Rice Small RNA miRNA Abundances

The data below are based on the microRNAs listed in the miRBase registry. Adjust libraries/reads to display on the control panel.


osa-miR11336-3p GAAUAUGGGAAAUGCUAGAAAGUCU 25 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR11336-5p GACUUUCUAGCGUUGCCCACAUUC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR11337-3p UAUCUCGUUAGAUUCGUCUCG 21 3 0 2 1    0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR11337-5p UGCGAGACGAAUCUAACGAGG 21 7 0 1 1    0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR11338-3p AUCUCGUUAGAUUCGUCUCGCAAA 24 19 0 9 1    0 0 0 0 0 0 2 0 0 0 0 0 9 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 1
osa-miR11338-5p UUUGUGAGACGAAUCUAAUGAUAU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR11339-3p UAUGAAUGUGGGCAAUGCUAG 21 401 6 77 1    59 0 2 77 3 67 0 34 4 11 4 0 0 0 1 0 1 10 10 0 10 0 3 0 10 8 8 14 3 0 2 0 9 4 6 0 5 3 2 0 8 0 8 0 2 2 0 5 1 0 3 1 0 1 0 0 0 0 0 0 0 0 0
osa-miR11339-5p GCAUUGCCCACAUUCAUAUAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR11340-3p AAUAGUGUAAUCGGAUUAUAGAUC 24 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR11340-5p AUCCGAUCUACGAUCCGAUUACAC 24 8 0 4 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR11341-3p AUCUCGUUAGAUUCGUCUCGCAAA 24 19 0 9 1    0 0 0 0 0 0 2 0 0 0 0 0 9 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 1
osa-miR11341-5p CCUAGGCUAUUUUGCGAGACGAAU 24 4 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1
osa-miR11342-3p CUCGUUAGAUUCGUCUCGCAAA 22 2 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 1 0 0 0
osa-miR11342-5p CGAGACGAAUCUAACGAGAUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR11343-3p UGAAUGUGGGCAAUGUUAAAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR11343-5p CUUUCUAGCGUUGCCCACAUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR11344-3p CUGUGAGGUACCGGUACCUAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR11344-5p UAUCUCGAGAUAUCGGUACCUC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1319a AACCGGCAUCUGUAAUAUAUUAUA 24 9 0 4 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 0 1 0
osa-miR1319b CCUUUAAUAUAUUAUAGGUGUCGG 24 214 3 31 1    1 0 4 6 1 4 7 0 4 0 16 0 9 0 2 0 4 10 0 0 1 0 0 0 1 0 0 0 0 0 0 0 2 0 1 7 8 0 2 31 1 0 1 4 7 3 0 7 5 4 8 3 5 0 0 0 0 0 10 23 0 11 1
osa-miR1320-3p UGUAAAAUUCAUUCGUUCCAA 21 363 6 72 1    0 18 38 2 0 0 2 1 13 11 0 0 0 8 5 0 1 10 5 0 3 72 7 0 1 25 4 0 6 16 2 8 6 0 1 71 0 0 1 22 0 0 0 0 1 1 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1320-5p UGGAACGGAGGAAUUUUAUAG 21 1,652 26 528 1    24 9 8 31 13 39 5 15 189 11 8 9 9 0 1 0 1 0 85 64 50 20 82 89 33 34 47 29 43 528 42 4 15 7 1 0 1 54 7 9 6 8 7 0 1 4 4 1 0 0 1 1 0 0 0 0 0 0 0 0 0 3 0
osa-miR1423-3p AGCGCCCAAGCGGUAGUUGUC 21 28 0 8 1    1 0 2 4 1 0 1 0 1 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 8 0 0 0 0 0 0 0 0 1 0 3 0 1 0 0 0 0 0 0 1 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 1
osa-miR1423-5p AGGCAACUACACGUUGGGCGCUCG 24 709 11 42 2    41 18 32 20 15 10 28 17 34 11 12 0 0 8 3 0 2 10 4 8 6 26 7 27 10 42 8 0 8 31 4 4 18 4 14 7 22 10 6 13 6 8 12 0 6 25 19 2 8 4 3 2 5 5 10 13 8 7 0 5 12 3 6
osa-miR1424 AUGCACACUGAUGCUGAUUGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1425-3p CAGCAAGAACUGGAUCUUAAU 21 5,375 85 754 5    58 395 36 37 47 32 51 35 40 34 53 0 27 32 13 14 41 227 5 32 8 26 50 0 28 42 47 86 34 16 17 390 565 112 224 64 754 54 160 136 39 110 33 55 68 50 58 61 29 69 123 332 16 69 40 70 50 0 10 23 12 21 15
osa-miR1425-5p UAGGAUUCAAUCCUUGCUGCU 21 16,923 269 2,389 5    191 18 656 305 289 468 40 562 49 1,232 49 298 219 318 293 41 62 10 337 16 404 209 435 44 218 17 473 144 508 62 721 16 2,389 26 1,304 707 79 152 78 35 178 183 127 450 502 238 562 547 82 19 13 15 5 22 139 272 0 20 21 17 0 23 14
osa-miR1426 AGAAUCUUGAUGAUGAUUAAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1427 UGCGGAACCGUGCGGUGGCGC 21 6,287 100 564 1    2 53 139 4 168 4 102 1 206 285 93 28 64 16 23 14 37 82 22 80 57 98 37 124 76 85 21 14 45 124 67 80 433 157 151 177 150 139 68 132 439 103 270 72 72 89 74 55 84 61 94 87 151 24 564 32 125 109 0 15 73 27 9
osa-miR1428a-3p UAAGAUAAAGCCGUGAAUUUG 21 3 0 2 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1428a-5p CGUUUUGCAAAUUCGCAGGCC 21 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1428b UAAGAUAAUGCCAUGAAUUCG 21 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1428c UAAGAUAAUGCCAUGAAUUCG 21 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1428d UAAGAUAAUGCCAUGAAUUCG 21 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1428e-3p UAAGAUAAUGCCAUGAAUUUG 21 69 1 27 1    1 0 2 2 1 2 0 2 3 0 0 0 0 0 0 0 1 0 4 8 1 0 1 0 1 0 1 0 1 0 0 0 27 0 1 0 0 0 0 0 1 0 2 0 0 3 0 1 0 0 0 1 0 1 0 0 0 0 0 0 0 0 1
osa-miR1428e-5p AAUUCACAGGCCCUAUCUUGUG 22 35 1 7 1    2 0 0 2 6 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 7 4 0 0 0 1 0 3 0 2 0 0 0 0 0 0 0 4 1 0 0 0 0 0 0 0 0 0 0 0
osa-miR1428f-5p AAUUCACAGGCCCUAUCUUGUG 22 35 1 7 1    2 0 0 2 6 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 7 4 0 0 0 1 0 3 0 2 0 0 0 0 0 0 0 4 1 0 0 0 0 0 0 0 0 0 0 0
osa-miR1428g-5p AAUUCACAGGCCCUAUCUUGUG 22 35 1 7 1    2 0 0 2 6 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 7 4 0 0 0 1 0 3 0 2 0 0 0 0 0 0 0 4 1 0 0 0 0 0 0 0 0 0 0 0
osa-miR1429-3p GUUGCACGGGUUUGUAUGUUG 21 18 0 5 1    0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 5 0 4 0 0 0 0 4 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1429-5p GUAAUAUACUAAUCCGUGCAU 21 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1430 UGGUGAGCCUUCCUGGCUAAG 21 737 12 84 1    1 0 9 0 6 0 7 1 0 46 8 0 37 0 0 0 0 0 0 0 0 7 0 0 0 0 0 29 0 0 0 84 84 19 62 64 36 6 0 44 7 57 5 42 36 9 0 4 2 4 7 2 5 2 5 0 0 0 0 0 0 0 0
osa-miR1431 UUUGCGAGUUGGCCCGCUUGC 21 373 6 34 1    0 9 13 4 10 2 2 0 0 23 8 0 18 8 1 0 0 10 2 8 4 20 1 0 1 0 0 0 1 0 4 8 17 4 4 14 7 19 3 18 6 34 7 8 5 4 19 10 5 4 1 5 0 1 0 19 0 0 0 1 0 0 1
osa-miR1432-3p CAGGUGUCAUCUCCCCUGAAC 21 1,136 18 103 1    6 26 28 14 21 4 28 6 24 11 8 0 0 0 2 14 3 103 70 40 77 33 65 27 60 25 43 43 25 0 27 12 66 19 9 28 13 10 0 22 4 19 15 8 1 57 4 2 0 4 4 0 0 0 5 0 0 0 0 0 0 0 1
osa-miR1432-5p AUCAGGAGAGAUGACACCGAC 21 7,619 121 802 1    164 88 75 142 85 199 85 142 157 46 130 0 55 8 4 0 6 556 512 791 548 261 802 364 422 102 206 129 164 326 334 44 34 64 24 106 84 51 99 35 32 49 46 0 3 5 4 4 1 11 5 1 0 0 10 0 0 0 0 1 0 0 3
osa-miR1435 UUUCUUAAGUCAAACUUUUU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1436 ACAUUAUGGGACGGAGGGAGU 21 9 0 3 1    0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 3 0 2 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1437a UCCGGCGCCGCACUAGGCACUG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1437b-3p GUGCUGGCGAGCUCCGGUGCCGCA 24 20 0 4 1    0 0 0 2 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 1 3 0 0 1 0 2 4 2 0 0 1 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0
osa-miR1437b-5p GGGAGGAAACAGUGCCUAGUG 21 22 0 14 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 14 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 7 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1438 AGGGUAAUUUUAUCAUUUUUAA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1439 UUUUGGAACGGAGUGAGUAUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1440a UGCUCAAAUACCACUCUCCU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1440b UUUAGGAGAGUGGUAUUUGAG 21 20 0 8 1    0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 1 8 1 0 2 0 1 0 1 0 3 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1441 ACCGGAUGUCGGAAAAGGUUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1442 AUUCAUAGUACUAGAUGUGU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR156a UGACAGAAGAGAGUGAGCAC 20 9,061,956 143,841 897,045 226    166,800 4,285 148,745 271,325 270,001 271,727 91,568 118,598 171,463 74,976 56,921 173,139 77,695 2,617 2,526 4,443 4,512 25,176 837,632 155,832 897,045 139,346 665,596 77,380 517,826 115,318 684,844 75,246 609,562 166,810 439,372 3,121 150,930 43,568 205,980 89,708 33,551 98,777 317,694 45,077 364,392 21,246 316,068 1,899 2,099 1,968 2,129 2,371 5,637 2,032 2,189 1,365 3,168 3,337 2,307 670 226 1,155 2,445 2,548 7,480 7,819 674
osa-miR156b-3p GCUCACUCUCUAUCUGUCAGC 21 656 10 189 1    15 0 15 18 4 20 4 13 0 23 4 0 0 0 0 0 0 0 5 0 15 189 10 36 9 93 10 14 3 47 6 4 38 0 13 21 1 3 0 13 2 0 1 0 2 0 0 1 0 0 3 0 0 0 0 0 0 0 0 1 0 0 0
osa-miR156b-5p UGACAGAAGAGAGUGAGCAC 20 9,061,956 143,841 897,045 226    166,800 4,285 148,745 271,325 270,001 271,727 91,568 118,598 171,463 74,976 56,921 173,139 77,695 2,617 2,526 4,443 4,512 25,176 837,632 155,832 897,045 139,346 665,596 77,380 517,826 115,318 684,844 75,246 609,562 166,810 439,372 3,121 150,930 43,568 205,980 89,708 33,551 98,777 317,694 45,077 364,392 21,246 316,068 1,899 2,099 1,968 2,129 2,371 5,637 2,032 2,189 1,365 3,168 3,337 2,307 670 226 1,155 2,445 2,548 7,480 7,819 674
osa-miR156c-3p GCUCACUUCUCUCUCUGUCAGC 22 865 14 142 1    94 9 17 132 4 142 3 59 0 23 4 0 0 0 2 0 0 0 5 0 5 65 3 0 3 17 7 0 0 16 0 4 41 7 22 57 3 13 0 0 5 27 2 21 19 1 19 10 1 0 2 0 0 0 0 0 0 0 0 0 0 0 1
osa-miR156c-5p UGACAGAAGAGAGUGAGCAC 20 9,061,956 143,841 897,045 226    166,800 4,285 148,745 271,325 270,001 271,727 91,568 118,598 171,463 74,976 56,921 173,139 77,695 2,617 2,526 4,443 4,512 25,176 837,632 155,832 897,045 139,346 665,596 77,380 517,826 115,318 684,844 75,246 609,562 166,810 439,372 3,121 150,930 43,568 205,980 89,708 33,551 98,777 317,694 45,077 364,392 21,246 316,068 1,899 2,099 1,968 2,129 2,371 5,637 2,032 2,189 1,365 3,168 3,337 2,307 670 226 1,155 2,445 2,548 7,480 7,819 674
osa-miR156d UGACAGAAGAGAGUGAGCAC 20 9,061,956 143,841 897,045 226    166,800 4,285 148,745 271,325 270,001 271,727 91,568 118,598 171,463 74,976 56,921 173,139 77,695 2,617 2,526 4,443 4,512 25,176 837,632 155,832 897,045 139,346 665,596 77,380 517,826 115,318 684,844 75,246 609,562 166,810 439,372 3,121 150,930 43,568 205,980 89,708 33,551 98,777 317,694 45,077 364,392 21,246 316,068 1,899 2,099 1,968 2,129 2,371 5,637 2,032 2,189 1,365 3,168 3,337 2,307 670 226 1,155 2,445 2,548 7,480 7,819 674
osa-miR156e UGACAGAAGAGAGUGAGCAC 20 9,061,956 143,841 897,045 226    166,800 4,285 148,745 271,325 270,001 271,727 91,568 118,598 171,463 74,976 56,921 173,139 77,695 2,617 2,526 4,443 4,512 25,176 837,632 155,832 897,045 139,346 665,596 77,380 517,826 115,318 684,844 75,246 609,562 166,810 439,372 3,121 150,930 43,568 205,980 89,708 33,551 98,777 317,694 45,077 364,392 21,246 316,068 1,899 2,099 1,968 2,129 2,371 5,637 2,032 2,189 1,365 3,168 3,337 2,307 670 226 1,155 2,445 2,548 7,480 7,819 674
osa-miR156f-3p GCUCACUUCUCUUUCUGUCAGC 22 419 7 43 1    24 0 4 37 4 41 1 23 0 0 8 0 0 0 2 0 0 0 3 8 5 39 1 9 1 0 1 0 0 0 4 4 43 15 29 35 7 6 0 0 9 30 3 0 6 0 12 2 1 0 2 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR156f-5p UGACAGAAGAGAGUGAGCAC 20 9,061,956 143,841 897,045 226    166,800 4,285 148,745 271,325 270,001 271,727 91,568 118,598 171,463 74,976 56,921 173,139 77,695 2,617 2,526 4,443 4,512 25,176 837,632 155,832 897,045 139,346 665,596 77,380 517,826 115,318 684,844 75,246 609,562 166,810 439,372 3,121 150,930 43,568 205,980 89,708 33,551 98,777 317,694 45,077 364,392 21,246 316,068 1,899 2,099 1,968 2,129 2,371 5,637 2,032 2,189 1,365 3,168 3,337 2,307 670 226 1,155 2,445 2,548 7,480 7,819 674
osa-miR156g-3p GCUCACUUCUCUCUCUGUCAGC 22 865 14 142 1    94 9 17 132 4 142 3 59 0 23 4 0 0 0 2 0 0 0 5 0 5 65 3 0 3 17 7 0 0 16 0 4 41 7 22 57 3 13 0 0 5 27 2 21 19 1 19 10 1 0 2 0 0 0 0 0 0 0 0 0 0 0 1
osa-miR156g-5p UGACAGAAGAGAGUGAGCAC 20 9,061,956 143,841 897,045 226    166,800 4,285 148,745 271,325 270,001 271,727 91,568 118,598 171,463 74,976 56,921 173,139 77,695 2,617 2,526 4,443 4,512 25,176 837,632 155,832 897,045 139,346 665,596 77,380 517,826 115,318 684,844 75,246 609,562 166,810 439,372 3,121 150,930 43,568 205,980 89,708 33,551 98,777 317,694 45,077 364,392 21,246 316,068 1,899 2,099 1,968 2,129 2,371 5,637 2,032 2,189 1,365 3,168 3,337 2,307 670 226 1,155 2,445 2,548 7,480 7,819 674
osa-miR156h-3p GCUCACUUCUCUUUCUGUCAGC 22 419 7 43 1    24 0 4 37 4 41 1 23 0 0 8 0 0 0 2 0 0 0 3 8 5 39 1 9 1 0 1 0 0 0 4 4 43 15 29 35 7 6 0 0 9 30 3 0 6 0 12 2 1 0 2 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR156h-5p UGACAGAAGAGAGUGAGCAC 20 9,061,956 143,841 897,045 226    166,800 4,285 148,745 271,325 270,001 271,727 91,568 118,598 171,463 74,976 56,921 173,139 77,695 2,617 2,526 4,443 4,512 25,176 837,632 155,832 897,045 139,346 665,596 77,380 517,826 115,318 684,844 75,246 609,562 166,810 439,372 3,121 150,930 43,568 205,980 89,708 33,551 98,777 317,694 45,077 364,392 21,246 316,068 1,899 2,099 1,968 2,129 2,371 5,637 2,032 2,189 1,365 3,168 3,337 2,307 670 226 1,155 2,445 2,548 7,480 7,819 674
osa-miR156i UGACAGAAGAGAGUGAGCAC 20 9,061,956 143,841 897,045 226    166,800 4,285 148,745 271,325 270,001 271,727 91,568 118,598 171,463 74,976 56,921 173,139 77,695 2,617 2,526 4,443 4,512 25,176 837,632 155,832 897,045 139,346 665,596 77,380 517,826 115,318 684,844 75,246 609,562 166,810 439,372 3,121 150,930 43,568 205,980 89,708 33,551 98,777 317,694 45,077 364,392 21,246 316,068 1,899 2,099 1,968 2,129 2,371 5,637 2,032 2,189 1,365 3,168 3,337 2,307 670 226 1,155 2,445 2,548 7,480 7,819 674
osa-miR156j-3p GCUCGCUCCUCUUUCUGUCAGC 22 49 1 7 1    5 0 4 6 0 6 0 6 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 6 0 1 7 0 0 0 0 1 0 2 0 1 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR156j-5p UGACAGAAGAGAGUGAGCAC 20 9,061,956 143,841 897,045 226    166,800 4,285 148,745 271,325 270,001 271,727 91,568 118,598 171,463 74,976 56,921 173,139 77,695 2,617 2,526 4,443 4,512 25,176 837,632 155,832 897,045 139,346 665,596 77,380 517,826 115,318 684,844 75,246 609,562 166,810 439,372 3,121 150,930 43,568 205,980 89,708 33,551 98,777 317,694 45,077 364,392 21,246 316,068 1,899 2,099 1,968 2,129 2,371 5,637 2,032 2,189 1,365 3,168 3,337 2,307 670 226 1,155 2,445 2,548 7,480 7,819 674
osa-miR156k UGACAGAAGAGAGAGAGCACA 21 13 0 2 1    1 0 0 0 0 2 0 2 1 0 0 0 0 0 0 0 0 0 1 0 1 0 1 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR156l-3p GCUCACUUCUCUUUCUGUCAGC 22 419 7 43 1    24 0 4 37 4 41 1 23 0 0 8 0 0 0 2 0 0 0 3 8 5 39 1 9 1 0 1 0 0 0 4 4 43 15 29 35 7 6 0 0 9 30 3 0 6 0 12 2 1 0 2 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR156l-5p CGACAGAAGAGAGUGAGCAUA 21 897 14 122 1    16 9 19 31 11 49 5 16 7 11 4 0 0 0 0 0 0 31 122 40 83 13 73 0 23 42 103 29 70 31 31 0 1 4 0 7 1 0 2 4 5 0 1 0 0 1 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0
osa-miR159a.1 UUUGGAUUGAAGGGAGCUCUG 21 15,701 249 1,802 14    197 141 147 303 132 290 277 189 282 171 57 149 639 64 42 14 41 196 213 80 369 72 269 44 140 68 310 273 169 62 593 104 236 56 419 99 741 86 291 57 182 42 109 1,041 1,061 134 1,802 1,782 121 107 136 332 62 122 99 57 67 55 83 45 110 52 18
osa-miR159a.2 UUGCAUGCCCCAGGAGCUGCA 21 15,538 247 2,169 8    22 105 224 22 474 16 55 24 193 262 77 121 37 390 394 869 918 185 144 264 193 601 165 2,169 269 474 123 158 167 1,616 109 24 504 105 288 382 32 634 45 194 173 377 163 115 116 75 273 167 217 15 29 28 93 13 183 114 8 55 41 40 49 76 70
osa-miR159b UUUGGAUUGAAGGGAGCUCUG 21 15,701 249 1,802 14    197 141 147 303 132 290 277 189 282 171 57 149 639 64 42 14 41 196 213 80 369 72 269 44 140 68 310 273 169 62 593 104 236 56 419 99 741 86 291 57 182 42 109 1,041 1,061 134 1,802 1,782 121 107 136 332 62 122 99 57 67 55 83 45 110 52 18
osa-miR159c AUUGGAUUGAAGGGAGCUCCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR159d AUUGGAUUGAAGGGAGCUCCG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR159e AUUGGAUUGAAGGGAGCUCCU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR159f CUUGGAUUGAAGGGAGCUCUA 21 1 0 1 1    0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR160a-3p GCGUGCAAGGAGCCAAGCAUG 21 3,658 58 855 1    83 18 83 47 15 69 13 42 34 0 32 0 0 8 8 0 5 72 38 176 92 170 38 160 80 110 30 29 30 855 23 4 16 7 16 0 17 16 12 4 6 11 7 110 99 173 4 14 24 27 40 95 52 83 10 51 0 0 0 1 24 3 372
osa-miR160a-5p UGCCUGGCUCCCUGUAUGCCA 21 6,715 107 1,351 3    172 79 38 252 35 300 86 206 3 80 65 130 1,351 32 22 69 41 247 39 40 31 78 61 124 15 372 49 244 23 78 65 96 85 19 73 42 66 67 9 163 9 183 9 106 97 48 175 148 140 80 50 79 0 8 193 133 17 7 62 42 0 5 77
osa-miR160b-3p GCGUGCAAGGAGCCAAGCAUG 21 3,658 58 855 1    83 18 83 47 15 69 13 42 34 0 32 0 0 8 8 0 5 72 38 176 92 170 38 160 80 110 30 29 30 855 23 4 16 7 16 0 17 16 12 4 6 11 7 110 99 173 4 14 24 27 40 95 52 83 10 51 0 0 0 1 24 3 372
osa-miR160b-5p UGCCUGGCUCCCUGUAUGCCA 21 6,715 107 1,351 3    172 79 38 252 35 300 86 206 3 80 65 130 1,351 32 22 69 41 247 39 40 31 78 61 124 15 372 49 244 23 78 65 96 85 19 73 42 66 67 9 163 9 183 9 106 97 48 175 148 140 80 50 79 0 8 193 133 17 7 62 42 0 5 77
osa-miR160c-3p GCGUGCACGGAGCCAAGCAUA 21 339 5 84 1    32 44 8 10 0 14 3 23 8 0 4 0 0 24 7 0 6 0 0 8 1 0 1 0 1 0 0 0 0 0 0 12 3 15 2 7 1 0 1 0 3 4 0 4 1 1 0 0 0 0 0 0 0 1 0 6 0 0 0 0 0 0 84
osa-miR160c-5p UGCCUGGCUCCCUGUAUGCCA 21 6,715 107 1,351 3    172 79 38 252 35 300 86 206 3 80 65 130 1,351 32 22 69 41 247 39 40 31 78 61 124 15 372 49 244 23 78 65 96 85 19 73 42 66 67 9 163 9 183 9 106 97 48 175 148 140 80 50 79 0 8 193 133 17 7 62 42 0 5 77
osa-miR160d-3p GCGUGCGAGGAGCCAAGCAUG 21 221 4 191 1    0 0 2 0 0 0 0 2 0 0 0 0 0 0 5 0 6 0 1 0 1 0 1 0 1 0 1 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 1 1 0 0 0 4 0 0 0 1 0 0 0 0 0 1 0 0 191
osa-miR160d-5p UGCCUGGCUCCCUGUAUGCCA 21 6,715 107 1,351 3    172 79 38 252 35 300 86 206 3 80 65 130 1,351 32 22 69 41 247 39 40 31 78 61 124 15 372 49 244 23 78 65 96 85 19 73 42 66 67 9 163 9 183 9 106 97 48 175 148 140 80 50 79 0 8 193 133 17 7 62 42 0 5 77
osa-miR160e-3p GCGUGCGAGGUGCCAAGCAUG 21 53 1 46 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 1 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 46
osa-miR160e-5p UGCCUGGCUCCCUGUAUGCCG 21 2,718 43 246 1    77 9 6 90 10 91 31 86 4 23 0 19 100 0 3 14 10 0 8 8 18 26 27 36 9 42 14 14 5 16 21 4 53 4 52 0 9 16 1 31 12 61 7 153 143 63 246 234 103 42 48 24 0 7 178 95 50 7 41 38 0 1 178
osa-miR160f-3p GCAUUGAGGGAGUCAUGCAGG 21 21 0 4 1    0 0 2 0 0 2 0 0 3 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 2 0 0 0 0 0 2 0 0 0 0 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1
osa-miR160f-5p UGCCUGGCUCCCUGAAUGCCA 21 692 11 91 1    11 0 17 20 15 32 16 33 0 23 4 0 91 0 6 0 6 0 0 0 1 0 0 0 1 0 0 0 0 0 0 8 21 4 21 14 7 16 2 40 14 30 3 55 44 5 31 33 13 8 3 7 0 0 10 6 0 0 0 4 0 1 16
osa-miR162a UCGAUAAACCUCUGCAUCCAG 21 4,622 73 531 4    269 0 64 531 76 424 70 360 186 34 89 0 18 0 5 0 6 21 37 8 61 13 55 0 31 17 56 14 38 93 46 4 12 67 125 42 17 60 66 101 66 95 27 106 138 12 273 315 62 15 33 6 73 56 89 0 8 27 10 8 12 16 59
osa-miR162b UCGAUAAGCCUCUGCAUCCAG 21 1,425 23 143 3    37 0 11 77 7 59 10 40 69 11 4 0 0 0 0 0 0 0 4 0 17 0 13 0 7 0 12 14 13 31 6 0 9 0 70 0 3 10 11 4 19 27 8 42 58 10 74 101 143 31 28 6 93 26 119 0 0 7 0 4 24 21 35
osa-miR164a UGGAGAAGCAGGGCACGUGCA 21 54,111 859 8,349 76    8,349 369 662 6,106 1,338 5,547 346 5,862 1,291 1,460 413 1,079 1,451 191 187 248 256 247 223 312 368 242 319 516 200 279 146 129 179 1,554 234 245 293 153 245 544 207 1,103 296 471 702 297 579 174 206 677 269 396 400 76 113 307 415 484 332 1,713 368 594 175 210 609 721 634
osa-miR164b UGGAGAAGCAGGGCACGUGCA 21 54,111 859 8,349 76    8,349 369 662 6,106 1,338 5,547 346 5,862 1,291 1,460 413 1,079 1,451 191 187 248 256 247 223 312 368 242 319 516 200 279 146 129 179 1,554 234 245 293 153 245 544 207 1,103 296 471 702 297 579 174 206 677 269 396 400 76 113 307 415 484 332 1,713 368 594 175 210 609 721 634
osa-miR164c UGGAGAAGCAGGGUACGUGCA 21 404 6 47 1    22 0 4 4 13 10 0 22 9 11 4 9 9 0 1 0 1 10 5 0 5 0 7 0 5 0 4 0 5 47 2 0 2 0 3 0 3 0 2 0 3 0 2 0 1 22 8 6 9 0 2 10 0 29 20 38 8 0 0 4 0 17 6
osa-miR164d UGGAGAAGCAGGGCACGUGCU 21 17,309 275 8,530 8    399 88 73 315 131 353 35 191 273 125 20 130 82 24 24 28 38 412 281 248 496 137 421 836 268 482 330 259 228 8,530 387 44 55 19 33 49 47 101 35 48 60 34 54 34 39 78 58 71 82 38 28 135 119 79 35 82 8 41 10 17 61 53 18
osa-miR164e UGGAGAAGCAGGGCACGUGAG 21 17,828 283 4,040 1    451 18 32 600 35 563 13 352 38 57 8 19 18 0 3 0 8 1,010 1,049 1,239 723 908 830 1,653 979 635 637 661 457 4,040 779 0 0 0 0 7 0 0 0 0 2 0 2 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 1
osa-miR164f UGGAGAAGCAGGGCACGUGCA 21 54,111 859 8,349 76    8,349 369 662 6,106 1,338 5,547 346 5,862 1,291 1,460 413 1,079 1,451 191 187 248 256 247 223 312 368 242 319 516 200 279 146 129 179 1,554 234 245 293 153 245 544 207 1,103 296 471 702 297 579 174 206 677 269 396 400 76 113 307 415 484 332 1,713 368 594 175 210 609 721 634
osa-miR166a-3p UCGGACCAGGCUUCAUUCCCC 21 833,667 13,233 53,165 594    12,986 1,572 13,528 33,021 4,591 21,829 14,092 22,383 9,045 9,922 22,509 2,139 6,326 2,729 2,147 1,242 1,190 7,571 38,144 37,997 49,520 22,673 53,165 22,694 15,605 24,257 51,972 32,968 30,197 25,746 45,925 2,088 9,382 11,494 11,782 3,753 2,840 3,739 11,614 7,082 6,934 10,360 5,308 7,154 7,325 3,132 6,131 5,478 4,054 9,931 10,293 986 14,275 4,680 9,902 3,338 594 6,552 2,073 1,641 4,020 3,399 2,648
osa-miR166a-5p GGAAUGUUGUCUGGUUCAAGG 21 547 9 103 1    71 26 4 12 0 22 2 33 3 0 4 0 0 0 0 0 0 103 11 40 11 33 6 0 8 34 11 57 2 0 0 4 8 0 0 0 4 0 1 0 0 0 1 0 1 5 0 0 0 0 0 1 0 0 5 0 0 0 0 0 0 0 24
osa-miR166b-3p UCGGACCAGGCUUCAUUCCCC 21 833,667 13,233 53,165 594    12,986 1,572 13,528 33,021 4,591 21,829 14,092 22,383 9,045 9,922 22,509 2,139 6,326 2,729 2,147 1,242 1,190 7,571 38,144 37,997 49,520 22,673 53,165 22,694 15,605 24,257 51,972 32,968 30,197 25,746 45,925 2,088 9,382 11,494 11,782 3,753 2,840 3,739 11,614 7,082 6,934 10,360 5,308 7,154 7,325 3,132 6,131 5,478 4,054 9,931 10,293 986 14,275 4,680 9,902 3,338 594 6,552 2,073 1,641 4,020 3,399 2,648
osa-miR166b-5p GGAAUGUUGUCUGGCUCGGGG 21 806 13 117 1    54 9 6 49 3 61 4 117 0 0 8 0 0 0 0 0 1 52 3 0 12 0 5 36 4 17 6 43 4 0 8 8 30 0 4 0 11 3 2 0 5 8 3 30 33 53 16 7 4 4 9 7 0 2 0 6 0 0 0 1 0 0 58
osa-miR166c-3p UCGGACCAGGCUUCAUUCCCC 21 833,667 13,233 53,165 594    12,986 1,572 13,528 33,021 4,591 21,829 14,092 22,383 9,045 9,922 22,509 2,139 6,326 2,729 2,147 1,242 1,190 7,571 38,144 37,997 49,520 22,673 53,165 22,694 15,605 24,257 51,972 32,968 30,197 25,746 45,925 2,088 9,382 11,494 11,782 3,753 2,840 3,739 11,614 7,082 6,934 10,360 5,308 7,154 7,325 3,132 6,131 5,478 4,054 9,931 10,293 986 14,275 4,680 9,902 3,338 594 6,552 2,073 1,641 4,020 3,399 2,648
osa-miR166c-5p GGAAUGUUGUCUGGUCCGAG 20 2 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR166d-3p UCGGACCAGGCUUCAUUCCCC 21 833,667 13,233 53,165 594    12,986 1,572 13,528 33,021 4,591 21,829 14,092 22,383 9,045 9,922 22,509 2,139 6,326 2,729 2,147 1,242 1,190 7,571 38,144 37,997 49,520 22,673 53,165 22,694 15,605 24,257 51,972 32,968 30,197 25,746 45,925 2,088 9,382 11,494 11,782 3,753 2,840 3,739 11,614 7,082 6,934 10,360 5,308 7,154 7,325 3,132 6,131 5,478 4,054 9,931 10,293 986 14,275 4,680 9,902 3,338 594 6,552 2,073 1,641 4,020 3,399 2,648
osa-miR166d-5p GGAAUGUUGUCUGGCUCGAGG 21 672 11 79 1    64 18 6 79 1 79 6 74 16 0 0 0 0 0 3 0 0 0 9 16 10 13 3 18 8 25 11 0 5 0 19 0 17 0 13 7 9 3 7 0 10 0 7 0 19 4 4 4 2 11 10 5 5 1 5 0 0 0 0 1 0 1 44
osa-miR166e-3p UCGAACCAGGCUUCAUUCCCC 21 695 11 61 1    6 0 6 6 0 12 3 8 4 0 20 0 18 0 0 0 0 0 10 24 11 0 16 18 9 0 16 0 10 31 13 0 8 0 3 21 1 0 7 0 3 8 2 25 20 35 23 26 14 15 19 4 42 12 15 6 8 14 0 6 61 35 21
osa-miR166e-5p GGAAUGUUGUCUGGUUCAAGG 21 547 9 103 1    71 26 4 12 0 22 2 33 3 0 4 0 0 0 0 0 0 103 11 40 11 33 6 0 8 34 11 57 2 0 0 4 8 0 0 0 4 0 1 0 0 0 1 0 1 5 0 0 0 0 0 1 0 0 5 0 0 0 0 0 0 0 24
osa-miR166f UCGGACCAGGCUUCAUUCCCC 21 833,667 13,233 53,165 594    12,986 1,572 13,528 33,021 4,591 21,829 14,092 22,383 9,045 9,922 22,509 2,139 6,326 2,729 2,147 1,242 1,190 7,571 38,144 37,997 49,520 22,673 53,165 22,694 15,605 24,257 51,972 32,968 30,197 25,746 45,925 2,088 9,382 11,494 11,782 3,753 2,840 3,739 11,614 7,082 6,934 10,360 5,308 7,154 7,325 3,132 6,131 5,478 4,054 9,931 10,293 986 14,275 4,680 9,902 3,338 594 6,552 2,073 1,641 4,020 3,399 2,648
osa-miR166g-3p UCGGACCAGGCUUCAUUCCUC 21 109,315 1,735 6,144 202    1,985 202 2,106 5,959 856 3,423 2,489 2,913 1,317 1,369 2,791 353 858 700 473 317 247 216 806 1,135 1,027 640 1,031 667 320 897 967 1,465 618 839 717 321 1,852 1,551 2,721 707 621 580 2,441 1,272 1,093 2,022 891 3,352 3,511 1,967 3,467 3,243 2,307 3,946 4,042 482 4,497 3,061 6,144 2,390 468 4,564 1,207 1,039 1,438 1,333 1,082
osa-miR166g-5p AAUGGAGGCUGAUCCAAGAUC 21 250 4 45 1    5 0 4 0 1 6 0 2 3 0 0 0 0 0 0 14 2 0 5 0 7 7 10 27 12 0 4 0 4 0 6 0 45 0 4 7 4 0 0 4 3 0 0 0 3 25 8 4 1 8 0 0 0 0 0 13 0 0 0 1 0 0 1
osa-miR166h-3p UCGGACCAGGCUUCAUUCCUC 21 109,315 1,735 6,144 202    1,985 202 2,106 5,959 856 3,423 2,489 2,913 1,317 1,369 2,791 353 858 700 473 317 247 216 806 1,135 1,027 640 1,031 667 320 897 967 1,465 618 839 717 321 1,852 1,551 2,721 707 621 580 2,441 1,272 1,093 2,022 891 3,352 3,511 1,967 3,467 3,243 2,307 3,946 4,042 482 4,497 3,061 6,144 2,390 468 4,564 1,207 1,039 1,438 1,333 1,082
osa-miR166h-5p GGAAUGUUGGCUGGCUCGAGG 21 317 5 173 1    26 0 2 12 14 14 1 20 34 0 0 0 0 0 0 0 3 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 2 0 4 0 1 1 0 0 0 0 0 0 0 0 0 6 0 0 0 0 0 1 173
osa-miR166i-3p UCGGAUCAGGCUUCAUUCCUC 21 318 5 23 1    3 0 6 18 1 8 7 4 3 23 8 0 0 0 2 14 1 0 5 0 3 0 6 18 1 0 2 14 0 16 2 0 6 11 8 0 0 3 4 4 4 19 2 4 9 4 12 2 8 0 4 1 10 10 0 6 0 0 0 9 0 8 5
osa-miR166i-5p AAUGCAGUUUGAUCCAAGAUC 21 21 0 16 1    1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 16 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1
osa-miR166j-3p UCGGACCAGGCUUCAUUCCCC 21 833,667 13,233 53,165 594    12,986 1,572 13,528 33,021 4,591 21,829 14,092 22,383 9,045 9,922 22,509 2,139 6,326 2,729 2,147 1,242 1,190 7,571 38,144 37,997 49,520 22,673 53,165 22,694 15,605 24,257 51,972 32,968 30,197 25,746 45,925 2,088 9,382 11,494 11,782 3,753 2,840 3,739 11,614 7,082 6,934 10,360 5,308 7,154 7,325 3,132 6,131 5,478 4,054 9,931 10,293 986 14,275 4,680 9,902 3,338 594 6,552 2,073 1,641 4,020 3,399 2,648
osa-miR166j-5p GAAUGACGUCCGGUCUGAAGA 21 575 9 105 1    1 53 30 2 4 0 0 4 16 0 4 0 0 0 0 0 1 0 0 0 1 0 1 0 1 0 1 0 3 0 0 16 26 22 10 14 105 16 27 4 10 0 4 59 54 5 4 3 0 4 4 34 16 14 0 0 0 0 0 0 0 0 2
osa-miR166k-3p UCGGACCAGGCUUCAAUCCCU 21 99,786 1,584 5,316 16    1,046 184 2,487 2,825 1,066 1,893 2,654 1,641 1,577 1,642 3,176 242 858 780 602 483 315 0 53 64 75 39 27 27 24 85 48 101 61 16 21 651 4,369 2,511 5,316 1,039 1,689 846 4,492 1,602 1,875 2,760 1,360 4,240 4,097 2,065 3,740 3,364 2,374 3,583 3,272 517 3,671 3,780 4,119 1,201 326 2,903 1,021 805 999 829 258
osa-miR166k-5p GGUUUGUUGUCUGGCUCGAGG 21 149 2 91 1    8 0 0 6 1 8 2 10 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 2 0 0 0 1 0 2 0 4 1 0 0 0 0 0 0 0 6 0 0 0 1 0 0 91
osa-miR166l-3p UCGGACCAGGCUUCAAUCCCU 21 99,786 1,584 5,316 16    1,046 184 2,487 2,825 1,066 1,893 2,654 1,641 1,577 1,642 3,176 242 858 780 602 483 315 0 53 64 75 39 27 27 24 85 48 101 61 16 21 651 4,369 2,511 5,316 1,039 1,689 846 4,492 1,602 1,875 2,760 1,360 4,240 4,097 2,065 3,740 3,364 2,374 3,583 3,272 517 3,671 3,780 4,119 1,201 326 2,903 1,021 805 999 829 258
osa-miR166l-5p GGAUUGUUGUCUGGUUCAAGG 21 6 0 4 1    1 0 0 0 0 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1
osa-miR166m UCGGACCAGGCUUCAUUCCCU 21 7,860 125 578 9    52 18 158 159 57 65 210 64 113 46 101 9 37 16 34 14 14 93 452 432 578 170 535 169 191 220 519 575 246 249 564 12 99 82 124 28 36 57 113 97 97 114 69 72 42 31 55 27 51 31 47 15 52 45 79 19 17 34 41 20 49 33 12
osa-miR167a-3p AUCAUGCAUGACAGCCUCAUUU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR167a-5p UGAAGCUGCCAGCAUGAUCUA 21 108,148 1,717 11,244 43    10,086 518 647 10,138 946 11,244 888 5,073 1,330 753 1,568 586 1,269 255 234 607 441 165 603 911 1,453 418 938 1,040 950 669 746 43 360 1,461 502 807 2,807 2,010 1,979 834 1,379 1,258 2,557 792 2,846 910 2,140 1,606 1,639 1,400 1,704 1,626 1,000 852 732 628 602 1,708 1,337 910 627 2,268 763 712 2,875 2,509 5,489
osa-miR167b UGAAGCUGCCAGCAUGAUCUA 21 108,148 1,717 11,244 43    10,086 518 647 10,138 946 11,244 888 5,073 1,330 753 1,568 586 1,269 255 234 607 441 165 603 911 1,453 418 938 1,040 950 669 746 43 360 1,461 502 807 2,807 2,010 1,979 834 1,379 1,258 2,557 792 2,846 910 2,140 1,606 1,639 1,400 1,704 1,626 1,000 852 732 628 602 1,708 1,337 910 627 2,268 763 712 2,875 2,509 5,489
osa-miR167c-3p GGUCAUGCUGCGGCAGCCUCACU 23 308 5 31 1    2 0 8 0 0 0 11 1 16 0 4 0 0 0 0 0 0 0 1 8 1 0 2 18 4 8 3 0 1 31 6 4 0 7 0 0 1 3 0 0 7 15 3 8 10 28 0 0 1 8 4 6 5 15 5 25 8 0 0 12 0 5 3
osa-miR167c-5p UGAAGCUGCCAGCAUGAUCUA 21 108,148 1,717 11,244 43    10,086 518 647 10,138 946 11,244 888 5,073 1,330 753 1,568 586 1,269 255 234 607 441 165 603 911 1,453 418 938 1,040 950 669 746 43 360 1,461 502 807 2,807 2,010 1,979 834 1,379 1,258 2,557 792 2,846 910 2,140 1,606 1,639 1,400 1,704 1,626 1,000 852 732 628 602 1,708 1,337 910 627 2,268 763 712 2,875 2,509 5,489
osa-miR167d-3p GAUCAUGCUGUGCAGUUUCAUC 22 265 4 36 1    5 0 9 0 0 2 0 2 3 0 4 0 0 0 1 14 0 0 1 16 2 0 1 9 1 0 2 0 0 0 0 16 19 15 4 7 8 6 7 0 3 0 0 17 26 36 0 1 0 0 0 6 0 6 0 13 0 0 0 1 0 0 2
osa-miR167d-5p UGAAGCUGCCAGCAUGAUCUG 21 68,124 1,081 6,920 24    6,920 61 186 6,480 636 6,844 196 4,075 1,476 160 1,450 279 146 24 25 124 187 41 1,023 1,582 2,306 85 1,347 542 1,112 110 1,279 72 514 1,072 825 96 1,289 1,252 985 156 300 783 3,818 128 2,611 221 1,433 1,032 1,170 525 1,962 1,884 367 176 166 149 769 1,525 277 120 100 1,141 72 59 792 760 827
osa-miR167e-3p AGAUCAUGUUGCAGCUUCACU 21 1,508 24 441 1    441 0 6 147 14 223 0 138 1 11 0 0 0 0 11 83 52 0 1 0 1 0 0 9 2 0 0 0 0 0 0 4 79 0 1 14 3 38 0 0 41 0 13 38 21 5 58 20 1 0 1 1 5 0 0 13 0 0 0 0 0 1 11
osa-miR167e-5p UGAAGCUGCCAGCAUGAUCUG 21 68,124 1,081 6,920 24    6,920 61 186 6,480 636 6,844 196 4,075 1,476 160 1,450 279 146 24 25 124 187 41 1,023 1,582 2,306 85 1,347 542 1,112 110 1,279 72 514 1,072 825 96 1,289 1,252 985 156 300 783 3,818 128 2,611 221 1,433 1,032 1,170 525 1,962 1,884 367 176 166 149 769 1,525 277 120 100 1,141 72 59 792 760 827
osa-miR167f UGAAGCUGCCAGCAUGAUCUG 21 68,124 1,081 6,920 24    6,920 61 186 6,480 636 6,844 196 4,075 1,476 160 1,450 279 146 24 25 124 187 41 1,023 1,582 2,306 85 1,347 542 1,112 110 1,279 72 514 1,072 825 96 1,289 1,252 985 156 300 783 3,818 128 2,611 221 1,433 1,032 1,170 525 1,962 1,884 367 176 166 149 769 1,525 277 120 100 1,141 72 59 792 760 827
osa-miR167g UGAAGCUGCCAGCAUGAUCUG 21 68,124 1,081 6,920 24    6,920 61 186 6,480 636 6,844 196 4,075 1,476 160 1,450 279 146 24 25 124 187 41 1,023 1,582 2,306 85 1,347 542 1,112 110 1,279 72 514 1,072 825 96 1,289 1,252 985 156 300 783 3,818 128 2,611 221 1,433 1,032 1,170 525 1,962 1,884 367 176 166 149 769 1,525 277 120 100 1,141 72 59 792 760 827
osa-miR167h-3p AGGUCAUGCUGUAGUUUCAUC 21 101 2 26 1    7 0 0 8 1 12 3 0 1 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 26 4 4 0 1 0 3 0 1 0 0 8 5 1 4 5 0 0 0 1 0 0 0 0 0 0 0 0 0 0 3
osa-miR167h-5p UGAAGCUGCCAGCAUGAUCUG 21 68,124 1,081 6,920 24    6,920 61 186 6,480 636 6,844 196 4,075 1,476 160 1,450 279 146 24 25 124 187 41 1,023 1,582 2,306 85 1,347 542 1,112 110 1,279 72 514 1,072 825 96 1,289 1,252 985 156 300 783 3,818 128 2,611 221 1,433 1,032 1,170 525 1,962 1,884 367 176 166 149 769 1,525 277 120 100 1,141 72 59 792 760 827
osa-miR167i-3p AGAUCAUGUUGCAGCUUCACU 21 1,508 24 441 1    441 0 6 147 14 223 0 138 1 11 0 0 0 0 11 83 52 0 1 0 1 0 0 9 2 0 0 0 0 0 0 4 79 0 1 14 3 38 0 0 41 0 13 38 21 5 58 20 1 0 1 1 5 0 0 13 0 0 0 0 0 1 11
osa-miR167i-5p UGAAGCUGCCAGCAUGAUCUG 21 68,124 1,081 6,920 24    6,920 61 186 6,480 636 6,844 196 4,075 1,476 160 1,450 279 146 24 25 124 187 41 1,023 1,582 2,306 85 1,347 542 1,112 110 1,279 72 514 1,072 825 96 1,289 1,252 985 156 300 783 3,818 128 2,611 221 1,433 1,032 1,170 525 1,962 1,884 367 176 166 149 769 1,525 277 120 100 1,141 72 59 792 760 827
osa-miR167j UGAAGCUGCCAGCAUGAUCUG 21 68,124 1,081 6,920 24    6,920 61 186 6,480 636 6,844 196 4,075 1,476 160 1,450 279 146 24 25 124 187 41 1,023 1,582 2,306 85 1,347 542 1,112 110 1,279 72 514 1,072 825 96 1,289 1,252 985 156 300 783 3,818 128 2,611 221 1,433 1,032 1,170 525 1,962 1,884 367 176 166 149 769 1,525 277 120 100 1,141 72 59 792 760 827
osa-miR168a-3p GAUCCCGCCUUGCACCAAGUGAAU 24 1,267 20 166 1    66 18 41 69 22 166 12 122 5 23 16 9 37 0 3 0 1 10 12 0 8 0 10 9 16 8 13 29 16 31 8 68 16 4 4 49 18 60 8 13 36 27 52 25 21 3 23 30 1 11 9 6 0 1 0 0 0 0 0 0 0 0 2
osa-miR168a-5p UCGCUUGGUGCAGAUCGGGAC 21 12,534,893 198,967 529,208 6,595    333,129 161,174 131,429 334,994 165,961 358,168 353,365 235,055 248,469 44,240 173,696 15,857 69,022 6,595 7,842 6,706 7,517 235,787 19,230 395,536 23,845 365,836 267,266 249,687 206,799 395,755 304,453 383,181 309,865 191,391 299,776 162,170 386,468 207,199 399,341 186,873 248,647 273,094 305,681 360,065 190,594 268,859 213,176 78,500 74,558 188,163 99,322 88,698 529,208 322,966 345,752 386,761 278,684 227,847 129,513 98,079 21,754 9,817 19,227 26,525 37,815 44,110 23,801
osa-miR168b AGGCUUGGUGCAGCUCGGGAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR169a CAGCCAAGGAUGACUUGCCGA 21 15,345 244 1,892 7    29 149 103 39 125 51 236 31 146 46 296 19 219 0 7 14 16 82 94 144 127 33 81 44 54 347 98 201 59 264 77 317 1,892 355 1,788 127 505 60 113 594 288 971 208 132 243 333 148 307 972 160 225 187 161 222 1,193 57 67 102 72 118 49 81 67
osa-miR169b CAGCCAAGGAUGACUUGCCGG 21 67,585 1,073 9,642 3    122 255 150 175 254 265 177 88 246 251 2,682 84 310 0 3 0 11 216 429 4,387 654 255 449 222 160 601 420 546 189 1,321 253 261 3,454 3,793 3,786 283 867 431 2,724 449 799 2,155 459 1,406 1,696 1,439 1,111 1,091 4,888 722 643 1,110 1,065 9,642 3,060 651 360 3,874 21 12 73 45 40
osa-miR169c CAGCCAAGGAUGACUUGCCGG 21 67,585 1,073 9,642 3    122 255 150 175 254 265 177 88 246 251 2,682 84 310 0 3 0 11 216 429 4,387 654 255 449 222 160 601 420 546 189 1,321 253 261 3,454 3,793 3,786 283 867 431 2,724 449 799 2,155 459 1,406 1,696 1,439 1,111 1,091 4,888 722 643 1,110 1,065 9,642 3,060 651 360 3,874 21 12 73 45 40
osa-miR169d UAGCCAAGGAUGAAUUGCCGG 21 87 1 30 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 0 0 0 0 0 0 0 0 0 1 4 0 0 4 0 1 5 0 12 30 6 0 14 0 0 0 1 5
osa-miR169e UAGCCAAGGAUGACUUGCCGG 21 3,735 59 1,107 1    0 9 2 0 4 0 7 0 4 0 4 9 0 0 0 0 0 10 1 16 1 0 0 9 0 0 1 0 0 0 0 4 47 4 127 7 43 3 17 0 3 23 1 47 49 92 70 49 195 23 15 66 73 1,026 193 101 42 1,107 0 12 37 43 139
osa-miR169f.1 UAGCCAAGGAUGACUUGCCUA 21 63,643 1,010 18,056 2    5 703 207 8 574 14 509 2 421 182 425 121 292 0 2 0 2 536 44 160 45 85 43 204 7 508 43 201 46 1,227 50 1,378 18,056 519 10,160 177 3,932 311 290 942 169 1,645 111 1,143 1,439 1,165 2,047 2,344 1,045 1,501 1,758 1,794 2,487 545 827 455 635 102 0 0 0 0 0
osa-miR169f.2 UGAGGACAAGAGCUGAUUCGG 21 7,090 113 687 1    100 35 36 393 138 411 109 68 277 23 16 9 37 0 6 0 4 93 474 56 447 33 568 53 266 68 520 460 551 140 687 28 28 11 42 21 78 13 26 40 238 69 191 21 20 7 4 12 8 11 7 96 10 17 0 0 8 0 0 1 0 3 2
osa-miR169g UAGCCAAGGAUGACUUGCCUA 21 63,643 1,010 18,056 2    5 703 207 8 574 14 509 2 421 182 425 121 292 0 2 0 2 536 44 160 45 85 43 204 7 508 43 201 46 1,227 50 1,378 18,056 519 10,160 177 3,932 311 290 942 169 1,645 111 1,143 1,439 1,165 2,047 2,344 1,045 1,501 1,758 1,794 2,487 545 827 455 635 102 0 0 0 0 0
osa-miR169h UAGCCAAGGAUGACUUGCCUG 21 137,327 2,180 22,145 1    127 2,222 2,122 92 2,651 116 1,130 76 1,913 1,791 474 893 785 32 16 14 49 2,318 320 416 371 2,592 266 2,987 89 2,912 251 546 196 7,085 240 3,831 13,139 631 22,145 2,849 9,349 3,086 683 1,747 1,144 5,193 460 4,886 6,001 751 4,380 4,611 2,574 1,597 1,712 2,216 3,178 927 3,050 386 1,413 137 62 67 12 17 1
osa-miR169i-3p UGAGUCGCUCUUAUCACUCAUG 22 4,305 68 735 1    51 70 83 35 36 30 128 45 65 91 8 0 9 0 3 0 2 62 12 0 21 59 13 27 8 203 23 0 11 16 8 181 198 22 46 57 226 48 9 180 50 30 23 616 735 20 160 231 4 92 98 40 21 3 10 0 0 7 41 25 12 1 0
osa-miR169i-5p.1 UAGCCAAGGAUGACUUGCCUG 21 137,327 2,180 22,145 1    127 2,222 2,122 92 2,651 116 1,130 76 1,913 1,791 474 893 785 32 16 14 49 2,318 320 416 371 2,592 266 2,987 89 2,912 251 546 196 7,085 240 3,831 13,139 631 22,145 2,849 9,349 3,086 683 1,747 1,144 5,193 460 4,886 6,001 751 4,380 4,611 2,574 1,597 1,712 2,216 3,178 927 3,050 386 1,413 137 62 67 12 17 1
osa-miR169i-5p.2 UGGUGAUAAGGGUGUAGCUCUG 22 15 0 8 1    0 0 0 0 0 2 2 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 8 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR169j UAGCCAAGGAUGACUUGCCUG 21 137,327 2,180 22,145 1    127 2,222 2,122 92 2,651 116 1,130 76 1,913 1,791 474 893 785 32 16 14 49 2,318 320 416 371 2,592 266 2,987 89 2,912 251 546 196 7,085 240 3,831 13,139 631 22,145 2,849 9,349 3,086 683 1,747 1,144 5,193 460 4,886 6,001 751 4,380 4,611 2,574 1,597 1,712 2,216 3,178 927 3,050 386 1,413 137 62 67 12 17 1
osa-miR169k UAGCCAAGGAUGACUUGCCUG 21 137,327 2,180 22,145 1    127 2,222 2,122 92 2,651 116 1,130 76 1,913 1,791 474 893 785 32 16 14 49 2,318 320 416 371 2,592 266 2,987 89 2,912 251 546 196 7,085 240 3,831 13,139 631 22,145 2,849 9,349 3,086 683 1,747 1,144 5,193 460 4,886 6,001 751 4,380 4,611 2,574 1,597 1,712 2,216 3,178 927 3,050 386 1,413 137 62 67 12 17 1
osa-miR169l UAGCCAAGGAUGACUUGCCUG 21 137,327 2,180 22,145 1    127 2,222 2,122 92 2,651 116 1,130 76 1,913 1,791 474 893 785 32 16 14 49 2,318 320 416 371 2,592 266 2,987 89 2,912 251 546 196 7,085 240 3,831 13,139 631 22,145 2,849 9,349 3,086 683 1,747 1,144 5,193 460 4,886 6,001 751 4,380 4,611 2,574 1,597 1,712 2,216 3,178 927 3,050 386 1,413 137 62 67 12 17 1
osa-miR169m UAGCCAAGGAUGACUUGCCUG 21 137,327 2,180 22,145 1    127 2,222 2,122 92 2,651 116 1,130 76 1,913 1,791 474 893 785 32 16 14 49 2,318 320 416 371 2,592 266 2,987 89 2,912 251 546 196 7,085 240 3,831 13,139 631 22,145 2,849 9,349 3,086 683 1,747 1,144 5,193 460 4,886 6,001 751 4,380 4,611 2,574 1,597 1,712 2,216 3,178 927 3,050 386 1,413 137 62 67 12 17 1
osa-miR169n UAGCCAAGAAUGACUUGCCUA 21 23,432 372 3,355 2    7 97 107 10 404 18 207 7 441 34 57 37 100 0 3 14 35 93 36 24 43 13 24 89 4 212 48 86 51 451 46 197 3,355 116 2,259 35 473 82 72 282 143 651 91 1,092 1,345 704 1,603 1,715 548 546 566 359 2,285 211 659 537 234 123 41 53 85 170 2
osa-miR169o UAGCCAAGAAUGACUUGCCUA 21 23,432 372 3,355 2    7 97 107 10 404 18 207 7 441 34 57 37 100 0 3 14 35 93 36 24 43 13 24 89 4 212 48 86 51 451 46 197 3,355 116 2,259 35 473 82 72 282 143 651 91 1,092 1,345 704 1,603 1,715 548 546 566 359 2,285 211 659 537 234 123 41 53 85 170 2
osa-miR169p UAGCCAAGGACAAACUUGCCGG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR169q UAGCCAAGGAGACUGCCCAUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR169r-3p UGGCAAGUCUCCUCGGCUACC 21 102 2 25 1    3 0 0 4 0 4 0 2 0 0 0 0 0 0 0 0 0 0 1 8 0 0 0 0 0 0 0 0 0 0 0 4 10 7 1 0 0 0 1 4 1 0 0 25 13 1 0 1 0 0 2 0 5 5 0 0 0 0 0 0 0 0 0
osa-miR169r-5p UAGCCAAGGAUGAUUUGCCUG 21 262 4 68 1    1 9 2 0 4 0 2 0 0 0 4 0 0 0 0 0 0 0 1 0 2 7 2 0 0 17 0 0 0 16 0 4 26 0 68 7 11 3 9 9 2 15 0 4 4 1 0 2 6 0 2 4 0 10 0 0 8 0 0 0 0 0 0
osa-miR171a UGAUUGAGCCGCGCCAAUAUC 21 138 2 22 1    0 9 0 0 0 0 0 0 1 0 0 9 0 0 0 0 0 0 0 0 0 7 0 18 0 0 0 0 0 16 0 12 22 4 5 0 4 0 4 0 0 0 0 0 4 7 4 2 2 0 1 2 0 1 0 0 0 0 0 0 0 4 0
osa-miR171b UGAUUGAGCCGUGCCAAUAUC 21 44,217 702 6,690 21    341 1,431 171 224 129 355 98 284 849 992 1,884 335 840 127 181 69 106 762 108 1,263 197 692 214 1,253 164 1,058 117 201 47 5,034 173 1,619 6,690 2,048 2,181 1,032 1,774 906 1,327 876 312 929 168 680 216 242 191 160 80 172 77 61 556 127 198 664 184 417 21 34 280 242 54
osa-miR171c-3p UGAUUGAGCCGUGCCAAUAUC 21 44,217 702 6,690 21    341 1,431 171 224 129 355 98 284 849 992 1,884 335 840 127 181 69 106 762 108 1,263 197 692 214 1,253 164 1,058 117 201 47 5,034 173 1,619 6,690 2,048 2,181 1,032 1,774 906 1,327 876 312 929 168 680 216 242 191 160 80 172 77 61 556 127 198 664 184 417 21 34 280 242 54
osa-miR171c-5p GGAUAUUGGUGCGGUUCAAUC 21 329 5 36 1    12 9 0 18 3 14 1 21 9 0 4 0 0 0 3 0 0 21 1 24 5 20 2 36 8 0 2 0 0 31 2 8 3 0 1 0 7 10 4 0 3 4 0 0 4 4 0 4 1 0 1 4 0 0 0 13 0 0 0 1 0 0 11
osa-miR171d-3p UGAUUGAGCCGUGCCAAUAUC 21 44,217 702 6,690 21    341 1,431 171 224 129 355 98 284 849 992 1,884 335 840 127 181 69 106 762 108 1,263 197 692 214 1,253 164 1,058 117 201 47 5,034 173 1,619 6,690 2,048 2,181 1,032 1,774 906 1,327 876 312 929 168 680 216 242 191 160 80 172 77 61 556 127 198 664 184 417 21 34 280 242 54
osa-miR171d-5p UGUUGGCCCGGCUCACUCAGA 21 253 4 77 1    5 0 0 0 7 0 1 6 16 11 4 0 0 0 3 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 24 11 7 5 0 8 3 2 4 4 4 3 0 1 9 0 2 1 0 2 1 0 4 5 19 0 0 0 0 0 1 77
osa-miR171e-3p UGAUUGAGCCGUGCCAAUAUC 21 44,217 702 6,690 21    341 1,431 171 224 129 355 98 284 849 992 1,884 335 840 127 181 69 106 762 108 1,263 197 692 214 1,253 164 1,058 117 201 47 5,034 173 1,619 6,690 2,048 2,181 1,032 1,774 906 1,327 876 312 929 168 680 216 242 191 160 80 172 77 61 556 127 198 664 184 417 21 34 280 242 54
osa-miR171e-5p UGUUGGCUCGGCUCACUCAGA 21 612 10 62 1    8 0 24 8 3 6 13 8 62 23 28 0 9 8 7 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 48 15 37 15 14 37 3 9 13 5 23 3 4 12 22 0 2 6 15 6 14 5 13 10 13 0 7 0 1 12 5 35
osa-miR171f-3p UGAUUGAGCCGUGCCAAUAUC 21 44,217 702 6,690 21    341 1,431 171 224 129 355 98 284 849 992 1,884 335 840 127 181 69 106 762 108 1,263 197 692 214 1,253 164 1,058 117 201 47 5,034 173 1,619 6,690 2,048 2,181 1,032 1,774 906 1,327 876 312 929 168 680 216 242 191 160 80 172 77 61 556 127 198 664 184 417 21 34 280 242 54
osa-miR171f-5p UGUUGGCAUGGUUCAAUCAAA 21 5,827 92 907 1    0 105 227 4 145 2 43 2 182 23 45 0 0 16 21 0 17 247 174 136 153 313 170 907 203 254 75 101 64 668 161 40 334 30 95 21 49 41 32 13 9 23 3 76 64 278 0 3 4 19 29 79 21 50 10 44 0 0 0 1 0 1 0
osa-miR171g GAGGUGAGCCGAGCCAAUAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR171h GUGAGCCGAACCAAUAUCACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR171i-3p GGAUUGAGCCGCGUCAAUAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR171i-5p AGGUAUUGGCGUGCCUCAAUC 21 163 3 38 1    0 0 2 0 3 0 1 3 4 0 0 0 0 8 6 28 10 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 2 0 1 0 4 3 1 0 0 4 0 0 1 8 0 0 0 0 0 0 0 5 0 38 0 0 0 0 0 0 30
osa-miR172a AGAAUCUUGAUGAUGCUGCAU 21 340,978 5,412 37,686 129    2,583 5,418 12,928 1,875 3,157 2,566 3,550 2,030 10,854 6,991 3,630 549 2,775 19,443 24,812 4,802 5,874 536 312 567 519 1,136 314 462 1,312 542 310 187 129 792 146 5,562 37,686 5,646 11,956 11,345 8,820 2,820 5,317 9,199 11,313 13,300 8,360 2,290 2,622 1,979 3,050 3,174 1,652 2,960 3,245 1,485 4,466 1,566 9,343 8,693 5,100 3,983 4,209 5,225 9,783 12,268 1,460
osa-miR172b GGAAUCUUGAUGAUGCUGCAU 21 15,933 253 1,969 1    3 9 56 2 10 0 13 3 34 23 12 0 9 40 34 0 14 0 0 0 1 0 0 0 1 8 1 0 0 31 2 8 32 15 13 14 20 0 5 26 7 23 1 1,177 1,295 517 842 979 493 470 424 699 800 276 777 575 468 273 784 932 1,693 1,969 20
osa-miR172c UGAAUCUUGAUGAUGCUGCAC 21 734 12 109 1    6 0 8 4 10 6 3 5 18 0 8 0 9 0 1 0 0 0 40 24 73 13 66 62 57 51 26 0 23 109 44 0 3 0 2 7 5 10 3 4 4 0 10 0 0 0 0 0 0 0 0 0 0 0 20 0 0 0 0 0 0 0 0
osa-miR172d-3p AGAAUCUUGAUGAUGCUGCAU 21 340,978 5,412 37,686 129    2,583 5,418 12,928 1,875 3,157 2,566 3,550 2,030 10,854 6,991 3,630 549 2,775 19,443 24,812 4,802 5,874 536 312 567 519 1,136 314 462 1,312 542 310 187 129 792 146 5,562 37,686 5,646 11,956 11,345 8,820 2,820 5,317 9,199 11,313 13,300 8,360 2,290 2,622 1,979 3,050 3,174 1,652 2,960 3,245 1,485 4,466 1,566 9,343 8,693 5,100 3,983 4,209 5,225 9,783 12,268 1,460
osa-miR172d-5p GCAGCACCAUCAAGAUUCAC 20 94 1 20 1    11 0 0 14 1 10 2 20 0 0 0 0 9 0 1 0 0 0 0 0 0 7 1 0 0 0 1 0 0 0 0 0 3 0 4 0 3 3 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 2
osa-miR1846a-3p UGACCCCGUUCUCCUCGCCGG 21 23 0 6 1    0 0 0 0 0 0 0 3 0 0 0 0 0 0 1 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 4 0 0 1 2 0 0 0 0 1 0 0 1 0 6 0 0 0 0 0 0 1
osa-miR1846a-5p AGUGAGGAGGCCGGGGCCGCU 21 198 3 28 1    2 0 4 6 1 2 4 1 7 0 4 0 0 8 0 0 28 0 1 8 1 0 3 0 3 0 0 14 0 16 0 8 1 4 1 7 0 6 0 4 1 19 3 0 1 1 0 1 2 4 1 3 0 4 0 13 0 0 0 0 0 0 1
osa-miR1846b-3p UGACCCCGUUCUCCUCGCCGG 21 23 0 6 1    0 0 0 0 0 0 0 3 0 0 0 0 0 0 1 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 4 0 0 1 2 0 0 0 0 1 0 0 1 0 6 0 0 0 0 0 0 1
osa-miR1846b-5p AGUGAGGAGGCCGGGGCCGCU 21 198 3 28 1    2 0 4 6 1 2 4 1 7 0 4 0 0 8 0 0 28 0 1 8 1 0 3 0 3 0 0 14 0 16 0 8 1 4 1 7 0 6 0 4 1 19 3 0 1 1 0 1 2 4 1 3 0 4 0 13 0 0 0 0 0 0 1
osa-miR1846c-3p UGACCCCGGUCUGCUCGCUGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1846c-5p AGUGAGGAGGCCGGGGCCGCU 21 198 3 28 1    2 0 4 6 1 2 4 1 7 0 4 0 0 8 0 0 28 0 1 8 1 0 3 0 3 0 0 14 0 16 0 8 1 4 1 7 0 6 0 4 1 19 3 0 1 1 0 1 2 4 1 3 0 4 0 13 0 0 0 0 0 0 1
osa-miR1846d-3p UAUCCGGCGCCGCAGGGAGG 20 24 0 4 1    1 0 2 2 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 1 0 1 0 0 0 0 0 0 4 0 0 3 0 0 4 1 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0
osa-miR1846d-5p UCCCACCGAGCAGCCGGAUCUC 22 72 1 9 1    0 0 4 4 1 4 0 1 1 0 0 9 0 0 0 0 0 0 1 0 2 0 0 0 1 0 1 0 1 0 0 0 1 0 1 0 0 0 1 4 0 0 1 8 8 5 0 1 3 4 2 1 0 2 0 0 0 0 0 0 0 0 0
osa-miR1846e CAACGAGGAGGCCGGGACCA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1847.1 UGCAGUUUGCAGUUGUGGCAC 21 196 3 16 1    9 0 4 6 3 10 1 0 5 11 0 0 0 0 2 0 3 10 1 0 3 0 2 0 3 8 0 0 1 16 0 4 8 0 6 14 3 6 2 0 4 8 6 0 1 4 4 2 1 4 5 1 0 2 10 0 0 0 0 2 0 0 1
osa-miR1847.2 UGGCCCACAUGUUAGUGCCACAAC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1848 CCUCGCCGGCGCGCGCGUGCA 21 32 1 8 1    0 0 2 0 4 0 1 0 0 0 0 0 0 0 0 0 2 0 0 0 1 0 0 0 1 0 2 0 1 0 8 0 0 0 0 0 0 3 0 0 0 4 0 0 0 0 0 1 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0
osa-miR1849 UAUCGUAUCCUAGGUUGGUUU 21 64 1 14 1    3 0 0 14 0 4 0 5 0 0 0 0 0 0 0 0 0 0 0 0 1 7 2 0 1 0 1 0 1 0 0 4 3 0 0 0 5 0 0 0 1 0 3 0 3 0 0 1 0 0 0 4 0 0 0 0 0 0 0 0 0 0 1
osa-miR1850.1 UGGAAAGUUGGGAGAUUGGGG 21 10,550 167 1,469 1    1,173 9 94 1,325 79 1,469 26 1,267 169 23 8 0 0 24 13 14 17 41 353 128 377 614 375 507 391 279 211 359 117 280 209 20 56 0 43 71 4 38 2 31 43 30 35 13 16 22 19 5 5 8 7 1 0 3 0 44 0 0 0 0 12 8 63
osa-miR1850.2 UUGUGUGUGAACUAAACGUGG 21 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1850.3 CUGUUUAGUUCACAUCAAUCUU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1851 CGUCUGGGAUGGCAUUUUGGC 21 865 14 67 1    12 35 6 12 8 12 12 2 28 0 8 9 27 0 5 0 1 31 1 32 2 26 1 0 1 25 1 29 0 0 2 8 45 41 67 42 54 16 32 44 2 53 2 4 6 6 0 1 12 11 15 6 10 6 15 0 8 7 0 2 12 9 1
osa-miR1852 AUAUGGAUUCAGAAUGCAGGU 21 23 0 8 1    0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 1 0 0 0 0 0 2 0 0 0 0 0 0 0 1 0 0 0 0 0 2 0 0 1 1 0 0 2 0 0 0 0 8 0 0 0 0 0 1
osa-miR1853-3p UAAUUGGGGAUGUUCGGUUGCU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1853-5p AGCAUUCAAACAUUCCCAAUUACC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1854-3p UCCAAUUUGGGGAUUUGCUGAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1854-5p UGGUGAAAUUUGUAGAUUGGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1855 AGCACUGGAGUAGCCAAGAGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1856 UAUGCGUAAGACGGAUUCGUA 21 2,123 34 340 1    33 202 55 20 25 16 49 28 94 0 8 19 18 0 1 0 0 0 3 0 3 0 1 0 2 0 1 0 1 0 6 84 66 11 83 7 340 16 118 13 24 15 20 51 61 12 39 45 8 42 48 322 16 25 5 0 59 7 0 0 0 0 1
osa-miR1857-3p UCAUGCUCCAAGAAAACCAGG 21 36 1 9 1    1 0 0 4 0 6 0 2 0 0 0 0 0 0 0 0 0 0 1 0 1 0 2 9 1 0 2 0 1 0 0 0 1 0 0 0 0 0 1 0 1 0 0 0 1 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1857-5p UGGUUUUUUUGGAGCAUGAGG 21 43 1 16 1    3 0 0 6 0 2 0 6 0 0 0 0 0 0 0 0 0 0 1 0 1 0 1 0 1 0 0 0 0 16 2 0 0 0 0 0 1 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1
osa-miR1858a GAGAGGAGGACGGAGUGGGGC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1858b GAGAGGAGGACGGAGUGGGGC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1859 UUUCCUAUGACGUCCAUUCCAA 22 2,885 46 500 1    195 44 11 216 24 251 16 198 15 23 32 47 91 8 13 28 5 0 1 24 2 7 4 27 1 59 0 29 3 109 0 4 9 4 8 14 1 10 0 0 2 30 2 21 23 55 16 18 50 27 22 11 10 17 500 133 59 14 10 3 24 13 292
osa-miR1860-3p AUCUGGAAGCUAGGUUUUCUCU 22 585 9 43 1    16 0 4 18 13 10 4 11 7 0 0 0 0 8 2 14 5 0 19 0 12 0 13 27 16 0 10 14 6 0 10 24 16 15 43 0 34 29 11 0 16 11 8 13 19 1 23 26 4 8 4 3 5 1 30 0 0 0 0 1 0 1 0
osa-miR1860-5p AGAAAACCAGCUUCCAGAUCU 21 97 2 16 1    6 0 2 16 1 16 0 6 0 0 0 0 0 0 0 0 0 10 2 0 2 0 2 9 2 0 5 0 0 0 6 0 0 0 0 0 0 3 0 0 0 0 0 4 0 0 4 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1861a UGAUCUUGAGGCAGAAACUGAG 22 163 3 40 1    9 0 2 14 8 16 0 3 12 0 0 0 0 0 0 0 0 0 1 0 2 0 1 0 0 0 3 0 2 31 2 0 0 0 0 0 3 0 0 0 12 0 40 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1861b CGAUCUUGAGGCAGGAACUGAG 22 121 2 22 1    6 0 0 22 0 18 1 10 0 0 0 0 0 0 0 0 0 0 2 0 6 0 4 0 4 8 4 0 4 0 4 0 0 0 0 0 0 0 0 0 1 0 0 0 0 4 0 1 1 8 4 1 0 1 0 6 0 0 0 0 0 0 1
osa-miR1861c CGAUCUUGUAGCAAGAACUGAG 22 36 1 8 1    2 0 0 0 0 0 6 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 8 2 1 0 0 0 0 5 0 5 0 0 0 0 0 0 1 0 0 0
osa-miR1861d UGGUCUUGAGGCAGGAACUGAG 22 53 1 16 1    2 0 0 2 0 10 0 1 5 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 16 2 4 0 0 0 0 0 0 0 0 0 0 1 0 1 1 0 0 0 0 0 1 5 1 0 0 0 0 0 0 0 0 0
osa-miR1861e CGGUCUUGUGGCAAGAACUGAG 22 188 3 27 1    1 0 2 0 3 0 2 0 4 0 0 0 0 0 0 0 1 0 1 8 0 0 0 0 1 0 0 0 2 0 2 0 1 0 1 0 0 0 1 0 0 0 2 25 25 2 19 13 2 27 19 5 0 3 0 0 0 0 0 0 12 4 0
osa-miR1861f CGAUCUUGAGGCAGGAACUGAG 22 121 2 22 1    6 0 0 22 0 18 1 10 0 0 0 0 0 0 0 0 0 0 2 0 6 0 4 0 4 8 4 0 4 0 4 0 0 0 0 0 0 0 0 0 1 0 0 0 0 4 0 1 1 8 4 1 0 1 0 6 0 0 0 0 0 0 1
osa-miR1861g CAGUCUUGUGGCAAGAACUGAG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1861h CGGUCUUGAGGCAGGAACUGAG 22 3,108 49 428 2    183 0 24 81 29 282 261 118 134 0 8 0 37 0 0 14 17 10 52 8 34 20 30 0 33 34 40 57 82 16 29 0 36 0 33 0 29 3 35 9 40 57 77 25 28 64 23 35 22 157 156 66 83 428 15 13 8 14 0 2 0 12 5
osa-miR1861i CGAUCUUGAGGCAGGAACUGAG 22 121 2 22 1    6 0 0 22 0 18 1 10 0 0 0 0 0 0 0 0 0 0 2 0 6 0 4 0 4 8 4 0 4 0 4 0 0 0 0 0 0 0 0 0 1 0 0 0 0 4 0 1 1 8 4 1 0 1 0 6 0 0 0 0 0 0 1
osa-miR1861j CGGUCUUGAGGCAGGAACUGAG 22 3,108 49 428 2    183 0 24 81 29 282 261 118 134 0 8 0 37 0 0 14 17 10 52 8 34 20 30 0 33 34 40 57 82 16 29 0 36 0 33 0 29 3 35 9 40 57 77 25 28 64 23 35 22 157 156 66 83 428 15 13 8 14 0 2 0 12 5
osa-miR1861k CGGUCUUGUGGCAAGAACUGAG 22 188 3 27 1    1 0 2 0 3 0 2 0 4 0 0 0 0 0 0 0 1 0 1 8 0 0 0 0 1 0 0 0 2 0 2 0 1 0 1 0 0 0 1 0 0 0 2 25 25 2 19 13 2 27 19 5 0 3 0 0 0 0 0 0 12 4 0
osa-miR1861l CGAUCUUGAGGCAGGAACUGAG 22 121 2 22 1    6 0 0 22 0 18 1 10 0 0 0 0 0 0 0 0 0 0 2 0 6 0 4 0 4 8 4 0 4 0 4 0 0 0 0 0 0 0 0 0 1 0 0 0 0 4 0 1 1 8 4 1 0 1 0 6 0 0 0 0 0 0 1
osa-miR1861m CGGUCUUGUGGCAAGAACUGAG 22 188 3 27 1    1 0 2 0 3 0 2 0 4 0 0 0 0 0 0 0 1 0 1 8 0 0 0 0 1 0 0 0 2 0 2 0 1 0 1 0 0 0 1 0 0 0 2 25 25 2 19 13 2 27 19 5 0 3 0 0 0 0 0 0 12 4 0
osa-miR1861n CGAUCUUGUGGCAGGAGCUGAG 22 102 2 26 1    23 0 2 2 0 2 11 26 22 0 0 0 0 8 0 0 0 0 0 0 1 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 1 0 0 0
osa-miR1861o UGAUCUUGAGGCAGAAACUGAG 22 163 3 40 1    9 0 2 14 8 16 0 3 12 0 0 0 0 0 0 0 0 0 1 0 2 0 1 0 0 0 3 0 2 31 2 0 0 0 0 0 3 0 0 0 12 0 40 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1862a ACGAGGUUGGUUUAUUUUGGGACG 24 1,156 18 253 1    152 44 2 147 0 132 16 253 9 11 4 9 9 0 4 0 0 10 5 16 6 0 9 0 4 8 3 14 9 0 4 12 3 15 19 0 16 3 13 0 11 27 7 17 8 6 12 9 16 0 6 4 0 6 15 6 0 7 0 1 0 0 37
osa-miR1862b ACGAGGUUGGUUUAUUUUGGGACG 24 1,156 18 253 1    152 44 2 147 0 132 16 253 9 11 4 9 9 0 4 0 0 10 5 16 6 0 9 0 4 8 3 14 9 0 4 12 3 15 19 0 16 3 13 0 11 27 7 17 8 6 12 9 16 0 6 4 0 6 15 6 0 7 0 1 0 0 37
osa-miR1862c ACGAGGUUGGUUUAUUUUGGGACG 24 1,156 18 253 1    152 44 2 147 0 132 16 253 9 11 4 9 9 0 4 0 0 10 5 16 6 0 9 0 4 8 3 14 9 0 4 12 3 15 19 0 16 3 13 0 11 27 7 17 8