37 51 38 36
osa-miR169k UAGCCAAGGAUGACUUGCCUG 21 5,283 220 905 13    334 401 556 266 555 905 456 364 592 308 13 18 0 43 135 30 45 36 40 24 37 51 38 36
osa-miR169l UAGCCAAGGAUGACUUGCCUG 21 5,283 220 905 13    334 401 556 266 555 905 456 364 592 308 13 18 0 43 135 30 45 36 40 24 37 51 38 36
osa-miR169m UAGCCAAGGAUGACUUGCCUG 21 5,283 220 905 13    334 401 556 266 555 905 456 364 592 308 13 18 0 43 135 30 45 36 40 24 37 51 38 36
osa-miR169n UAGCCAAGAAUGACUUGCCUA 21 1,100 46 203 1    78 57 106 79 111 203 107 97 143 59 26 6 22 1 3 2 0 0 0 0 0 0 0 0
osa-miR169o UAGCCAAGAAUGACUUGCCUA 21 1,100 46 203 1    78 57 106 79 111 203 107 97 143 59 26 6 22 1 3 2 0 0 0 0 0 0 0 0
osa-miR169p UAGCCAAGGACAAACUUGCCGG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR169q UAGCCAAGGAGACUGCCCAUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR169r-3p UGGCAAGUCUCCUCGGCUACC 21 558 23 108 1    38 22 45 51 63 108 50 39 65 44 0 0 0 4 1 1 0 6 13 7 0 0 1 0
osa-miR169r-5p UAGCCAAGGAUGAUUUGCCUG 21 123 5 31 1    4 4 9 10 11 7 13 22 31 1 1 1 2 0 0 0 1 2 3 0 1 0 0 0
osa-miR171a UGAUUGAGCCGCGCCAAUAUC 21 106 4 80 1    0 0 0 0 0 0 0 0 0 0 0 0 0 16 80 8 0 0 1 0 0 0 0 1
osa-miR171b UGAUUGAGCCGUGCCAAUAUC 21 4,188 175 426 13    119 99 261 234 231 273 199 119 234 140 65 13 16 63 393 54 55 48 30 42 426 367 370 337
osa-miR171c-3p UGAUUGAGCCGUGCCAAUAUC 21 4,188 175 426 13    119 99 261 234 231 273 199 119 234 140 65 13 16 63 393 54 55 48 30 42 426 367 370 337
osa-miR171c-5p GGAUAUUGGUGCGGUUCAAUC 21 61 3 30 1    0 1 0 0 2 4 0 0 0 0 0 2 0 30 6 10 0 2 1 0 0 0 1 2
osa-miR171d-3p UGAUUGAGCCGUGCCAAUAUC 21 4,188 175 426 13    119 99 261 234 231 273 199 119 234 140 65 13 16 63 393 54 55 48 30 42 426 367 370 337
osa-miR171d-5p UGUUGGCCCGGCUCACUCAGA 21 48 2 13 1    2 1 6 0 0 2 0 0 2 1 13 12 2 0 0 0 3 2 1 0 1 0 0 0
osa-miR171e-3p UGAUUGAGCCGUGCCAAUAUC 21 4,188 175 426 13    119 99 261 234 231 273 199 119 234 140 65 13 16 63 393 54 55 48 30 42 426 367 370 337
osa-miR171e-5p UGUUGGCUCGGCUCACUCAGA 21 496 21 150 1    0 0 1 0 1 3 2 0 2 3 39 37 4 0 1 0 1 0 3 1 78 49 121 150
osa-miR171f-3p UGAUUGAGCCGUGCCAAUAUC 21 4,188 175 426 13    119 99 261 234 231 273 199 119 234 140 65 13 16 63 393 54 55 48 30 42 426 367 370 337
osa-miR171f-5p UGUUGGCAUGGUUCAAUCAAA 21 69 3 36 1    0 0 0 0 0 2 0 0 0 0 21 36 9 1 0 0 0 0 0 0 0 0 0 0
osa-miR171g GAGGUGAGCCGAGCCAAUAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR171h GUGAGCCGAACCAAUAUCACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR171i-3p GGAUUGAGCCGCGUCAAUAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR171i-5p AGGUAUUGGCGUGCCUCAAUC 21 19 1 7 1    0 0 0 2 0 0 0 0 0 0 0 1 0 1 7 7 0 0 0 0 0 0 1 0
osa-miR172a AGAAUCUUGAUGAUGCUGCAU 21 6,144 256 3,234 4    13 4 14 31 17 41 23 8 39 6 105 34 107 701 3,234 1,740 9 6 4 8 0 0 0 0
osa-miR172b GGAAUCUUGAUGAUGCUGCAU 21 41 2 20 1    0 0 0 0 0 0 0 2 0 0 1 0 0 2 20 15 0 1 0 0 0 0 0 0
osa-miR172c UGAAUCUUGAUGAUGCUGCAC 21 44 2 13 1    0 4 0 0 0 3 8 7 0 0 1 0 2 3 13 2 1 0 0 0 0 0 0 0
osa-miR172d-3p AGAAUCUUGAUGAUGCUGCAU 21 6,144 256 3,234 4    13 4 14 31 17 41 23 8 39 6 105 34 107 701 3,234 1,740 9 6 4 8 0 0 0 0
osa-miR172d-5p GCAGCACCAUCAAGAUUCAC 20 78 3 37 1    0 0 0 4 0 3 0 3 0 0 1 1 0 21 8 37 0 0 0 0 0 0 0 0
osa-miR1846a-3p UGACCCCGUUCUCCUCGCCGG 21 205 9 37 1    1 4 6 0 0 0 2 0 2 0 2 2 0 0 0 0 14 10 18 9 29 35 37 34
osa-miR1846a-5p AGUGAGGAGGCCGGGGCCGCU 21 404 17 122 1    0 0 4 1 0 0 0 0 0 0 0 1 0 1 0 0 0 2 1 2 122 122 74 74
osa-miR1846b-3p UGACCCCGUUCUCCUCGCCGG 21 205 9 37 1    1 4 6 0 0 0 2 0 2 0 2 2 0 0 0 0 14 10 18 9 29 35 37 34
osa-miR1846b-5p AGUGAGGAGGCCGGGGCCGCU 21 404 17 122 1    0 0 4 1 0 0 0 0 0 0 0 1 0 1 0 0 0 2 1 2 122 122 74 74
osa-miR1846c-3p UGACCCCGGUCUGCUCGCUGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1846c-5p AGUGAGGAGGCCGGGGCCGCU 21 404 17 122 1    0 0 4 1 0 0 0 0 0 0 0 1 0 1 0 0 0 2 1 2 122 122 74 74
osa-miR1846d-3p UAUCCGGCGCCGCAGGGAGG 20 31 1 5 1    2 5 0 1 2 3 3 2 2 0 2 1 0 3 0 1 1 1 0 1 0 0 1 0
osa-miR1846d-5p UCCCACCGAGCAGCCGGAUCUC 22 250 10 37 1    7 1 1 6 13 3 5 3 0 1 1 0 0 0 0 0 28 20 37 20 37 27 20 20
osa-miR1846e CAACGAGGAGGCCGGGACCA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1847.1 UGCAGUUUGCAGUUGUGGCAC 21 47 2 6 1    1 0 0 0 5 2 5 0 5 1 0 0 0 0 0 0 6 1 4 4 1 4 3 5
osa-miR1847.2 UGGCCCACAUGUUAGUGCCACAAC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1848 CCUCGCCGGCGCGCGCGUGCA 21 31 1 9 1    0 0 0 0 0 3 0 0 0 0 0 0 0 2 1 0 0 0 1 0 6 9 3 6
osa-miR1849 UAUCGUAUCCUAGGUUGGUUU 21 304 13 36 1    27 17 23 24 15 36 23 14 24 14 1 1 0 0 0 0 13 19 18 13 4 7 7 4
osa-miR1850.1 UGGAAAGUUGGGAGAUUGGGG 21 837 35 177 2    24 34 60 31 44 52 40 36 105 20 177 116 22 22 21 18 0 0 0 0 6 4 2 3
osa-miR1850.2 UUGUGUGUGAACUAAACGUGG 21 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0
osa-miR1850.3 CUGUUUAGUUCACAUCAAUCUU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1851 CGUCUGGGAUGGCAUUUUGGC 21 15 1 4 1    0 0 1 4 0 0 0 0 2 3 0 0 0 0 0 0 0 1 0 3 0 0 1 0
osa-miR1852 AUAUGGAUUCAGAAUGCAGGU 21 5 0 3 2    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 2 0 0 0 0
osa-miR1853-3p UAAUUGGGGAUGUUCGGUUGCU 22 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0
osa-miR1853-5p AGCAUUCAAACAUUCCCAAUUACC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1854-3p UCCAAUUUGGGGAUUUGCUGAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1854-5p UGGUGAAAUUUGUAGAUUGGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1855 AGCACUGGAGUAGCCAAGAGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1856 UAUGCGUAAGACGGAUUCGUA 21 2,100 88 361 7    60 43 99 93 151 115 90 149 160 140 7 7 31 0 0 0 361 265 129 200 0 0 0 0
osa-miR1857-3p UCAUGCUCCAAGAAAACCAGG 21 158 7 26 1    8 9 11 18 21 15 26 12 9 7 3 2 0 1 1 0 1 2 4 1 1 3 1 2
osa-miR1857-5p UGGUUUUUUUGGAGCAUGAGG 21 20 1 5 1    0 0 0 0 2 2 3 0 5 0 1 1 4 0 1 0 0 0 1 0 0 0 0 0
osa-miR1858a GAGAGGAGGACGGAGUGGGGC 21 3 0 3 3    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 0 0
osa-miR1858b GAGAGGAGGACGGAGUGGGGC 21 3 0 3 3    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 0 0
osa-miR1859 UUUCCUAUGACGUCCAUUCCAA 22 445 19 113 1    2 10 9 1 1 18 8 8 1 0 0 0 18 2 1 4 99 31 113 69 6 9 17 18
osa-miR1860-3p AUCUGGAAGCUAGGUUUUCUCU 22 209 9 48 1    0 0 1 0 2 5 0 2 6 0 0 1 0 0 0 1 17 12 10 12 40 48 23 29
osa-miR1860-5p AGAAAACCAGCUUCCAGAUCU 21 20 1 5 1    0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 1 2 4 5 1 5
osa-miR1861a UGAUCUUGAGGCAGAAACUGAG 22 9 0 5 1    0 0 0 0 0 0 0 0 0 0 1 5 0 1 1 1 0 0 0 0 0 0 0 0
osa-miR1861b CGAUCUUGAGGCAGGAACUGAG 22 15 1 7 1    0 0 0 7 1 0 0 0 0 0 3 0 0 0 0 0 0 0 3 0 0 0 1 0
osa-miR1861c CGAUCUUGUAGCAAGAACUGAG 22 4 0 2 2    0 0 0 0 2 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1861d UGGUCUUGAGGCAGGAACUGAG 22 2 0 2 2    0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1861e CGGUCUUGUGGCAAGAACUGAG 22 49 2 38 1    0 0 0 0 0 0 0 0 0 0 38 5 0 0 0 0 0 1 0 0 0 0 1 4
osa-miR1861f CGAUCUUGAGGCAGGAACUGAG 22 15 1 7 1    0 0 0 7 1 0 0 0 0 0 3 0 0 0 0 0 0 0 3 0 0 0 1 0
osa-miR1861g CAGUCUUGUGGCAAGAACUGAG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1861h CGGUCUUGAGGCAGGAACUGAG 22 21 1 9 1    0 0 1 9 2 0 0 0 0 0 0 1 0 0 0 0 0 2 0 0 1 0 3 2
osa-miR1861i CGAUCUUGAGGCAGGAACUGAG 22 15 1 7 1    0 0 0 7 1 0 0 0 0 0 3 0 0 0 0 0 0 0 3 0 0 0 1 0
osa-miR1861j CGGUCUUGAGGCAGGAACUGAG 22 21 1 9 1    0 0 1 9 2 0 0 0 0 0 0 1 0 0 0 0 0 2 0 0 1 0 3 2
osa-miR1861k CGGUCUUGUGGCAAGAACUGAG 22 49 2 38 1    0 0 0 0 0 0 0 0 0 0 38 5 0 0 0 0 0 1 0 0 0 0 1 4
osa-miR1861l CGAUCUUGAGGCAGGAACUGAG 22 15 1 7 1    0 0 0 7 1 0 0 0 0 0 3 0 0 0 0 0 0 0 3 0 0 0 1 0
osa-miR1861m CGGUCUUGUGGCAAGAACUGAG 22 49 2 38 1    0 0 0 0 0 0 0 0 0 0 38 5 0 0 0 0 0 1 0 0 0 0 1 4
osa-miR1861n CGAUCUUGUGGCAGGAGCUGAG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1861o UGAUCUUGAGGCAGAAACUGAG 22 9 0 5 1    0 0 0 0 0 0 0 0 0 0 1 5 0 1 1 1 0 0 0 0 0 0 0 0
osa-miR1862a ACGAGGUUGGUUUAUUUUGGGACG 24 19,132 797 2,890 1    523 682 658 827 608 702 567 644 1,148 658 1 1 0 5 6 4 2,062 1,899 2,890 1,030 846 863 1,313 1,195
osa-miR1862b ACGAGGUUGGUUUAUUUUGGGACG 24 19,132 797 2,890 1    523 682 658 827 608 702 567 644 1,148 658 1 1 0 5 6 4 2,062 1,899 2,890 1,030 846 863 1,313 1,195
osa-miR1862c ACGAGGUUGGUUUAUUUUGGGACG 24 19,132 797 2,890 1    523 682 658 827 608 702 567 644 1,148 658 1 1 0 5 6 4 2,062 1,899 2,890 1,030 846 863 1,313 1,195
osa-miR1862d ACUAGGUUUGUUUAUUUUGGGACG 24 23,784 991 2,029 21    1,377 1,128 1,576 1,324 1,483 1,826 1,549 1,463 2,029 1,424 28 37 38 54 24 21 827 1,821 1,881 1,058 577 515 983 741
osa-miR1862e CUAGAUUUGUUUAUUUUGGGACGG 24 3,150 131 405 1    109 106 133 93 150 124 126 127 199 86 1 1 4 1 7 3 118 211 191 157 266 225 405 307
osa-miR1862f AUGAGGUUGGUUUAUUUUGG 20 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1862g AUGAGGUUGGUUUAUUUUGG 20 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1863a AGCUCUGAUACCAUGUUAGAUUAG 24 1,153 48 173 1    24 25 28 39 35 43 44 17 43 1 173 156 89 44 34 35 26 21 21 23 61 66 53 52
osa-miR1863b AGCUCUGAUACCAUGUUAACUGUU 24 292 12 46 1    5 8 11 3 19 17 5 2 4 3 1 3 4 0 0 0 14 14 10 7 46 40 40 36
osa-miR1863b.2 AGAGACUUGGCUGAUGCAUUACU 23 110 5 22 1    0 0 3 1 0 2 0 2 0 0 0 1 0 2 1 0 10 10 4 4 16 14 22 18
osa-miR1863c UAGAAACUUGGCUGAUGCAUUACU 24 178 7 20 1    2 5 9 5 11 11 2 7 0 0 1 4 0 3 8 14 9 6 7 18 20 14 9 13
osa-miR1864 UUGUAGUAACGUGAUGGUCAAUGU 24 52 2 14 1    0 5 1 2 0 0 0 0 4 0 0 0 0 0 0 0 0 0 0 0 14 7 10 9
osa-miR1865-3p CGAAGAAUCGCAGUCACUAGUUGU 24 145 6 29 1    2 1 10 4 10 2 3 3 1 3 0 0 0 0 0 0 7 10 8 2 29 20 14 16
osa-miR1865-5p UGCUAGUGAUGGUGAUUCUUCGAC 24 257 11 40 1    5 26 6 12 23 7 13 10 17 16 0 0 0 1 0 0 40 26 21 15 2 4 5 8
osa-miR1866-3p UGAAAUUCCUGUAAAAUUCUUG 22 269 11 116 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 84 68 116 1 0 0 0 0
osa-miR1866-5p GAGGGAUUUUGCGGGAAUUUCACG 24 263 11 202 9    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 9 52 202 0 0 0 0 0
osa-miR1868 UCACGGAAAACGAGGGAGCAGCCA 24 166 7 29 1    11 3 1 7 7 3 0 5 1 0 1 2 0 2 1 0 6 11 20 3 15 10 29 28
osa-miR1869 UGAGAACAAUAGGCAUGGGAGGUA 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1870-3p UUUAGGGCUAAUUCAGCAUGAACA 24 106 4 12 1    5 3 6 9 7 11 12 3 4 6 2 7 0 1 1 2 1 2 0 0 4 8 5 7
osa-miR1870-5p UGCUGAAUUAGACCUAGUGGGCAU 24 74 3 13 1    0 4 4 5 11 1 2 0 0 0 3 8 0 1 0 0 0 1 0 0 10 8 13 3
osa-miR1871 AUGGCUCUGAUAUCAUGUUGGUUU 24 11,194 466 1,468 21    424 351 262 492 505 507 430 389 250 175 41 65 98 34 73 21 1,468 847 756 818 879 960 699 650
osa-miR1872 GAACUGUAAGUCUGUGACGGGUAA 24 2 0 1 1    0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0
osa-miR1873 UCAACAUGGUAUCAGAGCUGGAAG 24 144 6 18 1    1 5 9 6 2 2 8 2 5 3 1 6 13 0 0 0 7 2 7 5 14 12 16 18
osa-miR1874-3p UAUGGAUGGAGGUGUAACCCGAUG 24 3,200 133 1,664 2    0 0 3 5 26 0 2 0 0 0 2 8 4 11 10 2 342 504 1,664 21 178 113 164 141
osa-miR1874-5p UAGGGCUACUACACCAUCCAUAAG 24 1,618 67 607 1    2 5 0 33 23 1 10 0 2 0 3 2 0 2 3 2 325 215 607 33 112 95 77 66
osa-miR1875 ACAAUGGAGUGAAGUGCAACAGAA 24 8 0 4 1    0 0 0 0 0 1 0 0 0 0 0 1 0 0 0 0 0 0 0 0 4 1 1 0
osa-miR1876 AUAAGUGGGUUUGUGGGCUGGCCC 24 56,084 2,337 5,930 9    2,729 1,759 1,953 1,615 2,199 2,865 2,873 2,869 3,196 2,076 32 99 9 73 58 28 3,227 3,504 4,927 2,494 3,434 3,127 5,008 5,930
osa-miR1877 AGAUGACAUGUGAAUGAUGAGGGG 24 3,156 132 1,446 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 918 788 1,446 3 0 0 1 0
osa-miR1878 ACUUAAUCUGGACACUAUAAAAGA 24 3,793 158 332 4    113 141 148 226 146 173 141 139 165 89 10 8 7 6 4 4 260 282 211 294 332 315 281 298
osa-miR1879 GUGUUUGGUUUAGGGAUGAGGUGG 24 181 8 25 1    0 9 1 11 1 20 1 7 10 4 5 6 0 10 7 9 6 25 18 8 5 7 5 6
osa-miR1880 UUCCAAGCGGGCCACUUAAGCAUU 24 187 8 38 2    6 12 11 13 15 2 10 14 4 18 0 0 0 0 0 0 38 10 31 3 0 0 0 0
osa-miR1881 AAUGUUAUUGUAGCGUGGUGGUGU 24 125 5 24 1    2 0 0 0 1 0 0 0 0 0 0 0 0 5 3 2 20 4 24 24 6 12 12 10
osa-miR1882a AGAUUGCUUUCAAGGUCAUUUCUU 24 339 14 70 1    17 27 37 28 44 70 37 25 23 6 0 1 20 2 1 1 0 0 0 0 0 0 0 0
osa-miR1882b AGAUUGCUUUCAAGGUCAUUUCUU 24 339 14 70 1    17 27 37 28 44 70 37 25 23 6 0 1 20 2 1 1 0 0 0 0 0 0 0 0
osa-miR1882c AGAUUGCUUUCAAGGUCAUUUCUU 24 339 14 70 1    17 27 37 28 44 70 37 25 23 6 0 1 20 2 1 1 0 0 0 0 0 0 0 0
osa-miR1882d AGAUUGCUUUCAAGGUCAUUUCUU 24 339 14 70 1    17 27 37 28 44 70 37 25 23 6 0 1 20 2 1 1 0 0 0 0 0 0 0 0
osa-miR1882e-3p GAAAUGAUCUUGGACGUAAUCUAG 24 70,155 2,923 8,554 1    6,505 7,794 7,665 7,753 5,983 6,858 8,238 5,340 8,554 5,458 0 2 4 0 0 0 0 0 0 0 0 0 1 0
osa-miR1882e-5p AGAUUGCUUUCAAGGUCAUUUCUU 24 339 14 70 1    17 27 37 28 44 70 37 25 23 6 0 1 20 2 1 1 0 0 0 0 0 0 0 0
osa-miR1882f AGAUUGCUUUCAAGGUCAUUUCUU 24 339 14 70 1    17 27 37 28 44 70 37 25 23 6 0 1 20 2 1 1 0 0 0 0 0 0 0 0
osa-miR1882g AGAUUGCUUUCAAGGUCAUUUCUU 24 339 14 70 1    17 27 37 28 44 70 37 25 23 6 0 1 20 2 1 1 0 0 0 0 0 0 0 0
osa-miR1882h AGAUUGCUUUCAAGGUCAUUUCUU 24 339 14 70 1    17 27 37 28 44 70 37 25 23 6 0 1 20 2 1 1 0 0 0 0 0 0 0 0
osa-miR1883a ACCUGUGACGGGCCGAGAAUGGAA 24 531 22 129 1    3 6 13 13 23 18 4 8 18 10 0 1 7 0 0 2 18 20 13 11 57 57 129 100
osa-miR1883b ACCUGUGACGGGCCGAGAAUGGAA 24 531 22 129 1    3 6 13 13 23 18 4 8 18 10 0 1 7 0 0 2 18 20 13 11 57 57 129 100
osa-miR2055 UUUCCUUGGGAAGGUGGUUUC 21 100 4 15 1    15 1 3 0 4 3 4 5 2 3 0 0 0 2 3 0 6 2 7 3 12 8 8 9
osa-miR2090 AACUCUGAUUCUAGAAUUUUUG 22 11 0 4 1    0 0 0 3 0 0 0 0 0 0 1 0 0 0 0 0 0 4 1 1 1 0 0 0
osa-miR2091-3p CAUACAUUGCCUCCUAGGCUUG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2091-5p UCAACCGAGCCGAGGAGGAGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2092-3p ACCAGCAUUCCAUUGGCAGAGG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2092-5p CAACUGAAGUCGGUGUUUACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2093-3p ACAUCUUCCAAUUAAUGCAU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2093-5p GUGCAUUAAUUGGAAGAACA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2094-3p CAGAGCUGUGGCAUCCACGUCG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2094-5p UGGCUGCUAGGCUCCUGGGUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2095-3p CUUCCAUUUAUGAUAAGUAU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2095-5p CUGAUAAUUUUACGAUGAAUAG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2096-3p CCUGAGGGGAAAUCGGCGGGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2096-5p UGCCGAUUUCCCCCUCGGGCG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2097-3p UUCUCUUCUUCGUGUCGCAUUU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2097-5p AGAGAUGGGACGGGCAGGGAAG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2098-3p CGGUUUGUCAAGCGGAGUGC 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2098-5p UCCCGUGGAGGCAGCCGAUG 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2099-3p ACAAAGCUGUAGCGUUAUUC 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2099-5p UGAAUAUGUUUGUACAAGCUUU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2100-3p AACCGCUGUUUAGGCGGAGUGG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2100-5p UUCUCUCAAGUUGCCAAACAAG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2101-3p AUUUAACUCAAGUGAGCAUUGU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2101-5p ACAUGUUUACAAGUUAAAAUGU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2102-3p CAUGGUGCCGGUUCCGGUGGCG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2102-5p GGGCAAGCCGCCGCCGCCAC 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2103 UUUCCCUCUCCGUGCGCGCUCG 22 31 1 4 1    4 4 3 2 0 3 0 0 0 3 0 0 0 0 0 0 4 4 3 1 0 0 0 0
osa-miR2104 GCGGCGAGGGGAUGCGAGCGUG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2105 UUGUGAUGUGAAUGAUUCAU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2106 CCGAGGUUUUCUGGAUACAUU 21 15 1 4 3    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 4 4 3
osa-miR2118a UUCUCGAUGCCUCCCAUUCCUA 22 3 0 1 1    0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 0
osa-miR2118b UUCCCGAUGCCUCCCAUUCCUA 22 644 27 117 1    57 75 61 83 45 117 53 30 35 30 0 0 0 3 3 1 27 5 6 13 0 0 0 0
osa-miR2118c UUCCCGAUGCCUCCUAUUCCUA 22 45 2 16 1    0 0 0 0 2 0 1 0 0 7 0 0 0 3 4 1 4 0 4 16 1 0 2 0
osa-miR2118d UUCCUGAUGCCUCCCAUGCCUA 22 7 0 2 1    0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 2 1 2 0 0 0 0
osa-miR2118e UUCCCAAUGCCUCCCAUGCCUA 22 227 9 36 1    1 3 11 8 20 17 14 7 2 10 0 0 2 1 1 2 7 2 1 3 25 34 20 36
osa-miR2118f UUCCUGAUGCCUCCCAUUCCUA 22 28 1 14 1    0 0 0 1 0 0 0 0 0 0 0 0 0 1 3 6 1 1 1 14 0 0 0 0
osa-miR2118g UUCCUAAUGCCUCCCAUUCCUA 22 5 0 3 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 3 1 0 0 0 0
osa-miR2118h UUCCUGAUGCCUCUCAUUCCUA 22 10 0 4 1    0 0 0 0 0 0 0 0 0 0 0 0 0 3 1 2 0 0 0 4 0 0 0 0
osa-miR2118i UUCCUAGUGCCUCCCAUUCCUA 22 4 0 4 4    0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 0 0 0 0 0 0 0 0 0
osa-miR2118j UUCCUGAUGCCUCCCAUUCCUA 22 28 1 14 1    0 0 0 1 0 0 0 0 0 0 0 0 0 1 3 6 1 1 1 14 0 0 0 0
osa-miR2118k UUCCUGAUGCCUCUCAUUCCUA 22 10 0 4 1    0 0 0 0 0 0 0 0 0 0 0 0 0 3 1 2 0 0 0 4 0 0 0 0
osa-miR2118l UUCCUAAUGCUUCCCAUUCCUA 22 6 0 2 1    0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 1 1 0 1 0 0 0 1 0
osa-miR2118m UUCCUGAUGCCUCCCAUUCCUA 22 28 1 14 1    0 0 0 1 0 0 0 0 0 0 0 0 0 1 3 6 1 1 1 14 0 0 0 0
osa-miR2118n UUCCCGAUGCCUCCCAUUCCUA 22 644 27 117 1    57 75 61 83 45 117 53 30 35 30 0 0 0 3 3 1 27 5 6 13 0 0 0 0
osa-miR2118o CUCCUGAUGCCUCCCAAGCCUA 22 1,563 65 315 1    100 117 149 142 212 315 170 137 148 44 0 0 0 0 0 0 7 1 1 20 0 0 0 0
osa-miR2118p UUCCCGAUGCCUCCCAUGCCUA 22 6 0 2 1    0 0 0 0 0 1 0 0 1 0 0 0 0 0 1 1 0 0 0 2 0 0 0 0
osa-miR2118q UUCCCGAUGCCUCCUAUUCCUA 22 45 2 16 1    0 0 0 0 2 0 1 0 0 7 0 0 0 3 4 1 4 0 4 16 1 0 2 0
osa-miR2118r UUCCCAAUGCCUCCCAUGCCUA 22 227 9 36 1    1 3 11 8 20 17 14 7 2 10 0 0 2 1 1 2 7 2 1 3 25 34 20 36
osa-miR2120 AAAGAUCUUUAGUCCCGGUUGUUC 24 3 0 2 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 0
osa-miR2120b-3p UUUAGUCGCGGUUGGUGUUA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2120b-5p ACACCAACCGCGACUAAAGA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2121a AAAACGGAGCGGUCCAUUAGCGCG 24 77 3 12 1    0 0 0 0 2 3 1 0 10 0 2 1 0 7 1 1 7 12 4 2 5 5 4 10
osa-miR2121b AAAACGGAGCGGUCCAUUAGCGCG 24 77 3 12 1    0 0 0 0 2 3 1 0 10 0 2 1 0 7 1 1 7 12 4 2 5 5 4 10
osa-miR2122 UUUCAAAAAUAACCUUUUGUUC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2275a UUUGGUUUCCUCCAAUAUCUCA 22 3 0 2 1    0 0 0 0 0 0 0 0 0 0 0 1 2 0 0 0 0 0 0 0 0 0 0 0
osa-miR2275b UUUGGUUUCCUCCAAUAUCUCA 22 3 0 2 1    0 0 0 0 0 0 0 0 0 0 0 1 2 0 0 0 0 0 0 0 0 0 0 0
osa-miR2275c AGAAUUGGAGGAAAACAAACUGA 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2275d CUUGUUUUUCUCCAAUAUCUCA 22 87 4 38 1    3 3 0 0 0 0 9 2 2 3 0 1 0 2 0 0 4 2 18 38 0 0 0 0
osa-miR2863a UUGUCCCAUUCUAGUUUAGCU 21 87 4 11 1    5 8 4 9 2 10 8 0 0 3 0 0 2 0 0 0 11 5 10 9 0 0 0 1
osa-miR2863b UUCGUUUAUUUGGACUAGAGU 21 152 6 22 1    2 5 7 17 5 3 5 0 5 1 1 1 2 0 0 0 6 22 17 16 7 10 11 9
osa-miR2863c UUAGUAGGACUAGAAUGGGCCAAA 24 377 16 83 1    0 8 1 7 10 6 6 12 5 8 1 2 13 0 0 0 3 2 3 10 83 79 53 65
osa-miR2864.1 UUUUGCUGCCCUUGUUUUGCA 21 101 4 17 1    17 1 4 8 8 16 15 17 1 1 2 3 4 1 0 0 1 0 1 0 0 0 1 0
osa-miR2864.2 UUGUUUUGCAUUGUAUAGGUA 21 220 9 33 1    7 1 21 13 5 20 14 8 12 6 4 3 33 0 0 1 18 17 11 16 2 3 2 3
osa-miR2865 CUCAGCAGUCGACUGUACCGUG 22 29 1 6 2    2 0 4 3 4 5 6 3 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0
osa-miR2866 UCUAGUUUGUGUUCAGCAUC 20 10 0 2 1    1 0 0 0 2 0 0 2 0 0 0 0 0 0 0 0 0 1 0 2 1 1 0 0
osa-miR2867-3p CCAGGACGUGUGGGAUGGCA 20 184 8 38 1    16 12 9 9 2 38 15 7 26 20 0 0 2 0 3 0 1 6 10 5 1 0 1 1
osa-miR2867-5p UGUGCCAUCCCACACAUCCCGA 22 3 0 2 1    0 1 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2868 UUGGUUUUGUGUAGUAGAAA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2869 UCCCGACAUUAAAUUCUGGGC 21 79 3 14 1    8 10 1 9 5 6 14 7 6 0 3 0 2 0 1 0 0 0 0 0 5 0 1 1
osa-miR2870 UAAUCAGUUUGGGGAGACAAA 21 50 2 14 1    1 0 3 0 0 0 13 14 1 1 1 5 0 0 1 0 1 0 3 0 1 4 1 0
osa-miR2871a-3p UAUUUUAGUUUCUAUGGUCAC 21 4,849 202 454 3    264 268 397 265 337 454 377 281 255 182 10 7 163 3 4 3 216 239 123 234 226 225 160 156
osa-miR2871a-5p GACCGUAGAAACUAGCAUAGAAAA 24 453 19 45 10    26 26 24 38 31 32 13 42 10 10 0 0 0 0 0 0 45 19 21 18 21 38 19 20
osa-miR2871b-3p UAUUUUAGUUUCUAUGGUCAC 21 4,849 202 454 3    264 268 397 265 337 454 377 281 255 182 10 7 163 3 4 3 216 239 123 234 226 225 160 156
osa-miR2871b-5p CAUGGUGACCGUAGAAACUAACAU 24 12 1 4 1    0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 1 4 2
osa-miR2872 UGGGGUUCUACAAACCGAACU 21 6 0 3 1    0 0 0 0 0 0 0 0 0 0 1 3 2 0 0 0 0 0 0 0 0 0 0 0
osa-miR2873a AAGUUUGGACUUAAAUUUGGUAAC 24 15,844 660 2,115 2    1,490 1,128 1,024 1,153 1,133 926 1,098 662 625 377 6 4 4 3 0 2 2,115 1,391 1,504 1,199 0 0 0 0
osa-miR2873b UUGGACUUGAGAUUUGGUAUG 21 127 5 13 1    7 13 4 3 6 3 2 10 11 10 0 1 2 0 0 0 9 9 13 8 6 4 2 4
osa-miR2873c CAAAUGAAGUUGAGUUUGGAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2874 AUGUGAACAGUGUCAAACAGUGUC 24 67 3 12 1    1 0 4 2 2 5 0 0 1 10 3 1 2 0 1 1 0 0 3 2 7 3 12 7
osa-miR2875 AUUUACAGUCAUAUACAGUUUAUA 24 12 1 5 3    0 0 0 0 0 3 0 5 0 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2876-3p UUCCUAUAUGAACACUGUUGC 21 173 7 31 1    13 6 1 3 1 13 3 19 7 17 0 0 0 0 0 0 24 15 14 31 0 0 3 3
osa-miR2876-5p AAUUGCUGGCAGCACUGUUUA 21 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0
osa-miR2877 UUGCAUCCUCUGCACUUUGGGCCU 24 64,523 2,688 9,003 1    4,418 2,006 1,268 2,291 2,333 1,671 3,094 3,443 1,572 1,744 1 1 0 3 1 0 7,785 6,981 9,003 7,491 1,556 1,564 3,029 3,268
osa-miR2878-3p CAGGAUUUUAUACAUGUAAAGAAU 24 168 7 24 1    16 5 14 16 12 23 14 12 24 4 0 1 0 0 0 0 3 1 10 1 2 3 3 4
osa-miR2878-5p UACAUGUAUAAAAUUCUGAGGAUG 24 2,754 115 279 1    143 131 162 189 251 216 194 110 142 49 7 8 2 1 3 6 279 257 217 195 51 42 51 48
osa-miR2879 GCCAGAUGUGUUAAAAUAAUGACC 24 314 13 57 1    0 12 3 8 14 12 6 7 0 1 0 0 0 1 1 0 57 27 23 41 16 29 30 26
osa-miR2880 ACGGUAUCCCGUUCGGACAGGAUG 24 4,263 178 379 3    262 246 244 260 284 333 254 271 271 233 0 0 0 0 3 0 270 379 375 275 60 64 83 96
osa-miR2905 UACAUGUCAGUGACAAAGGCA 21 32 1 7 1    2 1 0 3 0 0 0 0 1 0 0 1 7 0 0 0 0 0 1 3 2 3 7 1
osa-miR2907a GGCAGCCGAGCGAGGGCCUCGG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2907b GGCAGCCGAGCGAGGGCCUCGG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2907c GGCAGCCGAGCGAGGGCCUCGG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2907d GGCAGCCGAGCGAGGGCCUCGG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2918 AUCCGUGUUGUCUGCGCUUUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2919 AAGGGGGGGGGGGGAAAGA 19 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2920 AAACAACAAUAUAACAUUUCAAA 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2921 AAGAACUUAAUAUAACUUUAAAGC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2922 AAUAAGUGAUUACCGAAAUU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2923 AGACAAAAAUAUAAAUAACAAA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2924 CUCGCUUGCUCCGGCCGCCAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2925 UGGCGGCCGCGGGCUUCGU 19 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2926 AGGUCGUCGACGUUGGUGCU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2927 UGUCGUCGUCGAUGGAGCCCAUG 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2928 AAGAAGACGACAUUUUGUUG 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2929 CUCAAGGGUGUUUGUGAAAUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2930 UUCUCUUCUCUCGCGCGUGGCC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2931 CUUUAUUGUUGAUGUCAAAA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR2932 AGUAUGCCCACUACCUAUC 19 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR319a-3p ACUGGAUGACGCGGGAGCUAA 21 1,472 61 493 1    2 0 0 0 0 0 0 0 0 0 0 0 0 5 10 14 0 1 1 0 266 250 493 430
osa-miR319a-3p.2-3p UUGGACUGAAGGGUGCUCCC 20 179,493 7,479 50,838 5    57 27 31 44 56 44 42 32 52 63 5 5 0 8 11 6 200 152 419 163 37,252 42,884 47,102 50,838
osa-miR319a-5p AGCUGCCGAAUCAUCCAUUCA 21 113 5 40 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 24 40 22 26
osa-miR319b UUGGACUGAAGGGUGCUCCC 20 179,493 7,479 50,838 5    57 27 31 44 56 44 42 32 52 63 5 5 0 8 11 6 200 152 419 163 37,252 42,884 47,102 50,838
osa-miR390-3p CGCUAUCUAUCCUGAGCUCC 20 1,187 49 531 1    5 0 9 24 29 22 1 12 39 13 1 1 0 16 6 4 1 0 0 2 2 3 531 466
osa-miR390-5p AAGCUCAGGAGGGAUAGCGCC 21 11,856 494 4,592 1    107 67 125 212 218 144 83 125 185 165 3 4 0 74 130 114 288 189 207 231 12 1 4,592 4,580
osa-miR393a UCCAAAGGGAUCGCAUUGAUC 21 17,262 719 1,926 7    1,101 1,028 1,688 937 1,474 1,926 1,308 904 1,459 1,688 14 207 7 17 35 14 448 862 719 1,204 62 65 42 53
osa-miR393b-3p UCAGUGCAAUCCCUUUGGAAU 21 7,228 301 945 12    397 248 377 356 601 558 324 222 309 302 256 161 286 16 24 20 703 545 477 945 25 47 17 12
osa-miR393b-5p UCCAAAGGGAUCGCAUUGAUCU 22 355 15 38 1    25 12 23 23 26 38 25 12 34 21 0 5 0 3 1 0 7 25 16 20 11 10 9 9
osa-miR394 UUGGCAUUCUGUCCACCUCC 20 4,009 167 536 1    127 176 186 164 144 261 263 152 206 114 7 2 16 8 10 1 24 32 169 153 472 536 312 474
osa-miR395a GUGAAGUGCUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR395b GUGAAGUGUUUGGGGGAACUC 21 3 0 2 1    0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0
osa-miR395c GUGAAGUGUUUGGAGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR395d GUGAAGUGUUUGGGGGAACUC 21 3 0 2 1    0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0
osa-miR395e GUGAAGUGUUUGGGGGAACUC 21 3 0 2 1    0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0
osa-miR395f GUGAAUUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR395g GUGAAGUGUUUGGGGGAACUC 21 3 0 2 1    0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0
osa-miR395h GUGAAGUGUUUGGGGGAACUC 21 3 0 2 1    0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0
osa-miR395i GUGAAGUGUUUGGGGGAACUC 21 3 0 2 1    0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0
osa-miR395j GUGAAGUGUUUGGGGGAACUC 21 3 0 2 1    0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0
osa-miR395k GUGAAGUGUUUGGGGGAACUC 21 3 0 2 1    0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0
osa-miR395l GUGAAGUGUUUGGGGGAACUC 21 3 0 2 1    0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0
osa-miR395m GUGAAGUGUUUGGGGGAACUC 21 3 0 2 1    0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0
osa-miR395n GUGAAGUGUUUGGGGGAACUC 21 3 0 2 1    0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0
osa-miR395o AUGAAGUGUUUGGAGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR395p GUGAAGUGUUUGGGGGAACUC 21 3 0 2 1    0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0
osa-miR395q GUGAAGUGUUUGGGGGAACUC 21 3 0 2 1    0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0
osa-miR395r GUGAAGUGUUUGGGGGAACUC 21 3 0 2 1    0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0
osa-miR395s GUGAAGUGUUUGGGGGAACUC 21 3 0 2 1    0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0
osa-miR395t GUGAAGUGUUUGGGGAAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR395u GUGAAGCGUUUGGGGGAAAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR395v GUGAAGUAUUUGGCGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR395w GUGAAGUGUUUGGGGGAUUCUC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR395x GUGAAGUGUUUGGAGUAGCUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR395y GUGAAGUGUUUGGGGGAACUC 21 3 0 2 1    0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0
osa-miR396a-3p GUUCAAUAAAGCUGUGGGAA 20 339 14 146 1    0 0 0 0 0 0 0 0 0 0 3 2 9 88 87 146 0 0 0 0 1 1 0 2
osa-miR396a-5p UUCCACAGCUUUCUUGAACUG 21 26,284 1,095 3,713 2    136 102 88 166 194 83 127 120 76 203 70 40 2 152 519 312 1,366 2,801 3,479 3,713 3,663 2,976 3,249 2,647
osa-miR396b-3p GUUCAAUAAAGCUGUGGGAA 20 339 14 146 1    0 0 0 0 0 0 0 0 0 0 3 2 9 88 87 146 0 0 0 0 1 1 0 2
osa-miR396b-5p UUCCACAGCUUUCUUGAACUG 21 26,284 1,095 3,713 2    136 102 88 166 194 83 127 120 76 203 70 40 2 152 519 312 1,366 2,801 3,479 3,713 3,663 2,976 3,249 2,647
osa-miR396c-3p GGUCAAGAAAGCUGUGGGAAG 21 154 6 43 1    2 0 1 0 1 0 0 0 0 0 28 30 4 43 7 6 11 1 11 9 0 0 0 0
osa-miR396c-5p UUCCACAGCUUUCUUGAACUU 21 242,727 10,114 62,842 74    6,257 5,249 2,841 5,574 3,629 2,120 3,820 3,187 3,069 2,394 580 830 2,254 557 879 483 62,842 36,247 41,280 58,127 262 94 78 74
osa-miR396d UCCACAGGCUUUCUUGAACGG 21 4,328 180 458 1    458 382 314 425 430 289 358 298 212 109 1 0 0 0 0 0 136 306 197 408 1 0 3 1
osa-miR396e-3p AUGGUUCAAGAAAGCCCAUGGAAA 24 18 1 4 1    0 0 0 0 0 3 0 2 0 0 3 2 4 0 3 0 0 0 0 0 1 0 0 0
osa-miR396e-5p UCCACAGGCUUUCUUGAACUG 21 2,171,106 90,463 315,999 1,032    121,705 123,951 113,675 165,653 161,928 104,467 136,059 130,936 137,438 91,546 4,380 3,219 25,299 1,032 1,565 1,265 112,803 230,385 182,003 315,999 1,331 1,215 1,680 1,572
osa-miR396f-3p AUAGUUCAAGAAAGUCCUUGGAAA 24 115 5 43 1    0 0 0 1 1 0 0 0 0 0 43 24 40 3 0 3 0 0 0 0 0 0 0 0
osa-miR396f-5p UCUCCACAGGCUUUCUUGAACU 22 20 1 8 1    0 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0 4 5 1 8 0 0 0 0
osa-miR396g UCCACAGGCUUUCUUGAACGG 21 4,328 180 458 1    458 382 314 425 430 289 358 298 212 109 1 0 0 0 0 0 136 306 197 408 1 0 3 1
osa-miR396h UCCACAGGCUUUCUUGAACGG 21 4,328 180 458 1    458 382 314 425 430 289 358 298 212 109 1 0 0 0 0 0 136 306 197 408 1 0 3 1
osa-miR3979-3p CUUCGGGGGAGGAGAGAAGC 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR3979-5p UCUCUCUCUCCCUUGAAGGC 20 18 1 4 1    0 0 3 0 4 2 0 0 4 0 0 1 0 3 1 0 0 0 0 0 0 0 0 0
osa-miR397a UCAUUGAGUGCAGCGUUGAUG 21 3,497 146 731 10    10 39 43 52 52 84 45 58 84 35 19 20 29 36 44 58 17 82 45 24 731 556 658 676
osa-miR397b UUAUUGAGUGCAGCGUUGAUG 21 29 1 8 1    4 0 0 3 0 4 0 0 0 0 1 1 0 0 0 0 0 0 3 0 2 8 0 3
osa-miR3980a-3p CUGGCCGAGGCCGUCGAUUCU 21 9 0 3 1    0 0 0 0 0 0 0 0 0 0 0 0 2 1 3 3 0 0 0 0 0 0 0 0
osa-miR3980a-5p AAUCGACGGCCUCAGUCAGGG 21 250 10 57 40    0 0 0 0 0 0 0 0 0 0 48 50 0 57 55 40 0 0 0 0 0 0 0 0
osa-miR3980b-3p CUGGCCGAGGCCGUCGAUUCU 21 9 0 3 1    0 0 0 0 0 0 0 0 0 0 0 0 2 1 3 3 0 0 0 0 0 0 0 0
osa-miR3980b-5p AAUCGACGGCCUCAGUCAGGG 21 250 10 57 40    0 0 0 0 0 0 0 0 0 0 48 50 0 57 55 40 0 0 0 0 0 0 0 0
osa-miR3981-3p AGUAUUAGGAUACGUCUCAUC 21 14 1 5 1    0 0 4 0 0 3 5 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0
osa-miR3981-5p UGGGACGUAUCCUAUUACUAU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR3982-3p AGUUGCCUACAUGGAGCGCCA 21 28 1 9 2    5 0 0 0 2 5 9 2 0 0 0 5 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR3982-5p GCGCUCCACGUAGGCAACAAU 21 5 0 3 2    0 3 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR398a UGUGUUCUCAGGUCACCCCUU 21 112 5 37 3    0 0 0 0 0 0 0 0 0 0 10 4 7 6 11 14 37 20 0 3 0 0 0 0
osa-miR398b UGUGUUCUCAGGUCGCCCCUG 21 313,090 13,045 48,586 22    10,143 8,518 3,989 9,672 5,724 13,508 17,804 10,552 6,369 4,723 553 671 22 183 348 380 11,243 33,169 310 5,210 41,148 48,586 38,082 42,183
osa-miR399a UGCCAAAGGAGAAUUGCCCUG 21 161 7 29 1    10 1 6 8 2 6 8 2 4 0 0 0 0 0 0 0 16 29 0 26 1 4 20 18
osa-miR399b UGCCAAAGGAGAAUUGCCCUG 21 161 7 29 1    10 1 6 8 2 6 8 2 4 0 0 0 0 0 0 0 16 29 0 26 1 4 20 18
osa-miR399c UGCCAAAGGAGAAUUGCCCUG 21 161 7 29 1    10 1 6 8 2 6 8 2 4 0 0 0 0 0 0 0 16 29 0 26 1 4 20 18
osa-miR399d UGCCAAAGGAGAGUUGCCCUG 21 14,876 620 2,838 2    704 716 565 519 619 758 894 555 1,057 600 3 26 4 2 6 2 1,516 2,838 909 1,654 94 109 346 380
osa-miR399e UGCCAAAGGAGAUUUGCCCAG 21 3 0 1 1    0 0 0 0 0 1 0 0 0 0 0 1 0 0 0 0 0 0 0 1 0 0 0 0
osa-miR399f UGCCAAAGGAGAUUUGCCCAG 21 3 0 1 1    0 0 0 0 0 1 0 0 0 0 0 1 0 0 0 0 0 0 0 1 0 0 0 0
osa-miR399g UGCCAAAGGAGAUUUGCCCAG 21 3 0 1 1    0 0 0 0 0 1 0 0 0 0 0 1 0 0 0 0 0 0 0 1 0 0 0 0
osa-miR399h UGCCAAAGGAGACUUGCCCAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR399i UGCCAAAGGAGAGCUGCCCUG 21 76 3 55 1    0 0 0 0 0 1 0 0 0 1 0 0 0 0 0 0 1 55 1 11 0 1 1 4
osa-miR399j UGCCAAAGGAGAGUUGCCCUA 21 71 3 11 1    0 1 0 1 7 0 1 0 0 0 3 11 11 3 1 1 4 11 7 8 0 0 1 0
osa-miR399k UGCCAAAGGAAAUUUGCCCCG 21 46 2 10 1    4 3 10 3 1 4 6 3 2 0 0 0 0 0 0 0 3 2 0 0 2 0 1 2
osa-miR408-3p CUGCACUGCCUCUUCCCUGGC 21 498,671 20,778 108,109 39    1,812 3,284 1,292 3,160 2,005 2,446 3,493 2,210 1,790 1,250 39 78 69 287 151 123 15,231 61,406 19,046 208 94,371 108,109 87,558 89,253
osa-miR408-5p CAGGGAUGAGGCAGAGCAUGG 21 8,234 343 1,916 3    110 136 40 212 173 223 187 169 201 120 36 19 0 324 108 85 3 17 7 0 1,782 1,916 1,217 1,149
osa-miR413 CUAGUUUCACUUGUUCUGCAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR414 UCAUCCUCAUCAUCAUCGUCC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR415 AACAGAACAGAAGCAGAGCAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR416 UGUUCGUCCGUACACUGUUCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR417 GAAUGUAGUGAAUUUGUUCCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR418 UAAUGUGAUGAUGAAAUGACG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR419 UGAUGAAUGCUGACGAUGUUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR426 UUUUGGAAGUUUGUCCUUACG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR435 UUAUCCGGUAUUGGAGUUGA 20 388 16 225 1    3 1 3 3 0 15 9 5 22 0 49 36 225 1 1 1 0 0 3 0 4 4 1 2
osa-miR437 AAAGUUAGAGAAGUUUGACUU 21 14 1 6 1    0 0 6 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 2
osa-miR438 UUCCCACGCGUUAUAGUGAAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR439a UGUCGAACCGCGGUUGUUCGA 21 4 0 2 2    0 0 0 0 0 0 0 0 0 0 2 0 2 0 0 0 0 0 0 0 0 0 0 0
osa-miR439b UGUCGAACCGCGGUUGUUCGA 21 4 0 2 2    0 0 0 0 0 0 0 0 0 0 2 0 2 0 0 0 0 0 0 0 0 0 0 0
osa-miR439c UGUCGAACCGCGGUUGUUCGA 21 4 0 2 2    0 0 0 0 0 0 0 0 0 0 2 0 2 0 0 0 0 0 0 0 0 0 0 0
osa-miR439d UGUCGAACCGCGGUUGUUCGA 21 4 0 2 2    0 0 0 0 0 0 0 0 0 0 2 0 2 0 0 0 0 0 0 0 0 0 0 0
osa-miR439e UGUCGAACCGCGGUUGUUCGA 21 4 0 2 2    0 0 0 0 0 0 0 0 0 0 2 0 2 0 0 0 0 0 0 0 0 0 0 0
osa-miR439f UGUCGAACCGCGGUUGUUCGA 21 4 0 2 2    0 0 0 0 0 0 0 0 0 0 2 0 2 0 0 0 0 0 0 0 0 0 0 0
osa-miR439g UGUCGAACCGCGGUUGUUCGA 21 4 0 2 2    0 0 0 0 0 0 0 0 0 0 2 0 2 0 0 0 0 0 0 0 0 0 0 0
osa-miR439h UGUCGAACCGCGGUUGUUCGA 21 4 0 2 2    0 0 0 0 0 0 0 0 0 0 2 0 2 0 0 0 0 0 0 0 0 0 0 0
osa-miR439i UGUCGAACCGCGGUUGUUCGA 21 4 0 2 2    0 0 0 0 0 0 0 0 0 0 2 0 2 0 0 0 0 0 0 0 0 0 0 0
osa-miR440 AGUGUCUCCUGAUGAUCGGGACAA 24 21 1 11 1    0 0 1 0 0 0 0 0 0 0 1 2 11 0 0 0 0 0 0 0 2 1 3 0
osa-miR443 AUCACAAUACAAUAAAUCUGGA 22 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1
osa-miR444a-3p.1 UUGCUGCCUCAAGCUUGCUGC 21 70 3 15 1    1 5 6 6 2 15 9 5 9 3 0 0 0 0 0 0 0 1 4 1 0 1 0 2
osa-miR444a-3p.2 UGCAGUUGCUGCCUCAAGCUU 21 8,048 335 686 5    483 468 481 353 440 676 573 278 376 169 20 5 0 10 6 6 399 296 302 456 610 686 483 472
osa-miR444a-5p GCUAGAGGUGGCAACUGCAUA 21 271 11 38 1    6 14 10 3 1 24 5 25 23 20 1 0 0 12 0 6 3 2 3 0 31 38 22 22
osa-miR444b.1 UGUUGUCUCAAGCUUGCUGCC 21 108,696 4,529 16,657 27    1,208 1,276 1,548 1,179 905 1,326 1,732 1,026 1,109 871 99 81 27 119 209 44 16,657 12,304 15,938 14,925 8,598 8,671 9,321 9,523
osa-miR444b.2 UGCAGUUGUUGUCUCAAGCUU 21 80,808 3,367 14,352 22    2,594 2,205 2,511 2,545 2,745 3,318 3,476 2,552 1,949 1,134 266 224 22 153 104 62 14,352 9,856 9,677 13,581 1,138 1,273 2,463 2,608
osa-miR444c.1 UGUUGUCUCAAGCUUGCUGCC 21 108,696 4,529 16,657 27    1,208 1,276 1,548 1,179 905 1,326 1,732 1,026 1,109 871 99 81 27 119 209 44 16,657 12,304 15,938 14,925 8,598 8,671 9,321 9,523
osa-miR444c.2 UGCAGUUGUUGUCUCAAGCUU 21 80,808 3,367 14,352 22    2,594 2,205 2,511 2,545 2,745 3,318 3,476 2,552 1,949 1,134 266 224 22