Rice Small RNA miRNA Abundances

The data below are based on the microRNAs listed in the Sanger registry. Adjust libraries/reads to display on the control panel.


        miRNA         miRNA sequence Len Sum (norm) Average Max Min (>0)  G1_5G6_10AGO1a_IPAGO1b_IPAGO1c_IPAGO_CTAGO4a_IPAGO4b_IPAGO16_IPdcl1_sdldcl3_sdlrdr2_sdlwt_sdlME5aPxo99aOsMockLeafRootBCPCallusTCPUNMLACt1La706La706cLros1bLOsNpbOsTCP_brdr6_HTrdr6_LTzh_HTzh_LT704f704s9311f 9311s waf1-1waf1-2Wt_waf1-1Wt_waf1-2Wt_HEN1bSeg_Wt_HEN1bOs hen1-358N_158S_1total_mel1total_WTMEL1IP_WTMEL1IP_mel1WTLamina3A1Lamina3A3Lamina
osa-miR11336-3p GAAUAUGGGAAAUGCUAGAAAGUCU 25 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR11336-5p GACUUUCUAGCGUUGCCCACAUUC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR11337-3p UAUCUCGUUAGAUUCGUCUCG 21 9 0 2 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 1 1 1 1 0 0 0 1 1 0 0 0 0 0 0 1
osa-miR11337-5p UGCGAGACGAAUCUAACGAGG 21 11 0 4 1    0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 0 0 0 1 4 1
osa-miR11338-3p AUCUCGUUAGAUUCGUCUCGCAAA 24 6 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 1 1 0 1 0 0 0 0 0 0 0 1 0 0
osa-miR11338-5p UUUGUGAGACGAAUCUAAUGAUAU 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR11339-3p UAUGAAUGUGGGCAAUGCUAG 21 559 11 89 1    7 30 0 0 0 2 0 1 0 0 8 4 3 1 4 5 42 59 10 12 2 0 4 13 10 4 6 0 64 49 89 45 0 0 0 0 6 4 4 10 0 1 2 1 2 3 12 1 0 5 15 19
osa-miR11339-5p GCAUUGCCCACAUUCAUAUAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR11340-3p AAUAGUGUAAUCGGAUUAUAGAUC 24 17 0 5 1    0 0 0 0 0 2 1 0 5 2 0 2 1 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 1
osa-miR11340-5p AUCCGAUCUACGAUCCGAUUACAC 24 32 1 4 1    0 0 0 0 0 0 1 1 0 0 0 0 2 0 2 4 0 0 0 0 0 0 1 0 0 0 0 0 0 1 1 2 0 0 2 0 1 0 4 3 2 2 2 0 1 0 0 0 0 0 0 0
osa-miR11341-3p AUCUCGUUAGAUUCGUCUCGCAAA 24 6 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 1 1 0 1 0 0 0 0 0 0 0 1 0 0
osa-miR11341-5p CCUAGGCUAUUUUGCGAGACGAAU 24 5 0 1 1    0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 1 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0
osa-miR11342-3p CUCGUUAGAUUCGUCUCGCAAA 22 11 0 2 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 2 2 0 0 0 0 0 0 0 0 0 2 2 1
osa-miR11342-5p CGAGACGAAUCUAACGAGAUA 21 5 0 2 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1
osa-miR11343-3p UGAAUGUGGGCAAUGUUAAAA 21 2 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1
osa-miR11343-5p CUUUCUAGCGUUGCCCACAUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR11344-3p CUGUGAGGUACCGGUACCUAA 21 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0
osa-miR11344-5p UAUCUCGAGAUAUCGGUACCUC 22 4 0 1 1    0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0
osa-miR1319a AACCGGCAUCUGUAAUAUAUUAUA 24 13 0 4 1    0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 4 0 2 1 0 0 0 0 0 0 0 0 0 0 0 1 1 0 1 0 0 1 0 0
osa-miR1319b CCUUUAAUAUAUUAUAGGUGUCGG 24 66 1 13 1    0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 4 13 12 0 0 0 7 3 1 3 2 0 0 1 0 0 1 1 0 0 0 3 5 4 3 0 0 0 0 1
osa-miR1320-3p UGUAAAAUUCAUUCGUUCCAA 21 1,656 32 820 1    0 0 11 0 0 35 0 1 0 0 19 9 4 0 1 1 5 2 0 0 0 0 0 7 10 0 0 0 0 0 0 0 0 4 0 3 1 1 0 0 0 0 0 0 0 0 1 0 0 253 820 468
osa-miR1320-5p UGGAACGGAGGAAUUUUAUAG 21 708 14 226 1    0 0 0 0 0 5 0 0 1 0 10 12 1 7 4 0 40 63 0 2 0 0 12 26 28 1 88 6 3 0 0 0 1 0 0 0 4 7 1 0 0 0 0 0 1 1 0 0 0 52 226 106
osa-miR1423-3p AGCGCCCAAGCGGUAGUUGUC 21 52 1 10 1    0 0 0 0 0 0 0 0 0 1 0 0 1 6 1 3 0 0 0 0 0 0 2 0 0 1 0 0 0 0 0 0 0 0 0 0 2 1 10 9 4 8 0 0 0 0 0 0 0 1 1 1
osa-miR1423-5p AGGCAACUACACGUUGGGCGCUCG 24 4,034 78 1,051 2    4 4 0 0 0 42 5 107 8 4 4 26 6 62 44 84 0 0 0 0 0 0 16 20 26 106 10 0 0 0 0 0 0 0 0 0 723 502 211 141 1,051 399 353 7 7 0 2 0 0 41 5 14
osa-miR1424 AUGCACACUGAUGCUGAUUGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1425-3p CAGCAAGAACUGGAUCUUAAU 21 2,646 51 312 1    36 76 0 0 0 19 0 1 0 6 38 42 36 81 51 30 16 21 2 12 1 1 150 277 312 157 33 31 99 106 70 38 18 11 16 59 21 36 10 23 1 8 18 11 19 38 66 34 0 213 179 123
osa-miR1425-5p UAGGAUUCAAUCCUUGCUGCU 21 248,960 4,788 96,039 1    300 376 483 670 501 489 7 3 1 189 827 465 599 3,548 3,247 38,833 68 64 12 120 16 4 1,600 1,104 1,204 2,651 1,571 284 163 116 28 110 41 223 24 245 13,414 16,351 96,039 18,852 22,862 6,960 3,567 54 60 15 40 1 262 3,120 3,835 3,342
osa-miR1426 AGAAUCUUGAUGAUGAUUAAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1427 UGCGGAACCGUGCGGUGGCGC 21 4,418 85 699 1    4 4 0 0 0 29 0 0 0 15 209 127 123 107 397 18 5 2 0 0 1 0 267 56 47 187 16 3 101 37 44 133 0 0 0 0 226 415 699 675 1 1 0 3 4 9 11 1 0 138 146 157
osa-miR1428a-3p UAAGAUAAAGCCGUGAAUUUG 21 8 0 3 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 3 1
osa-miR1428a-5p CGUUUUGCAAAUUCGCAGGCC 21 9 0 3 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 3 3 1
osa-miR1428b UAAGAUAAUGCCAUGAAUUCG 21 11 0 5 1    0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 5 2
osa-miR1428c UAAGAUAAUGCCAUGAAUUCG 21 11 0 5 1    0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 5 2
osa-miR1428d UAAGAUAAUGCCAUGAAUUCG 21 11 0 5 1    0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 5 2
osa-miR1428e-3p UAAGAUAAUGCCAUGAAUUUG 21 4,729 91 2,041 1    0 25 0 0 0 39 0 1 3 0 96 6 82 0 0 4 0 0 0 0 0 0 2 2 0 0 5 0 1 0 0 0 0 2 0 0 1 0 1 1 0 0 0 1 1 0 2 0 0 984 2,041 1,429
osa-miR1428e-5p AAUUCACAGGCCCUAUCUUGUG 22 2,225 43 845 1    0 13 0 0 0 7 0 0 0 0 21 0 26 0 0 4 0 0 0 0 0 0 0 0 0 0 8 0 0 0 0 0 0 0 0 0 1 0 5 3 2 1 7 1 1 0 0 0 0 543 845 737
osa-miR1428f-5p AAUUCACAGGCCCUAUCUUGUG 22 2,225 43 845 1    0 13 0 0 0 7 0 0 0 0 21 0 26 0 0 4 0 0 0 0 0 0 0 0 0 0 8 0 0 0 0 0 0 0 0 0 1 0 5 3 2 1 7 1 1 0 0 0 0 543 845 737
osa-miR1428g-5p AAUUCACAGGCCCUAUCUUGUG 22 2,225 43 845 1    0 13 0 0 0 7 0 0 0 0 21 0 26 0 0 4 0 0 0 0 0 0 0 0 0 0 8 0 0 0 0 0 0 0 0 0 1 0 5 3 2 1 7 1 1 0 0 0 0 543 845 737
osa-miR1429-3p GUUGCACGGGUUUGUAUGUUG 21 49 1 12 1    0 0 0 0 0 0 0 1 0 1 0 1 1 2 0 0 0 0 0 1 0 0 0 0 0 0 0 0 12 3 10 8 0 0 0 0 2 4 1 1 0 0 0 0 0 1 0 0 0 0 0 0
osa-miR1429-5p GUAAUAUACUAAUCCGUGCAU 21 22 0 11 1    0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 11 2 5 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1430 UGGUGAGCCUUCCUGGCUAAG 21 897 17 457 1    0 0 0 0 0 16 0 0 0 0 19 19 44 58 54 457 0 0 0 0 0 0 21 3 4 13 1 0 0 0 0 0 0 0 0 0 35 26 41 31 0 0 0 0 0 0 0 0 0 15 30 10
osa-miR1431 UUUGCGAGUUGGCCCGCUUGC 21 357 7 62 1    0 0 0 0 0 9 0 0 0 1 11 5 6 0 7 62 1 0 0 0 0 0 17 4 6 0 19 0 0 0 0 0 1 15 0 10 1 1 41 39 22 10 0 1 1 0 0 0 0 22 25 20
osa-miR1432-3p CAGGUGUCAUCUCCCCUGAAC 21 2,012 39 352 1    0 0 0 0 0 3 0 0 0 0 2 6 4 115 119 73 0 2 0 0 0 0 5 4 6 17 3 0 0 1 0 0 0 0 0 6 352 256 151 69 34 50 223 0 0 0 0 0 0 137 208 166
osa-miR1432-5p AUCAGGAGAGAUGACACCGAC 21 2,024 39 349 1    18 8 0 0 0 38 1 14 1 1 32 18 9 71 56 3 115 349 0 17 0 1 45 109 103 35 125 0 37 5 51 15 0 15 0 32 3 4 27 57 4 14 6 0 0 0 0 0 0 124 294 167
osa-miR1435 UUUCUUAAGUCAAACUUUUU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1436 ACAUUAUGGGACGGAGGGAGU 21 12 0 4 1    0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 1 4 2
osa-miR1437a UCCGGCGCCGCACUAGGCACUG 22 6 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 1 1 0 0 0 0 0 0 0 0 0 0 1
osa-miR1437b-3p GUGCUGGCGAGCUCCGGUGCCGCA 24 683 13 204 1    0 0 0 0 0 8 1 44 5 1 0 9 6 30 4 1 0 0 0 0 0 0 9 1 0 1 0 0 0 0 0 0 0 0 0 0 18 25 75 55 155 204 22 0 0 0 0 0 0 9 0 0
osa-miR1437b-5p GGGAGGAAACAGUGCCUAGUG 21 4 0 1 1    0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 1
osa-miR1438 AGGGUAAUUUUAUCAUUUUUAA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1439 UUUUGGAACGGAGUGAGUAUU 21 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1440a UGCUCAAAUACCACUCUCCU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1440b UUUAGGAGAGUGGUAUUUGAG 21 5 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1
osa-miR1441 ACCGGAUGUCGGAAAAGGUUU 21 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1442 AUUCAUAGUACUAGAUGUGU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR156a UGACAGAAGAGAGUGAGCAC 20 1,831,881 35,228 222,348 6    31,133 80,998 8,931 5,819 1,437 1,454 17 19 111 23 1,249 1,386 654 155,456 64,070 60,993 62,946 117,435 23,985 202,052 8,790 11,454 12,586 46,891 58,828 138,090 13,683 22,010 24,671 9,807 17,630 12,365 538 62,494 769 222,348 8,145 6,171 45,618 47,098 31,465 180,807 13,980 820 1,090 58 61 6 0 3,831 5,996 3,613
osa-miR156b-3p GCUCACUCUCUAUCUGUCAGC 21 777 15 246 1    0 4 0 0 0 95 0 0 1 1 1 4 1 103 93 246 0 4 0 1 0 0 0 1 0 0 2 0 0 0 0 0 0 97 0 23 0 1 5 6 33 12 1 0 0 0 0 0 0 8 13 21
osa-miR156b-5p UGACAGAAGAGAGUGAGCAC 20 1,831,881 35,228 222,348 6    31,133 80,998 8,931 5,819 1,437 1,454 17 19 111 23 1,249 1,386 654 155,456 64,070 60,993 62,946 117,435 23,985 202,052 8,790 11,454 12,586 46,891 58,828 138,090 13,683 22,010 24,671 9,807 17,630 12,365 538 62,494 769 222,348 8,145 6,171 45,618 47,098 31,465 180,807 13,980 820 1,090 58 61 6 0 3,831 5,996 3,613
osa-miR156c-3p GCUCACUUCUCUCUCUGUCAGC 22 7,371 142 2,001 1    4 17 0 0 0 801 2 1 3 0 9 18 10 173 196 1,589 3 11 0 5 0 0 0 0 0 32 426 7 3 0 1 1 0 163 0 16 258 507 189 42 2,001 346 220 0 0 9 8 0 0 84 125 91
osa-miR156c-5p UGACAGAAGAGAGUGAGCAC 20 1,831,881 35,228 222,348 6    31,133 80,998 8,931 5,819 1,437 1,454 17 19 111 23 1,249 1,386 654 155,456 64,070 60,993 62,946 117,435 23,985 202,052 8,790 11,454 12,586 46,891 58,828 138,090 13,683 22,010 24,671 9,807 17,630 12,365 538 62,494 769 222,348 8,145 6,171 45,618 47,098 31,465 180,807 13,980 820 1,090 58 61 6 0 3,831 5,996 3,613
osa-miR156d UGACAGAAGAGAGUGAGCAC 20 1,831,881 35,228 222,348 6    31,133 80,998 8,931 5,819 1,437 1,454 17 19 111 23 1,249 1,386 654 155,456 64,070 60,993 62,946 117,435 23,985 202,052 8,790 11,454 12,586 46,891 58,828 138,090 13,683 22,010 24,671 9,807 17,630 12,365 538 62,494 769 222,348 8,145 6,171 45,618 47,098 31,465 180,807 13,980 820 1,090 58 61 6 0 3,831 5,996 3,613
osa-miR156e UGACAGAAGAGAGUGAGCAC 20 1,831,881 35,228 222,348 6    31,133 80,998 8,931 5,819 1,437 1,454 17 19 111 23 1,249 1,386 654 155,456 64,070 60,993 62,946 117,435 23,985 202,052 8,790 11,454 12,586 46,891 58,828 138,090 13,683 22,010 24,671 9,807 17,630 12,365 538 62,494 769 222,348 8,145 6,171 45,618 47,098 31,465 180,807 13,980 820 1,090 58 61 6 0 3,831 5,996 3,613
osa-miR156f-3p GCUCACUUCUCUUUCUGUCAGC 22 54,882 1,055 22,974 1    0 0 0 0 0 379 0 1 0 0 93 48 22 232 354 537 2 2 0 0 0 0 0 0 6 17 87 0 0 0 1 1 0 179 0 10 112 160 1,020 750 828 184 75 0 0 1 0 0 0 17,267 22,974 9,540
osa-miR156f-5p UGACAGAAGAGAGUGAGCAC 20 1,831,881 35,228 222,348 6    31,133 80,998 8,931 5,819 1,437 1,454 17 19 111 23 1,249 1,386 654 155,456 64,070 60,993 62,946 117,435 23,985 202,052 8,790 11,454 12,586 46,891 58,828 138,090 13,683 22,010 24,671 9,807 17,630 12,365 538 62,494 769 222,348 8,145 6,171 45,618 47,098 31,465 180,807 13,980 820 1,090 58 61 6 0 3,831 5,996 3,613
osa-miR156g-3p GCUCACUUCUCUCUCUGUCAGC 22 7,371 142 2,001 1    4 17 0 0 0 801 2 1 3 0 9 18 10 173 196 1,589 3 11 0 5 0 0 0 0 0 32 426 7 3 0 1 1 0 163 0 16 258 507 189 42 2,001 346 220 0 0 9 8 0 0 84 125 91
osa-miR156g-5p UGACAGAAGAGAGUGAGCAC 20 1,831,881 35,228 222,348 6    31,133 80,998 8,931 5,819 1,437 1,454 17 19 111 23 1,249 1,386 654 155,456 64,070 60,993 62,946 117,435 23,985 202,052 8,790 11,454 12,586 46,891 58,828 138,090 13,683 22,010 24,671 9,807 17,630 12,365 538 62,494 769 222,348 8,145 6,171 45,618 47,098 31,465 180,807 13,980 820 1,090 58 61 6 0 3,831 5,996 3,613
osa-miR156h-3p GCUCACUUCUCUUUCUGUCAGC 22 54,882 1,055 22,974 1    0 0 0 0 0 379 0 1 0 0 93 48 22 232 354 537 2 2 0 0 0 0 0 0 6 17 87 0 0 0 1 1 0 179 0 10 112 160 1,020 750 828 184 75 0 0 1 0 0 0 17,267 22,974 9,540
osa-miR156h-5p UGACAGAAGAGAGUGAGCAC 20 1,831,881 35,228 222,348 6    31,133 80,998 8,931 5,819 1,437 1,454 17 19 111 23 1,249 1,386 654 155,456 64,070 60,993 62,946 117,435 23,985 202,052 8,790 11,454 12,586 46,891 58,828 138,090 13,683 22,010 24,671 9,807 17,630 12,365 538 62,494 769 222,348 8,145 6,171 45,618 47,098 31,465 180,807 13,980 820 1,090 58 61 6 0 3,831 5,996 3,613
osa-miR156i UGACAGAAGAGAGUGAGCAC 20 1,831,881 35,228 222,348 6    31,133 80,998 8,931 5,819 1,437 1,454 17 19 111 23 1,249 1,386 654 155,456 64,070 60,993 62,946 117,435 23,985 202,052 8,790 11,454 12,586 46,891 58,828 138,090 13,683 22,010 24,671 9,807 17,630 12,365 538 62,494 769 222,348 8,145 6,171 45,618 47,098 31,465 180,807 13,980 820 1,090 58 61 6 0 3,831 5,996 3,613
osa-miR156j-3p GCUCGCUCCUCUUUCUGUCAGC 22 1,377 26 334 1    0 0 0 0 0 127 0 3 1 0 16 20 6 9 15 63 0 0 0 0 0 0 0 0 2 7 30 3 0 1 2 2 0 38 0 4 28 41 59 39 76 17 7 0 0 3 0 0 0 138 334 286
osa-miR156j-5p UGACAGAAGAGAGUGAGCAC 20 1,831,881 35,228 222,348 6    31,133 80,998 8,931 5,819 1,437 1,454 17 19 111 23 1,249 1,386 654 155,456 64,070 60,993 62,946 117,435 23,985 202,052 8,790 11,454 12,586 46,891 58,828 138,090 13,683 22,010 24,671 9,807 17,630 12,365 538 62,494 769 222,348 8,145 6,171 45,618 47,098 31,465 180,807 13,980 820 1,090 58 61 6 0 3,831 5,996 3,613
osa-miR156k UGACAGAAGAGAGAGAGCACA 21 15 0 4 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 3 4 0 0 0 1 0 0 0 0 0 0 0 2 1 1 1 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR156l-3p GCUCACUUCUCUUUCUGUCAGC 22 54,882 1,055 22,974 1    0 0 0 0 0 379 0 1 0 0 93 48 22 232 354 537 2 2 0 0 0 0 0 0 6 17 87 0 0 0 1 1 0 179 0 10 112 160 1,020 750 828 184 75 0 0 1 0 0 0 17,267 22,974 9,540
osa-miR156l-5p CGACAGAAGAGAGUGAGCAUA 21 54 1 40 1    0 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 40 0 0 0 0 0 0 0 0 0 0 2 1 2 1 0 2 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR159a.1 UUUGGAUUGAAGGGAGCUCUG 21 2,891,471 55,605 855,703 2    25 25 654,922 387,120 855,703 22,592 242 422 1,412 13,378 38,954 98,476 37,238 78 92 2,838 197 203 7 139 2 36 393 451 346 1,235 93,165 1,473 98 57 96 203 28 287 14 79 10,492 14,412 1,110 583 118 624 1,666 60 57 15,930 9,712 10,433 230,044 112,331 131,000 140,873
osa-miR159a.2 UUGCAUGCCCCAGGAGCUGCA 21 15,395 296 2,919 1    4 4 0 0 0 7 0 0 0 2 3 3 4 1,555 2,919 2,190 1 1 0 2 0 1 131 155 215 1,032 105 0 25 9 11 12 50 163 42 362 234 227 1,311 1,011 742 2,458 353 1 1 0 0 0 0 16 19 14
osa-miR159b UUUGGAUUGAAGGGAGCUCUG 21 2,891,471 55,605 855,703 2    25 25 654,922 387,120 855,703 22,592 242 422 1,412 13,378 38,954 98,476 37,238 78 92 2,838 197 203 7 139 2 36 393 451 346 1,235 93,165 1,473 98 57 96 203 28 287 14 79 10,492 14,412 1,110 583 118 624 1,666 60 57 15,930 9,712 10,433 230,044 112,331 131,000 140,873
osa-miR159c AUUGGAUUGAAGGGAGCUCCA 21 3 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 1 0
osa-miR159d AUUGGAUUGAAGGGAGCUCCG 21 2 0 1 1    0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0
osa-miR159e AUUGGAUUGAAGGGAGCUCCU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR159f CUUGGAUUGAAGGGAGCUCUA 21 78 2 16 1    0 0 1 2 2 1 0 0 0 1 0 3 0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 0 2 0 2 2 0 0 0 0 0 1 1 1 1 0 0 1 1 16 3 8 0 8 10 9
osa-miR160a-3p GCGUGCAAGGAGCCAAGCAUG 21 3,474 67 548 1    14 30 0 0 0 0 0 0 0 0 3 0 1 130 142 57 1 11 0 2 0 0 8 34 30 31 8 0 452 215 371 548 42 177 36 274 37 61 101 183 90 170 161 13 13 0 3 0 0 8 9 8
osa-miR160a-5p UGCCUGGCUCCCUGUAUGCCA 21 7,635 147 1,343 1    22 25 4 0 88 22 2 1 1 6 11 12 7 12 22 1,309 1 2 0 8 1 0 35 8 10 12 330 10 53 19 4 21 95 525 55 322 9 11 492 294 447 169 6 40 39 13 32 2 0 1,343 670 1,013
osa-miR160b-3p GCGUGCAAGGAGCCAAGCAUG 21 3,474 67 548 1    14 30 0 0 0 0 0 0 0 0 3 0 1 130 142 57 1 11 0 2 0 0 8 34 30 31 8 0 452 215 371 548 42 177 36 274 37 61 101 183 90 170 161 13 13 0 3 0 0 8 9 8
osa-miR160b-5p UGCCUGGCUCCCUGUAUGCCA 21 7,635 147 1,343 1    22 25 4 0 88 22 2 1 1 6 11 12 7 12 22 1,309 1 2 0 8 1 0 35 8 10 12 330 10 53 19 4 21 95 525 55 322 9 11 492 294 447 169 6 40 39 13 32 2 0 1,343 670 1,013
osa-miR160c-3p GCGUGCACGGAGCCAAGCAUA 21 374 7 90 1    0 4 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 90 50 89 64 0 9 2 47 0 0 0 1 1 1 0 8 6 0 0 0 0 1 0 0
osa-miR160c-5p UGCCUGGCUCCCUGUAUGCCA 21 7,635 147 1,343 1    22 25 4 0 88 22 2 1 1 6 11 12 7 12 22 1,309 1 2 0 8 1 0 35 8 10 12 330 10 53 19 4 21 95 525 55 322 9 11 492 294 447 169 6 40 39 13 32 2 0 1,343 670 1,013
osa-miR160d-3p GCGUGCGAGGAGCCAAGCAUG 21 233 4 57 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 0 0 0 0 0 0 0 0 0 1 0 44 39 57 31 2 11 4 17 1 1 2 2 4 1 4 3 3 0 2 0 0 0 1 0
osa-miR160d-5p UGCCUGGCUCCCUGUAUGCCA 21 7,635 147 1,343 1    22 25 4 0 88 22 2 1 1 6 11 12 7 12 22 1,309 1 2 0 8 1 0 35 8 10 12 330 10 53 19 4 21 95 525 55 322 9 11 492 294 447 169 6 40 39 13 32 2 0 1,343 670 1,013
osa-miR160e-3p GCGUGCGAGGUGCCAAGCAUG 21 9 0 2 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 2 0 2 0 1 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0
osa-miR160e-5p UGCCUGGCUCCCUGUAUGCCG 21 10,354 199 3,505 1    11 17 22 0 47 26 0 1 1 10 8 8 16 32 39 1,272 0 0 0 1 0 1 13 3 4 11 137 8 75 66 17 50 97 689 58 209 4 5 1,407 829 3,505 610 6 33 36 34 108 13 0 360 176 279
osa-miR160f-3p GCAUUGAGGGAGUCAUGCAGG 21 22 0 7 1    0 0 0 0 0 1 0 0 1 0 0 0 2 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 7 0 1 0 0 1 0 0 0 0 1 1 3 3 0 0 0 0 0
osa-miR160f-5p UGCCUGGCUCCCUGAAUGCCA 21 10,205 196 2,458 1    0 0 129 2 279 103 9 2 6 17 25 63 31 250 86 1,443 1 0 4 0 11 0 65 11 12 37 105 190 15 6 5 3 9 42 4 113 2 3 1,132 396 2,458 686 6 1 1 9 6 1 0 982 632 812
osa-miR162a UCGAUAAACCUCUGCAUCCAG 21 54,021 1,039 9,498 17    83 165 8,025 9,498 6,839 2,097 30 17 61 57 761 1,190 555 246 149 408 166 114 106 62 40 27 150 95 97 73 616 291 2,476 1,614 1,873 2,006 32 157 25 276 863 1,737 611 527 256 293 531 24 22 275 244 25 262 3,113 2,213 2,548
osa-miR162b UCGAUAAGCCUCUGCAUCCAG 21 8,850 170 1,346 1    47 51 140 9 237 70 0 1 6 3 73 65 52 79 39 218 3 2 0 5 2 0 46 33 20 81 66 21 300 235 278 322 16 146 20 86 682 800 546 824 451 621 1,346 13 12 20 36 4 0 320 173 230
osa-miR164a UGGAGAAGCAGGGCACGUGCA 21 105,317 2,025 21,686 14    940 1,189 107 361 490 863 30 68 252 113 543 333 404 575 264 868 1,451 425 69 49 16 1,168 845 1,237 1,226 515 1,707 94 21,686 10,454 18,789 16,847 123 1,146 82 1,248 14 18 2,500 3,468 668 1,934 86 60 63 200 433 126 0 3,242 2,449 3,479
osa-miR164b UGGAGAAGCAGGGCACGUGCA 21 105,317 2,025 21,686 14    940 1,189 107 361 490 863 30 68 252 113 543 333 404 575 264 868 1,451 425 69 49 16 1,168 845 1,237 1,226 515 1,707 94 21,686 10,454 18,789 16,847 123 1,146 82 1,248 14 18 2,500 3,468 668 1,934 86 60 63 200 433 126 0 3,242 2,449 3,479
osa-miR164c UGGAGAAGCAGGGUACGUGCA 21 1,061 20 240 1    7 0 0 2 1 3 0 0 1 2 8 3 8 0 0 0 0 2 1 1 0 1 1 2 0 4 1 0 233 176 180 240 6 20 4 3 0 0 1 2 0 1 0 4 4 23 65 6 0 15 11 19
osa-miR164d UGGAGAAGCAGGGCACGUGCU 21 4,754 91 525 1    29 34 8 0 9 168 5 6 9 1 27 18 27 34 18 56 37 24 1 2 1 56 96 75 91 24 68 15 525 233 408 357 2 66 2 94 6 14 372 490 131 242 81 1 1 0 2 3 0 313 178 294
osa-miR164e UGGAGAAGCAGGGCACGUGAG 21 7,652 147 3,557 1    65 1,620 0 0 0 1 0 0 0 0 1 1 0 12 1 0 7 3,557 4 491 0 1 1 1 6 0 1 0 1 0 2 2 0 1,161 0 690 0 0 1 3 1 1 0 0 1 0 0 0 0 4 11 4
osa-miR164f UGGAGAAGCAGGGCACGUGCA 21 105,317 2,025 21,686 14    940 1,189 107 361 490 863 30 68 252 113 543 333 404 575 264 868 1,451 425 69 49 16 1,168 845 1,237 1,226 515 1,707 94 21,686 10,454 18,789 16,847 123 1,146 82 1,248 14 18 2,500 3,468 668 1,934 86 60 63 200 433 126 0 3,242 2,449 3,479
osa-miR166a-3p UCGGACCAGGCUUCAUUCCCC 21 769,071 14,790 101,814 56    6,005 9,458 24,295 22,177 35,545 3,224 173 56 173 510 1,730 5,410 1,249 6,328 3,617 13,879 1,422 3,099 210 2,013 100 449 8,870 3,454 3,881 7,154 14,008 1,606 9,780 10,620 10,666 12,986 5,471 33,328 2,355 17,900 15,124 16,733 62,989 82,773 101,814 79,419 9,153 11,717 15,708 2,446 3,264 485 1,832 33,116 21,863 27,434
osa-miR166a-5p GGAAUGUUGUCUGGUUCAAGG 21 3,880 75 1,439 1    4 4 0 0 0 27 1 15 1 0 18 1 33 0 0 1 0 3 0 1 0 0 0 0 0 0 49 3 7 5 9 9 8 108 6 90 0 0 0 1 0 0 0 1 1 1,439 780 54 1,047 74 27 53
osa-miR166b-3p UCGGACCAGGCUUCAUUCCCC 21 769,071 14,790 101,814 56    6,005 9,458 24,295 22,177 35,545 3,224 173 56 173 510 1,730 5,410 1,249 6,328 3,617 13,879 1,422 3,099 210 2,013 100 449 8,870 3,454 3,881 7,154 14,008 1,606 9,780 10,620 10,666 12,986 5,471 33,328 2,355 17,900 15,124 16,733 62,989 82,773 101,814 79,419 9,153 11,717 15,708 2,446 3,264 485 1,832 33,116 21,863 27,434
osa-miR166b-5p GGAAUGUUGUCUGGCUCGGGG 21 2,076 40 280 1    14 25 0 0 0 10 0 1 1 1 12 13 7 1 2 2 1 11 0 1 0 0 1 2 6 5 33 0 46 37 61 95 5 177 7 38 63 63 9 3 7 5 4 2 3 280 235 92 262 107 184 142
osa-miR166c-3p UCGGACCAGGCUUCAUUCCCC 21 769,071 14,790 101,814 56    6,005 9,458 24,295 22,177 35,545 3,224 173 56 173 510 1,730 5,410 1,249 6,328 3,617 13,879 1,422 3,099 210 2,013 100 449 8,870 3,454 3,881 7,154 14,008 1,606 9,780 10,620 10,666 12,986 5,471 33,328 2,355 17,900 15,124 16,733 62,989 82,773 101,814 79,419 9,153 11,717 15,708 2,446 3,264 485 1,832 33,116 21,863 27,434
osa-miR166c-5p GGAAUGUUGUCUGGUCCGAG 20 61 1 25 1    0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 25 24 0 1 0 0 0 0 0 0 0 0 0 2 4 3
osa-miR166d-3p UCGGACCAGGCUUCAUUCCCC 21 769,071 14,790 101,814 56    6,005 9,458 24,295 22,177 35,545 3,224 173 56 173 510 1,730 5,410 1,249 6,328 3,617 13,879 1,422 3,099 210 2,013 100 449 8,870 3,454 3,881 7,154 14,008 1,606 9,780 10,620 10,666 12,986 5,471 33,328 2,355 17,900 15,124 16,733 62,989 82,773 101,814 79,419 9,153 11,717 15,708 2,446 3,264 485 1,832 33,116 21,863 27,434
osa-miR166d-5p GGAAUGUUGUCUGGCUCGAGG 21 3,367 65 438 1    109 114 0 0 0 7 1 2 2 4 34 61 28 30 9 19 4 6 1 0 1 0 10 35 14 32 173 40 23 27 21 29 11 285 8 55 438 350 58 81 50 48 299 5 3 44 71 9 0 271 198 247
osa-miR166e-3p UCGAACCAGGCUUCAUUCCCC 21 1,982 38 331 1    7 13 8 5 10 6 1 0 0 1 4 9 3 3 3 19 3 7 1 5 0 3 14 12 6 8 12 0 179 166 268 331 0 0 0 0 3 6 213 212 164 84 2 10 14 37 58 2 0 29 19 22
osa-miR166e-5p GGAAUGUUGUCUGGUUCAAGG 21 3,880 75 1,439 1    4 4 0 0 0 27 1 15 1 0 18 1 33 0 0 1 0 3 0 1 0 0 0 0 0 0 49 3 7 5 9 9 8 108 6 90 0 0 0 1 0 0 0 1 1 1,439 780 54 1,047 74 27 53
osa-miR166f UCGGACCAGGCUUCAUUCCCC 21 769,071 14,790 101,814 56    6,005 9,458 24,295 22,177 35,545 3,224 173 56 173 510 1,730 5,410 1,249 6,328 3,617 13,879 1,422 3,099 210 2,013 100 449 8,870 3,454 3,881 7,154 14,008 1,606 9,780 10,620 10,666 12,986 5,471 33,328 2,355 17,900 15,124 16,733 62,989 82,773 101,814 79,419 9,153 11,717 15,708 2,446 3,264 485 1,832 33,116 21,863 27,434
osa-miR166g-3p UCGGACCAGGCUUCAUUCCUC 21 147,893 2,844 16,885 2    1,523 1,476 1,207 2,434 4,078 268 17 7 18 54 147 595 94 918 606 1,176 115 40 8 9 2 60 968 668 844 874 309 101 6,744 7,246 6,703 7,777 3,863 1,058 1,827 1,973 2,105 1,497 14,045 16,885 12,121 7,217 515 10,569 15,597 866 1,369 104 785 3,374 2,042 2,995
osa-miR166g-5p AAUGGAGGCUGAUCCAAGAUC 21 127 2 35 1    0 0 0 0 0 3 0 0 0 1 1 0 1 0 0 8 0 4 0 0 0 0 1 1 0 0 0 0 0 0 0 1 1 2 0 4 1 1 16 14 35 23 0 0 0 3 1 0 0 4 0 1
osa-miR166h-3p UCGGACCAGGCUUCAUUCCUC 21 147,893 2,844 16,885 2    1,523 1,476 1,207 2,434 4,078 268 17 7 18 54 147 595 94 918 606 1,176 115 40 8 9 2 60 968 668 844 874 309 101 6,744 7,246 6,703 7,777 3,863 1,058 1,827 1,973 2,105 1,497 14,045 16,885 12,121 7,217 515 10,569 15,597 866 1,369 104 785 3,374 2,042 2,995
osa-miR166h-5p GGAAUGUUGGCUGGCUCGAGG 21 2,042 39 523 1    7 17 0 0 0 0 0 0 1 0 0 13 6 1 1 0 0 1 0 0 0 0 1 0 2 0 3 5 55 139 89 140 45 523 33 100 34 17 12 25 7 12 78 24 21 210 381 18 0 8 6 7
osa-miR166i-3p UCGGAUCAGGCUUCAUUCCUC 21 201 4 28 1    0 4 2 0 28 1 0 0 0 1 1 2 1 2 1 1 0 1 0 0 0 0 2 3 2 3 1 0 9 12 5 6 18 7 5 16 1 1 7 8 7 3 1 10 12 1 1 0 0 7 3 5
osa-miR166i-5p AAUGCAGUUUGAUCCAAGAUC 21 92 2 37 1    0 0 0 0 0 9 0 0 0 1 4 5 11 0 0 0 0 0 0 0 0 0 0 1 2 0 1 0 0 0 0 0 1 0 0 0 0 0 0 1 0 0 0 1 0 3 2 1 0 37 4 8
osa-miR166j-3p UCGGACCAGGCUUCAUUCCCC 21 769,071 14,790 101,814 56    6,005 9,458 24,295 22,177 35,545 3,224 173 56 173 510 1,730 5,410 1,249 6,328 3,617 13,879 1,422 3,099 210 2,013 100 449 8,870 3,454 3,881 7,154 14,008 1,606 9,780 10,620 10,666 12,986 5,471 33,328 2,355 17,900 15,124 16,733 62,989 82,773 101,814 79,419 9,153 11,717 15,708 2,446 3,264 485 1,832 33,116 21,863 27,434
osa-miR166j-5p GAAUGACGUCCGGUCUGAAGA 21 4,637 89 1,219 1    0 0 0 0 0 92 0 1 1 15 1,219 573 764 0 1 2 1 0 0 0 0 0 48 45 61 54 17 0 0 0 0 0 1 26 0 13 40 65 13 27 51 40 58 0 0 0 0 0 0 533 379 497
osa-miR166k-3p UCGGACCAGGCUUCAAUCCCU 21 118,660 2,282 16,593 1    695 867 289 363 439 289 8 2 1 53 154 240 122 1,099 786 5,542 75 5 1 31 0 28 1,389 1,006 1,293 1,469 406 82 1,867 2,183 1,991 2,406 1,714 801 1,084 866 3,515 4,287 16,593 9,639 7,449 7,283 965 4,572 6,483 2,887 3,455 138 4,187 7,028 4,887 5,646
osa-miR166k-5p GGUUUGUUGUCUGGCUCGAGG 21 762 15 249 1    4 4 0 0 0 0 0 1 0 1 1 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 1 2 23 42 21 30 9 97 1 23 22 16 3 6 1 1 11 11 8 249 125 32 0 6 4 5
osa-miR166l-3p UCGGACCAGGCUUCAAUCCCU 21 118,660 2,282 16,593 1    695 867 289 363 439 289 8 2 1 53 154 240 122 1,099 786 5,542 75 5 1 31 0 28 1,389 1,006 1,293 1,469 406 82 1,867 2,183 1,991 2,406 1,714 801 1,084 866 3,515 4,287 16,593 9,639 7,449 7,283 965 4,572 6,483 2,887 3,455 138 4,187 7,028 4,887 5,646
osa-miR166l-5p GGAUUGUUGUCUGGUUCAAGG 21 374 7 143 1    0 0 0 0 0 2 0 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 4 0 2 1 4 0 1 0 1 0 0 0 0 0 1 1 143 120 2 0 28 33 25
osa-miR166m UCGGACCAGGCUUCAUUCCCU 21 35,476 682 15,543 1    4 17 66 35 85 9 0 0 1 2 5 13 6 12 7 52 9 10 0 4 1 1 41 23 40 36 29 0 13 10 26 26 40 86 18 158 13,213 15,543 370 515 215 280 3,277 20 28 14 4 0 0 519 267 326
osa-miR167a-3p AUCAUGCAUGACAGCCUCAUUU 22 10 0 3 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 2 1 1 0 0 3 0 0 0 0 0 0 0 0 0
osa-miR167a-5p UGAAGCUGCCAGCAUGAUCUA 21 296,215 5,696 40,434 9    2,196 4,141 5,262 2,081 4,237 4,239 72 71 250 978 2,832 2,715 5,903 10,777 6,673 3,675 1,740 543 420 11,265 76 4,749 9,445 8,021 8,447 4,830 2,840 66 32,675 26,554 29,159 40,434 3,208 1,122 3,498 15,998 49 43 6,884 10,547 2,282 4,734 58 3,410 4,378 30 102 9 0 1,012 718 767
osa-miR167b UGAAGCUGCCAGCAUGAUCUA 21 296,215 5,696 40,434 9    2,196 4,141 5,262 2,081 4,237 4,239 72 71 250 978 2,832 2,715 5,903 10,777 6,673 3,675 1,740 543 420 11,265 76 4,749 9,445 8,021 8,447 4,830 2,840 66 32,675 26,554 29,159 40,434 3,208 1,122 3,498 15,998 49 43 6,884 10,547 2,282 4,734 58 3,410 4,378 30 102 9 0 1,012 718 767
osa-miR167c-3p GGUCAUGCUGCGGCAGCCUCACU 23 288 6 59 1    0 0 0 0 0 1 0 0 0 0 0 0 0 19 20 2 0 1 0 0 0 0 3 3 2 5 2 0 9 10 13 59 13 11 8 7 11 9 22 5 32 10 3 3 4 0 0 0 0 0 0 1
osa-miR167c-5p UGAAGCUGCCAGCAUGAUCUA 21 296,215 5,696 40,434 9    2,196 4,141 5,262 2,081 4,237 4,239 72 71 250 978 2,832 2,715 5,903 10,777 6,673 3,675 1,740 543 420 11,265 76 4,749 9,445 8,021 8,447 4,830 2,840 66 32,675 26,554 29,159 40,434 3,208 1,122 3,498 15,998 49 43 6,884 10,547 2,282 4,734 58 3,410 4,378 30 102 9 0 1,012 718 767
osa-miR167d-3p GAUCAUGCUGUGCAGUUUCAUC 22 379 7 107 1    0 0 0 0 0 10 0 1 0 0 5 2 9 3 4 107 0 0 0 0 0 0 0 0 2 3 1 0 0 0 1 2 0 38 4 10 27 38 19 14 24 4 34 0 0 0 0 0 0 7 6 4
osa-miR167d-5p UGAAGCUGCCAGCAUGAUCUG 21 188,418 3,623 19,471 12    582 918 917 936 3,149 1,501 32 22 47 38 297 154 428 8,729 2,739 12,429 1,350 1,549 58 30 20 1,207 2,984 1,718 1,831 6,617 810 84 19,354 9,779 19,471 16,705 310 6,708 371 12,506 1,797 2,878 8,470 10,062 11,174 6,418 9,277 19 23 67 109 12 0 511 511 710
osa-miR167e-3p AGAUCAUGUUGCAGCUUCACU 21 3,097 60 478 1    101 478 0 0 0 18 1 2 9 3 14 19 19 21 28 31 45 4 1 1 0 11 4 17 10 7 16 0 461 146 256 415 1 46 13 51 23 32 51 30 16 8 1 1 1 1 2 0 0 267 247 168
osa-miR167e-5p UGAAGCUGCCAGCAUGAUCUG 21 188,418 3,623 19,471 12    582 918 917 936 3,149 1,501 32 22 47 38 297 154 428 8,729 2,739 12,429 1,350 1,549 58 30 20 1,207 2,984 1,718 1,831 6,617 810 84 19,354 9,779 19,471 16,705 310 6,708 371 12,506 1,797 2,878 8,470 10,062 11,174 6,418 9,277 19 23 67 109 12 0 511 511 710
osa-miR167f UGAAGCUGCCAGCAUGAUCUG 21 188,418 3,623 19,471 12    582 918 917 936 3,149 1,501 32 22 47 38 297 154 428 8,729 2,739 12,429 1,350 1,549 58 30 20 1,207 2,984 1,718 1,831 6,617 810 84 19,354 9,779 19,471 16,705 310 6,708 371 12,506 1,797 2,878 8,470 10,062 11,174 6,418 9,277 19 23 67 109 12 0 511 511 710
osa-miR167g UGAAGCUGCCAGCAUGAUCUG 21 188,418 3,623 19,471 12    582 918 917 936 3,149 1,501 32 22 47 38 297 154 428 8,729 2,739 12,429 1,350 1,549 58 30 20 1,207 2,984 1,718 1,831 6,617 810 84 19,354 9,779 19,471 16,705 310 6,708 371 12,506 1,797 2,878 8,470 10,062 11,174 6,418 9,277 19 23 67 109 12 0 511 511 710
osa-miR167h-3p AGGUCAUGCUGUAGUUUCAUC 21 3,054 59 653 1    0 0 0 0 0 85 0 1 0 6 91 144 117 0 1 8 6 5 0 0 0 0 1 2 2 0 199 31 8 13 6 7 0 0 0 3 182 256 6 6 5 1 7 0 0 32 15 0 0 653 535 620
osa-miR167h-5p UGAAGCUGCCAGCAUGAUCUG 21 188,418 3,623 19,471 12    582 918 917 936 3,149 1,501 32 22 47 38 297 154 428 8,729 2,739 12,429 1,350 1,549 58 30 20 1,207 2,984 1,718 1,831 6,617 810 84 19,354 9,779 19,471 16,705 310 6,708 371 12,506 1,797 2,878 8,470 10,062 11,174 6,418 9,277 19 23 67 109 12 0 511 511 710
osa-miR167i-3p AGAUCAUGUUGCAGCUUCACU 21 3,097 60 478 1    101 478 0 0 0 18 1 2 9 3 14 19 19 21 28 31 45 4 1 1 0 11 4 17 10 7 16 0 461 146 256 415 1 46 13 51 23 32 51 30 16 8 1 1 1 1 2 0 0 267 247 168
osa-miR167i-5p UGAAGCUGCCAGCAUGAUCUG 21 188,418 3,623 19,471 12    582 918 917 936 3,149 1,501 32 22 47 38 297 154 428 8,729 2,739 12,429 1,350 1,549 58 30 20 1,207 2,984 1,718 1,831 6,617 810 84 19,354 9,779 19,471 16,705 310 6,708 371 12,506 1,797 2,878 8,470 10,062 11,174 6,418 9,277 19 23 67 109 12 0 511 511 710
osa-miR167j UGAAGCUGCCAGCAUGAUCUG 21 188,418 3,623 19,471 12    582 918 917 936 3,149 1,501 32 22 47 38 297 154 428 8,729 2,739 12,429 1,350 1,549 58 30 20 1,207 2,984 1,718 1,831 6,617 810 84 19,354 9,779 19,471 16,705 310 6,708 371 12,506 1,797 2,878 8,470 10,062 11,174 6,418 9,277 19 23 67 109 12 0 511 511 710
osa-miR168a-3p GAUCCCGCCUUGCACCAAGUGAAU 24 4,934 95 2,453 1    22 17 0 0 0 185 62 2,453 138 6 7 165 154 62 116 47 2 4 6 1 1 1 302 246 239 35 125 8 9 5 8 10 5 7 3 18 4 3 135 119 4 7 10 2 2 1 5 2 0 166 2 3
osa-miR168a-5p UCGCUUGGUGCAGAUCGGGAC 21 2,529,002 48,635 204,317 25    102,866 204,317 16,423 14,948 1,321 16,717 38 25 91 2,399 22,477 28,070 19,148 22,831 19,874 2,602 8,374 9,463 1,882 1,860 1,218 6,241 121,418 124,772 133,722 23,822 9,079 388 198,069 166,352 130,466 119,611 40,036 54,060 48,733 170,272 20,423 26,511 16,131 30,889 4,048 111,951 18,308 16,063 16,132 538 824 52 262 167,584 113,750 141,551
osa-miR168b AGGCUUGGUGCAGCUCGGGAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR169a CAGCCAAGGAUGACUUGCCGA 21 20,179 388 5,801 1    22 42 26 0 3 17 0 1 1 29 17 55 57 3,049 1,977 5,801 88 54 3 9 0 1 80 51 59 42 178 0 626 294 492 495 7 1,033 11 487 704 985 890 730 235 718 660 1 1 0 0 0 0 47 69 32
osa-miR169b CAGCCAAGGAUGACUUGCCGG 21 101,656 1,955 32,281 1    4 21 973 828 567 247 0 4 7 17 263 1,388 547 9,850 7,897 9,863 35 30 1 12 0 1 551 424 579 1,473 216 8 464 296 299 776 37 32,281 22 16,362 50 65 1,167 1,352 701 4,472 416 2 1 0 1 1 0 3,395 1,403 2,287
osa-miR169c CAGCCAAGGAUGACUUGCCGG 21 101,656 1,955 32,281 1    4 21 973 828 567 247 0 4 7 17 263 1,388 547 9,850 7,897 9,863 35 30 1 12 0 1 551 424 579 1,473 216 8 464 296 299 776 37 32,281 22 16,362 50 65 1,167 1,352 701 4,472 416 2 1 0 1 1 0 3,395 1,403 2,287
osa-miR169d UAGCCAAGGAUGAAUUGCCGG 21 64 1 14 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 2 0 0 0 14 5 8 7 7 0 6 0 0 0 0 0 0 0 0 5 3 4 1 0 0 0 0 0
osa-miR169e UAGCCAAGGAUGACUUGCCGG 21 1,425 27 168 1    0 0 1 0 0 0 0 0 0 0 2 6 3 19 16 139 0 0 0 0 0 1 2 2 2 3 1 0 168 155 111 144 87 33 66 49 1 12 12 18 11 17 1 30 33 33 50 1 0 89 25 82
osa-miR169f.1 UAGCCAAGGAUGACUUGCCUA 21 25,412 489 12,183 1    0 0 8 178 0 62 0 0 0 0 139 276 429 1,591 3,334 12,183 1 0 0 0 0 0 162 383 478 243 120 0 2 1 0 6 0 7 0 11 384 586 1,202 505 705 1,258 1,085 0 0 0 0 0 0 24 28 21
osa-miR169f.2 UGAGGACAAGAGCUGAUUCGG 21 2,493 48 1,020 1    14 38 0 0 0 0 0 0 0 1 5 19 2 80 50 10 1 3 0 0 0 0 28 64 75 12 1,020 5 2 1 1 3 0 208 0 178 95 212 42 125 18 47 27 1 1 1 1 26 0 23 29 25
osa-miR169g UAGCCAAGGAUGACUUGCCUA 21 25,412 489 12,183 1    0 0 8 178 0 62 0 0 0 0 139 276 429 1,591 3,334 12,183 1 0 0 0 0 0 162 383 478 243 120 0 2 1 0 6 0 7 0 11 384 586 1,202 505 705 1,258 1,085 0 0 0 0 0 0 24 28 21
osa-miR169h UAGCCAAGGAUGACUUGCCUG 21 203,780 3,919 91,846 2    0 0 15 2 0 34 0 0 0 0 128 122 482 14,520 28,680 91,846 12 6 0 3 0 0 681 724 850 580 497 0 11 31 12 92 3 1,669 2 759 570 1,276 2,214 983 27,349 17,459 12,148 0 0 0 0 0 0 9 7 4
osa-miR169i-3p UGAGUCGCUCUUAUCACUCAUG 22 7,482 144 1,892 1    0 0 24 2 0 169 2 1 0 2 226 368 619 578 1,119 1,892 5 2 0 3 0 0 0 0 53 41 129 0 0 1 0 9 1 26 0 39 26 66 22 6 627 587 833 0 0 0 0 0 0 1 2 1
osa-miR169i-5p.1 UAGCCAAGGAUGACUUGCCUG 21 203,780 3,919 91,846 2    0 0 15 2 0 34 0 0 0 0 128 122 482 14,520 28,680 91,846 12 6 0 3 0 0 681 724 850 580 497 0 11 31 12 92 3 1,669 2 759 570 1,276 2,214 983 27,349 17,459 12,148 0 0 0 0 0 0 9 7 4
osa-miR169i-5p.2 UGGUGAUAAGGGUGUAGCUCUG 22 95 2 53 1    0 0 0 0 0 0 0 0 0 0 1 2 2 1 0 7 0 0 0 0 0 0 0 0 0 0 53 0 0 0 0 1 0 0 0 0 1 4 0 1 0 1 20 0 0 0 0 0 0 1 0 0
osa-miR169j UAGCCAAGGAUGACUUGCCUG 21 203,780 3,919 91,846 2    0 0 15 2 0 34 0 0 0 0 128 122 482 14,520 28,680 91,846 12 6 0 3 0 0 681 724 850 580 497 0 11 31 12 92 3 1,669 2 759 570 1,276 2,214 983 27,349 17,459 12,148 0 0 0 0 0 0 9 7 4
osa-miR169k UAGCCAAGGAUGACUUGCCUG 21 203,780 3,919 91,846 2    0 0 15 2 0 34 0 0 0 0 128 122 482 14,520 28,680 91,846 12 6 0 3 0 0 681 724 850 580 497 0 11 31 12 92 3 1,669 2 759 570 1,276 2,214 983 27,349 17,459 12,148 0 0 0 0 0 0 9 7 4
osa-miR169l UAGCCAAGGAUGACUUGCCUG 21 203,780 3,919 91,846 2    0 0 15 2 0 34 0 0 0 0 128 122 482 14,520 28,680 91,846 12 6 0 3 0 0 681 724 850 580 497 0 11 31 12 92 3 1,669 2 759 570 1,276 2,214 983 27,349 17,459 12,148 0 0 0 0 0 0 9 7 4
osa-miR169m UAGCCAAGGAUGACUUGCCUG 21 203,780 3,919 91,846 2    0 0 15 2 0 34 0 0 0 0 128 122 482 14,520 28,680 91,846 12 6 0 3 0 0 681 724 850 580 497 0 11 31 12 92 3 1,669 2 759 570 1,276 2,214 983 27,349 17,459 12,148 0 0 0 0 0 0 9 7 4
osa-miR169n UAGCCAAGAAUGACUUGCCUA 21 28,333 545 17,190 1    0 4 6 2 0 46 0 1 0 0 68 82 232 706 1,769 17,190 0 1 0 0 1 0 450 628 639 320 113 5 5 8 4 32 3 15 5 62 129 126 710 272 1,903 1,380 1,356 0 0 0 0 0 0 29 16 15
osa-miR169o UAGCCAAGAAUGACUUGCCUA 21 28,333 545 17,190 1    0 4 6 2 0 46 0 1 0 0 68 82 232 706 1,769 17,190 0 1 0 0 1 0 450 628 639 320 113 5 5 8 4 32 3 15 5 62 129 126 710 272 1,903 1,380 1,356 0 0 0 0 0 0 29 16 15
osa-miR169p UAGCCAAGGACAAACUUGCCGG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR169q UAGCCAAGGAGACUGCCCAUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR169r-3p UGGCAAGUCUCCUCGGCUACC 21 117 2 21 1    0 0 0 0 9 1 0 0 1 0 0 1 1 5 9 9 0 0 0 0 0 0 1 0 0 0 3 0 0 0 0 5 0 0 0 13 1 1 1 1 19 7 21 0 0 0 0 0 0 3 2 3
osa-miR169r-5p UAGCCAAGGAUGAUUUGCCUG 21 163 3 53 1    0 0 0 0 0 1 0 0 0 0 3 6 16 2 16 53 0 0 0 0 0 0 0 2 2 1 1 0 0 2 0 2 0 4 0 1 1 1 1 1 14 8 25 0 0 0 0 0 0 0 0 0
osa-miR171a UGAUUGAGCCGCGCCAAUAUC 21 56 1 12 1    0 0 1 4 5 1 0 0 0 0 2 1 5 0 0 3 1 0 0 0 0 0 1 0 0 0 0 5 0 0 1 0 0 0 0 0 1 0 4 12 0 0 2 0 0 1 1 0 0 3 1 1
osa-miR171b UGAUUGAGCCGUGCCAAUAUC 21 27,703 533 4,700 1    65 72 648 4,700 4,178 1,090 15 4 10 30 217 81 384 745 728 2,705 32 46 0 23 1 4 275 110 150 54 76 3 197 162 128 241 142 64 164 255 19 19 2,180 1,281 1,810 564 40 27 41 8 26 2 262 1,465 1,015 1,145
osa-miR171c-3p UGAUUGAGCCGUGCCAAUAUC 21 27,703 533 4,700 1    65 72 648 4,700 4,178 1,090 15 4 10 30 217 81 384 745 728 2,705 32 46 0 23 1 4 275 110 150 54 76 3 197 162 128 241 142 64 164 255 19 19 2,180 1,281 1,810 564 40 27 41 8 26 2 262 1,465 1,015 1,145
osa-miR171c-5p GGAUAUUGGUGCGGUUCAAUC 21 97 2 14 1    14 8 0 0 0 1 0 0 1 0 0 1 0 0 0 0 0 3 0 1 0 0 0 1 2 0 0 0 5 10 2 10 7 0 3 7 0 1 1 0 0 0 0 4 3 4 4 1 0 1 1 1
osa-miR171d-3p UGAUUGAGCCGUGCCAAUAUC 21 27,703 533 4,700 1    65 72 648 4,700 4,178 1,090 15 4 10 30 217 81 384 745 728 2,705 32 46 0 23 1 4 275 110 150 54 76 3 197 162 128 241 142 64 164 255 19 19 2,180 1,281 1,810 564 40 27 41 8 26 2 262 1,465 1,015 1,145
osa-miR171d-5p UGUUGGCCCGGCUCACUCAGA 21 267 5 49 1    0 0 0 0 0 1 0 0 1 0 0 0 0 0 0 3 0 0 1 1 0 0 2 0 0 3 1 0 13 18 21 15 4 20 7 49 0 1 7 6 26 29 0 4 4 8 17 2 0 1 1 1
osa-miR171e-3p UGAUUGAGCCGUGCCAAUAUC 21 27,703 533 4,700 1    65 72 648 4,700 4,178 1,090 15 4 10 30 217 81 384 745 728 2,705 32 46 0 23 1 4 275 110 150 54 76 3 197 162 128 241 142 64 164 255 19 19 2,180 1,281 1,810 564 40 27 41 8 26 2 262 1,465 1,015 1,145
osa-miR171e-5p UGUUGGCUCGGCUCACUCAGA 21 690 13 136 1    14 8 0 136 6 2 0 0 0 0 1 0 0 0 6 4 2 0 0 2 0 0 3 0 0 0 2 0 40 28 44 37 3 33 5 30 1 4 12 10 32 28 3 4 4 88 92 2 0 1 2 1
osa-miR171f-3p UGAUUGAGCCGUGCCAAUAUC 21 27,703 533 4,700 1    65 72 648 4,700 4,178 1,090 15 4 10 30 217 81 384 745 728 2,705 32 46 0 23 1 4 275 110 150 54 76 3 197 162 128 241 142 64 164 255 19 19 2,180 1,281 1,810 564 40 27 41 8 26 2 262 1,465 1,015 1,145
osa-miR171f-5p UGUUGGCAUGGUUCAAUCAAA 21 1,695 33 578 1    0 0 5 0 0 43 2 0 0 0 0 1 0 0 0 0 0 5 0 0 0 0 2 5 2 0 0 0 0 0 1 1 0 0 0 11 1 1 1 0 0 0 0 0 0 0 0 0 0 499 578 537
osa-miR171g GAGGUGAGCCGAGCCAAUAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR171h GUGAGCCGAACCAAUAUCACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR171i-3p GGAUUGAGCCGCGUCAAUAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR171i-5p AGGUAUUGGCGUGCCUCAAUC 21 102 2 23 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 0 0 0 0 0 0 0 0 0 0 0 17 23 11 17 5 2 5 7 1 1 2 2 1 1 1 1 1 0 1 0 0 0 0 0
osa-miR172a AGAAUCUUGAUGAUGCUGCAU 21 1,323,110 25,444 417,906 1    18 63 8 0 26 383 2 2 3 102 373 154 376 24,890 24,720 80,662 1,520 571 8 1 21 30 17,187 47,049 40,237 67,866 94,701 0 32,702 7,960 13,613 18,180 3,624 336 3,688 1,393 7,714 5,544 417,906 270,845 52,844 76,119 3,045 943 752 3 49 0 0 2,183 1,335 1,359
osa-miR172b GGAAUCUUGAUGAUGCUGCAU 21 7,737 149 5,988 1    25 34 0 0 0 2 0 0 0 1 1 0 1 39 14 76 1 0 2 0 0 2 11 25 8 31 5,988 0 192 77 145 159 136 9 173 7 4 18 213 138 84 56 34 7 7 0 5 0 0 5 5 2
osa-miR172c UGAAUCUUGAUGAUGCUGCAC 21 4,493 86 2,333 1    0 0 0 0 0 0 0 0 0 0 0 0 0 2,333 1,221 661 0 0 0 31 0 0 16 55 18 15 6 0 1 0 0 0 1 4 1 82 2 1 11 20 6 6 0 0 1 0 0 0 0 0 0 1
osa-miR172d-3p AGAAUCUUGAUGAUGCUGCAU 21 1,323,110 25,444 417,906 1    18 63 8 0 26 383 2 2 3 102 373 154 376 24,890 24,720 80,662 1,520 571 8 1 21 30 17,187 47,049 40,237 67,866 94,701 0 32,702 7,960 13,613 18,180 3,624 336 3,688 1,393 7,714 5,544 417,906 270,845 52,844 76,119 3,045 943 752 3 49 0 0 2,183 1,335 1,359
osa-miR172d-5p GCAGCACCAUCAAGAUUCAC 20 229 4 54 1    0 0 0 0 0 1 0 1 1 0 1 1 0 0 0 0 1 2 0 0 0 0 0 0 0 0 4 0 32 8 6 18 1 0 2 1 0 1 0 1 0 0 0 1 2 3 2 0 0 39 46 54
osa-miR1846a-3p UGACCCCGUUCUCCUCGCCGG 21 333 6 99 1    0 0 0 99 12 0 0 0 0 1 0 0 0 0 0 5 0 0 0 0 0 0 0 0 0 0 8 0 0 0 0 0 0 0 0 0 29 26 26 23 17 26 1 0 1 1 1 1 0 19 17 20
osa-miR1846a-5p AGUGAGGAGGCCGGGGCCGCU 21 74 1 11 1    4 0 0 0 0 1 0 0 0 0 0 2 0 0 0 0 0 0 0 1 0 0 1 0 0 0 2 0 0 0 0 2 0 0 0 0 4 5 6 6 3 8 11 0 2 0 0 0 0 4 7 5
osa-miR1846b-3p UGACCCCGUUCUCCUCGCCGG 21 333 6 99 1    0 0 0 99 12 0 0 0 0 1 0 0 0 0 0 5 0 0 0 0 0 0 0 0 0 0 8 0 0 0 0 0 0 0 0 0 29 26 26 23 17 26 1 0 1 1 1 1 0 19 17 20
osa-miR1846b-5p AGUGAGGAGGCCGGGGCCGCU 21 74 1 11 1    4 0 0 0 0 1 0 0 0 0 0 2 0 0 0 0 0 0 0 1 0 0 1 0 0 0 2 0 0 0 0 2 0 0 0 0 4 5 6 6 3 8 11 0 2 0 0 0 0 4 7 5
osa-miR1846c-3p UGACCCCGGUCUGCUCGCUGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1846c-5p AGUGAGGAGGCCGGGGCCGCU 21 74 1 11 1    4 0 0 0 0 1 0 0 0 0 0 2 0 0 0 0 0 0 0 1 0 0 1 0 0 0 2 0 0 0 0 2 0 0 0 0 4 5 6 6 3 8 11 0 2 0 0 0 0 4 7 5
osa-miR1846d-3p UAUCCGGCGCCGCAGGGAGG 20 38 1 4 1    0 4 0 0 0 1 0 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0 2 0 2 3 0 0 0 0 0 2 0 2 0 4 0 1 1 1 1 1 0 1 1 0 0 0 0 3 4 2
osa-miR1846d-5p UCCCACCGAGCAGCCGGAUCUC 22 313 6 98 1    0 4 5 0 0 6 0 0 0 0 1 1 1 9 3 1 0 0 0 1 0 0 0 0 8 4 1 0 0 0 0 1 1 2 0 3 1 2 5 9 98 75 2 1 1 0 1 0 0 23 22 21
osa-miR1846e CAACGAGGAGGCCGGGACCA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1847.1 UGCAGUUUGCAGUUGUGGCAC 21 77 1 10 1    4 4 0 0 0 2 0 0 0 0 1 0 1 1 1 2 0 1 0 0 0 0 1 4 2 5 0 0 5 2 4 5 0 0 0 0 0 1 3 10 7 6 0 0 0 0 0 0 0 2 2 1
osa-miR1847.2 UGGCCCACAUGUUAGUGCCACAAC 24 8 0 2 1    0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 1 2 1 0 0 0 0 0 0 0 0 0 0
osa-miR1848 CCUCGCCGGCGCGCGCGUGCA 21 20 0 6 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 1 0 0 0 0 0 0 0 5 5 6
osa-miR1849 UAUCGUAUCCUAGGUUGGUUU 21 258 5 56 1    11 13 8 0 0 3 0 0 0 2 14 9 15 0 0 0 0 0 0 0 0 0 2 3 0 0 3 0 4 1 2 0 0 0 1 3 2 2 1 1 0 1 0 1 1 0 1 0 0 51 47 56
osa-miR1850.1 UGGAAAGUUGGGAGAUUGGGG 21 9,209 177 1,874 1    749 1,874 0 0 10 50 2 4 26 5 241 330 232 27 11 2 13 181 121 5 7 60 19 36 34 11 327 77 64 140 110 135 2 713 3 611 7 9 4 7 1 8 27 51 45 403 520 33 785 313 405 359
osa-miR1850.2 UUGUGUGUGAACUAAACGUGG 21 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1850.3 CUGUUUAGUUCACAUCAAUCUU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1851 CGUCUGGGAUGGCAUUUUGGC 21 378 7 61 1    4 8 0 0 0 2 0 0 0 0 5 2 4 61 37 19 2 0 6 0 3 0 7 0 2 4 10 0 9 2 7 9 0 0 0 0 13 16 32 40 23 19 21 1 1 0 0 0 0 1 5 3
osa-miR1852 AUAUGGAUUCAGAAUGCAGGU 21 41 1 9 1    4 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 3 0 0 5 1 5 0 0 0 0 0 1 1 0 1 1 0 0 1 1 9 3 0 0 0 0 0
osa-miR1853-3p UAAUUGGGGAUGUUCGGUUGCU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1853-5p AGCAUUCAAACAUUCCCAAUUACC 24 4 0 4 4    0 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1854-3p UCCAAUUUGGGGAUUUGCUGAU 22 4 0 4 4    0 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1854-5p UGGUGAAAUUUGUAGAUUGGA 21 8 0 8 8    0 8 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1855 AGCACUGGAGUAGCCAAGAGA 21 8 0 8 8    0 8 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1856 UAUGCGUAAGACGGAUUCGUA 21 6,652 128 1,983 1    4 30 239 4 172 102 2 0 1 1 39 49 17 0 2 1 1 4 0 0 0 1 22 45 24 8 1 0 2 0 8 1 0 0 0 0 180 281 7 8 1 3 7 0 0 0 0 0 0 1,480 1,983 1,922
osa-miR1857-3p UCAUGCUCCAAGAAAACCAGG 21 1,320 25 341 1    4 4 51 104 341 11 0 1 2 5 29 29 14 0 0 0 1 1 1 0 0 1 1 1 0 0 24 0 1 0 1 3 0 7 1 10 0 1 1 1 0 0 0 1 1 4 7 1 0 180 248 227
osa-miR1857-5p UGGUUUUUUUGGAGCAUGAGG 21 142 3 34 1    0 0 7 0 0 1 0 0 1 0 14 7 6 1 1 1 0 1 0 0 0 0 0 1 6 0 4 0 0 0 2 0 0 0 0 6 2 3 1 2 1 1 0 0 0 1 3 1 0 16 34 18
osa-miR1858a GAGAGGAGGACGGAGUGGGGC 21 30 1 30 30    0 30 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1858b GAGAGGAGGACGGAGUGGGGC 21 30 1 30 30    0 30 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1859 UUUCCUAUGACGUCCAUUCCAA 22 6,962 134 1,379 1    25 237 5 0 0 0 0 0 0 0 2 0 1 0 1 1 2 2 0 9 0 4 0 0 2 0 2 0 1,379 1,139 1,027 1,205 2 0 3 6 0 0 1 2 0 0 0 915 740 13 28 19 0 82 34 74
osa-miR1860-3p AUCUGGAAGCUAGGUUUUCUCU 22 1,364 26 297 1    7 30 0 0 0 15 0 1 0 0 8 6 14 171 130 183 1 1 1 1 2 1 0 0 32 82 2 0 3 10 6 3 3 7 2 13 28 12 9 5 48 86 297 4 3 0 3 0 0 41 52 41
osa-miR1860-5p AGAAAACCAGCUUCCAGAUCU 21 112 2 21 1    4 17 0 0 0 4 0 1 0 0 2 4 1 3 4 0 0 1 0 0 0 1 1 6 2 1 1 0 1 1 0 0 0 0 0 0 0 0 0 0 0 1 0 1 2 0 0 0 0 21 18 14
osa-miR1861a UGAUCUUGAGGCAGAAACUGAG 22 55 1 13 1    0 13 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 0 7 1 0 1 10 1 7 0 1 0 0 0 0 3 0 0 3 2 3
osa-miR1861b CGAUCUUGAGGCAGGAACUGAG 22 6,061 117 1,654 1    7 334 0 0 0 2 0 0 0 2 46 0 1 0 1 0 0 7 1 2 1 4 0 0 2 1 2 0 1,057 730 662 820 1 1,654 1 224 1 2 9 24 2 2 0 1 1 8 0 11 0 56 83 299
osa-miR1861c CGAUCUUGUAGCAAGAACUGAG 22 130 3 44 1    0 4 0 0 0 1 0 0 0 0 5 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 44 0 3 1 10 4 4 6 2 0 0 1 0 3 0 0 3 8 27
osa-miR1861d UGGUCUUGAGGCAGGAACUGAG 22 85 2 29 1    0 4 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 10 0 2 9 0 0 0 0 1 4 1 4 1 1 1 1 0 0 0 0 0 3 13 29
osa-miR1861e CGGUCUUGUGGCAAGAACUGAG 22 1,804 35 387 1    0 0 0 0 0 2 0 0 0 2 250 352 21 0 2 1 0 4 0 0 0 0 0 0 0 5 0 0 81 29 49 47 2 55 1 24 20 49 11 10 7 2 6 0 0 0 0 0 0 47 338 387
osa-miR1861f CGAUCUUGAGGCAGGAACUGAG 22 6,061 117 1,654 1    7 334 0 0 0 2 0 0 0 2 46 0 1 0 1 0 0 7 1 2 1 4 0 0 2 1 2 0 1,057 730 662 820 1 1,654 1 224 1 2 9 24 2 2 0 1 1 8 0 11 0 56 83 299
osa-miR1861g CAGUCUUGUGGCAAGAACUGAG 22 4 0 1 1    0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1
osa-miR1861h CGGUCUUGAGGCAGGAACUGAG 22 9,096 175 2,305 1    18 80 0 0 0 6 0 0 0 4 116 44 5 50 17 27 0 1 0 0 0 0 0 0 2 8 11 3 7 1 2 13 7 1,267 0 226 115 478 253 514 207 97 37 1 1 11 4 0 0 1,225 1,933 2,305
osa-miR1861i CGAUCUUGAGGCAGGAACUGAG 22 6,061 117 1,654 1    7 334 0 0 0 2 0 0 0 2 46 0 1 0 1 0 0 7 1 2 1 4 0 0 2 1 2 0 1,057 730 662 820 1 1,654 1 224 1 2 9 24 2 2 0 1 1 8 0 11 0 56 83 299
osa-miR1861j CGGUCUUGAGGCAGGAACUGAG 22 9,096 175 2,305 1    18 80 0 0 0 6 0 0 0 4 116 44 5 50 17 27 0 1 0 0 0 0 0 0 2 8 11 3 7 1 2 13 7 1,267 0 226 115 478 253 514 207 97 37 1 1 11 4 0 0 1,225 1,933 2,305
osa-miR1861k CGGUCUUGUGGCAAGAACUGAG 22 1,804 35 387 1    0 0 0 0 0 2 0 0 0 2 250 352 21 0 2 1 0 4 0 0 0 0 0 0 0 5 0 0 81 29 49 47 2 55 1 24 20 49 11 10 7 2 6 0 0 0 0 0 0 47 338 387
osa-miR1861l CGAUCUUGAGGCAGGAACUGAG 22 6,061 117 1,654 1    7 334 0 0 0 2 0 0 0 2 46 0 1 0 1 0 0 7 1 2 1 4 0 0 2 1 2 0 1,057 730 662 820 1 1,654 1 224 1 2 9 24 2 2 0 1 1 8 0 11 0 56 83 299
osa-miR1861m CGGUCUUGUGGCAAGAACUGAG 22 1,804 35 387 1    0 0 0 0 0 2 0 0 0 2 250 352 21 0 2 1 0 4 0 0 0 0 0 0 0 5 0 0 81 29 49 47 2 55 1 24 20 49 11 10 7 2 6 0 0 0 0 0 0 47 338 387
osa-miR1861n CGAUCUUGUGGCAGGAGCUGAG 22 28 1 15 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 10 15 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1
osa-miR1861o UGAUCUUGAGGCAGAAACUGAG 22 55 1 13 1    0 13 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 0 7 1 0 1 10 1 7 0 1 0 0 0 0 3 0 0 3 2 3
osa-miR1862a ACGAGGUUGGUUUAUUUUGGGACG 24 1,175 23 264 1    29 118 0 0 0 13 47 89 3 14 5 18 15 11 10 47 1 1 0 0 0 0 21 13 10 4 27 0 0 1 0 0 0 0 0 0 31 29 85 76 34 37 27 27 28 6 20 1 0 264 3 10
osa-miR1862b ACGAGGUUGGUUUAUUUUGGGACG 24 1,175 23 264 1    29 118 0 0 0 13 47 89 3 14 5 18 15 11 10 47 1 1 0 0 0 0 21 13 10 4 27 0 0 1 0 0 0 0 0 0 31 29 85 76 34 37 27 27 28 6 20 1 0 264 3 10
osa-miR1862c ACGAGGUUGGUUUAUUUUGGGACG 24 1,175 23 264 1    29 118 0 0 0 13 47 89 3 14 5 18 15 11 10 47 1 1 0 0 0 0 21 13 10 4 27 0 0 1 0 0 0 0 0 0 31 29 85 76 34 37 27 27 28 6 20 1 0 264 3 10
osa-miR1862d ACUAGGUUUGUUUAUUUUGGGACG 24 20,361 392 3,569 8    72 237 0 0 0 174 1,159 483 61 323 10 133 257 154 304 1,030 0 0 0 0 0 0 170 157 144 66 1,626 356 0 0 0 0 122 1,905 93 456 426 767 627 488 65 43 73 65 65 1,168 1,294 87 2,094 3,569 8 30
osa-miR1862e CUAGAUUUGUUUAUUUUGGGACGG 24 12,050 232 3,393 1    43 93 0 0 0 28 1 43 1 73 19 49 72 78 131 140 0 0 1 0 0 0 391 601 441 202 730 3,393 1 0 0 0 50 698 44 166 251 388 299 540 82 105 54 120 74 379 546 837 262 531 31 62
osa-miR1862f AUGAGGUUGGUUUAUUUUGG 20 2 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1862g AUGAGGUUGGUUUAUUUUGG 20 2 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1863a AGCUCUGAUACCAUGUUAGAUUAG 24 24,214 466 5,135 1    11 25 0 0 0 3,016 2,506 682 184 391 42 1,068 541 485 725 163 0 0 1 0 0 0 1,414 5,135 4,211 611 41 0 0 0 0 0 17 7 22 30 57 59 230 177 101 37 48 59 50 6 13 0 0 1,989 11 49
osa-miR1863b AGCUCUGAUACCAUGUUAACUGUU 24 85 2 24 1    0 0 0 0 0 13 15 24 0 1 1 6 2 0 0 2 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 1 1 3 3 0 0 9 0 1
osa-miR1863b.2 AGAGACUUGGCUGAUGCAUUACU 23 175 3 43 1    7 25 0 0 0 2 3 43 4 1 1 1 1 3 1 0 0 0 0 0 0 0 8 11 16 3 1 0 0 0 0 1 1 0 0 1 1 2 1 3 1 0 0 9 8 1 1 1 0 5 2 6
osa-miR1863c UAGAAACUUGGCUGAUGCAUUACU 24 352 7 87 1    7 30 0 0 0 4 0 52 1 4 0 21 7 0 2 1 0 0 1 1 0 0 7 5 10 1 2 87 0 0 0 1 2 2 3 7 2 2 6 9 1 1 2 2 1 8 25 0 0 33 1 1
osa-miR1864 UUGUAGUAACGUGAUGGUCAAUGU 24 195 4 39 1    14 38 0 0 0 2 0 1 0 2 1 0 1 0 0 1 1 1 0 0 0 0 2 7 4 0 2 0 3 2 3 2 4 2 3 3 3 2 1 2 1 0 0 39 30 1 6 0 0 9 1 1
osa-miR1865-3p CGAAGAAUCGCAGUCACUAGUUGU 24 22 0 4 1    4 0 0 0 0 0 0 3 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 0 0 0 1 2 0 1 0 0 0 1 0 0 0 1 1 1 3 1 0 0 0 0
osa-miR1865-5p UGCUAGUGAUGGUGAUUCUUCGAC 24 430 8 118 1    4 8 0 0 0 1 0 76 2 2 1 1 3 7 3 8 0 0 0 0 0 0 5 7 2 5 7 0 0 0 0 0 15 11 18 16 11 9 46 118 13 20 0 2 1 0 3 0 0 4 1 0
osa-miR1866-3p UGAAAUUCCUGUAAAAUUCUUG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
osa-miR1866-5p GAGGGAUUUUGCGGGAAUUUCACG 24 95 2 85 1    7 85 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 0 0
osa-miR1868 UCACGGAAAACGAGGGAGCAGCCA 24 1,198 23 435 1    47 114 0 0 0 1 0 1 0 2 0 0 0 3 2 2 0 0 0 0 0 0 6 3 10 0 1 2 0 0 0 0 16 435 15 369 1 1 3 6 3 11 8 65 53 0 1 1 0 14 1 1
osa-miR1869 UGAGAACAAUAGGCAUGGGAGGUA 24 16 0 4 1    4 4 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 3 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0
osa-miR1870-3p UUUAGGGCUAAUUCAGCAUGAACA 24 648 12 110 1    0 0 0 0 0 88 2 75 2 22 1 93 46 14 5 15 0 0 0 0 0 0 7 21 18 8 6 0 0 0 0 0 1 0 0 7 18 25 7 13 6 11 17 1 1 1 3 0 0 110 1 3
osa-miR1870-5p UGCUGAAUUAGACCUAGUGGGCAU 24 13,864 267 1,600 1    268 423 0 0 0 9 0 10 1 9 0 7 5 1,600 648 361 0 1 0 0 0 0 288 313 302 1,341 19 0 0 2 2 0 356 298 287 701 988 1,550 590 620 281 564 981 486 476 13 26 0 0 37 1 0
osa-miR1871 AUGGCUCUGAUAUCAUGUUGGUUU 24 6,388 123 1,652 1    7 13 0 0 0 205 853 707 1,652 151 14 320 92 9 10 19 0 0 7 0 1 2 4 9 2 0 163 115 0 0 0 0 2 0 2 0 20 29 40 20 26 1 2 7 7 44 138 2 0 1,641 11 41
osa-miR1872 GAACUGUAAGUCUGUGACGGGUAA 24 170 3 35 1    4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 3 1 1 0 1 2 3 2 0 0 0 33 15 35 30 7 7 6 4 0 0 0 0 0 0 0 6 6 0 2 0 0 1 0 0
osa-miR1873 UCAACAUGGUAUCAGAGCUGGAAG 24 707 14 175 1    7 42 0 0 0 41 1 175 5 9 1 17 13 13 3 3 0 0 0 0 0 0 18 49 61 4 8 0 0 0 0 0 0 0 0 0 3 7 6 11 3 4 0 56 49 23 40 2 0 30 1 2
osa-miR1874-3p UAUGGAUGGAGGUGUAACCCGAUG 24 838 16 351 1    69 351 0 0 0 1 0 8 1 3 1 35 5 0 0 0 1 1 126 2 11 5 0 0 0 0 2 139 3 4 4 3 0 20 0 0 0 1 1 1 0 0 0 0 0 0 2 0 0 37 0 1
osa-miR1874-5p UAGGGCUACUACACCAUCCAUAAG 24 207 4 80 1    51 80 0 0 0 1 0 4 0 1 0 13 0 0 0 0 0 0 6 1 2 0 1 0 0 0 1 31 2 1 4 0 0 0 0 0 1 1 1 1 0 0 0 0 0 0 0 0 0 4 0 0
osa-miR1875 ACAAUGGAGUGAAGUGCAACAGAA 24 311 6 62 1    11 25 0 0 0 2 5 1 0 0 1 1 1 1 0 0 1 4 2 1 1 4 2 10 8 4 1 0 61 62 42 33 0 0 0 11 0 0 0 1 0 0 0 3 3 1 2 1 0 2 1 2
osa-miR1876 AUAAGUGGGUUUGUGGGCUGGCCC 24 10,442 201 1,516 2    4 13 0 0 0 71 356 130 99 43 2 63 46 259 95 1,516 0 0 0 0 0 0 124 30 16 86 139 17 0 0 0 0 8 554 5 220 515 512 1,477 848 1,360 671 387 4 3 11 36 11 0 700 2 9
osa-miR1877 AGAUGACAUGUGAAUGAUGAGGGG 24 306 6 279 1    22 279 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 0 0 0 0
osa-miR1878 ACUUAAUCUGGACACUAUAAAAGA 24 1,046 20 328 1    4 13 0 0 0 32 259 55 19 22 8 7 29 0 0 0 0 0 0 0 0 0 17 23 12 0 4 6 0 0 0 0 4 0 2 0 0 0 1 1 0 0 0 4 7 77 80 0 0 328 8 24
osa-miR1879 GUGUUUGGUUUAGGGAUGAGGUGG 24 578 11 87 1    11 38 0 0 0 9 2 87 6 19 4 17 24 5 8 4 0 0 0 0 0 0 6 8 0 0 62 3 0 0 0 0 2 73 1 55 2 3 4 6 2 2 0 8 7 27 20 20 0 31 1 1
osa-miR1880 UUCCAAGCGGGCCACUUAAGCAUU 24 72 1 17 1    4 17 0 0 0 1 0 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 2 2 3 1 0 1 1 1 1 1 0 9 12 0 0 0 0 12 0 1
osa-miR1881 AAUGUUAUUGUAGCGUGGUGGUGU 24 482 9 219 1    43 42 0 0 0 1 2 1 2 4 0 8 1 2