Rice miRNA Abundances

The data below are based on the microRNAs listed in the Sanger registry. Adjust libraries/reads to display on the control panel.


        miRNA         miRNA sequence Len Sum (norm) Average Max Min (>0)  SC938INF939 INF9311aNPBs
osa-miR1319a AACCGGCAUCUGUAAUAUAUUAUA 24 0 0 0 0    0 0 0 0
osa-miR1319b CCUUUAAUAUAUUAUAGGUGUCGG 24 0 0 0 0    0 0 0 0
osa-miR1320-3p UGUAAAAUUCAUUCGUUCCAA 21 0 0 0 0    0 0 0 0
osa-miR1320-5p UGGAACGGAGGAAUUUUAUAG 21 0 0 0 0    0 0 0 0
osa-miR1423-3p AGCGCCCAAGCGGUAGUUGUC 21 0 0 0 0    0 0 0 0
osa-miR1423-5p AGGCAACUACACGUUGGGCGCUCG 24 0 0 0 0    0 0 0 0
osa-miR1424 AUGCACACUGAUGCUGAUUGU 21 0 0 0 0    0 0 0 0
osa-miR1425-3p CAGCAAGAACUGGAUCUUAAU 21 0 0 0 0    0 0 0 0
osa-miR1425-5p UAGGAUUCAAUCCUUGCUGCU 21 0 0 0 0    0 0 0 0
osa-miR1426 AGAAUCUUGAUGAUGAUUAAA 21 0 0 0 0    0 0 0 0
osa-miR1427 UGCGGAACCGUGCGGUGGCGC 21 0 0 0 0    0 0 0 0
osa-miR1428a-3p UAAGAUAAAGCCGUGAAUUUG 21 0 0 0 0    0 0 0 0
osa-miR1428a-5p CGUUUUGCAAAUUCGCAGGCC 21 0 0 0 0    0 0 0 0
osa-miR1428b UAAGAUAAUGCCAUGAAUUCG 21 0 0 0 0    0 0 0 0
osa-miR1428c UAAGAUAAUGCCAUGAAUUCG 21 0 0 0 0    0 0 0 0
osa-miR1428d UAAGAUAAUGCCAUGAAUUCG 21 0 0 0 0    0 0 0 0
osa-miR1428e-3p UAAGAUAAUGCCAUGAAUUUG 21 0 0 0 0    0 0 0 0
osa-miR1428e-5p AAUUCACAGGCCCUAUCUUGUG 22 0 0 0 0    0 0 0 0
osa-miR1428f-5p AAUUCACAGGCCCUAUCUUGUG 22 0 0 0 0    0 0 0 0
osa-miR1428g-5p AAUUCACAGGCCCUAUCUUGUG 22 0 0 0 0    0 0 0 0
osa-miR1429-3p GUUGCACGGGUUUGUAUGUUG 21 0 0 0 0    0 0 0 0
osa-miR1429-5p GUAAUAUACUAAUCCGUGCAU 21 0 0 0 0    0 0 0 0
osa-miR1430 UGGUGAGCCUUCCUGGCUAAG 21 0 0 0 0    0 0 0 0
osa-miR1431 UUUGCGAGUUGGCCCGCUUGC 21 0 0 0 0    0 0 0 0
osa-miR1432-3p CAGGUGUCAUCUCCCCUGAAC 21 0 0 0 0    0 0 0 0
osa-miR1432-5p AUCAGGAGAGAUGACACCGAC 21 0 0 0 0    0 0 0 0
osa-miR1435 UUUCUUAAGUCAAACUUUUU 20 0 0 0 0    0 0 0 0
osa-miR1436 ACAUUAUGGGACGGAGGGAGU 21 0 0 0 0    0 0 0 0
osa-miR1437a UCCGGCGCCGCACUAGGCACUG 22 0 0 0 0    0 0 0 0
osa-miR1437b-3p GUGCUGGCGAGCUCCGGUGCCGCA 24 0 0 0 0    0 0 0 0
osa-miR1437b-5p GGGAGGAAACAGUGCCUAGUG 21 0 0 0 0    0 0 0 0
osa-miR1438 AGGGUAAUUUUAUCAUUUUUAA 22 0 0 0 0    0 0 0 0
osa-miR1439 UUUUGGAACGGAGUGAGUAUU 21 0 0 0 0    0 0 0 0
osa-miR1440a UGCUCAAAUACCACUCUCCU 20 0 0 0 0    0 0 0 0
osa-miR1440b UUUAGGAGAGUGGUAUUUGAG 21 0 0 0 0    0 0 0 0
osa-miR1441 ACCGGAUGUCGGAAAAGGUUU 21 0 0 0 0    0 0 0 0
osa-miR1442 AUUCAUAGUACUAGAUGUGU 20 0 0 0 0    0 0 0 0
osa-miR156a UGACAGAAGAGAGUGAGCAC 20 101 25 50 1    16 34 1 50
osa-miR156b-3p GCUCACUCUCUAUCUGUCAGC 21 0 0 0 0    0 0 0 0
osa-miR156b-5p UGACAGAAGAGAGUGAGCAC 20 101 25 50 1    16 34 1 50
osa-miR156c-3p GCUCACUUCUCUCUCUGUCAGC 22 0 0 0 0    0 0 0 0
osa-miR156c-5p UGACAGAAGAGAGUGAGCAC 20 101 25 50 1    16 34 1 50
osa-miR156d UGACAGAAGAGAGUGAGCAC 20 101 25 50 1    16 34 1 50
osa-miR156e UGACAGAAGAGAGUGAGCAC 20 101 25 50 1    16 34 1 50
osa-miR156f-3p GCUCACUUCUCUUUCUGUCAGC 22 0 0 0 0    0 0 0 0
osa-miR156f-5p UGACAGAAGAGAGUGAGCAC 20 101 25 50 1    16 34 1 50
osa-miR156g-3p GCUCACUUCUCUCUCUGUCAGC 22 0 0 0 0    0 0 0 0
osa-miR156g-5p UGACAGAAGAGAGUGAGCAC 20 101 25 50 1    16 34 1 50
osa-miR156h-3p GCUCACUUCUCUUUCUGUCAGC 22 0 0 0 0    0 0 0 0
osa-miR156h-5p UGACAGAAGAGAGUGAGCAC 20 101 25 50 1    16 34 1 50
osa-miR156i UGACAGAAGAGAGUGAGCAC 20 101 25 50 1    16 34 1 50
osa-miR156j-3p GCUCGCUCCUCUUUCUGUCAGC 22 0 0 0 0    0 0 0 0
osa-miR156j-5p UGACAGAAGAGAGUGAGCAC 20 101 25 50 1    16 34 1 50
osa-miR156k UGACAGAAGAGAGAGAGCACA 21 0 0 0 0    0 0 0 0
osa-miR156l-3p GCUCACUUCUCUUUCUGUCAGC 22 0 0 0 0    0 0 0 0
osa-miR156l-5p CGACAGAAGAGAGUGAGCAUA 21 0 0 0 0    0 0 0 0
osa-miR159a.1 UUUGGAUUGAAGGGAGCUCUG 21 0 0 0 0    0 0 0 0
osa-miR159a.2 UUGCAUGCCCCAGGAGCUGCA 21 0 0 0 0    0 0 0 0
osa-miR159b UUUGGAUUGAAGGGAGCUCUG 21 0 0 0 0    0 0 0 0
osa-miR159c AUUGGAUUGAAGGGAGCUCCA 21 0 0 0 0    0 0 0 0
osa-miR159d AUUGGAUUGAAGGGAGCUCCG 21 0 0 0 0    0 0 0 0
osa-miR159e AUUGGAUUGAAGGGAGCUCCU 21 0 0 0 0    0 0 0 0
osa-miR159f CUUGGAUUGAAGGGAGCUCUA 21 0 0 0 0    0 0 0 0
osa-miR160a-3p GCGUGCAAGGAGCCAAGCAUG 21 0 0 0 0    0 0 0 0
osa-miR160a-5p UGCCUGGCUCCCUGUAUGCCA 21 0 0 0 0    0 0 0 0
osa-miR160b-3p GCGUGCAAGGAGCCAAGCAUG 21 0 0 0 0    0 0 0 0
osa-miR160b-5p UGCCUGGCUCCCUGUAUGCCA 21 0 0 0 0    0 0 0 0
osa-miR160c-3p GCGUGCACGGAGCCAAGCAUA 21 0 0 0 0    0 0 0 0
osa-miR160c-5p UGCCUGGCUCCCUGUAUGCCA 21 0 0 0 0    0 0 0 0
osa-miR160d-3p GCGUGCGAGGAGCCAAGCAUG 21 0 0 0 0    0 0 0 0
osa-miR160d-5p UGCCUGGCUCCCUGUAUGCCA 21 0 0 0 0    0 0 0 0
osa-miR160e-3p GCGUGCGAGGUGCCAAGCAUG 21 0 0 0 0    0 0 0 0
osa-miR160e-5p UGCCUGGCUCCCUGUAUGCCG 21 0 0 0 0    0 0 0 0
osa-miR160f-3p GCAUUGAGGGAGUCAUGCAGG 21 0 0 0 0    0 0 0 0
osa-miR160f-5p UGCCUGGCUCCCUGAAUGCCA 21 0 0 0 0    0 0 0 0
osa-miR162a UCGAUAAACCUCUGCAUCCAG 21 0 0 0 0    0 0 0 0
osa-miR162b UCGAUAAGCCUCUGCAUCCAG 21 0 0 0 0    0 0 0 0
osa-miR164a UGGAGAAGCAGGGCACGUGCA 21 0 0 0 0    0 0 0 0
osa-miR164b UGGAGAAGCAGGGCACGUGCA 21 0 0 0 0    0 0 0 0
osa-miR164c UGGAGAAGCAGGGUACGUGCA 21 0 0 0 0    0 0 0 0
osa-miR164d UGGAGAAGCAGGGCACGUGCU 21 0 0 0 0    0 0 0 0
osa-miR164e UGGAGAAGCAGGGCACGUGAG 21 0 0 0 0    0 0 0 0
osa-miR164f UGGAGAAGCAGGGCACGUGCA 21 0 0 0 0    0 0 0 0
osa-miR166a-3p UCGGACCAGGCUUCAUUCCCC 21 0 0 0 0    0 0 0 0
osa-miR166a-5p GGAAUGUUGUCUGGUUCAAGG 21 0 0 0 0    0 0 0 0
osa-miR166b-3p UCGGACCAGGCUUCAUUCCCC 21 0 0 0 0    0 0 0 0
osa-miR166b-5p GGAAUGUUGUCUGGCUCGGGG 21 0 0 0 0    0 0 0 0
osa-miR166c-3p UCGGACCAGGCUUCAUUCCCC 21 0 0 0 0    0 0 0 0
osa-miR166c-5p GGAAUGUUGUCUGGUCCGAG 20 0 0 0 0    0 0 0 0
osa-miR166d-3p UCGGACCAGGCUUCAUUCCCC 21 0 0 0 0    0 0 0 0
osa-miR166d-5p GGAAUGUUGUCUGGCUCGAGG 21 0 0 0 0    0 0 0 0
osa-miR166e-3p UCGAACCAGGCUUCAUUCCCC 21 0 0 0 0    0 0 0 0
osa-miR166e-5p GGAAUGUUGUCUGGUUCAAGG 21 0 0 0 0    0 0 0 0
osa-miR166f UCGGACCAGGCUUCAUUCCCC 21 0 0 0 0    0 0 0 0
osa-miR166g-3p UCGGACCAGGCUUCAUUCCUC 21 0 0 0 0    0 0 0 0
osa-miR166g-5p AAUGGAGGCUGAUCCAAGAUC 21 0 0 0 0    0 0 0 0
osa-miR166h-3p UCGGACCAGGCUUCAUUCCUC 21 0 0 0 0    0 0 0 0
osa-miR166h-5p GGAAUGUUGGCUGGCUCGAGG 21 0 0 0 0    0 0 0 0
osa-miR166i-3p UCGGAUCAGGCUUCAUUCCUC 21 0 0 0 0    0 0 0 0
osa-miR166i-5p AAUGCAGUUUGAUCCAAGAUC 21 0 0 0 0    0 0 0 0
osa-miR166j-3p UCGGACCAGGCUUCAUUCCCC 21 0 0 0 0    0 0 0 0
osa-miR166j-5p GAAUGACGUCCGGUCUGAAGA 21 0 0 0 0    0 0 0 0
osa-miR166k-3p UCGGACCAGGCUUCAAUCCCU 21 0 0 0 0    0 0 0 0
osa-miR166k-5p GGUUUGUUGUCUGGCUCGAGG 21 0 0 0 0    0 0 0 0
osa-miR166l-3p UCGGACCAGGCUUCAAUCCCU 21 0 0 0 0    0 0 0 0
osa-miR166l-5p GGAUUGUUGUCUGGUUCAAGG 21 0 0 0 0    0 0 0 0
osa-miR166m UCGGACCAGGCUUCAUUCCCU 21 0 0 0 0    0 0 0 0
osa-miR167a-3p AUCAUGCAUGACAGCCUCAUUU 22 0 0 0 0    0 0 0 0
osa-miR167a-5p UGAAGCUGCCAGCAUGAUCUA 21 0 0 0 0    0 0 0 0
osa-miR167b UGAAGCUGCCAGCAUGAUCUA 21 0 0 0 0    0 0 0 0
osa-miR167c-3p GGUCAUGCUGCGGCAGCCUCACU 23 0 0 0 0    0 0 0 0
osa-miR167c-5p UGAAGCUGCCAGCAUGAUCUA 21 0 0 0 0    0 0 0 0
osa-miR167d-3p GAUCAUGCUGUGCAGUUUCAUC 22 0 0 0 0    0 0 0 0
osa-miR167d-5p UGAAGCUGCCAGCAUGAUCUG 21 0 0 0 0    0 0 0 0
osa-miR167e-3p AGAUCAUGUUGCAGCUUCACU 21 0 0 0 0    0 0 0 0
osa-miR167e-5p UGAAGCUGCCAGCAUGAUCUG 21 0 0 0 0    0 0 0 0
osa-miR167f UGAAGCUGCCAGCAUGAUCUG 21 0 0 0 0    0 0 0 0
osa-miR167g UGAAGCUGCCAGCAUGAUCUG 21 0 0 0 0    0 0 0 0
osa-miR167h-3p AGGUCAUGCUGUAGUUUCAUC 21 0 0 0 0    0 0 0 0
osa-miR167h-5p UGAAGCUGCCAGCAUGAUCUG 21 0 0 0 0    0 0 0 0
osa-miR167i-3p AGAUCAUGUUGCAGCUUCACU 21 0 0 0 0    0 0 0 0
osa-miR167i-5p UGAAGCUGCCAGCAUGAUCUG 21 0 0 0 0    0 0 0 0
osa-miR167j UGAAGCUGCCAGCAUGAUCUG 21 0 0 0 0    0 0 0 0
osa-miR168a-3p GAUCCCGCCUUGCACCAAGUGAAU 24 0 0 0 0    0 0 0 0
osa-miR168a-5p UCGCUUGGUGCAGAUCGGGAC 21 0 0 0 0    0 0 0 0
osa-miR168b AGGCUUGGUGCAGCUCGGGAA 21 0 0 0 0    0 0 0 0
osa-miR169a CAGCCAAGGAUGACUUGCCGA 21 0 0 0 0    0 0 0 0
osa-miR169b CAGCCAAGGAUGACUUGCCGG 21 0 0 0 0    0 0 0 0
osa-miR169c CAGCCAAGGAUGACUUGCCGG 21 0 0 0 0    0 0 0 0
osa-miR169d UAGCCAAGGAUGAAUUGCCGG 21 0 0 0 0    0 0 0 0
osa-miR169e UAGCCAAGGAUGACUUGCCGG 21 0 0 0 0    0 0 0 0
osa-miR169f.1 UAGCCAAGGAUGACUUGCCUA 21 0 0 0 0    0 0 0 0
osa-miR169f.2 UGAGGACAAGAGCUGAUUCGG 21 0 0 0 0    0 0 0 0
osa-miR169g UAGCCAAGGAUGACUUGCCUA 21 0 0 0 0    0 0 0 0
osa-miR169h UAGCCAAGGAUGACUUGCCUG 21 0 0 0 0    0 0 0 0
osa-miR169i-3p UGAGUCGCUCUUAUCACUCAUG 22 0 0 0 0    0 0 0 0
osa-miR169i-5p.1 UAGCCAAGGAUGACUUGCCUG 21 0 0 0 0    0 0 0 0
osa-miR169i-5p.2 UGGUGAUAAGGGUGUAGCUCUG 22 0 0 0 0    0 0 0 0
osa-miR169j UAGCCAAGGAUGACUUGCCUG 21 0 0 0 0    0 0 0 0
osa-miR169k UAGCCAAGGAUGACUUGCCUG 21 0 0 0 0    0 0 0 0
osa-miR169l UAGCCAAGGAUGACUUGCCUG 21 0 0 0 0    0 0 0 0
osa-miR169m UAGCCAAGGAUGACUUGCCUG 21 0 0 0 0    0 0 0 0
osa-miR169n UAGCCAAGAAUGACUUGCCUA 21 0 0 0 0    0 0 0 0
osa-miR169o UAGCCAAGAAUGACUUGCCUA 21 0 0 0 0    0 0 0 0
osa-miR169p UAGCCAAGGACAAACUUGCCGG 22 0 0 0 0    0 0 0 0
osa-miR169q UAGCCAAGGAGACUGCCCAUG 21 0 0 0 0    0 0 0 0
osa-miR169r-3p UGGCAAGUCUCCUCGGCUACC 21 0 0 0 0    0 0 0 0
osa-miR169r-5p UAGCCAAGGAUGAUUUGCCUG 21 0 0 0 0    0 0 0 0
osa-miR171a UGAUUGAGCCGCGCCAAUAUC 21 0 0 0 0    0 0 0 0
osa-miR171b UGAUUGAGCCGUGCCAAUAUC 21 0 0 0 0    0 0 0 0
osa-miR171c-3p UGAUUGAGCCGUGCCAAUAUC 21 0 0 0 0    0 0 0 0
osa-miR171c-5p GGAUAUUGGUGCGGUUCAAUC 21 0 0 0 0    0 0 0 0
osa-miR171d-3p UGAUUGAGCCGUGCCAAUAUC 21 0 0 0 0    0 0 0 0
osa-miR171d-5p UGUUGGCCCGGCUCACUCAGA 21 0 0 0 0    0 0 0 0
osa-miR171e-3p UGAUUGAGCCGUGCCAAUAUC 21 0 0 0 0    0 0 0 0
osa-miR171e-5p UGUUGGCUCGGCUCACUCAGA 21 0 0 0 0    0 0 0 0
osa-miR171f-3p UGAUUGAGCCGUGCCAAUAUC 21 0 0 0 0    0 0 0 0
osa-miR171f-5p UGUUGGCAUGGUUCAAUCAAA 21 0 0 0 0    0 0 0 0
osa-miR171g GAGGUGAGCCGAGCCAAUAUC 21 0 0 0 0    0 0 0 0
osa-miR171h GUGAGCCGAACCAAUAUCACU 21 0 0 0 0    0 0 0 0
osa-miR171i-3p GGAUUGAGCCGCGUCAAUAUC 21 0 0 0 0    0 0 0 0
osa-miR171i-5p AGGUAUUGGCGUGCCUCAAUC 21 0 0 0 0    0 0 0 0
osa-miR172a AGAAUCUUGAUGAUGCUGCAU 21 0 0 0 0    0 0 0 0
osa-miR172b GGAAUCUUGAUGAUGCUGCAU 21 0 0 0 0    0 0 0 0
osa-miR172c UGAAUCUUGAUGAUGCUGCAC 21 0 0 0 0    0 0 0 0
osa-miR172d-3p AGAAUCUUGAUGAUGCUGCAU 21 0 0 0 0    0 0 0 0
osa-miR172d-5p GCAGCACCAUCAAGAUUCAC 20 6 3 4 2    0 0 2 4
osa-miR1846a-3p UGACCCCGUUCUCCUCGCCGG 21 0 0 0 0    0 0 0 0
osa-miR1846a-5p AGUGAGGAGGCCGGGGCCGCU 21 0 0 0 0    0 0 0 0
osa-miR1846b-3p UGACCCCGUUCUCCUCGCCGG 21 0 0 0 0    0 0 0 0
osa-miR1846b-5p AGUGAGGAGGCCGGGGCCGCU 21 0 0 0 0    0 0 0 0
osa-miR1846c-3p UGACCCCGGUCUGCUCGCUGG 21 0 0 0 0    0 0 0 0
osa-miR1846c-5p AGUGAGGAGGCCGGGGCCGCU 21 0 0 0 0    0 0 0 0
osa-miR1846d-3p UAUCCGGCGCCGCAGGGAGG 20 0 0 0 0    0 0 0 0
osa-miR1846d-5p UCCCACCGAGCAGCCGGAUCUC 22 0 0 0 0    0 0 0 0
osa-miR1846e CAACGAGGAGGCCGGGACCA 20 0 0 0 0    0 0 0 0
osa-miR1847.1 UGCAGUUUGCAGUUGUGGCAC 21 0 0 0 0    0 0 0 0
osa-miR1847.2 UGGCCCACAUGUUAGUGCCACAAC 24 0 0 0 0    0 0 0 0
osa-miR1848 CCUCGCCGGCGCGCGCGUGCA 21 0 0 0 0    0 0 0 0
osa-miR1849 UAUCGUAUCCUAGGUUGGUUU 21 0 0 0 0    0 0 0 0
osa-miR1850.1 UGGAAAGUUGGGAGAUUGGGG 21 0 0 0 0    0 0 0 0
osa-miR1850.2 UUGUGUGUGAACUAAACGUGG 21 0 0 0 0    0 0 0 0
osa-miR1850.3 CUGUUUAGUUCACAUCAAUCUU 22 0 0 0 0    0 0 0 0
osa-miR1851 CGUCUGGGAUGGCAUUUUGGC 21 0 0 0 0    0 0 0 0
osa-miR1852 AUAUGGAUUCAGAAUGCAGGU 21 0 0 0 0    0 0 0 0
osa-miR1853-3p UAAUUGGGGAUGUUCGGUUGCU 22 0 0 0 0    0 0 0 0
osa-miR1853-5p AGCAUUCAAACAUUCCCAAUUACC 24 0 0 0 0    0 0 0 0
osa-miR1854-3p UCCAAUUUGGGGAUUUGCUGAU 22 0 0 0 0    0 0 0 0
osa-miR1854-5p UGGUGAAAUUUGUAGAUUGGA 21 0 0 0 0    0 0 0 0
osa-miR1855 AGCACUGGAGUAGCCAAGAGA 21 0 0 0 0    0 0 0 0
osa-miR1856 UAUGCGUAAGACGGAUUCGUA 21 0 0 0 0    0 0 0 0
osa-miR1857-3p UCAUGCUCCAAGAAAACCAGG 21 0 0 0 0    0 0 0 0
osa-miR1857-5p UGGUUUUUUUGGAGCAUGAGG 21 0 0 0 0    0 0 0 0
osa-miR1858a GAGAGGAGGACGGAGUGGGGC 21 0 0 0 0    0 0 0 0
osa-miR1858b GAGAGGAGGACGGAGUGGGGC 21 0 0 0 0    0 0 0 0
osa-miR1859 UUUCCUAUGACGUCCAUUCCAA 22 0 0 0 0    0 0 0 0
osa-miR1860-3p AUCUGGAAGCUAGGUUUUCUCU 22 0 0 0 0    0 0 0 0
osa-miR1860-5p AGAAAACCAGCUUCCAGAUCU 21 0 0 0 0    0 0 0 0
osa-miR1861a UGAUCUUGAGGCAGAAACUGAG 22 0 0 0 0    0 0 0 0
osa-miR1861b CGAUCUUGAGGCAGGAACUGAG 22 0 0 0 0    0 0 0 0
osa-miR1861c CGAUCUUGUAGCAAGAACUGAG 22 0 0 0 0    0 0 0 0
osa-miR1861d UGGUCUUGAGGCAGGAACUGAG 22 0 0 0 0    0 0 0 0
osa-miR1861e CGGUCUUGUGGCAAGAACUGAG 22 0 0 0 0    0 0 0 0
osa-miR1861f CGAUCUUGAGGCAGGAACUGAG 22 0 0 0 0    0 0 0 0
osa-miR1861g CAGUCUUGUGGCAAGAACUGAG 22 0 0 0 0    0 0 0 0
osa-miR1861h CGGUCUUGAGGCAGGAACUGAG 22 0 0 0 0    0 0 0 0
osa-miR1861i CGAUCUUGAGGCAGGAACUGAG 22 0 0 0 0    0 0 0 0
osa-miR1861j CGGUCUUGAGGCAGGAACUGAG 22 0 0 0 0    0 0 0 0
osa-miR1861k CGGUCUUGUGGCAAGAACUGAG 22 0 0 0 0    0 0 0 0
osa-miR1861l CGAUCUUGAGGCAGGAACUGAG 22 0 0 0 0    0 0 0 0
osa-miR1861m CGGUCUUGUGGCAAGAACUGAG 22 0 0 0 0    0 0 0 0
osa-miR1861n CGAUCUUGUGGCAGGAGCUGAG 22 0 0 0 0    0 0 0 0
osa-miR1861o UGAUCUUGAGGCAGAAACUGAG 22 0 0 0 0    0 0 0 0
osa-miR1862a ACGAGGUUGGUUUAUUUUGGGACG 24 0 0 0 0    0 0 0 0
osa-miR1862b ACGAGGUUGGUUUAUUUUGGGACG 24 0 0 0 0    0 0 0 0
osa-miR1862c ACGAGGUUGGUUUAUUUUGGGACG 24 0 0 0 0    0 0 0 0
osa-miR1862d ACUAGGUUUGUUUAUUUUGGGACG 24 0 0 0 0    0 0 0 0
osa-miR1862e CUAGAUUUGUUUAUUUUGGGACGG 24 0 0 0 0    0 0 0 0
osa-miR1862f AUGAGGUUGGUUUAUUUUGG 20 0 0 0 0    0 0 0 0
osa-miR1862g AUGAGGUUGGUUUAUUUUGG 20 0 0 0 0    0 0 0 0
osa-miR1863a AGCUCUGAUACCAUGUUAGAUUAG 24 0 0 0 0    0 0 0 0
osa-miR1863b AGCUCUGAUACCAUGUUAACUGUU 24 0 0 0 0    0 0 0 0
osa-miR1863b.2 AGAGACUUGGCUGAUGCAUUACU 23 0 0 0 0    0 0 0 0
osa-miR1863c UAGAAACUUGGCUGAUGCAUUACU 24 0 0 0 0    0 0 0 0
osa-miR1864 UUGUAGUAACGUGAUGGUCAAUGU 24 0 0 0 0    0 0 0 0
osa-miR1865-3p CGAAGAAUCGCAGUCACUAGUUGU 24 0 0 0 0    0 0 0 0
osa-miR1865-5p UGCUAGUGAUGGUGAUUCUUCGAC 24 0 0 0 0    0 0 0 0
osa-miR1866-3p UGAAAUUCCUGUAAAAUUCUUG 22 0 0 0 0    0 0 0 0
osa-miR1866-5p GAGGGAUUUUGCGGGAAUUUCACG 24 0 0 0 0    0 0 0 0
osa-miR1868 UCACGGAAAACGAGGGAGCAGCCA 24 0 0 0 0    0 0 0 0
osa-miR1869 UGAGAACAAUAGGCAUGGGAGGUA 24 0 0 0 0    0 0 0 0
osa-miR1870-3p UUUAGGGCUAAUUCAGCAUGAACA 24 0 0 0 0    0 0 0 0
osa-miR1870-5p UGCUGAAUUAGACCUAGUGGGCAU 24 0 0 0 0    0 0 0 0
osa-miR1871 AUGGCUCUGAUAUCAUGUUGGUUU 24 0 0 0 0    0 0 0 0
osa-miR1872 GAACUGUAAGUCUGUGACGGGUAA 24 0 0 0 0    0 0 0 0
osa-miR1873 UCAACAUGGUAUCAGAGCUGGAAG 24 0 0 0 0    0 0 0 0
osa-miR1874-3p UAUGGAUGGAGGUGUAACCCGAUG 24 0 0 0 0    0 0 0 0
osa-miR1874-5p UAGGGCUACUACACCAUCCAUAAG 24 0 0 0 0    0 0 0 0
osa-miR1875 ACAAUGGAGUGAAGUGCAACAGAA 24 0 0 0 0    0 0 0 0
osa-miR1876 AUAAGUGGGUUUGUGGGCUGGCCC 24 0 0 0 0    0 0 0 0
osa-miR1877 AGAUGACAUGUGAAUGAUGAGGGG 24 0 0 0 0    0 0 0 0
osa-miR1878 ACUUAAUCUGGACACUAUAAAAGA 24 0 0 0 0    0 0 0 0
osa-miR1879 GUGUUUGGUUUAGGGAUGAGGUGG 24 0 0 0 0    0 0 0 0
osa-miR1880 UUCCAAGCGGGCCACUUAAGCAUU 24 0 0 0 0    0 0 0 0
osa-miR1881 AAUGUUAUUGUAGCGUGGUGGUGU 24 0 0 0 0    0 0 0 0
osa-miR1882a AGAUUGCUUUCAAGGUCAUUUCUU 24 0 0 0 0    0 0 0 0
osa-miR1882b AGAUUGCUUUCAAGGUCAUUUCUU 24 0 0 0 0    0 0 0 0
osa-miR1882c AGAUUGCUUUCAAGGUCAUUUCUU 24 0 0 0 0    0 0 0 0
osa-miR1882d AGAUUGCUUUCAAGGUCAUUUCUU 24 0 0 0 0    0 0 0 0
osa-miR1882e-3p GAAAUGAUCUUGGACGUAAUCUAG 24 0 0 0 0    0 0 0 0
osa-miR1882e-5p AGAUUGCUUUCAAGGUCAUUUCUU 24 0 0 0 0    0 0 0 0
osa-miR1882f AGAUUGCUUUCAAGGUCAUUUCUU 24 0 0 0 0    0 0 0 0
osa-miR1882g AGAUUGCUUUCAAGGUCAUUUCUU 24 0 0 0 0    0 0 0 0
osa-miR1882h AGAUUGCUUUCAAGGUCAUUUCUU 24 0 0 0 0    0 0 0 0
osa-miR1883a ACCUGUGACGGGCCGAGAAUGGAA 24 0 0 0 0    0 0 0 0
osa-miR1883b ACCUGUGACGGGCCGAGAAUGGAA 24 0 0 0 0    0 0 0 0
osa-miR2055 UUUCCUUGGGAAGGUGGUUUC 21 0 0 0 0    0 0 0 0
osa-miR2090 AACUCUGAUUCUAGAAUUUUUG 22 0 0 0 0    0 0 0 0
osa-miR2091-3p CAUACAUUGCCUCCUAGGCUUG 22 0 0 0 0    0 0 0 0
osa-miR2091-5p UCAACCGAGCCGAGGAGGAGG 21 0 0 0 0    0 0 0 0
osa-miR2092-3p ACCAGCAUUCCAUUGGCAGAGG 22 0 0 0 0    0 0 0 0
osa-miR2092-5p CAACUGAAGUCGGUGUUUACU 21 0 0 0 0    0 0 0 0
osa-miR2093-3p ACAUCUUCCAAUUAAUGCAU 20 0 0 0 0    0 0 0 0
osa-miR2093-5p GUGCAUUAAUUGGAAGAACA 20 0 0 0 0    0 0 0 0
osa-miR2094-3p CAGAGCUGUGGCAUCCACGUCG 22 0 0 0 0    0 0 0 0
osa-miR2094-5p UGGCUGCUAGGCUCCUGGGUG 21 0 0 0 0    0 0 0 0
osa-miR2095-3p CUUCCAUUUAUGAUAAGUAU 20 0 0 0 0    0 0 0 0
osa-miR2095-5p CUGAUAAUUUUACGAUGAAUAG 22 0 0 0 0    0 0 0 0
osa-miR2096-3p CCUGAGGGGAAAUCGGCGGGA 21 0 0 0 0    0 0 0 0
osa-miR2096-5p UGCCGAUUUCCCCCUCGGGCG 21 0 0 0 0    0 0 0 0
osa-miR2097-3p UUCUCUUCUUCGUGUCGCAUUU 22 0 0 0 0    0 0 0 0
osa-miR2097-5p AGAGAUGGGACGGGCAGGGAAG 22 0 0 0 0    0 0 0 0
osa-miR2098-3p CGGUUUGUCAAGCGGAGUGC 20 2 2 2 2    0 2 0 0
osa-miR2098-5p UCCCGUGGAGGCAGCCGAUG 20 0 0 0 0    0 0 0 0
osa-miR2099-3p ACAAAGCUGUAGCGUUAUUC 20 0 0 0 0    0 0 0 0
osa-miR2099-5p UGAAUAUGUUUGUACAAGCUUU 22 0 0 0 0    0 0 0 0
osa-miR2100-3p AACCGCUGUUUAGGCGGAGUGG 22 0 0 0 0    0 0 0 0
osa-miR2100-5p UUCUCUCAAGUUGCCAAACAAG 22 0 0 0 0    0 0 0 0
osa-miR2101-3p AUUUAACUCAAGUGAGCAUUGU 22 0 0 0 0    0 0 0 0
osa-miR2101-5p ACAUGUUUACAAGUUAAAAUGU 22 0 0 0 0    0 0 0 0
osa-miR2102-3p CAUGGUGCCGGUUCCGGUGGCG 22 0 0 0 0    0 0 0 0
osa-miR2102-5p GGGCAAGCCGCCGCCGCCAC 20 0 0 0 0    0 0 0 0
osa-miR2103 UUUCCCUCUCCGUGCGCGCUCG 22 0 0 0 0    0 0 0 0
osa-miR2104 GCGGCGAGGGGAUGCGAGCGUG 22 0 0 0 0    0 0 0 0
osa-miR2105 UUGUGAUGUGAAUGAUUCAU 20 0 0 0 0    0 0 0 0
osa-miR2106 CCGAGGUUUUCUGGAUACAUU 21 0 0 0 0    0 0 0 0
osa-miR2118a UUCUCGAUGCCUCCCAUUCCUA 22 0 0 0 0    0 0 0 0
osa-miR2118b UUCCCGAUGCCUCCCAUUCCUA 22 0 0 0 0    0 0 0 0
osa-miR2118c UUCCCGAUGCCUCCUAUUCCUA 22 0 0 0 0    0 0 0 0
osa-miR2118d UUCCUGAUGCCUCCCAUGCCUA 22 0 0 0 0    0 0 0 0
osa-miR2118e UUCCCAAUGCCUCCCAUGCCUA 22 0 0 0 0    0 0 0 0
osa-miR2118f UUCCUGAUGCCUCCCAUUCCUA 22 0 0 0 0    0 0 0 0
osa-miR2118g UUCCUAAUGCCUCCCAUUCCUA 22 0 0 0 0    0 0 0 0
osa-miR2118h UUCCUGAUGCCUCUCAUUCCUA 22 0 0 0 0    0 0 0 0
osa-miR2118i UUCCUAGUGCCUCCCAUUCCUA 22 0 0 0 0    0 0 0 0
osa-miR2118j UUCCUGAUGCCUCCCAUUCCUA 22 0 0 0 0    0 0 0 0
osa-miR2118k UUCCUGAUGCCUCUCAUUCCUA 22 0 0 0 0    0 0 0 0
osa-miR2118l UUCCUAAUGCUUCCCAUUCCUA 22 0 0 0 0    0 0 0 0
osa-miR2118m UUCCUGAUGCCUCCCAUUCCUA 22 0 0 0 0    0 0 0 0
osa-miR2118n UUCCCGAUGCCUCCCAUUCCUA 22 0 0 0 0    0 0 0 0
osa-miR2118o CUCCUGAUGCCUCCCAAGCCUA 22 0 0 0 0    0 0 0 0
osa-miR2118p UUCCCGAUGCCUCCCAUGCCUA 22 0 0 0 0    0 0 0 0
osa-miR2118q UUCCCGAUGCCUCCUAUUCCUA 22 0 0 0 0    0 0 0 0
osa-miR2118r UUCCCAAUGCCUCCCAUGCCUA 22 0 0 0 0    0 0 0 0
osa-miR2120 AAAGAUCUUUAGUCCCGGUUGUUC 24 0 0 0 0    0 0 0 0
osa-miR2121a AAAACGGAGCGGUCCAUUAGCGCG 24 0 0 0 0    0 0 0 0
osa-miR2121b AAAACGGAGCGGUCCAUUAGCGCG 24 0 0 0 0    0 0 0 0
osa-miR2122 UUUCAAAAAUAACCUUUUGUUC 22 0 0 0 0    0 0 0 0
osa-miR2275a UUUGGUUUCCUCCAAUAUCUCA 22 0 0 0 0    0 0 0 0
osa-miR2275b UUUGGUUUCCUCCAAUAUCUCA 22 0 0 0 0    0 0 0 0
osa-miR2275c AGAAUUGGAGGAAAACAAACUGA 23 0 0 0 0    0 0 0 0
osa-miR2275d CUUGUUUUUCUCCAAUAUCUCA 22 0 0 0 0    0 0 0 0
osa-miR2863a UUGUCCCAUUCUAGUUUAGCU 21 0 0 0 0    0 0 0 0
osa-miR2863b UUCGUUUAUUUGGACUAGAGU 21 0 0 0 0    0 0 0 0
osa-miR2863c UUAGUAGGACUAGAAUGGGCCAAA 24 0 0 0 0    0 0 0 0
osa-miR2864.1 UUUUGCUGCCCUUGUUUUGCA 21 0 0 0 0    0 0 0 0
osa-miR2864.2 UUGUUUUGCAUUGUAUAGGUA 21 0 0 0 0    0 0 0 0
osa-miR2865 CUCAGCAGUCGACUGUACCGUG 22 0 0 0 0    0 0 0 0
osa-miR2866 UCUAGUUUGUGUUCAGCAUC 20 0 0 0 0    0 0 0 0
osa-miR2867-3p CCAGGACGUGUGGGAUGGCA 20 0 0 0 0    0 0 0 0
osa-miR2867-5p UGUGCCAUCCCACACAUCCCGA 22 0 0 0 0    0 0 0 0
osa-miR2868 UUGGUUUUGUGUAGUAGAAA 20 0 0 0 0    0 0 0 0
osa-miR2869 UCCCGACAUUAAAUUCUGGGC 21 0 0 0 0    0 0 0 0
osa-miR2870 UAAUCAGUUUGGGGAGACAAA 21 0 0 0 0    0 0 0 0
osa-miR2871a-3p UAUUUUAGUUUCUAUGGUCAC 21 0 0 0 0    0 0 0 0
osa-miR2871a-5p GACCGUAGAAACUAGCAUAGAAAA 24 0 0 0 0    0 0 0 0
osa-miR2871b UAUUUUAGUUUCUAUGGUCAC 21 0 0 0 0    0 0 0 0
osa-miR2872 UGGGGUUCUACAAACCGAACU 21 0 0 0 0    0 0 0 0
osa-miR2873a AAGUUUGGACUUAAAUUUGGUAAC 24 0 0 0 0    0 0 0 0
osa-miR2873b UUGGACUUGAGAUUUGGUAUG 21 0 0 0 0    0 0 0 0
osa-miR2873c CAAAUGAAGUUGAGUUUGGAC 21 0 0 0 0    0 0 0 0
osa-miR2874 AUGUGAACAGUGUCAAACAGUGUC 24 0 0 0 0    0 0 0 0
osa-miR2875 AUUUACAGUCAUAUACAGUUUAUA 24 0 0 0 0    0 0 0 0
osa-miR2876-3p UUCCUAUAUGAACACUGUUGC 21 0 0 0 0    0 0 0 0
osa-miR2876-5p AAUUGCUGGCAGCACUGUUUA 21 0 0 0 0    0 0 0 0
osa-miR2877 UUGCAUCCUCUGCACUUUGGGCCU 24 0 0 0 0    0 0 0 0
osa-miR2878-3p CAGGAUUUUAUACAUGUAAAGAAU 24 0 0 0 0    0 0 0 0
osa-miR2878-5p UACAUGUAUAAAAUUCUGAGGAUG 24 0 0 0 0    0 0 0 0
osa-miR2879 GCCAGAUGUGUUAAAAUAAUGACC 24 0 0 0 0    0 0 0 0
osa-miR2880 ACGGUAUCCCGUUCGGACAGGAUG 24 0 0 0 0    0 0 0 0
osa-miR2905 UACAUGUCAGUGACAAAGGCA 21 0 0 0 0    0 0 0 0
osa-miR2907a GGCAGCCGAGCGAGGGCCUCGG 22 0 0 0 0    0 0 0 0
osa-miR2907b GGCAGCCGAGCGAGGGCCUCGG 22 0 0 0 0    0 0 0 0
osa-miR2907c GGCAGCCGAGCGAGGGCCUCGG 22 0 0 0 0    0 0 0 0
osa-miR2907d GGCAGCCGAGCGAGGGCCUCGG 22 0 0 0 0    0 0 0 0
osa-miR2918 AUCCGUGUUGUCUGCGCUUUA 21 0 0 0 0    0 0 0 0
osa-miR2919 AAGGGGGGGGGGGGAAAGA 19 0 0 0 0    0 0 0 0
osa-miR2920 AAACAACAAUAUAACAUUUCAAA 23 0 0 0 0    0 0 0 0
osa-miR2921 AAGAACUUAAUAUAACUUUAAAGC 24 0 0 0 0    0 0 0 0
osa-miR2922 AAUAAGUGAUUACCGAAAUU 20 0 0 0 0    0 0 0 0
osa-miR2923 AGACAAAAAUAUAAAUAACAAA 22 0 0 0 0    0 0 0 0
osa-miR2924 CUCGCUUGCUCCGGCCGCCAC 21 0 0 0 0    0 0 0 0
osa-miR2925 UGGCGGCCGCGGGCUUCGU 19 0 0 0 0    0 0 0 0
osa-miR2926 AGGUCGUCGACGUUGGUGCU 20 0 0 0 0    0 0 0 0
osa-miR2927 UGUCGUCGUCGAUGGAGCCCAUG 23 0 0 0 0    0 0 0 0
osa-miR2928 AAGAAGACGACAUUUUGUUG 20 0 0 0 0    0 0 0 0
osa-miR2929 CUCAAGGGUGUUUGUGAAAUA 21 0 0 0 0    0 0 0 0
osa-miR2930 UUCUCUUCUCUCGCGCGUGGCC 22 0 0 0 0    0 0 0 0
osa-miR2931 CUUUAUUGUUGAUGUCAAAA 20 0 0 0 0    0 0 0 0
osa-miR2932 AGUAUGCCCACUACCUAUC 19 0 0 0 0    0 0 0 0
osa-miR319a-3p ACUGGAUGACGCGGGAGCUAA 21 0 0 0 0    0 0 0 0
osa-miR319a-3p.2-3p UUGGACUGAAGGGUGCUCCC 20 8 3 4 2    0 2 2 4
osa-miR319a-5p AGCUGCCGAAUCAUCCAUUCA 21 0 0 0 0    0 0 0 0
osa-miR319b UUGGACUGAAGGGUGCUCCC 20 8 3 4 2    0 2 2 4
osa-miR390-3p CGCUAUCUAUCCUGAGCUCC 20 1 1 1 1    0 0 0 1
osa-miR390-5p AAGCUCAGGAGGGAUAGCGCC 21 0 0 0 0    0 0 0 0
osa-miR393a UCCAAAGGGAUCGCAUUGAUC 21 0 0 0 0    0 0 0 0
osa-miR393b-3p UCAGUGCAAUCCCUUUGGAAU 21 0 0 0 0    0 0 0 0
osa-miR393b-5p UCCAAAGGGAUCGCAUUGAUCU 22 0 0 0 0    0 0 0 0
osa-miR394 UUGGCAUUCUGUCCACCUCC 20 24 8 17 3    17 3 0 4
osa-miR395a GUGAAGUGCUUGGGGGAACUC 21 0 0 0 0    0 0 0 0
osa-miR395b GUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0
osa-miR395c GUGAAGUGUUUGGAGGAACUC 21 0 0 0 0    0 0 0 0
osa-miR395d GUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0
osa-miR395e GUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0
osa-miR395f GUGAAUUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0
osa-miR395g GUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0
osa-miR395h GUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0
osa-miR395i GUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0
osa-miR395j GUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0
osa-miR395k GUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0
osa-miR395l GUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0
osa-miR395m GUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0
osa-miR395n GUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0
osa-miR395o AUGAAGUGUUUGGAGGAACUC 21 0 0 0 0    0 0 0 0
osa-miR395p GUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0
osa-miR395q GUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0
osa-miR395r GUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0
osa-miR395s GUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0
osa-miR395t GUGAAGUGUUUGGGGAAACUC 21 0 0 0 0    0 0 0 0
osa-miR395u GUGAAGCGUUUGGGGGAAAUC 21 0 0 0 0    0 0 0 0
osa-miR395v GUGAAGUAUUUGGCGGAACUC 21 0 0 0 0    0 0 0 0
osa-miR395w GUGAAGUGUUUGGGGGAUUCUC 22 0 0 0 0    0 0 0 0
osa-miR395x GUGAAGUGUUUGGAGUAGCUC 21 0 0 0 0    0 0 0 0
osa-miR395y GUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0
osa-miR396a-3p GUUCAAUAAAGCUGUGGGAA 20 7 4 6 1    0 0 6 1
osa-miR396a-5p UUCCACAGCUUUCUUGAACUG 21 0 0 0 0    0 0 0 0
osa-miR396b-3p GUUCAAUAAAGCUGUGGGAA 20 7 4 6 1    0 0 6 1
osa-miR396b-5p UUCCACAGCUUUCUUGAACUG 21 0 0 0 0    0 0 0 0
osa-miR396c-3p GGUCAAGAAAGCUGUGGGAAG 21 0 0 0 0    0 0 0 0
osa-miR396c-5p UUCCACAGCUUUCUUGAACUU 21 0 0 0 0    0 0 0 0
osa-miR396d UCCACAGGCUUUCUUGAACGG 21 0 0 0 0    0 0 0 0
osa-miR396e-3p AUGGUUCAAGAAAGCCCAUGGAAA 24 0 0 0 0    0 0 0 0
osa-miR396e-5p UCCACAGGCUUUCUUGAACUG 21 0 0 0 0    0 0 0 0
osa-miR396f-3p AUAGUUCAAGAAAGUCCUUGGAAA 24 0 0 0 0    0 0 0 0
osa-miR396f-5p UCUCCACAGGCUUUCUUGAACU 22 0 0 0 0    0 0 0 0
osa-miR396g UCCACAGGCUUUCUUGAACGG 21 0 0 0 0    0 0 0 0
osa-miR396h UCCACAGGCUUUCUUGAACGG 21 0 0 0 0    0 0 0 0
osa-miR3979-3p CUUCGGGGGAGGAGAGAAGC 20 1 1 1 1    0 0 0 1
osa-miR3979-5p UCUCUCUCUCCCUUGAAGGC 20 2 2 2 2    0 0 0 2
osa-miR397a UCAUUGAGUGCAGCGUUGAUG 21 0 0 0 0    0 0 0 0
osa-miR397b UUAUUGAGUGCAGCGUUGAUG 21 0 0 0 0    0 0 0 0
osa-miR3980a-3p CUGGCCGAGGCCGUCGAUUCU 21 0 0 0 0    0 0 0 0
osa-miR3980a-5p AAUCGACGGCCUCAGUCAGGG 21 0 0 0 0    0 0 0 0
osa-miR3980b-3p CUGGCCGAGGCCGUCGAUUCU 21 0 0 0 0    0 0 0 0
osa-miR3980b-5p AAUCGACGGCCUCAGUCAGGG 21 0 0 0 0    0 0 0 0
osa-miR3981-3p AGUAUUAGGAUACGUCUCAUC 21 0 0 0 0    0 0 0 0
osa-miR3981-5p UGGGACGUAUCCUAUUACUAU 21 0 0 0 0    0 0 0 0
osa-miR3982-3p AGUUGCCUACAUGGAGCGCCA 21 0 0 0 0    0 0 0 0
osa-miR3982-5p GCGCUCCACGUAGGCAACAAU 21 0 0 0 0    0 0 0 0
osa-miR398a UGUGUUCUCAGGUCACCCCUU 21 0 0 0 0    0 0 0 0
osa-miR398b UGUGUUCUCAGGUCGCCCCUG 21 0 0 0 0    0 0 0 0
osa-miR399a UGCCAAAGGAGAAUUGCCCUG 21 0 0 0 0    0 0 0 0
osa-miR399b UGCCAAAGGAGAAUUGCCCUG 21 0 0 0 0    0 0 0 0
osa-miR399c UGCCAAAGGAGAAUUGCCCUG 21 0 0 0 0    0 0 0 0
osa-miR399d UGCCAAAGGAGAGUUGCCCUG 21 0 0 0 0    0 0 0 0
osa-miR399e UGCCAAAGGAGAUUUGCCCAG 21 0 0 0 0    0 0 0 0
osa-miR399f UGCCAAAGGAGAUUUGCCCAG 21 0 0 0 0    0 0 0 0
osa-miR399g UGCCAAAGGAGAUUUGCCCAG 21 0 0 0 0    0 0 0 0
osa-miR399h UGCCAAAGGAGACUUGCCCAG 21 0 0 0 0    0 0 0 0
osa-miR399i UGCCAAAGGAGAGCUGCCCUG 21 0 0 0 0    0 0 0 0
osa-miR399j UGCCAAAGGAGAGUUGCCCUA 21 0 0 0 0    0 0 0 0
osa-miR399k UGCCAAAGGAAAUUUGCCCCG 21 0 0 0 0    0 0 0 0
osa-miR408-3p CUGCACUGCCUCUUCCCUGGC 21 0 0 0 0    0 0 0 0
osa-miR408-5p CAGGGAUGAGGCAGAGCAUGG 21 0 0 0 0    0 0 0 0
osa-miR413 CUAGUUUCACUUGUUCUGCAC 21 0 0 0 0    0 0 0 0
osa-miR414 UCAUCCUCAUCAUCAUCGUCC 21 0 0 0 0    0 0 0 0
osa-miR415 AACAGAACAGAAGCAGAGCAG 21 0 0 0 0    0 0 0 0
osa-miR416 UGUUCGUCCGUACACUGUUCA 21 0 0 0 0    0 0 0 0
osa-miR417 GAAUGUAGUGAAUUUGUUCCA 21 0 0 0 0    0 0 0 0
osa-miR418 UAAUGUGAUGAUGAAAUGACG 21 0 0 0 0    0 0 0 0
osa-miR419 UGAUGAAUGCUGACGAUGUUG 21 0 0 0 0    0 0 0 0
osa-miR426 UUUUGGAAGUUUGUCCUUACG 21 0 0 0 0    0 0 0 0
osa-miR435 UUAUCCGGUAUUGGAGUUGA 20 9 5 7 2    0 0 2 7
osa-miR437 AAAGUUAGAGAAGUUUGACUU 21 0 0 0 0    0 0 0 0
osa-miR438 UUCCCACGCGUUAUAGUGAAA 21 0 0 0 0    0 0 0 0
osa-miR439a UGUCGAACCGCGGUUGUUCGA 21 0 0 0 0    0 0 0 0
osa-miR439b UGUCGAACCGCGGUUGUUCGA 21 0 0 0 0    0 0 0 0
osa-miR439c UGUCGAACCGCGGUUGUUCGA 21 0 0 0 0    0 0 0 0
osa-miR439d UGUCGAACCGCGGUUGUUCGA 21 0 0 0 0    0 0 0 0
osa-miR439e UGUCGAACCGCGGUUGUUCGA 21 0 0 0 0    0 0 0 0
osa-miR439f UGUCGAACCGCGGUUGUUCGA 21 0 0 0 0    0 0 0 0
osa-miR439g UGUCGAACCGCGGUUGUUCGA 21 0 0 0 0    0 0 0 0
osa-miR439h UGUCGAACCGCGGUUGUUCGA 21 0 0 0 0    0 0 0 0
osa-miR439i UGUCGAACCGCGGUUGUUCGA 21 0 0 0 0    0 0 0 0
osa-miR440 AGUGUCUCCUGAUGAUCGGGACAA 24 0 0 0 0    0 0 0 0
osa-miR443 AUCACAAUACAAUAAAUCUGGA 22 0 0 0 0    0 0 0 0
osa-miR444a-3p.1 UUGCUGCCUCAAGCUUGCUGC 21 0 0 0 0    0 0 0 0
osa-miR444a-3p.2 UGCAGUUGCUGCCUCAAGCUU 21 0 0 0 0    0 0 0 0
osa-miR444a-5p GCUAGAGGUGGCAACUGCAUA 21 0 0 0 0    0 0 0 0
osa-miR444b.1 UGUUGUCUCAAGCUUGCUGCC 21 0 0 0 0    0 0 0 0
osa-miR444b.2 UGCAGUUGUUGUCUCAAGCUU 21 0 0 0 0    0 0 0 0
osa-miR444c.1 UGUUGUCUCAAGCUUGCUGCC 21 0 0 0 0    0 0 0 0
osa-miR444c.2 UGCAGUUGUUGUCUCAAGCUU 21 0 0 0 0    0 0 0 0
osa-miR444d.1 UUGCUGCCUCAAGCUUGCUGC 21 0 0 0 0    0 0 0 0
osa-miR444d.2 UGCAGUUGCUGCCUCAAGCUU 21 0 0 0 0    0 0 0 0
osa-miR444d.3 UUGUGGCUUUCUUGCAAGUUG 21 0 0 0 0    0 0 0 0
osa-miR444e UGCAGUUGCUGCCUCAAGCUU 21 0 0 0 0    0 0 0 0
osa-miR444f UGCAGUUGUUGCCUCAAGCUU 21 0 0 0 0    0 0 0 0
osa-miR5071 UCAAGCAUCAUAUCGUGGACA 21 0 0 0 0    0 0 0 0
osa-miR5072 CGAUUCCCCAGCGGAGUCGCCA 22 0 0 0 0    0 0 0 0
osa-miR5073 GUUUGGUGAAUCGGAAACUAUUU 23 0 0 0 0    0 0 0 0
osa-miR5074 GAAGGCCACCGUCGGGAUCGC 21 0 0 0 0    0 0 0 0
osa-miR5075 UUCUCCGUCGCCGCCGUCCGC 21 0 0 0 0    0 0 0 0
osa-miR5076 GAAAUGGGAGCAGAGCAGGUUU 22 0 0 0 0    0 0 0 0
osa-miR5077 GUUCGCGUCGGGUUCACCA 19 0 0 0 0    0 0 0 0
osa-miR5078 CCUCGUUCGACCGUGGCAUUU 21 0 0 0 0    0 0 0 0
osa-miR5079a UUUGGAUCUGUUAUUUUGGUAU 22 0 0 0 0    0 0 0 0
osa-miR5079b UUUGGAUCUGUUAUUUUGGUAU 22 0 0 0 0    0 0 0 0
osa-miR5080 AAAAGGAUCAUACCGUGACAG 21 0 0 0 0    0 0 0 0
osa-miR5081 UAAUUUGUAGCAAAUUGAUAGU 22 0 0 0 0    0 0 0 0
osa-miR5082 UGCGAUGAUGGCCGCGCGGGUUCA 24 0 0 0 0    0 0 0 0
osa-miR5083 AGACUACAAUUAUCUGAUCA 20 0 0 0 0    0 0 0 0
osa-miR5143a UGUGGUAUGUUGGCAAUGUAGGAA 24 0 0 0 0    0 0 0 0
osa-miR5143b UGUGGUAUGUUGGCAAUGUAGGAA 24 0 0 0 0    0 0 0 0
osa-miR5144-3p UCUCCUCAGCAGCACAAGAAG 21 0 0 0 0    0 0 0 0
osa-miR5144-5p UUCUUGUGCUGCUGAAGAGAC 21 0 0 0 0    0 0 0 0
osa-miR5145 ACCUGUUUGGAUUCUUGAGGGCUA 24 0 0 0 0    0 0 0 0
osa-miR5146 UUUAACUAAUGAACCGGCACCUAU 24 0 0 0 0    0 0 0 0
osa-miR5147 ACAACUCUUGUGGAUGGAGGG 21 0 0 0 0    0 0 0 0
osa-miR5148a UGAGGGGUAGAAAUGUCAUAUCAU 24 0 0 0 0    0 0 0 0
osa-miR5148b UGAGGGGUAGAAAUGUCAUAUCAU 24 0 0 0 0    0 0 0 0
osa-miR5148c UGAGGGGUAGAAAUGUCAUAUCAU 24 0 0 0 0    0 0 0 0
osa-miR5149 GAGGAGCUGUGACGAUUUGGGA 22 0 0 0 0    0 0 0 0
osa-miR5150-3p AGAAGCUGCAGCUGUCAGAAGCUC 24 0 0 0 0    0 0 0 0
osa-miR5150-5p AGCUUCUGACAGCUGCAGUUUCUC 24 0 0 0 0    0 0 0 0
osa-miR5151 UAAUGAUGUGGGUACGAAUGAA 22 0 0 0 0    0 0 0 0
osa-miR5152-3p AGACCAUGCCUAUACCUACCA 21 0 0 0 0    0 0 0 0
osa-miR5152-5p GUAGGGAUAGGCAUGAUCUCU 21 0 0 0 0    0 0 0 0
osa-miR5153 UGGAUUCCACUGACACGUAGACGU 24 0 0 0 0    0 0 0 0
osa-miR5154 AGCACCAGUUGACGUGACGCUGAG 24 0 0 0 0    0 0 0 0
osa-miR5155 ACUUUAAUACCAUUGGAAGAUUGC 24 0 0 0 0    0 0 0 0
osa-miR5156 AGCCUGUAAAACUGCAAAAAGGAA 24 0 0 0 0    0 0 0 0
osa-miR5157a-3p AGAAGUUGUGGCUAUCAAAAAGUU 24 0 0 0 0    0 0 0 0
osa-miR5157a-5p AACUUUUUAAUAGCUACAACUUCU 24 0 0 0 0    0 0 0 0
osa-miR5157b-3p AGAAGUUGUGGCUAUCAAAAAGUU 24 0 0 0 0    0 0 0 0
osa-miR5157b-5p AACUUUUUAAUAGCUACAACUUCU 24 0 0 0 0    0 0 0 0
osa-miR5158 UGAGCCACUGGGAUGAGGAUGAAU 24 0 0 0 0    0 0 0 0
osa-miR5159 AACUAGAGUGGGUCAACGGGUACC 24 0 0 0 0    0 0 0 0
osa-miR5160 CGAGAUCGAUGGUAUAUUUCUG 22 0 0 0 0    0 0 0 0
osa-miR5161 UCUGGAUCAGAGGGAGUAUA 20 0 0 0 0    0 0 0 0
osa-miR5162 AAAUGACCAAAAUACCCCUAGAAC 24 0 0 0 0    0 0 0 0
osa-miR5179 UUUUGCUCAAGACCGCGCAAC 21 0 0 0 0    0 0 0 0
osa-miR528-3p CCUGUGCUUGCCUCUUCCAUU 21 0 0 0 0    0 0 0 0
osa-miR528-5p UGGAAGGGGCAUGCAGAGGAG 21 0 0 0 0    0 0 0 0
osa-miR529a CUGUACCCUCUCUCUUCUUC 20 1 1 1 1    0 0 0 1
osa-miR529b AGAAGAGAGAGAGUACAGCUU 21 0 0 0 0    0 0 0 0
osa-miR530-3p AGGUGCAGAGGCAGAUGCAAC 21 0 0 0 0    0 0 0 0
osa-miR530-5p UGCAUUUGCACCUGCACCUA 20 0 0 0 0    0 0 0 0
osa-miR531a CUCGCCGGGGCUGCGUGCCGCCAU 24 0 0 0 0    0 0 0 0
osa-miR531b CUCGCCGGGGCUGCGUGCCG 20 0 0 0 0    0 0 0 0
osa-miR531c CUCGCCGGGGCUGCGUGCCGCCAU 24 0 0 0 0    0 0 0 0
osa-miR5337a AAAUUACUUGUCGUUCUAGCU 21 0 0 0 0    0 0 0 0
osa-miR5337b CUAGAACGGCAAGCAAUUUGA 21 0 0 0 0    0 0 0 0
osa-miR5338 UGAAGCUUCAGUUGGUUGUAU 21 0 0 0 0    0 0 0 0
osa-miR5339 CAGAUAGAGAAUCUUCUCAGA 21 0 0 0 0    0 0 0 0
osa-miR5340 UGAUGACGUGGAUGAAUUUCAAA 23 0 0 0 0    0 0 0 0
osa-miR535-3p GUGCUUUCUCCCGUUGUCACU 21 0 0 0 0    0 0 0 0
osa-miR535-5p UGACAACGAGAGAGAGCACGC 21 0 0 0 0    0 0 0 0
osa-miR5484 AACCGAGCGCGCUGUUGAUUA 21 0 0 0 0    0 0 0 0
osa-miR5485 UGACAACUGGUAGCAGAGCAA 21 0 0 0 0    0 0 0 0
osa-miR5486 AGGGGCUUGCAUAUUCUACCA 21 0 0 0 0    0 0 0 0
osa-miR5487 AAAGAUGUGCAUGUAGUUCCG 21 0 0 0 0    0 0 0 0
osa-miR5488 UGAAGGCGACUGAUGAUUUCA 21 0 0 0 0    0 0 0 0
osa-miR5489 CAGGUGUUCUCGAUGGCUUCC 21 0 0 0 0    0 0 0 0
osa-miR5490 UUGGAUUUUUAUUUAGGACGG 21 0 0 0 0    0 0 0 0
osa-miR5491 UGAAAUGGAGGCUCGUUGUAC 21 0 0 0 0    0 0 0 0
osa-miR5492 AGAAGGAGAAUAGAUAUGGUU 21 0 0 0 0    0 0 0 0
osa-miR5493 AGCCGGGCUCGGUCGCGCGUG 21 0 0 0 0    0 0 0 0
osa-miR5494 UUAUAGGAGGUAUAGACGGUA 21 0 0 0 0    0 0 0 0
osa-miR5495 AGAGGUCCGGAUCGAACGUAG 21 0 0 0 0    0 0 0 0
osa-miR5496 CCAGCCGGUGGCAUAGUUCUC 21 0 0 0 0    0 0 0 0
osa-miR5497 CAGAAUAUCUGGGACGAGCAU 21 0 0 0 0    0 0 0 0
osa-miR5498 UGAGCUGUAACACUUGAAGAC 21 0 0 0 0    0 0 0 0
osa-miR5499 GAAGGAAGAAUCGUUAUGGAA 21 0 0 0 0    0 0 0 0
osa-miR5500 AUCACUGAUGAAAUCUUGCGGC 22 0 0 0 0    0 0 0 0
osa-miR5501 UCUUGUGGCUAGAAGGGUGAG 21 0 0 0 0    0 0 0 0
osa-miR5502 UACGGAUACGGAUACGCGAUAC 22 0 0 0 0    0 0 0 0
osa-miR5503 UUCGGAUCUUUCUAGAGGCAUU 22 0 0 0 0    0 0 0 0
osa-miR5504 AGUGACGGGAGGACUGCAAGG 21 0 0 0 0    0 0 0 0
osa-miR5505 GAGGAUUCGGUAUUGAUCGCUA 22 0 0 0 0    0 0 0 0
osa-miR5506 UGGAUCGCUUCGUCUGAUGGU 21 0 0 0 0    0 0 0 0
osa-miR5507 AAUGAGAAUGAUGACCCGGUG 21 0 0 0 0    0 0 0 0
osa-miR5508 UAGAUGGCUGAUCUGGUGUGG 21 0 0 0 0    0 0 0 0
osa-miR5509 UAGGCAUUUUCUCUUGGCAUG 21 0 0 0 0    0 0 0 0
osa-miR5510 AGGCUGAUCCACUCCAGAGGA 21 0 0 0 0    0 0 0 0
osa-miR5511 CAUAUCCCAGCUGUUUCGGCC 21 0 0 0 0    0 0 0 0
osa-miR5512a UAGGAUAUGGUAAUGCUAAAA 21 0 0 0 0    0 0 0 0
osa-miR5512b UAGGAUAUGGUAAUGCUAAAA 21 0 0 0 0    0 0 0 0
osa-miR5513 UAACAAAGGACAACAGACUGA 21 0 0 0 0    0 0 0 0
osa-miR5514 UCCCAGAGCUUUGGCCGUCGC 21 0 0 0 0    0 0 0 0
osa-miR5515 CCGAUGGUUGUUCUACAGGUG 21 0 0 0 0    0 0 0 0
osa-miR5516a CUCAUUGCUUCGGUAGGCUGG 21 0 0 0 0    0 0 0 0
osa-miR5516b CUCAUUGCUUCGGUAGGCUGG 21 0 0 0 0    0 0 0 0
osa-miR5517 UGCAUCACGGCGCAUAUGUAG 21 0 0 0 0    0 0 0 0
osa-miR5518 AUACUCAAACAGGGCAUUGCA 21 0 0 0 0    0 0 0 0
osa-miR5519 UGGCAGAAGUACUGGACUUAG 21 0 0 0 0    0 0 0 0
osa-miR5521 AGUGGCUGCAUAUCUGAUGAG 21 0 0 0 0    0 0 0 0
osa-miR5522 AACAAUAGGAAUGGGAGGCAU 21 0 0 0 0    0 0 0 0
osa-miR5523 UGAGGAGGAACAUAUUUACUAG 22 0 0 0 0    0 0 0 0
osa-miR5524 UGGAAAAUGUGUUCAUGACGG 21 0 0 0 0    0 0 0 0
osa-miR5525 UGAACCUUGGGAGCGAUCUGAA 22 0 0 0 0    0 0 0 0
osa-miR5526 AAAGGUAGAGUCAGGUAUGAG 21 0 0 0 0    0 0 0 0
osa-miR5527 UCUCAGCCAGGGCAGUAACAG 21 0 0 0 0    0 0 0 0
osa-miR5528 AAGACGGUUUUAGAUGUUGCC 21 0 0 0 0    0 0 0 0
osa-miR5529 GUUUCAUCCAUGGACACCGCA 21 0 0 0 0    0 0 0 0
osa-miR5530 AGUGGUGUCGUAUUACCUGCC 21 0 0 0 0    0 0 0 0
osa-miR5531 ACUGACUGCCUUGAGCUCCGGG 22 0 0 0 0    0 0 0 0
osa-miR5532 AUGGAAUAUAUGACAAAGGUGG 22 0 0 0 0    0 0 0 0
osa-miR5533 CUUUGCCAGAAGCCCUCAUGG 21 0 0 0 0    0 0 0 0
osa-miR5534a UGACGACAACAGCUAGAAUGG 21 0 0 0 0    0 0 0 0
osa-miR5534b CGAUGACAACAGCUAGAAUGG 21 0 0 0 0    0 0 0 0
osa-miR5535 UCUGCGUGAUUGAAGUCUGCAU 22 0 0 0 0    0 0 0 0
osa-miR5536 AAUGGUAGUGACAUUAUGGUAG 22 0 0 0 0    0 0 0 0
osa-miR5537 AAUGUUUGUAUGGAUCGUUUGU 22 0 0 0 0    0 0 0 0
osa-miR5538 ACUGAACUCAAUCACUUGCUGC 22 0 0 0 0    0 0 0 0
osa-miR5539a AAGAAAACGGAUGCGCGUGCUA 22 0 0 0 0    0 0 0 0
osa-miR5539b AAGAAAACGGAUGCGCGUGCUA 22 0 0 0 0    0 0 0 0
osa-miR5540 UUGUGCGAGAUCGACGGUAUA 21 0 0 0 0    0 0 0 0
osa-miR5541 UCAAGUGGUGUACUCUAAAGA 21 0 0 0 0    0 0 0 0
osa-miR5542 UUUGAGAAGGUAUCAUGAGAU 21 0 0 0 0    0 0 0 0
osa-miR5543 UAUGAAUGGUAUAUUUUCUUG 21 0 0 0 0    0 0 0 0
osa-miR5544 AGAACACGGAGUAGAAGUUGGU 22 0 0 0 0    0 0 0 0
osa-miR5788 UGGAUGUGACAUACUCUAGUA 21 0 0 0 0    0 0 0 0
osa-miR5789 UGACUGAGCUUCGUUCGGUAU 21 0 0 0 0    0 0 0 0
osa-miR5790 AAGACGAUCCUAGCAGAGCUUCAU 24 0 0 0 0    0 0 0 0
osa-miR5791 UUGCAGGAGACUAGAGACCAG 21 0 0 0 0    0 0 0 0
osa-miR5792 GAUGACAGCGGUGGUUCGGACAUC 24 0 0 0 0    0 0 0 0
osa-miR5793 CGAGGACGAGAUACAGUGCAG 21 0 0 0 0    0 0 0 0
osa-miR5794 UGAGGAAUCACUAGUAGUCGU 21 0 0 0 0    0 0 0 0
osa-miR5795 AUGUCGAGGUCGAGUUCCCGGC 22 0 0 0 0    0 0 0 0
osa-miR5796 UCAUUCAGGAUUGAAGCCGCC 21 0 0 0 0    0 0 0 0
osa-miR5797 UCGUGGGAUUUAUGCAGUUAA 21 0 0 0 0    0 0 0 0
osa-miR5798 CUGGACUACAAGAUCCCGGAU 21 0 0 0 0    0 0 0 0
osa-miR5799 AAGACGAAUAAUCAAACGUUGGAC 24 0 0 0 0    0 0 0 0
osa-miR5800 CCCGGCUAUCGGAACGGCUGC 21 0 0 0 0    0 0 0 0
osa-miR5801 ACCAAAUCGUUUUCGAUCGUUGGA 24 0 0 0 0    0 0 0 0
osa-miR5802 AUGGACUGUACUUUGUAAAGCGGA 24 0 0 0 0    0 0 0 0
osa-miR5803 ACCACUGUAGACGCUACGUGUGAG 24 0 0 0 0    0 0 0 0
osa-miR5804 UGCGAAGUAGAGAUGCCGACU 21 0 0 0 0    0 0 0 0
osa-miR5805 ACGAGUGAUGGCGGCGUAUACCUG 24 0 0 0 0    0 0 0 0
osa-miR5806 ACAGGCAAAGACAAUGACGGC 21 0 0 0 0    0 0 0 0
osa-miR5807 AGGAGGUCUGGAGAGUUAUGUGGC 24 0 0 0 0    0 0 0 0
osa-miR5808 ACUAAAUCGUUUCUGAUCGUUGGA 24 0 0 0 0    0 0 0 0
osa-miR5809 UCGUCGCCGGCGACCACAGC 20 0 0 0 0    0 0 0 0
osa-miR5810 ACGGAACCCUAAUGGCGAUGGCAU 24 0 0 0 0    0 0 0 0
osa-miR5811 CCUAACCUAGGAGUUCGAUGGGAC 24 0 0 0 0    0 0 0 0
osa-miR5812 AGCAACGAUUUUAAGAUUGUGGCA 24 0 0 0 0    0 0 0 0
osa-miR5813 AAGCAGCGACUCUGGUCAUGGA 22 0 0 0 0    0 0 0 0
osa-miR5814 AAUCAAGUUAGGAACCAUGCAAGU 24 0 0 0 0    0 0 0 0
osa-miR5815 AAUGUUAUGGACACUAGAUGACAU 24 0 0 0 0    0 0 0 0
osa-miR5816 UAGGAGUGUUUGUAGGAGCGCCAC 24 0 0 0 0    0 0 0 0
osa-miR5817 AUCGAAUUUGAAAGAAAAAGGUAU 24 0 0 0 0    0 0 0 0
osa-miR5818 UCGAACUAGAAGGGCCAGGUU 21 0 0 0 0    0 0 0 0
osa-miR5819 AGGACGAGGGGAACGGCGGCG 21 0 0 0 0    0 0 0 0
osa-miR5820 UGGCAGAGAUUGAUCGAGGAA 21 0 0 0 0    0 0 0 0
osa-miR5821 UGGACGGAGCGAUGGUGGGCG 21 0 0 0 0    0 0 0 0
osa-miR5822 UGUCUGCUCGAUGUCAGGUUG 21 0 0 0 0    0 0 0 0
osa-miR5823 AAGGAAUUGGGUCUAAUCUCUUCC 24 0 0 0 0    0 0 0 0
osa-miR5824 AGUCUGAUAAGAAGUCAAUGGCGU 24 0 0 0 0    0 0 0 0
osa-miR5825 AAAACAUCUGAUAACCUGAAACGG 24 0 0 0 0    0 0 0 0
osa-miR5826 UAGCCCAAAGUGAGAAGAGUGGGU 24 0 0 0 0    0 0 0 0
osa-miR5827 UUUGUUGCAAUUUGGACUACC 21 0 0 0 0    0 0 0 0
osa-miR5828 UUACGGCAUUAAAAGUAAAUC 21 0 0 0 0    0 0 0 0
osa-miR5829 AUCAGGACCAGUAGGCGAUGGUAA 24 0 0 0 0    0 0 0 0
osa-miR5830 AUGUAGAUGAGGUGAUGUUACACA 24 0 0 0 0    0 0 0 0
osa-miR5831 UAGUCAAACUUAGAAUAGUUGGAC 24 0 0 0 0    0 0 0 0
osa-miR5832 UUGGCGGAGCGGUUGCUGUCA 21 0 0 0 0    0 0 0 0
osa-miR5833 UCCUCCUCGGGCUCAUCGGGC 21 0 0 0 0    0 0 0 0
osa-miR5834 ACGGAUGUAGAAAUUGGUGAU 21 0 0 0 0    0 0 0 0
osa-miR5835 ACGAAACCAUAGGGAUUUUGGCAU 24 0 0 0 0    0 0 0 0
osa-miR5836 UGAGCAGCCGGACCAUGGGAU 21 0 0 0 0    0 0 0 0
osa-miR5837.1 AUGUUGGAAUGACAUGCAGCU 21 0 0 0 0    0 0 0 0
osa-miR5837.2 GGUGAUGUGGAGCGUUCGGCA 21 0 0 0 0    0 0 0 0
osa-miR6245 AGUAUAGGUGUCGGCUCUAUU 21 0 0 0 0    0 0 0 0
osa-miR6246 UUGGGGAUUUCCUGCCGGAGGAA 23 0 0 0 0    0 0 0 0
osa-miR6247 UGGCUGAUUGACCUAAUGGCA 21 0 0 0 0    0 0 0 0
osa-miR6248 UAUUUGAGGAUGGAGGUAGUA 21 0 0 0 0    0 0 0 0
osa-miR6249a CGUGAAGAGCUCGCCGGCGGC 21 0 0 0 0    0 0 0 0
osa-miR6249b CGUGAAGAGCUCGCCGGCGGC 21 0 0 0 0    0 0 0 0
osa-miR6250 GGGGAUAGAUCGACGCGUCAAG 22 0 0 0 0    0 0 0 0
osa-miR6251 UGUGUAGCCACAUUGUAAGGG 21 0 0 0 0    0 0 0 0
osa-miR6252 AUUCGUUGUAUUAAGAGAGGGUU 23 0 0 0 0    0 0 0 0
osa-miR6253 GAGGAAAGUGGGCAGUUGGGUU 22 0 0 0 0    0 0 0 0
osa-miR6254 UGCUCCGGAUAUUAUGGCAUG 21 0 0 0 0    0 0 0 0
osa-miR6255 UGGGAAAAAUGGGCAGUUGAGU 22 0 0 0 0    0 0 0 0
osa-miR6256 GUAGUACUCGGUUGUAGGUGUA 22 0 0 0 0    0 0 0 0
osa-miR7692-3p UGACUUGGCAUGCUUACGUGGCAC 24 0 0 0 0    0 0 0 0
osa-miR7692-5p GAUCCAAAAAAGUGCCACGUGAGC 24 0 0 0 0    0 0 0 0
osa-miR7693-3p GACGUCCAUCGAUGAAGAGCGA 22 0 0 0 0    0 0 0 0
osa-miR7693-5p GUUUCCGCUCUUCAUCGAUGGCUG 24 0 0 0 0    0 0 0 0
osa-miR7694-3p CCAUAUUCGUAGUGCUAGGUGG 22 0 0 0 0    0 0 0 0
osa-miR7694-5p AACCUAGUACUGGAUUAGUCACCA 24 0 0 0 0    0 0 0 0
osa-miR7695-3p ACGUGAUGUGCCACGUAGGCA 21 0 0 0 0    0 0 0 0
osa-miR7695-5p UGCCUAUGUGGCACGCCACGUGAA 24 0 0 0 0    0 0 0 0
osa-miR810a UCAUAAGCCCACCACAUGUGG 21 0 0 0 0    0 0 0 0
osa-miR810b.1 UGAACACCGAUAUGCGUCAUC 21 0 0 0 0    0 0 0 0
osa-miR810b.2 AAGUGAUUUAAUUAUGCCGUU 21 0 0 0 0    0 0 0 0
osa-miR812a GACGGACGGUUAAACGUUGGAC 22 0 0 0 0    0 0 0 0
osa-miR812b GACGGACGGUUAAACGUUGGAC 22 0 0 0 0    0 0 0 0
osa-miR812c GACGGACGGUUAAACGUUGGAC 22 0 0 0 0    0 0 0 0
osa-miR812d GACGGACGGUUAAACGUUGGAC 22 0 0 0 0    0 0 0 0
osa-miR812e GACGGACGGUUAAACGUUGGAC 22 0 0 0 0    0 0 0 0
osa-miR812f ACGGAUGAUUAAAGUUGGACACGG 24 0 0 0 0    0 0 0 0
osa-miR812g AAGACGGAUGAUUAAAGUUGGACA 24 0 0 0 0    0 0 0 0
osa-miR812h AAGACGGAUGAUUAAAGUUGGACA 24 0 0 0 0    0 0 0 0
osa-miR812i AAGACGGAUGAUUAAAGUUGGACA 24 0 0 0 0    0 0 0 0
osa-miR812j AAGACGGAUGAUUAAAGUUGGACA 24 0 0 0 0    0 0 0 0
osa-miR812k ACGAACGGUUAAAGUUGGACGCGG 24 0 0 0 0    0 0 0 0
osa-miR812l ACGAACGGUUAAAGUUGGACGCGG 24 0 0 0 0    0 0 0 0
osa-miR812m ACGAACGGUUAAAGUUGGACGCGG 24 0 0 0 0    0 0 0 0
osa-miR812n-3p ACGGAAAAUCAUGGCUGCACUUAA 24 0 0 0 0    0 0 0 0
osa-miR812n-5p AAGUGCAGCCAUGAGUUUCCGUGC 24 0 0 0 0    0 0 0 0
osa-miR812o-3p GAACGGUCAAAUGUUAGACACGGA 24 0 0 0 0    0 0 0 0
osa-miR812o-5p CGUGUUCAACGUUUGACUGUC 21 0 0 0 0    0 0 0 0
osa-miR812p GACGGACGAUUAAAGUUGGGCAUG 24 0 0 0 0    0 0 0 0
osa-miR812q ACGUUGGGUACGAAUAUCUACGGC 24 0 0 0 0    0 0 0 0
osa-miR812r ACGUUAGACACGAAUUUCUACGGC 24 0 0 0 0    0 0 0 0
osa-miR812s AAGACGGACAAUCAAACGUUGGAC 24 0 0 0 0    0 0 0 0
osa-miR812t ACGGAAAAUCAUGGCUGCACUUAA 24 0 0 0 0    0 0 0 0
osa-miR812u ACGGAAAAUCAUGGCUGCACUUAA 24 0 0 0 0    0 0 0 0
osa-miR812v AUGGCUGCACUUAAAAUGGGACGG 24 0 0 0 0    0 0 0 0
osa-miR814a CACUUCAUAGUACAACGAAUCU 22 0 0 0 0    0 0 0 0
osa-miR814b CACUUCAUAGUACAACGAAUCU 22 0 0 0 0    0 0 0 0
osa-miR814c CACUUCAUAGUACAACGAAUCU 22 0 0 0 0    0 0 0 0
osa-miR815a AAGGGGAUUGAGGAGAUUGGG 21 0 0 0 0    0 0 0 0
osa-miR815b AAGGGGAUUGAGGAGAUUGGG 21 0 0 0 0    0 0 0 0
osa-miR815c AAGGGGAUUGAGGAGAUUGGG 21 0 0 0 0    0 0 0 0
osa-miR816 GUGACAUAUUUUACUACAAC 20 0 0 0 0    0 0 0 0
osa-miR817 UCCAACUUGAGGCCCGAUUGA 21 0 0 0 0    0 0 0 0
osa-miR818a AAUCCCUUAUAUUAUGGGACGG 22 0 0 0 0    0 0 0 0
osa-miR818b AAUCCCUUAUAUUAUGGGACGG 22 0 0 0 0    0 0 0 0
osa-miR818c AAUCCCUUAUAUUAUGGGACGG 22 0 0 0 0    0 0 0 0
osa-miR818d AAUCCCUUAUAUUAUGGGACGG 22 0 0 0 0    0 0 0 0
osa-miR818e AAUCCCUUAUAUUAUGGGACGG 22 0 0 0 0    0 0 0 0
osa-miR818f GGGAGCAUGUAGGAUGGCCAU 21 0 0 0 0    0 0 0 0
osa-miR820a UCGGCCUCGUGGAUGGACCAG 21 0 0 0 0    0 0 0 0
osa-miR820b UCGGCCUCGUGGAUGGACCAG 21 0 0 0 0    0 0 0 0
osa-miR820c UCGGCCUCGUGGAUGGACCAG 21 0 0 0 0    0 0 0 0
osa-miR821a AAGUCAUCAACAAAAAAGUUGAAU 24 0 0 0 0    0 0 0 0
osa-miR821b AAGUCAUCAACAAAAAAGUUGAAU 24 0 0 0 0    0 0 0 0
osa-miR821c AAGUCAUCAACAAAAAAGUUGAAU 24 0 0 0 0    0 0 0 0
osa-miR827 UUAGAUGACCAUCAGCAAACA 21 0 0 0 0    0 0 0 0