Medicago Small RNA miRNA Abundances

The data below are based on the microRNAs listed in the miRBase registry. Adjust libraries/reads to display on the control panel.

        

        miRNA         miRNA sequence Len Sum (norm) Average Max Min (>0)  1507OE1507OE_22109OE2109OE_22118aOE2118aOE_22118bOE2118bOE_22118cOE2118cOE_4MtOE_controlMtOE_control_2MIM1507_1MIM1507_2MIM2109_1MIM2109_2MIM2118_1MIM2118_2MIMall_v2_1MIMall_v2_2MIMck_1MIMck_2MLEF2MSDL2MtWtMYR2G643815G64381614d_DeNodRoot16d_DeNodRoot14d_Nodule16d_Nodule
mtr-miR1507-3p CCUCGUUCCAUACAUCAUCUAG 22 1,941,895 60,684 1,259,150 16    1,259,150 348,428 10,368 8,312 12,685 13,498 12,335 10,236 14,008 14,329 21,335 9,193 4,912 781 23,609 21,394 16,976 10,239 14,984 9,369 18,215 19,944 2,092 13,175 16 16,304 9,722 7,348 3,435 2,508 8,267 4,728
mtr-miR1507-5p AGAGUUGUAUGGAACGAAAGAU 22 1,806 56 910 1    10 15 7 16 5 17 11 14 14 1 5 8 4 3 13 5 2 4 9 0 5 3 8 0 1 4 910 667 20 5 9 11
mtr-miR1509a-3p ACCGGAUUUCCUUGAUUAAAG 21 19,246 601 1,446 1    281 889 368 1,446 412 1,342 347 1,145 398 936 232 1,028 753 353 1,110 484 811 723 902 574 794 532 72 101 1 167 70 59 813 687 518 898
mtr-miR1509a-5p UUAAUCUAGGAAAAUACGGUG 21 759 24 129 1    3 10 17 6 10 9 13 8 13 5 7 12 10 114 11 7 16 15 12 129 14 14 1 12 0 66 78 64 9 29 20 25
mtr-miR1509b UUAAUCUAGGAAAUUACACUCG 22 17,212 538 1,746 1    183 459 325 377 343 352 486 441 361 243 323 342 705 461 587 339 497 481 520 449 554 541 290 106 1 1,250 10 0 1,367 1,743 1,330 1,746
mtr-miR1510a-3p CGGAGGAUUAGGUAAAACAAC 21 117,127 3,660 12,171 4    3,242 5,750 2,722 5,993 965 3,491 1,329 4,317 1,588 966 2,054 4,152 6,060 1,852 6,781 5,744 6,489 6,029 5,601 3,554 6,791 4,635 1,292 12,171 4 781 3,389 2,339 1,832 1,641 1,730 1,843
mtr-miR1510a-5p UUGUCUUACCCAUUCCUCCCA 21 44,994 1,406 24,690 16    383 477 474 347 416 438 575 429 596 360 468 316 490 304 450 411 375 407 313 367 293 383 4,956 24,690 16 2,652 131 94 492 351 1,789 751
mtr-miR1510b-3p ACAUGGUCGGUAUCCCUGGAA 21 16,441 514 1,101 205    306 543 830 419 1,101 639 929 494 868 379 610 578 637 355 641 308 648 312 578 348 704 682 205 289 246 488 689 531 240 224 207 413
mtr-miR1510b-5p CCAUGGAUCCCUACCAUGUGG 21 579 18 79 3    12 28 53 6 79 16 38 31 46 3 17 26 12 19 8 3 11 9 8 12 16 18 4 5 55 11 7 0 9 0 11 6
mtr-miR156a UGACAGAAGAGAGAGAGCACA 21 24 1 5 1    1 1 1 4 1 0 0 0 0 0 0 1 0 0 0 0 1 0 0 0 3 1 1 1 1 0 5 0 0 0 0 2
mtr-miR156b-3p UGCUCACUCUCUAUCUGUCACC 22 175 5 58 1    0 0 1 0 2 0 1 0 0 1 5 1 2 0 0 1 0 0 1 0 1 3 0 58 0 15 0 0 2 5 33 43
mtr-miR156b-5p UGACAGAAGAGAGUGAGCAC 20 428,975 13,405 190,370 421    524 903 623 1,011 495 1,217 664 1,015 562 421 786 1,323 2,015 860 1,044 921 1,309 585 1,721 2,180 1,580 1,302 2,884 8,744 5,302 668 188,786 190,370 768 579 2,917 4,896
mtr-miR156c-3p UGCUUACUCUCUAUCUGUCACC 22 3,478 109 1,134 20    33 23 61 36 74 44 65 52 37 20 83 48 169 27 64 37 143 29 128 25 110 137 590 1,134 0 99 0 0 58 63 30 59
mtr-miR156c-5p UGACAGAAGAGAGUGAGCAC 20 428,975 13,405 190,370 421    524 903 623 1,011 495 1,217 664 1,015 562 421 786 1,323 2,015 860 1,044 921 1,309 585 1,721 2,180 1,580 1,302 2,884 8,744 5,302 668 188,786 190,370 768 579 2,917 4,896
mtr-miR156d-3p UGCUCACUCAUCUUUCUGUCAAA 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR156d-5p UGACAGAAGAGAGUGAGCAC 20 428,975 13,405 190,370 421    524 903 623 1,011 495 1,217 664 1,015 562 421 786 1,323 2,015 860 1,044 921 1,309 585 1,721 2,180 1,580 1,302 2,884 8,744 5,302 668 188,786 190,370 768 579 2,917 4,896
mtr-miR156e UUGACAGAAGAUAGAGAGCAC 21 147,526 4,610 60,838 11    70 11 99 30 158 35 50 19 126 44 85 48 48 38 28 27 22 29 63 25 104 122 75 43,906 1,034 510 60,838 38,299 254 156 628 545
mtr-miR156f UUGACAGAAGAUAGAGAGCAC 21 147,526 4,610 60,838 11    70 11 99 30 158 35 50 19 126 44 85 48 48 38 28 27 22 29 63 25 104 122 75 43,906 1,034 510 60,838 38,299 254 156 628 545
mtr-miR156g-3p GCUCUCUAGACUUCUGUCAUC 21 3,636 114 1,154 3    21 4 32 16 17 17 24 14 23 26 9 10 9 3 8 19 8 6 21 12 15 14 660 44 129 5 49 20 327 200 1,154 720
mtr-miR156g-5p UUGACAGAAGAUAGAGGGCAC 21 210,412 6,575 86,350 30    315 30 482 98 461 129 460 79 565 180 484 85 250 46 74 186 128 116 222 152 173 205 5,338 4,359 5,330 2,969 86,350 75,955 2,567 2,902 11,149 8,573
mtr-miR156h-3p GCUCUUUAUUCUUCUGUCAUC 21 324 10 263 1    1 0 3 0 3 1 1 1 0 0 1 0 0 0 0 0 0 0 2 0 0 3 0 263 0 0 2 0 11 0 24 8
mtr-miR156h-5p UUGACAGAAGAUAGAGAGCAC 21 147,526 4,610 60,838 11    70 11 99 30 158 35 50 19 126 44 85 48 48 38 28 27 22 29 63 25 104 122 75 43,906 1,034 510 60,838 38,299 254 156 628 545
mtr-miR156i-3p UGCUCACUUCUCUUUCUGUCAUC 23 229 7 39 1    8 6 8 4 8 2 10 6 7 4 10 1 4 3 8 3 2 1 7 6 5 8 14 39 0 29 0 0 16 10 0 0
mtr-miR156i-5p UGACAGAAGAGAGUGAGCAC 20 428,975 13,405 190,370 421    524 903 623 1,011 495 1,217 664 1,015 562 421 786 1,323 2,015 860 1,044 921 1,309 585 1,721 2,180 1,580 1,302 2,884 8,744 5,302 668 188,786 190,370 768 579 2,917 4,896
mtr-miR156j UGACAGAAGAGGGUGAGCAC 20 235 7 82 1    0 0 0 0 0 0 1 0 1 0 0 0 0 5 0 15 0 4 0 27 0 19 1 3 7 0 68 82 0 0 0 2
mtr-miR159a UUUGGAUUGAAGGGAGCUCUA 21 3,730,355 116,574 267,110 1,164    65,911 101,762 162,642 207,443 164,955 119,881 146,135 164,797 148,563 99,947 93,144 232,772 121,106 74,706 132,836 66,651 174,968 101,094 134,935 68,657 142,105 115,632 118,361 267,110 1,164 158,449 5,482 4,992 79,700 70,743 81,562 102,150
mtr-miR159b AUUGGAGUGAAGGGAGCUCCA 21 6,655 208 2,831 5    8 17 24 18 28 12 19 33 21 19 11 14 30 5 38 57 11 23 14 18 6 10 0 10 12 185 2,334 2,831 78 54 495 220
mtr-miR160a UGCCUGGCUCCCUGUAUGCCA 21 14,457 452 2,625 62    79 94 179 108 151 92 159 89 163 87 101 75 104 98 102 62 91 110 84 96 89 110 2,625 1,771 1,083 2,341 519 637 663 852 675 968
mtr-miR160b UGCCUGGCUCCCUGUAUGCCA 21 14,457 452 2,625 62    79 94 179 108 151 92 159 89 163 87 101 75 104 98 102 62 91 110 84 96 89 110 2,625 1,771 1,083 2,341 519 637 663 852 675 968
mtr-miR160c UGCCUGGCUCCCUGAAUGCCA 21 828 26 352 1    1 3 3 2 1 1 2 2 0 3 0 3 2 3 2 6 1 4 0 6 3 6 12 0 352 39 286 57 4 15 4 5
mtr-miR160d UGCCUGGCUCCCUGUAUGCCA 21 14,457 452 2,625 62    79 94 179 108 151 92 159 89 163 87 101 75 104 98 102 62 91 110 84 96 89 110 2,625 1,771 1,083 2,341 519 637 663 852 675 968
mtr-miR160e UGCCUGGCUCCCUGUAUGCCA 21 14,457 452 2,625 62    79 94 179 108 151 92 159 89 163 87 101 75 104 98 102 62 91 110 84 96 89 110 2,625 1,771 1,083 2,341 519 637 663 852 675 968
mtr-miR160f GCGUGAAGGGAGUCAAGCAGG 21 71 2 68 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 1 0 68 0 0 0 0 0
mtr-miR162 UCGAUAAACCUCUGCAUCCAG 21 102,734 3,210 5,848 97    3,300 4,612 3,160 4,740 4,024 5,030 3,354 4,039 3,465 3,483 3,842 3,431 4,563 1,841 5,848 4,542 4,450 3,791 4,037 2,219 3,596 4,029 566 2,205 97 1,693 1,186 743 2,545 2,376 2,922 3,005
mtr-miR164a UGGAGAAGCAGGGCACGUGCA 21 47,388 1,481 20,777 19    27 61 48 62 43 53 54 77 64 41 20 53 30 27 47 19 25 39 31 31 56 32 58 52 6,052 1,173 12,660 20,777 1,425 4,027 109 115
mtr-miR164b UGGAGAAGCAGGGCACGUGCA 21 47,388 1,481 20,777 19    27 61 48 62 43 53 54 77 64 41 20 53 30 27 47 19 25 39 31 31 56 32 58 52 6,052 1,173 12,660 20,777 1,425 4,027 109 115
mtr-miR164c UGGAGAAGCAGGGCACGUGCA 21 47,388 1,481 20,777 19    27 61 48 62 43 53 54 77 64 41 20 53 30 27 47 19 25 39 31 31 56 32 58 52 6,052 1,173 12,660 20,777 1,425 4,027 109 115
mtr-miR164d UGGAGAAGCAGGGCACAUGCU 21 192 6 62 1    0 3 5 22 4 1 6 7 2 4 1 4 2 0 4 0 0 0 1 0 2 4 0 0 0 9 22 62 4 5 9 9
mtr-miR166a UCGGACCAGGCUUCAUUCCCC 21 62,374,643 1,949,208 3,765,179 153,584    2,788,069 1,993,879 2,328,222 1,768,499 2,611,400 1,991,729 2,644,836 1,499,333 2,694,822 2,167,420 3,765,179 1,815,778 2,417,855 1,860,239 2,445,504 3,195,999 2,013,428 2,839,843 2,098,796 2,035,229 2,511,905 3,336,617 1,043,195 1,104,846 153,584 2,192,543 418,547 446,788 614,173 440,999 1,677,850 1,457,537
mtr-miR166b UCGGACCAGGCUUCAUUCCUA 21 285,017 8,907 107,265 755    755 2,092 1,909 2,184 1,965 1,816 1,605 2,315 1,922 1,209 1,344 2,310 1,844 1,242 2,357 1,400 2,355 1,391 1,649 1,293 2,480 1,893 839 1,501 9,208 7,612 107,265 90,997 4,422 3,116 10,947 9,780
mtr-miR166c UCGGACCAGGCUUCAUUCCUC 21 11,047 345 2,722 62    320 154 280 152 335 145 308 112 365 521 431 142 157 146 145 186 135 192 130 117 159 247 86 85 164 202 2,722 2,401 62 117 161 168
mtr-miR166d UCGGGCCAGGCUUCAUCCCCC 21 46 1 21 1    1 1 0 0 4 0 1 1 0 2 2 0 0 0 0 3 0 3 1 0 0 3 0 1 21 0 0 2 0 0 0 0
mtr-miR166e-3p UCGGACCAGGCUUCAUUCCCC 21 62,374,643 1,949,208 3,765,179 153,584    2,788,069 1,993,879 2,328,222 1,768,499 2,611,400 1,991,729 2,644,836 1,499,333 2,694,822 2,167,420 3,765,179 1,815,778 2,417,855 1,860,239 2,445,504 3,195,999 2,013,428 2,839,843 2,098,796 2,035,229 2,511,905 3,336,617 1,043,195 1,104,846 153,584 2,192,543 418,547 446,788 614,173 440,999 1,677,850 1,457,537
mtr-miR166e-5p GGAAUGUUGGCUGGCUCGAGG 21 98,845 3,089 20,465 36    896 2,557 1,746 5,426 500 3,354 1,113 5,142 1,172 1,553 819 3,477 2,351 1,071 2,950 2,280 2,252 2,488 2,891 1,571 2,347 1,762 36 47 995 51 2,695 2,571 8,549 20,465 1,427 12,291
mtr-miR166f UCGGACCAGGCUUCAUUCCUC 21 11,047 345 2,722 62    320 154 280 152 335 145 308 112 365 521 431 142 157 146 145 186 135 192 130 117 159 247 86 85 164 202 2,722 2,401 62 117 161 168
mtr-miR166g-3p UCGGACCAGGCUUCAUUCCCC 21 62,374,643 1,949,208 3,765,179 153,584    2,788,069 1,993,879 2,328,222 1,768,499 2,611,400 1,991,729 2,644,836 1,499,333 2,694,822 2,167,420 3,765,179 1,815,778 2,417,855 1,860,239 2,445,504 3,195,999 2,013,428 2,839,843 2,098,796 2,035,229 2,511,905 3,336,617 1,043,195 1,104,846 153,584 2,192,543 418,547 446,788 614,173 440,999 1,677,850 1,457,537
mtr-miR166g-5p GGAAUGUUGUCUGGCUCGAGG 21 100,963 3,155 24,307 54    275 566 1,940 3,396 552 2,486 1,258 3,212 1,586 2,999 799 1,867 1,547 469 2,300 1,560 1,411 1,865 2,175 920 1,563 1,020 1,258 54 881 54 4,922 4,779 11,190 24,307 3,486 14,266
mtr-miR167a UGAAGCUGCCAGCAUGAUCUA 21 27,839 870 17,269 8    17 52 55 44 72 80 42 60 44 21 26 74 79 8 47 48 43 95 72 43 84 96 78 87 198 172 17,269 8,269 82 34 231 217
mtr-miR167b-3p GAUCAUGUUGGAGCUUCACC 20 41 1 8 1    2 3 5 4 2 0 2 2 4 2 0 0 2 0 1 0 2 1 8 0 1 0 0 0 0 0 0 0 0 0 0 0
mtr-miR167b-5p UGAAGCUGCCAGCAUGAUCUG 21 46,707 1,460 9,461 184    184 239 513 391 477 466 377 255 444 301 319 319 704 439 482 322 699 603 520 518 1,092 1,043 5,109 4,448 3,091 1,868 9,461 6,847 508 516 2,523 1,629
mtr-miR168a UUGCUUGGUGCUGGUCGGGAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR168b UCGCUUGGUGCAGGUCGGGAA 21 396,498 12,391 96,859 518    3,670 10,687 5,158 10,272 4,368 11,032 3,463 9,207 5,433 5,035 5,135 9,559 8,094 3,007 10,776 6,237 9,744 5,897 7,888 5,013 8,895 7,959 5,712 7,073 518 3,894 96,859 85,072 10,486 14,865 5,077 10,413
mtr-miR168c-3p CCCGCCUUGCAUCAACUGAAU 21 38,891 1,215 4,585 13    646 2,394 947 3,358 688 4,585 541 2,129 859 2,001 398 1,664 1,072 190 1,508 1,220 934 836 959 580 825 1,011 2,167 72 13 100 1,344 1,082 1,316 813 1,310 1,329
mtr-miR168c-5p UCGCUUGGUGCAGGUCGGGAA 21 396,498 12,391 96,859 518    3,670 10,687 5,158 10,272 4,368 11,032 3,463 9,207 5,433 5,035 5,135 9,559 8,094 3,007 10,776 6,237 9,744 5,897 7,888 5,013 8,895 7,959 5,712 7,073 518 3,894 96,859 85,072 10,486 14,865 5,077 10,413
mtr-miR169a CAGCCAAGGAUGACUUGCCGA 21 10,033 314 9,996 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 1 9,996 1 15 10 0 0 6 3
mtr-miR169b CAGCCAAGGAUGACUUGCCGG 21 728 23 601 1    0 1 0 0 0 0 0 0 0 0 0 0 1 3 0 0 1 3 1 4 1 0 2 31 601 2 44 17 9 5 0 2
mtr-miR169c CAGCCAAGGGUGAUUUGCCGG 21 534 17 453 1    2 0 3 0 1 0 2 0 1 2 2 0 1 0 2 0 2 4 2 2 0 2 1 453 0 5 22 12 2 0 8 3
mtr-miR169d-3p GGCAGGUCAUCCUUCGGCUAUA 22 536 17 415 1    1 3 0 0 2 1 0 0 0 2 0 1 4 5 3 3 1 3 1 6 2 1 0 0 6 2 415 27 9 10 25 3
mtr-miR169d-5p AAGCCAAGGAUGACUUGCCGG 21 155 5 126 3    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5 4 126 7 0 10 3 0
mtr-miR169e-3p GGCAGGUCAUCCUUCGGCUAUA 22 536 17 415 1    1 3 0 0 2 1 0 0 0 2 0 1 4 5 3 3 1 3 1 6 2 1 0 0 6 2 415 27 9 10 25 3
mtr-miR169e-5p GAGCCAAGGAUGACUUGCCGG 21 84 3 48 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 48 1 17 5 0 5 6 0
mtr-miR169f AAGCCAAGGAUGACUUGCCUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR169g CAGCCAAGGAUGACUUGCCGG 21 728 23 601 1    0 1 0 0 0 0 0 0 0 0 0 0 1 3 0 0 1 3 1 4 1 0 2 31 601 2 44 17 9 5 0 2
mtr-miR169h UGAGCCAAAGAUGACUUGCCGG 22 455 14 189 2    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 23 91 189 41 5 9 49 26 20
mtr-miR169i UGAGCCAAAGAUGACUUGCCGG 22 455 14 189 2    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 23 91 189 41 5 9 49 26 20
mtr-miR169j UGAGCCAGGAUGACUUGCCGG 21 103 3 38 2    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 2 38 20 32 2 2 0 3 2
mtr-miR169k UGAGCCAGGAUGGCUUGCCGG 21 29 1 11 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 4 11 5 0 0 0 5 1 2
mtr-miR169l-3p GGCAAGUUUUUCCUUGGCUAUA 22 39 1 11 1    0 0 2 0 1 0 2 0 1 1 0 0 0 5 0 0 0 2 0 6 1 1 0 0 1 0 0 0 11 5 0 0
mtr-miR169l-5p CAGCCAAGGAUGACUUGCCGG 21 728 23 601 1    0 1 0 0 0 0 0 0 0 0 0 0 1 3 0 0 1 3 1 4 1 0 2 31 601 2 44 17 9 5 0 2
mtr-miR171a UGAUUGAGUCGUGCCAAUAUC 21 382 12 141 1    2 0 0 0 1 0 0 0 1 0 1 0 1 0 0 0 0 2 0 2 0 0 25 0 18 9 104 141 60 15 0 0
mtr-miR171b UGAUUGAGCCGCGUCAAUAUC 21 1,182 37 90 6    18 31 71 26 90 27 55 39 58 10 31 26 20 38 51 13 42 31 51 23 34 47 17 16 6 43 70 20 31 19 63 65
mtr-miR171c UGAUUGAGCCGUGCCAAUAUU 21 73 2 55 2    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 16 55 0 0 0 0 0 0 0
mtr-miR171d UGAUUGAGCCGUGCCAAUAUC 21 209 7 198 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 8 198 1 0 0 0 0 0 0
mtr-miR171e-3p AGAUUGAGCCGCGCCAAUAUC 21 4 0 2 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 2 0 0 1 0
mtr-miR171e-5p CGAUGUUGGUGAGGUUCAAUC 21 3,197 100 589 3    11 14 46 74 51 38 284 60 41 11 32 30 41 3 40 25 36 41 88 31 30 33 0 14 0 228 192 220 559 589 127 208
mtr-miR171f UUGAGCCGUGCCAAUAUCACG 21 211 7 81 1    1 5 2 2 1 1 1 4 2 1 2 0 2 0 1 1 1 0 1 2 2 1 12 81 51 4 0 0 20 10 0 0
mtr-miR171g CGAGCCGAAUCAAUAUCACUC 21 46,489 1,453 6,865 1    471 576 1,129 768 1,184 1,207 1,094 1,574 939 972 1,100 1,246 3,223 1,879 1,852 2,481 3,338 1,989 1,656 1,698 2,036 1,717 1 15 1 816 6,865 3,174 178 146 694 470
mtr-miR171h CGAGCCGAAUCAAUAUCACUC 21 46,489 1,453 6,865 1    471 576 1,129 768 1,184 1,207 1,094 1,574 939 972 1,100 1,246 3,223 1,879 1,852 2,481 3,338 1,989 1,656 1,698 2,036 1,717 1 15 1 816 6,865 3,174 178 146 694 470
mtr-miR172a AGAAUCCUGAUGAUGCUGCAG 21 8,407 263 3,944 1    8 635 11 289 21 83 4 186 19 1 12 202 321 19 108 64 266 187 143 37 57 79 12 1 3,944 324 352 254 214 117 272 165
mtr-miR172b AGAAUCUUGAUGAUGCUGCAU 21 220,368 6,887 176,722 1    3 24 1 12 4 11 3 20 6 1 3 8 11 3 16 11 10 8 13 2 6 3 245 3 176,722 219 20,047 22,452 78 78 213 132
mtr-miR172c-3p AGAAUCUUGAUGAUGCUGCAU 21 220,368 6,887 176,722 1    3 24 1 12 4 11 3 20 6 1 3 8 11 3 16 11 10 8 13 2 6 3 245 3 176,722 219 20,047 22,452 78 78 213 132
mtr-miR172c-5p GUAGCAUCAUCAAGAUUCACA 21 117 4 36 1    0 4 0 8 0 5 0 8 1 0 0 4 1 0 0 2 1 2 0 0 0 1 10 0 1 0 5 0 36 19 3 6
mtr-miR172d-3p AGAAUCUUGAUGAUGCUGCA 20 1,473 46 512 1    0 1 0 0 1 2 0 0 0 0 1 0 5 0 1 2 2 0 1 4 0 2 3 0 512 2 422 425 9 19 34 25
mtr-miR172d-5p AGUGGAGCAUCAUCAAGAUUCACA 24 2 0 2 2    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0
mtr-miR2086-3p GACAUGAAUGCAGAACUGGAA 21 75,807 2,369 43,060 11    143 399 160 441 91 486 118 439 152 342 106 304 344 87 413 318 293 312 368 248 313 201 191 46 277 11 43,060 24,830 301 394 308 311
mtr-miR2086-5p CCAGUUCUGCGUUCAUGUCCC 21 1,957 61 167 9    35 79 52 74 22 92 34 70 42 58 36 68 49 27 57 77 46 67 49 53 31 67 60 13 9 15 167 165 98 73 78 94
mtr-miR2087-3p CUGCAGUCGGUUUCUUACUUC 21 18 1 2 1    0 0 1 0 1 0 1 0 0 1 0 0 0 0 0 0 2 0 1 2 2 1 2 0 0 0 2 0 0 0 2 0
mtr-miR2087-5p GAAGUAAAGAACCGGCUGCAG 21 130 4 57 1    0 1 1 0 1 2 1 1 4 1 0 1 0 0 0 0 0 3 2 0 2 1 6 0 0 0 46 57 0 0 0 0
mtr-miR2088-3p UCCAAUGUAAUCUAGGUCUA 20 215 7 24 1    1 3 5 4 6 7 2 6 9 6 1 7 6 24 4 7 9 5 3 8 10 4 2 13 0 5 12 7 18 10 6 5
mtr-miR2088-5p AGGCCUAGAUUACAUUGGAC 20 206 6 29 1    0 6 1 6 0 1 0 9 0 6 1 8 3 14 4 9 2 3 3 12 1 0 2 0 29 2 12 15 24 29 4 0
mtr-miR2089-3p AGGAUUGGUGUAAUAGGUAAAA 22 6,385 200 3,207 2    32 54 14 36 2 2 6 27 78 27 7 37 20 3 28 24 16 23 31 20 25 12 7 0 0 13 3,207 2,527 38 15 32 22
mtr-miR2089-5p UUACCUAUUCCACCAAUUCCAU 22 52,183 1,631 23,049 1    108 126 175 76 212 134 196 109 14,514 23,049 154 70 151 87 133 158 72 32 24 14 161 149 792 2,026 1 4,361 158 101 1,643 1,568 781 848
mtr-miR2111a-3p AGCCUUGGAAUGCAGAUUAUC 21 185 6 107 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 1 1 107 1 0 1 39 10 7 10 4 3
mtr-miR2111a-5p UAAUCUGCAUCCUGAGGUUUA 21 9,678 302 6,845 1    0 0 1 0 1 0 0 0 1 1 0 0 0 0 1 0 0 0 0 0 0 0 6,845 139 77 513 919 655 107 58 238 122
mtr-miR2111b UAAUCUGCAUCCUGAGGUUUA 21 9,678 302 6,845 1    0 0 1 0 1 0 0 0 1 1 0 0 0 0 1 0 0 0 0 0 0 0 6,845 139 77 513 919 655 107 58 238 122
mtr-miR2111c UAAUCUGCAUCCUGAGGUUUA 21 9,678 302 6,845 1    0 0 1 0 1 0 0 0 1 1 0 0 0 0 1 0 0 0 0 0 0 0 6,845 139 77 513 919 655 107 58 238 122
mtr-miR2111d-3p AUCCUUAGAAUGCAGAUUAUC 21 291 9 124 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 52 1 0 1 124 74 7 19 5 6
mtr-miR2111d-5p UAAUCUGCAUCCUGAGGUUUA 21 9,678 302 6,845 1    0 0 1 0 1 0 0 0 1 1 0 0 0 0 1 0 0 0 0 0 0 0 6,845 139 77 513 919 655 107 58 238 122
mtr-miR2111e-3p AGCCUUGGGAUGCUGAUUAUC 21 45 1 24 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 6 0 1 0 24 12 0 0 2 0
mtr-miR2111e-5p UAAUCUGCAUCCUGAGGUUUA 21 9,678 302 6,845 1    0 0 1 0 1 0 0 0 1 1 0 0 0 0 1 0 0 0 0 0 0 0 6,845 139 77 513 919 655 107 58 238 122
mtr-miR2111f UAAUCUGCAUCCUGAGGUUUA 21 9,678 302 6,845 1    0 0 1 0 1 0 0 0 1 1 0 0 0 0 1 0 0 0 0 0 0 0 6,845 139 77 513 919 655 107 58 238 122
mtr-miR2111g-3p AGCCUCGGAGUGCGGAUUAUC 21 745 23 260 2    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 151 8 2 5 260 119 47 107 29 17
mtr-miR2111g-5p UAAUCUGCAUCCUGAGGUUUA 21 9,678 302 6,845 1    0 0 1 0 1 0 0 0 1 1 0 0 0 0 1 0 0 0 0 0 0 0 6,845 139 77 513 919 655 107 58 238 122
mtr-miR2111h UAAUCUGCAUCCUGAGGUUUA 21 9,678 302 6,845 1    0 0 1 0 1 0 0 0 1 1 0 0 0 0 1 0 0 0 0 0 0 0 6,845 139 77 513 919 655 107 58 238 122
mtr-miR2111i UAAUCUGCAUCCUGAGGUUUA 21 9,678 302 6,845 1    0 0 1 0 1 0 0 0 1 1 0 0 0 0 1 0 0 0 0 0 0 0 6,845 139 77 513 919 655 107 58 238 122
mtr-miR2111j UAAUCUGCAUCCUGAGGUUUA 21 9,678 302 6,845 1    0 0 1 0 1 0 0 0 1 1 0 0 0 0 1 0 0 0 0 0 0 0 6,845 139 77 513 919 655 107 58 238 122
mtr-miR2111k UAAUCUGCAUCCUGAGGUUUA 21 9,678 302 6,845 1    0 0 1 0 1 0 0 0 1 1 0 0 0 0 1 0 0 0 0 0 0 0 6,845 139 77 513 919 655 107 58 238 122
mtr-miR2111l AUCCUUGGAAUGCAGAUUAUC 21 1,630 51 959 1    1 0 1 0 1 0 0 0 0 5 0 0 0 0 0 1 0 0 0 0 0 0 959 58 0 93 85 37 118 146 88 37
mtr-miR2111m-3p GUCCUCGGGAUACAGAUUACU 21 213 7 90 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 50 0 1 2 90 59 0 0 8 3
mtr-miR2111m-5p UAAUCUGCAUCCUGAGGUUUA 21 9,678 302 6,845 1    0 0 1 0 1 0 0 0 1 1 0 0 0 0 1 0 0 0 0 0 0 0 6,845 139 77 513 919 655 107 58 238 122
mtr-miR2111n UAAUCUGCAUCCUGAGGUUUA 21 9,678 302 6,845 1    0 0 1 0 1 0 0 0 1 1 0 0 0 0 1 0 0 0 0 0 0 0 6,845 139 77 513 919 655 107 58 238 122
mtr-miR2111o UAAUCUGCAUCCUGAGGUUUA 21 9,678 302 6,845 1    0 0 1 0 1 0 0 0 1 1 0 0 0 0 1 0 0 0 0 0 0 0 6,845 139 77 513 919 655 107 58 238 122
mtr-miR2118 UUACCGAUUCCACCCAUUCCUA 22 160,808 5,025 47,217 11    956 1,620 1,473 1,057 47,217 24,996 1,632 1,334 1,553 1,420 1,165 1,021 811 572 1,274 709 548 433 310 193 1,103 995 38,292 11,220 11 5,710 577 763 3,389 5,268 1,419 1,767
mtr-miR2119 UCAAAGGGAGGUGUGGAGUAG 21 466 15 102 1    2 1 3 2 2 1 1 4 0 0 1 3 3 3 8 1 3 1 3 4 2 3 2 2 1 102 65 35 29 34 71 74
mtr-miR2199 UGAUACACUAGCACGGAUCAC 21 42,562 1,330 15,847 43    100 257 183 175 251 210 244 193 220 75 98 105 53 60 228 110 43 61 61 78 74 53 201 1,161 4,633 514 15,054 15,847 919 589 358 354
mtr-miR2585a CAGGAUUAGCGAUUACAGGGAC 22 17 1 7 1    0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 0 0 2 0 0 0 0 0 0 7 0 0 0 6 0
mtr-miR2585b CAGGAUUAGCGAUUACAGGGAC 22 17 1 7 1    0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 0 0 2 0 0 0 0 0 0 7 0 0 0 6 0
mtr-miR2585c CAGGAUUAGCGAUUACAGGGAC 22 17 1 7 1    0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 0 0 2 0 0 0 0 0 0 7 0 0 0 6 0
mtr-miR2585d CAGGAUUAGCGAUUACAGGGAC 22 17 1 7 1    0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 0 0 2 0 0 0 0 0 0 7 0 0 0 6 0
mtr-miR2586a CGAGGAGUGUCCGUGCUUCAU 21 11 0 11 11    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 11 0 0 0 0 0 0 0
mtr-miR2586b CGGUGUCGUAUCGGUGUUGGAC 22 57 2 29 1    0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 29 25 0 0 0 0
mtr-miR2587a UUGACCGUUCAUAUGAACCCUG 22 50 2 24 1    0 1 1 0 1 1 0 2 1 1 1 1 1 0 1 1 1 0 1 0 2 0 0 0 2 1 0 2 2 0 24 2
mtr-miR2587b UUGACCGUUCAUAUGAACCCUG 22 50 2 24 1    0 1 1 0 1 1 0 2 1 1 1 1 1 0 1 1 1 0 1 0 2 0 0 0 2 1 0 2 2 0 24 2
mtr-miR2587c UUGACCGUUCAUAUGAACCCUG 22 50 2 24 1    0 1 1 0 1 1 0 2 1 1 1 1 1 0 1 1 1 0 1 0 2 0 0 0 2 1 0 2 2 0 24 2
mtr-miR2587d UUGACCGUUCAUAUGAACCCUG 22 50 2 24 1    0 1 1 0 1 1 0 2 1 1 1 1 1 0 1 1 1 0 1 0 2 0 0 0 2 1 0 2 2 0 24 2
mtr-miR2587e UUGACCGUUCAUAUGAACCCUG 22 50 2 24 1    0 1 1 0 1 1 0 2 1 1 1 1 1 0 1 1 1 0 1 0 2 0 0 0 2 1 0 2 2 0 24 2
mtr-miR2587f UUGACCGUUCAUAUGAACCCUG 22 50 2 24 1    0 1 1 0 1 1 0 2 1 1 1 1 1 0 1 1 1 0 1 0 2 0 0 0 2 1 0 2 2 0 24 2
mtr-miR2587g UUGACCGUUCAUAUGAACCCUG 22 50 2 24 1    0 1 1 0 1 1 0 2 1 1 1 1 1 0 1 1 1 0 1 0 2 0 0 0 2 1 0 2 2 0 24 2
mtr-miR2588a UAACACUGUGCAACUAAGUCC 21 16 1 3 1    0 0 0 0 0 0 3 1 1 0 0 0 0 3 2 0 0 0 0 2 1 0 0 0 0 1 0 0 0 0 0 2
mtr-miR2588b UAACACUGUGCAACUAAGUCC 21 16 1 3 1    0 0 0 0 0 0 3 1 1 0 0 0 0 3 2 0 0 0 0 2 1 0 0 0 0 1 0 0 0 0 0 2
mtr-miR2589 GGCAUCCACGUGUGCUUCACCG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2590a AUCUAAAGGUGAUUAUUGUGCC 22 24 1 5 1    0 0 1 0 3 0 0 0 1 1 1 0 0 0 0 0 1 2 1 0 1 2 1 0 0 2 0 0 2 0 0 5
mtr-miR2590b AUCUAAAGGUGAUUAUUGUGCC 22 24 1 5 1    0 0 1 0 3 0 0 0 1 1 1 0 0 0 0 0 1 2 1 0 1 2 1 0 0 2 0 0 2 0 0 5
mtr-miR2590c AUCUAAAGGUGAUUAUUGUGCC 22 24 1 5 1    0 0 1 0 3 0 0 0 1 1 1 0 0 0 0 0 1 2 1 0 1 2 1 0 0 2 0 0 2 0 0 5
mtr-miR2590d AUCUAAAGGUGAUUAUUGUGCC 22 24 1 5 1    0 0 1 0 3 0 0 0 1 1 1 0 0 0 0 0 1 2 1 0 1 2 1 0 0 2 0 0 2 0 0 5
mtr-miR2590e AUCUAAAGGUGAUUAUUGUGCC 22 24 1 5 1    0 0 1 0 3 0 0 0 1 1 1 0 0 0 0 0 1 2 1 0 1 2 1 0 0 2 0 0 2 0 0 5
mtr-miR2590f AUCUAAAGGUGAUUAUUGUGCC 22 24 1 5 1    0 0 1 0 3 0 0 0 1 1 1 0 0 0 0 0 1 2 1 0 1 2 1 0 0 2 0 0 2 0 0 5
mtr-miR2590g AAAUGAGACUGAAAUCUAAAGGUG 24 606 19 126 1    9 17 10 14 27 17 12 25 13 13 7 11 11 3 13 7 25 13 15 4 28 11 4 1 0 21 126 104 13 5 15 12
mtr-miR2590h AGAAUGACAUGGCAGAAUAAUCAC 24 1,871 58 801 1    7 14 10 14 7 24 10 19 8 14 10 18 17 11 21 21 19 26 19 14 7 16 12 1 1 5 801 667 18 15 13 12
mtr-miR2590i AGAAUGACAUGGCAGAAUAAUCAC 24 1,871 58 801 1    7 14 10 14 7 24 10 19 8 14 10 18 17 11 21 21 19 26 19 14 7 16 12 1 1 5 801 667 18 15 13 12
mtr-miR2590j AGAAUGACAUGGCAGAAUAAUCAC 24 1,871 58 801 1    7 14 10 14 7 24 10 19 8 14 10 18 17 11 21 21 19 26 19 14 7 16 12 1 1 5 801 667 18 15 13 12
mtr-miR2591 GGAACUUCUACGGUACACCUGC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2592a-3p GAAAAACAUGAAUGUCGAGCG 21 5,354 167 384 28    154 235 218 281 108 232 145 200 197 209 117 228 190 157 384 184 229 122 196 147 283 226 216 28 0 32 119 94 134 54 155 80
mtr-miR2592a-5p CCCGGCAUUCAUGUUUUCCU 20 1 0 1 1    0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2592a.2-3p AAAUGCUUGAGUCCUGUUGUU 21 1,168 37 62 1    25 51 29 36 41 49 33 35 33 12 37 35 34 35 50 37 43 17 38 25 43 45 59 55 1 40 51 62 24 24 41 28
mtr-miR2592ab CAACAGGACUCAAGCAUUUCGC 22 2,037 64 376 24    26 59 37 24 39 53 43 52 26 25 54 45 58 38 57 35 74 35 42 51 73 57 40 27 25 52 376 299 42 54 70 49
mtr-miR2592ac CAACAGGACUCAAGCAUUUCGC 22 2,037 64 376 24    26 59 37 24 39 53 43 52 26 25 54 45 58 38 57 35 74 35 42 51 73 57 40 27 25 52 376 299 42 54 70 49
mtr-miR2592ad CAACAGGACUCAAGCAUUUCGC 22 2,037 64 376 24    26 59 37 24 39 53 43 52 26 25 54 45 58 38 57 35 74 35 42 51 73 57 40 27 25 52 376 299 42 54 70 49
mtr-miR2592ae CAACAGGACUCAAGCAUUUCG 21 1,221 38 364 9    12 20 26 14 19 13 25 19 21 19 15 16 25 27 28 10 15 9 18 18 34 22 41 14 21 26 364 230 22 15 51 12
mtr-miR2592af CAACAGGACUCAAGCAUUUCGC 22 2,037 64 376 24    26 59 37 24 39 53 43 52 26 25 54 45 58 38 57 35 74 35 42 51 73 57 40 27 25 52 376 299 42 54 70 49
mtr-miR2592ah CAACAGGACUCAAGCAUUUCGC 22 2,037 64 376 24    26 59 37 24 39 53 43 52 26 25 54 45 58 38 57 35 74 35 42 51 73 57 40 27 25 52 376 299 42 54 70 49
mtr-miR2592ai CAACAGGACUCAAGCAUUUCGC 22 2,037 64 376 24    26 59 37 24 39 53 43 52 26 25 54 45 58 38 57 35 74 35 42 51 73 57 40 27 25 52 376 299 42 54 70 49
mtr-miR2592aj CAACAGGACUCAAGCAUUUCGC 22 2,037 64 376 24    26 59 37 24 39 53 43 52 26 25 54 45 58 38 57 35 74 35 42 51 73 57 40 27 25 52 376 299 42 54 70 49
mtr-miR2592al CAACAGGACUCAAGCAUUUCGC 22 2,037 64 376 24    26 59 37 24 39 53 43 52 26 25 54 45 58 38 57 35 74 35 42 51 73 57 40 27 25 52 376 299 42 54 70 49
mtr-miR2592am CAACAGGACUCAAGCAUUUCGC 22 2,037 64 376 24    26 59 37 24 39 53 43 52 26 25 54 45 58 38 57 35 74 35 42 51 73 57 40 27 25 52 376 299 42 54 70 49
mtr-miR2592an AAAUGCUUGAGUCCUGUUGUU 21 1,168 37 62 1    25 51 29 36 41 49 33 35 33 12 37 35 34 35 50 37 43 17 38 25 43 45 59 55 1 40 51 62 24 24 41 28
mtr-miR2592ao AAAUGCUUGAGUCCUGUUGUU 21 1,168 37 62 1    25 51 29 36 41 49 33 35 33 12 37 35 34 35 50 37 43 17 38 25 43 45 59 55 1 40 51 62 24 24 41 28
mtr-miR2592ap AGGCUGGUUUAGAUGAAGGUA 21 3,788 118 1,885 1    2 9 0 16 1 11 0 6 7 3 2 14 6 3 15 5 8 7 10 14 10 6 7 2 0 0 1,885 1,709 16 0 6 8
mtr-miR2592aq AGGCUGGUUUAGAUGAAGGUA 21 3,788 118 1,885 1    2 9 0 16 1 11 0 6 7 3 2 14 6 3 15 5 8 7 10 14 10 6 7 2 0 0 1,885 1,709 16 0 6 8
mtr-miR2592ar AGGCUGGUUUAGAUGAAGGUA 21 3,788 118 1,885 1    2 9 0 16 1 11 0 6 7 3 2 14 6 3 15 5 8 7 10 14 10 6 7 2 0 0 1,885 1,709 16 0 6 8
mtr-miR2592as AGGCUGGUUUAGAUGAAGGUA 21 3,788 118 1,885 1    2 9 0 16 1 11 0 6 7 3 2 14 6 3 15 5 8 7 10 14 10 6 7 2 0 0 1,885 1,709 16 0 6 8
mtr-miR2592at AGGCUGGUUUAGAUGAAGGUA 21 3,788 118 1,885 1    2 9 0 16 1 11 0 6 7 3 2 14 6 3 15 5 8 7 10 14 10 6 7 2 0 0 1,885 1,709 16 0 6 8
mtr-miR2592au AGGCUGGUUUAGAUGAAGGUA 21 3,788 118 1,885 1    2 9 0 16 1 11 0 6 7 3 2 14 6 3 15 5 8 7 10 14 10 6 7 2 0 0 1,885 1,709 16 0 6 8
mtr-miR2592av AGGCUGGUUUAGAUGAAGGUA 21 3,788 118 1,885 1    2 9 0 16 1 11 0 6 7 3 2 14 6 3 15 5 8 7 10 14 10 6 7 2 0 0 1,885 1,709 16 0 6 8
mtr-miR2592aw AGGCUGGUUUAGAUGAAGGUA 21 3,788 118 1,885 1    2 9 0 16 1 11 0 6 7 3 2 14 6 3 15 5 8 7 10 14 10 6 7 2 0 0 1,885 1,709 16 0 6 8
mtr-miR2592ax AGGCUGGUUUAGAUGAAGGUA 21 3,788 118 1,885 1    2 9 0 16 1 11 0 6 7 3 2 14 6 3 15 5 8 7 10 14 10 6 7 2 0 0 1,885 1,709 16 0 6 8
mtr-miR2592ay AGGCUGGUUUAGAUGAAGGUA 21 3,788 118 1,885 1    2 9 0 16 1 11 0 6 7 3 2 14 6 3 15 5 8 7 10 14 10 6 7 2 0 0 1,885 1,709 16 0 6 8
mtr-miR2592az AGGCUGGUUUAGAUGAAGGUA 21 3,788 118 1,885 1    2 9 0 16 1 11 0 6 7 3 2 14 6 3 15 5 8 7 10 14 10 6 7 2 0 0 1,885 1,709 16 0 6 8
mtr-miR2592b-3p AAAUGCUUGAGUCCUGUUGUU 21 1,168 37 62 1    25 51 29 36 41 49 33 35 33 12 37 35 34 35 50 37 43 17 38 25 43 45 59 55 1 40 51 62 24 24 41 28
mtr-miR2592b-5p ACAACAGGACUCAAGCAUUUC 21 146 5 10 2    4 5 3 0 5 0 5 2 5 7 7 8 7 8 7 3 7 3 6 6 4 5 2 7 0 7 5 10 0 0 6 2
mtr-miR2592ba AGGCUGGUUUAGAUGAAGGUA 21 3,788 118 1,885 1    2 9 0 16 1 11 0 6 7 3 2 14 6 3 15 5 8 7 10 14 10 6 7 2 0 0 1,885 1,709 16 0 6 8
mtr-miR2592bb AGGCUGGUUUAGAUGAAGGUA 21 3,788 118 1,885 1    2 9 0 16 1 11 0 6 7 3 2 14 6 3 15 5 8 7 10 14 10 6 7 2 0 0 1,885 1,709 16 0 6 8
mtr-miR2592bc AGGCUGGUUUAGAUGAAGGUA 21 3,788 118 1,885 1    2 9 0 16 1 11 0 6 7 3 2 14 6 3 15 5 8 7 10 14 10 6 7 2 0 0 1,885 1,709 16 0 6 8
mtr-miR2592bd AGGCUGGUUUAGAUGAAGGUA 21 3,788 118 1,885 1    2 9 0 16 1 11 0 6 7 3 2 14 6 3 15 5 8 7 10 14 10 6 7 2 0 0 1,885 1,709 16 0 6 8
mtr-miR2592be AGGCUGGUUUAGAUGAAGGUA 21 3,788 118 1,885 1    2 9 0 16 1 11 0 6 7 3 2 14 6 3 15 5 8 7 10 14 10 6 7 2 0 0 1,885 1,709 16 0 6 8
mtr-miR2592bf AGGCUGGUUUAGAUGAAGGUA 21 3,788 118 1,885 1    2 9 0 16 1 11 0 6 7 3 2 14 6 3 15 5 8 7 10 14 10 6 7 2 0 0 1,885 1,709 16 0 6 8
mtr-miR2592bg AGGCUGGUUUAGAUGAAGGUA 21 3,788 118 1,885 1    2 9 0 16 1 11 0 6 7 3 2 14 6 3 15 5 8 7 10 14 10 6 7 2 0 0 1,885 1,709 16 0 6 8
mtr-miR2592bi UGGAACAUUGGGAAUGCCGGU 21 139 4 72 9    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 9 0 58 72 0 0 0 0
mtr-miR2592bj UGGAACAUUGGGAAUGCCGGU 21 139 4 72 9    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 9 0 58 72 0 0 0 0
mtr-miR2592bk UGGAACAUUGGGAAUGCCGGU 21 139 4 72 9    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 9 0 58 72 0 0 0 0
mtr-miR2592bl-3p GAGUAAUUCAAACUUGUUAAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2592bl-5p UGGCAAGUUUGAAUUUACCUCA 22 5 0 2 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 2 2 0 0 0 0
mtr-miR2592bm-3p GGAAAACAUGAAUGUCGGGUG 21 251 8 214 1    1 0 1 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 1 0 1 1 214 3 0 0 2 2 7 5 8 3
mtr-miR2592bm-5p CUCGGCAUUCAUGUUUUUCCUU 22 415 13 104 2    3 7 9 2 8 7 9 8 4 2 4 7 6 3 7 3 10 4 10 2 5 6 104 46 0 49 10 10 22 10 26 12
mtr-miR2592bn-3p GGAAAACAUGAAUGUCGGGUG 21 251 8 214 1    1 0 1 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 1 0 1 1 214 3 0 0 2 2 7 5 8 3
mtr-miR2592bn-5p CUCGGCAUUCAUGUUUUUCCUU 22 415 13 104 2    3 7 9 2 8 7 9 8 4 2 4 7 6 3 7 3 10 4 10 2 5 6 104 46 0 49 10 10 22 10 26 12
mtr-miR2592bo-3p AAAUGCUUGAGUCCUGUUGUU 21 1,168 37 62 1    25 51 29 36 41 49 33 35 33 12 37 35 34 35 50 37 43 17 38 25 43 45 59 55 1 40 51 62 24 24 41 28
mtr-miR2592bo-5p CGGCCAGGACUCAAGCAUUUCG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2592bp-3p CGGCAGAACUCCAGCAUUCGA 21 2 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2592bp-5p AAAUGCUUGAGUCCUGUUGUU 21 1,168 37 62 1    25 51 29 36 41 49 33 35 33 12 37 35 34 35 50 37 43 17 38 25 43 45 59 55 1 40 51 62 24 24 41 28
mtr-miR2592bq-3p AAAUGCUUGAGUCAUGUUGUU 21 445 14 82 1    10 21 25 22 33 38 38 17 22 11 82 4 2 5 1 6 15 3 17 8 20 21 0 0 0 0 0 2 4 0 10 8
mtr-miR2592bq-5p CGACCAUGACUCAAGUAUUAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2592br-3p AAAUGCUUGAGUCCUGUUGUU 21 1,168 37 62 1    25 51 29 36 41 49 33 35 33 12 37 35 34 35 50 37 43 17 38 25 43 45 59 55 1 40 51 62 24 24 41 28
mtr-miR2592br-5p GACUAGGACUCAAGUAUUUCG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2592c AAAUGCUUGAGUCCUGUUGUU 21 1,168 37 62 1    25 51 29 36 41 49 33 35 33 12 37 35 34 35 50 37 43 17 38 25 43 45 59 55 1 40 51 62 24 24 41 28
mtr-miR2592d-3p AAAUGCUUGAGUCCUGUUGUU 21 1,168 37 62 1    25 51 29 36 41 49 33 35 33 12 37 35 34 35 50 37 43 17 38 25 43 45 59 55 1 40 51 62 24 24 41 28
mtr-miR2592d-5p CAACAGGACUCAAGCAUUUCGC 22 2,037 64 376 24    26 59 37 24 39 53 43 52 26 25 54 45 58 38 57 35 74 35 42 51 73 57 40 27 25 52 376 299 42 54 70 49
mtr-miR2592e-3p AAAUGCUUGAGUCCUGUUGUU 21 1,168 37 62 1    25 51 29 36 41 49 33 35 33 12 37 35 34 35 50 37 43 17 38 25 43 45 59 55 1 40 51 62 24 24 41 28
mtr-miR2592e-5p CAACAGGACUCAAGCAUUUCGC 22 2,037 64 376 24    26 59 37 24 39 53 43 52 26 25 54 45 58 38 57 35 74 35 42 51 73 57 40 27 25 52 376 299 42 54 70 49
mtr-miR2592f AAAUGCUUGAGUCCUGUUGUU 21 1,168 37 62 1    25 51 29 36 41 49 33 35 33 12 37 35 34 35 50 37 43 17 38 25 43 45 59 55 1 40 51 62 24 24 41 28
mtr-miR2592g AAAUGCUUGAGUCCUGUUGUU 21 1,168 37 62 1    25 51 29 36 41 49 33 35 33 12 37 35 34 35 50 37 43 17 38 25 43 45 59 55 1 40 51 62 24 24 41 28
mtr-miR2592h AAAUGCUUGAGUCCUGUUGUU 21 1,168 37 62 1    25 51 29 36 41 49 33 35 33 12 37 35 34 35 50 37 43 17 38 25 43 45 59 55 1 40 51 62 24 24 41 28
mtr-miR2592i AAAUGCUUGAGUCCUGUUGUU 21 1,168 37 62 1    25 51 29 36 41 49 33 35 33 12 37 35 34 35 50 37 43 17 38 25 43 45 59 55 1 40 51 62 24 24 41 28
mtr-miR2592j AAAUGCUUGAGUCCUGUUGUU 21 1,168 37 62 1    25 51 29 36 41 49 33 35 33 12 37 35 34 35 50 37 43 17 38 25 43 45 59 55 1 40 51 62 24 24 41 28
mtr-miR2592k AAAUGCUUGAGUCCUGUUGUU 21 1,168 37 62 1    25 51 29 36 41 49 33 35 33 12 37 35 34 35 50 37 43 17 38 25 43 45 59 55 1 40 51 62 24 24 41 28
mtr-miR2592l AAAUGCUUGAGUCCUGUUGUU 21 1,168 37 62 1    25 51 29 36 41 49 33 35 33 12 37 35 34 35 50 37 43 17 38 25 43 45 59 55 1 40 51 62 24 24 41 28
mtr-miR2592m AAAUGCUUGAGUCCUGUUGUU 21 1,168 37 62 1    25 51 29 36 41 49 33 35 33 12 37 35 34 35 50 37 43 17 38 25 43 45 59 55 1 40 51 62 24 24 41 28
mtr-miR2592n AAAUGCUUGAGUCCUGUUGUU 21 1,168 37 62 1    25 51 29 36 41 49 33 35 33 12 37 35 34 35 50 37 43 17 38 25 43 45 59 55 1 40 51 62 24 24 41 28
mtr-miR2592o-3p AAAUGCUUGAGUCCUGUUGUU 21 1,168 37 62 1    25 51 29 36 41 49 33 35 33 12 37 35 34 35 50 37 43 17 38 25 43 45 59 55 1 40 51 62 24 24 41 28
mtr-miR2592o-5p CAACAGGACUCAAGCAUUUCGC 22 2,037 64 376 24    26 59 37 24 39 53 43 52 26 25 54 45 58 38 57 35 74 35 42 51 73 57 40 27 25 52 376 299 42 54 70 49
mtr-miR2592p AAAUGCUUGAGUCCUGUUGUU 21 1,168 37 62 1    25 51 29 36 41 49 33 35 33 12 37 35 34 35 50 37 43 17 38 25 43 45 59 55 1 40 51 62 24 24 41 28
mtr-miR2592q-3p AAAUGCUUGAGUCCUGUUGUU 21 1,168 37 62 1    25 51 29 36 41 49 33 35 33 12 37 35 34 35 50 37 43 17 38 25 43 45 59 55 1 40 51 62 24 24 41 28
mtr-miR2592q-5p CAACAGGACUCAAGCAUUUCGC 22 2,037 64 376 24    26 59 37 24 39 53 43 52 26 25 54 45 58 38 57 35 74 35 42 51 73 57 40 27 25 52 376 299 42 54 70 49
mtr-miR2592r AAAUGCUUGAGUCCUGUUGUU 21 1,168 37 62 1    25 51 29 36 41 49 33 35 33 12 37 35 34 35 50 37 43 17 38 25 43 45 59 55 1 40 51 62 24 24 41 28
mtr-miR2592s-3p AAAUGCUUGAGUCAUGUUGUU 21 445 14 82 1    10 21 25 22 33 38 38 17 22 11 82 4 2 5 1 6 15 3 17 8 20 21 0 0 0 0 0 2 4 0 10 8
mtr-miR2592s-5p ACAACAGGACUCAAGCAUUUC 21 146 5 10 2    4 5 3 0 5 0 5 2 5 7 7 8 7 8 7 3 7 3 6 6 4 5 2 7 0 7 5 10 0 0 6 2
mtr-miR2592t CAACAGGACUCAAGCAUUUCGC 22 2,037 64 376 24    26 59 37 24 39 53 43 52 26 25 54 45 58 38 57 35 74 35 42 51 73 57 40 27 25 52 376 299 42 54 70 49
mtr-miR2592u CAACAGGACUCAAGCAUUUCGC 22 2,037 64 376 24    26 59 37 24 39 53 43 52 26 25 54 45 58 38 57 35 74 35 42 51 73 57 40 27 25 52 376 299 42 54 70 49
mtr-miR2592v CAACAGGACUCAAGCAUUUCGC 22 2,037 64 376 24    26 59 37 24 39 53 43 52 26 25 54 45 58 38 57 35 74 35 42 51 73 57 40 27 25 52 376 299 42 54 70 49
mtr-miR2592w CAACAGGACUCAAGCAUUUCGC 22 2,037 64 376 24    26 59 37 24 39 53 43 52 26 25 54 45 58 38 57 35 74 35 42 51 73 57 40 27 25 52 376 299 42 54 70 49
mtr-miR2592x CAACAGGACUCAAGCAUUUCGC 22 2,037 64 376 24    26 59 37 24 39 53 43 52 26 25 54 45 58 38 57 35 74 35 42 51 73 57 40 27 25 52 376 299 42 54 70 49
mtr-miR2592y CAACAGGACUCAAGCAUUUCGC 22 2,037 64 376 24    26 59 37 24 39 53 43 52 26 25 54 45 58 38 57 35 74 35 42 51 73 57 40 27 25 52 376 299 42 54 70 49
mtr-miR2592z CAACAGGACUCAAGCAUUUCGC 22 2,037 64 376 24    26 59 37 24 39 53 43 52 26 25 54 45 58 38 57 35 74 35 42 51 73 57 40 27 25 52 376 299 42 54 70 49
mtr-miR2593a UUAAAUGAAUGAACCUAGAAU 21 249 8 24 2    2 9 9 14 13 18 6 10 8 5 2 10 11 3 16 3 7 6 10 0 10 7 24 16 0 5 7 7 0 5 3 3
mtr-miR2593b UUAAAUGAAUGAACCUAGAAU 21 249 8 24 2    2 9 9 14 13 18 6 10 8 5 2 10 11 3 16 3 7 6 10 0 10 7 24 16 0 5 7 7 0 5 3 3
mtr-miR2593c UUAAAUGAAUGAACCUAGAAU 21 249 8 24 2    2 9 9 14 13 18 6 10 8 5 2 10 11 3 16 3 7 6 10 0 10 7 24 16 0 5 7 7 0 5 3 3
mtr-miR2593d AUACAUCAUUGAUUGAAUGAACCU 24 493 15 168 1    4 8 9 12 7 10 6 14 1 7 7 7 10 5 17 11 9 15 8 12 15 6 1 2 6 0 95 168 9 0 7 5
mtr-miR2593e AUACAUCAUUGAUUGAAUGAACCU 24 493 15 168 1    4 8 9 12 7 10 6 14 1 7 7 7 10 5 17 11 9 15 8 12 15 6 1 2 6 0 95 168 9 0 7 5
mtr-miR2594 CCAUGGCCAAGGAUGCCAGAG 21 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0
mtr-miR2595 UACAUUUUCUUCUUUAUGUCU 21 774 24 268 1    1 3 2 2 3 5 4 2 2 6 4 1 3 5 5 4 3 8 2 0 0 3 13 5 1 65 0 2 82 268 155 115
mtr-miR2596 UCUAUUUCAUUGUUCCACACA 21 193 6 50 2    9 8 4 0 3 6 8 3 7 4 2 3 2 3 4 3 2 7 2 4 0 3 2 50 0 17 0 0 7 5 16 9
mtr-miR2597 UUUGGUACUUCGUCGAUUUGA 21 40,706 1,272 3,228 29    1,296 1,385 1,558 947 1,286 1,349 1,211 876 1,523 2,749 1,301 1,080 2,595 1,415 1,684 1,155 2,643 1,471 1,719 1,424 3,228 2,387 80 327 0 809 29 77 537 842 570 1,153
mtr-miR2598 CUAAGGGUGAUUAUUCUGCCA 21 4 0 3 1    0 0 0 0 0 0 0 1 0 0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2599 UGGGUACAAGGAAUCUACUUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2600a ACAUUAGCCAAUCACAAUGCC 21 22 1 3 1    0 0 3 0 1 0 0 0 0 1 1 0 1 0 0 0 0 0 0 0 2 2 0 0 0 2 2 2 2 0 1 2
mtr-miR2600b AAGCAUUGUGGCAUUGUGAUUGGU 24 834 26 279 1    6 12 15 16 10 18 4 16 12 32 9 12 13 5 10 10 10 9 7 8 10 2 12 8 1 32 213 279 13 10 8 12
mtr-miR2600c AAGCAUUGUGGCAUUGUGAUUGGU 24 834 26 279 1    6 12 15 16 10 18 4 16 12 32 9 12 13 5 10 10 10 9 7 8 10 2 12 8 1 32 213 279 13 10 8 12
mtr-miR2600d AAGCAUUGUGGCAUUGUGAUUGGU 24 834 26 279 1    6 12 15 16 10 18 4 16 12 32 9 12 13 5 10 10 10 9 7 8 10 2 12 8 1 32 213 279 13 10 8 12
mtr-miR2600e AAGCAUUGUGGCAUUGUGAUUGGC 24 1,147 36 257 4    21 46 31 24 34 29 27 35 21 47 24 20 28 14 33 23 40 25 31 20 25 14 14 4 13 30 146 257 9 10 27 25
mtr-miR2601 UAUUUGGUAUCGCUUUGGUCCC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2602a UGGCAGUGAUUGCCACGUCAU 21 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0
mtr-miR2602b UGGCAGUGAUUGCCACGUCAU 21 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0
mtr-miR2603 UUUGGUAUUGGUCCCUGCACUU 22 1 0 1 1    0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2604 UAAUUUUUAUGUGGGAGUGUU 21 2 0 1 1    0 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2605 ACUUAGUUUAUAUGACCUAC 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2606a UACAAUUCCUUAGGUGCUUUU 21 7 0 5 1    0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5 1 0
mtr-miR2606b UACAAUUCCUUAGGUGCUUUU 21 7 0 5 1    0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5 1 0
mtr-miR2606c AGUUAAGAACCAUACAAAAAACAC 24 81 3 42 39    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 39 42 0 0 0 0
mtr-miR2607 AUGUGAUUAUGUGAUAAGUGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2608 GUUGUACAUAUAUCACUACUCU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2609a UGGAAGUAAUAGGUUCUCACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2609b UGGAAGUAAUAGGUUCUCACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2610a AGAUUGAGACUUGUAUGGCUU 21 110 3 20 1    2 1 5 2 1 6 3 2 2 1 1 5 5 3 2 2 3 2 4 2 2 0 4 2 3 5 19 20 0 0 1 0
mtr-miR2610b AGAUUGAGACUUGUAUGGCUU 21 110 3 20 1    2 1 5 2 1 6 3 2 2 1 1 5 5 3 2 2 3 2 4 2 2 0 4 2 3 5 19 20 0 0 1 0
mtr-miR2611 UAUUUGUCAGUGUUUGAUGAA 21 6 0 2 1    0 1 0 0 0 2 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2
mtr-miR2612 UGAUAGUGUCAACUAGUACAG 21 277 9 23 1    4 13 7 4 6 11 6 17 4 7 2 12 2 8 10 23 7 6 13 4 6 2 11 14 1 7 2 2 20 15 19 12
mtr-miR2613 CGGUCGCCGGUGGUCAAUGGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2614 CGGUUCGACUCGUUAGGUUC 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2615a CCUGAUCGCAUUUUAAAAGGC 21 18 1 10 1    0 0 0 0 0 0 0 0 0 0 0 0 1 3 0 0 0 0 1 0 0 1 0 0 0 0 0 0 2 10 0 0
mtr-miR2615b CCUGAUCGCAUUUUAAAAGGC 21 18 1 10 1    0 0 0 0 0 0 0 0 0 0 0 0 1 3 0 0 0 0 1 0 0 1 0 0 0 0 0 0 2 10 0 0
mtr-miR2615c CCUGAUCGCAUUUUAAAAGGC 21 18 1 10 1    0 0 0 0 0 0 0 0 0 0 0 0 1 3 0 0 0 0 1 0 0 1 0 0 0 0 0 0 2 10 0 0
mtr-miR2616 AUUGGGUUUGGUUCGGGCGGAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2617a UGUAGUGUAGCAUGCCCGUU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2617b UGUAGUGUAGCAUGCCCGUU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2617c UGUAGUGUAGCAUGCCCGUU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2618a GUGAAUUCAGUUUACGUACGUU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2618b GUGAAUUCAGUUUACGUACGUU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2619a ACAUAGGAGGCUGUUUUGUAU 21 3 0 2 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 2 0 0 0 0 0
mtr-miR2619b-3p CCAAAGAAUCAAUACAUAGGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2619b-5p AUAUGUUUUGAUUCUUUGGCA 21 120 4 17 1    2 8 1 0 3 6 4 2 4 4 3 1 8 3 3 1 3 2 3 0 4 3 2 9 0 2 7 17 2 0 8 5
mtr-miR2620 UUCUGAUAGACACCGGCUCUGC 22 1,593 50 91 2    51 46 81 62 56 40 66 46 60 49 54 65 51 24 59 67 75 51 52 29 54 65 28 91 29 74 2 0 40 44 44 38
mtr-miR2621 AGCUUGGGCUAGGAAUUUGUGC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2622 UUUGUGUGCCAUCGUGAACUUA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2623 UCGGCUGUACUGUCCUUCAUG 21 172 5 12 1    1 9 5 4 4 10 5 11 7 12 3 10 5 5 7 4 6 7 5 6 6 1 2 0 0 9 0 0 7 10 3 8
mtr-miR2624 CGAAAGACGAGGUUGCCGGCU 21 2 0 1 1    0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0
mtr-miR2625 CCAUCGUGCCACGUUACGAUCC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2626 AACGUCGGGAUUUAGGGUGUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2627 UUUCGGUAGUUAACUGCUGAGG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2628 CAUGAAAGAAUGAUGAGUAA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2629a AGUUUUCCUCGGUAGUUAACU 21 10 0 4 1    0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 1 0 1 0 4 1 0 0 0 0 1 0 0 0 0 0 0
mtr-miR2629b AGUUUUCCUCGGUAGUUAACU 21 10 0 4 1    0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 1 0 1 0 4 1 0 0 0 0 1 0 0 0 0 0 0
mtr-miR2629c AGUUUUCCUCGGUAGUUAACU 21 10 0 4 1    0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 1 0 1 0 4 1 0 0 0 0 1 0 0 0 0 0 0
mtr-miR2629d AGUUUUCCUCGGUAGUUAACU 21 10 0 4 1    0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 1 0 1 0 4 1 0 0 0 0 1 0 0 0 0 0 0
mtr-miR2629e AGUUUUCCUCGGUAGUUAACU 21 10 0 4 1    0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 1 0 1 0 4 1 0 0 0 0 1 0 0 0 0 0 0
mtr-miR2629f AGUUUUCCUCGGUAGUUAACU 21 10 0 4 1    0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 1 0 1 0 4 1 0 0 0 0 1 0 0 0 0 0 0
mtr-miR2629g AGUUUUCCUCGGUAGUUAACU 21 10 0 4 1    0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 1 0 1 0 4 1 0 0 0 0 1 0 0 0 0 0 0
mtr-miR2629h GCAGAAGAUCCUCGGCAGUUAACU 24 221 7 61 1    1 6 2 10 9 2 2 3 7 4 0 5 4 0 1 3 5 3 3 0 2 5 1 5 4 6 61 44 2 15 4 2
mtr-miR2630a UGGUUUUGGUCCUUGGUAUUU 21 57 2 20 2    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 7 0 0 6 17 20 0 0 2 5
mtr-miR2630b UGGUUUUGGUCCUUGGUAUUU 21 57 2 20 2    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 7 0 0 6 17 20 0 0 2 5
mtr-miR2630c UGGUUUUGGUCCUUGGUAUUU 21 57 2 20 2    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 7 0 0 6 17 20 0 0 2 5
mtr-miR2630d UGGUUUUGGUCCUUGGUAUUU 21 57 2 20 2    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 7 0 0 6 17 20 0 0 2 5
mtr-miR2630e UGGUUUUGGUCCUUGGUAUUU 21 57 2 20 2    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 7 0 0 6 17 20 0 0 2 5
mtr-miR2630f UGGUUUUGGUCCUUGGUAUUU 21 57 2 20 2    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 7 0 0 6 17 20 0 0 2 5
mtr-miR2630g UGGUUUUGGUCCUUGGUAUUU 21 57 2 20 2    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 7 0 0 6 17 20 0 0 2 5
mtr-miR2630h UGGUUUUGGUCCUUGGUAUUU 21 57 2 20 2    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 7 0 0 6 17 20 0 0 2 5
mtr-miR2630i UGGUUUUGGUCCUUGGUAUUU 21 57 2 20 2    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 7 0 0 6 17 20 0 0 2 5
mtr-miR2630j UGGUUUUGGUCCUUGGUAUUU 21 57 2 20 2    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 7 0 0 6 17 20 0 0 2 5
mtr-miR2630k UGGUUUUGGUCCUUGGUAUUU 21 57 2 20 2    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 7 0 0 6 17 20 0 0 2 5
mtr-miR2630l UGGUUUUGGUCCUUGGUAUUU 21 57 2 20 2    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 7 0 0 6 17 20 0 0 2 5
mtr-miR2630m UGGUUUUGGUCCUUGGUAUUU 21 57 2 20 2    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 7 0 0 6 17 20 0 0 2 5
mtr-miR2630n UGGUUUUGGUCCUUGGUAUUU 21 57 2 20 2    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 7 0 0 6 17 20 0 0 2 5
mtr-miR2630o UGGUUUUGGUCCUUGGUAUUU 21 57 2 20 2    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 7 0 0 6 17 20 0 0 2 5
mtr-miR2630p UGGUUUUGGUCCUUGGUAUUU 21 57 2 20 2    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 7 0 0 6 17 20 0 0 2 5
mtr-miR2630q UGGUUUUGGUCCUUGGUAUUU 21 57 2 20 2    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 7 0 0 6 17 20 0 0 2 5
mtr-miR2630r UGGUUUUGGUCCUUGGUAUUU 21 57 2 20 2    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 7 0 0 6 17 20 0 0 2 5
mtr-miR2630s UGGUUUUGGUCCUUGGUAUUU 21 57 2 20 2    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 7 0 0 6 17 20 0 0 2 5
mtr-miR2630t UGGUUUUGGUCCUUGGUAUUU 21 57 2 20 2    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 7 0 0 6 17 20 0 0 2 5
mtr-miR2630u UGGUUUUGGUCCUUGGUAUUU 21 57 2 20 2    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 7 0 0 6 17 20 0 0 2 5
mtr-miR2630v UGGUUUUGGUCCUUGGUAUUU 21 57 2 20 2    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 7 0 0 6 17 20 0 0 2 5
mtr-miR2630w UGGUUUUGGUCCUUGGUAUUU 21 57 2 20 2    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 7 0 0 6 17 20 0 0 2 5
mtr-miR2630x UGGUUUUGGUCCUUGGUAUUU 21 57 2 20 2    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 7 0 0 6 17 20 0 0 2 5
mtr-miR2630y UGGUUUUGGUCCUUGGUAUUU 21 57 2 20 2    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 7 0 0 6 17 20 0 0 2 5
mtr-miR2631 UGACACGCCACGUGGCACACU 21 32 1 8 1    0 0 3 0 2 0 0 0 2 0 2 0 0 0 0 0 0 0 0 0 0 0 0 1 0 5 0 0 2 5 8 2
mtr-miR2632a CCUGAAGUUACUAAUCCUUCCA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2632b CCUGAAGUUACUAAUCCUUCCA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2632c CCUGAAGUUACUAAUCCUUCCA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2633 UGACAUUUUGCUCCAGAUUCA 21 687 21 269 1    2 1 2 0 6 2 2 1 6 2 3 0 3 0 4 3 1 3 2 0 0 1 2 25 32 46 269 212 11 0 35 11
mtr-miR2634 UUUAUUCUCAGUUUGUUGCUC 21 4,390 137 355 5    56 127 108 130 117 154 114 159 149 181 73 149 134 79 247 117 147 94 159 137 150 101 40 114 5 355 12 12 198 273 200 299
mtr-miR2635 AUUAUUGUCAACGUGACUAG 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2636 UUUGGUUAGUGUGCUGAAUAU 21 59 2 7 1    1 3 2 2 1 0 1 2 4 7 1 0 1 0 3 1 2 0 1 2 2 2 3 4 1 6 0 2 4 0 1 0
mtr-miR2637 AAAUACUUCCUCUGAUCACUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2638a AUGAUUAAUAUUUGCAGUGGC 21 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2638b AUGAUUAAUAUUUGCAGUGGC 21 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2639 UAGUCGGCUUACGUCACCUUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2640 UUCCUUGCCGGAGCUGGACUAC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2641 GUUUGAUCCUUUACGUUUAU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2642 AUGAGUUUCAUCAAAUCAUGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2643a UUUGGGAUCAGAAAUUAGAGA 21 4,406 138 346 43    59 114 104 128 107 111 113 126 140 53 123 135 125 43 105 76 116 54 109 45 154 127 122 235 0 247 298 245 191 346 207 248
mtr-miR2643b-3p UUUGGGAUCAGAAAUUAGAGA 21 4,406 138 346 43    59 114 104 128 107 111 113 126 140 53 123 135 125 43 105 76 116 54 109 45 154 127 122 235 0 247 298 245 191 346 207 248
mtr-miR2643b-5p UCUAAUCUCUGUUCCCAAUUA 21 209 7 19 1    5 14 1 12 4 19 6 7 6 7 6 10 10 11 6 7 13 4 8 2 9 6 9 2 0 6 0 0 9 0 5 5
mtr-miR2644 CACUUCAGAUUGAUGGUGUGU 21 27 1 25 1    0 0 0 0 0 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 25 0 0 0 0 0 0 0
mtr-miR2645 UUUCUAGAGAUGAGCAUAUAU 21 9 0 2 1    0 0 0 0 0 0 0 0 0 1 0 0 0 0 1 0 1 0 0 0 0 0 1 1 0 2 0 2 0 0 0 0
mtr-miR2646a CAUGACAUUUAGUGAUGAUGU 21 2 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0
mtr-miR2646b CAUGACAUUUAGUGAUGAUGU 21 2 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0
mtr-miR2647a AUUCACGGGGACGAACCUCCU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2647b AUUCACGGGGACGAACCUCCU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2647c AUUCACGGGGACGAACCUCCU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2648 UAGCCAAUGGGAAUAACAGAU 21 403 13 57 1    2 6 4 6 6 4 3 3 4 1 8 1 4 5 1 3 4 5 3 6 5 10 23 33 0 46 24 10 31 29 56 57
mtr-miR2649 AAAGGUGCCAAUUAUGAGUGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2650 AACUUAAAUAUGUUUUCAGUCC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2651 UUUGAUUGGUAUGCCUGCAUU 21 1,862 58 208 10    33 42 74 42 87 45 95 72 72 40 40 57 50 19 64 19 50 20 60 21 65 52 36 208 21 78 133 156 20 10 52 29
mtr-miR2652a UAUGCAGGGUGCAUAAGGAUU 21 2 0 1 1    0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2652b UAUGCAGGGUGCAUAAGGAUU 21 2 0 1 1    0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2652c UAUGCAGGGUGCAUAAGGAUU 21 2 0 1 1    0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2652d UAUGCAGGGUGCAUAAGGAUU 21 2 0 1 1    0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2652e UAUGCAGGGUGCAUAAGGAUU 21 2 0 1 1    0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2652f UAUGCAGGGUGCAUAAGGAUU 21 2 0 1 1    0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2652g UAUGCAGGGUGCAUAAGGAUU 21 2 0 1 1    0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2652h UAUGCAGGGUGCAUAAGGAUU 21 2 0 1 1    0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2652i UAUGCAGGGUGCAUAAGGAUU 21 2 0 1 1    0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2652j UAUGCAGGGUGCAUAAGGAUU 21 2 0 1 1    0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2652k UAUGCAGGGUGCAUAAGGAUU 21 2 0 1 1    0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2652l UAUGCAGGGUGCAUAAGGAUU 21 2 0 1 1    0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2652m UAUGCAGGGUGCAUAAGGAUU 21 2 0 1 1    0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2653a UCACGCUGCUGUGAACAUGAU 21 6 0 1 1    0 1 1 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 0
mtr-miR2653b UCACGCUGCUGUGAACAUGAU 21 6 0 1 1    0 1 1 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 0
mtr-miR2653c UCACGCUGCUGUGAACAUGAU 21 6 0 1 1    0 1 1 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 0
mtr-miR2653d UCACGCUGCUGUGAACAUGAU 21 6 0 1 1    0 1 1 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 0
mtr-miR2654 AUUCAGGGACAAAGUGUGCG 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2655a CGUUUAGGUCCCUUAACUUUA 21 2 0 1 1    0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2655b CGUUUUGGUCCCUUAACUUUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2655c CGUUUAGGUCCCUUAACUUUA 21 2 0 1 1    0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2655d CGUUUAGGUCCCUUAACUUUA 21 2 0 1 1    0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2655e CGUUUAGGUCCCUUAACUUUA 21 2 0 1 1    0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2655f CGUUUAGGUCCCUUAACUUUA 21 2 0 1 1    0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2655g CGUUUAGGUCCCUUAACUUUA 21 2 0 1 1    0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2655h CGUUUAGGUCCCUUAACUUUA 21 2 0 1 1    0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2655i CGUUUAGGUCCCUUAACUUUA 21 2 0 1 1    0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2655j CGUUUAGGUCCCUUAACUUUA 21 2 0 1 1    0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2655k CGUUUAGGUCCCUUAACUUUA 21 2 0 1 1    0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2655l CGUUUAGGUCCCUUAACUUUA 21 2 0 1 1    0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2655m CGUUUAGGUCCCUUAACUUUA 21 2 0 1 1    0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2655n CGUUUAGGUCCCUUAACUUUA 21 2 0 1 1    0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2655o CGUUUAGGUCCCUUAACUUUA 21 2 0 1 1    0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2656a AAGUUGCAUAAUCGAGUUGG 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2656b AAGUUGCAUAAUCGAGUUGG 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2656c AAGUUGCAUAAUCGAGUUGG 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2656d AAGUUGCAUAAUCGAGUUGG 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2656e AAGUUGCAUAAUCGAGUUGG 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2657 UGUUAUUUCAUCGAUUUUGUUG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2658 AUGUGACCUUGUAUAUGAUC 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2659a CCAUGGGUGCGACUUGGUAAG 21 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0
mtr-miR2659b CCAUGGGUGCGACUUGGUAAG 21 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0
mtr-miR2659c CCAUGGGUGCGACUUGGUAAG 21 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0
mtr-miR2659d CCAUGGGUGCGACUUGGUAAG 21 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0
mtr-miR2659e CCAUGGGUGCGACUUGGUAAG 21 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0
mtr-miR2659f CCAUGGGUGCGACUUGGUAAG 21 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0
mtr-miR2659g CCAUGGGUGCGACUUGGUAAG 21 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0
mtr-miR2659h CCAUGGGUGCGACUUGGUAAG 21 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0
mtr-miR2659i CCAUGGGUGCGACUUGGUAAG 21 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0
mtr-miR2659j CCAUGGGUGCGACUUGGUAAG 21 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0
mtr-miR2659k CCAUGGGUGCGACUUGGUAAG 21 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0
mtr-miR2660 UAAGACAUCAGCUAUAAGCUA 21 2 0 2 2    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0
mtr-miR2661 UAGGUUUGAGAAAAUGGGCAG 21 6,579 206 2,801 1    2 1 5 0 47 6 6 2 5 7 6 5 1 11 4 5 7 24 0 2 10 6 14 56 2,801 6 1,836 1,694 2 0 5 3
mtr-miR2662 GAGUAAAAAUGUGAACCGAAU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2663 UUAGAGAGGGCGUUACAAUU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2664a AAUUGUGGUGGGUUGACAGUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2664b AAUUGUGGUGGGUUGACAGUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2665 UGAUUUCAGGUCAAGAAUUGA 21 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0
mtr-miR2666 CGAAAGUGAGGAUAUCAAGGA 21 932 29 161 1    17 24 48 18 32 19 52 31 37 10 24 20 18 14 10 2 20 18 6 8 17 14 29 7 1 95 107 161 16 10 29 18
mtr-miR2667a UCCUUGAUCUGACGGCUACC 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2667b UCCUUGAUCUGACGGCUACC 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2668 UUCAUCCUUGCAAUUAGGGGUC 22 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0
mtr-miR2669a AAAGUUCAGUCUUCAUAGUAUC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2669b AAAGUUCAGUCUUCAUAGUAUC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2670a CAAGAAGGUUGCUCACUAUUU 21 19 1 4 1    0 0 0 0 1 1 0 1 4 1 0 0 0 0 1 1 0 0 0 0 0 1 1 0 1 0 2 2 0 0 2 0
mtr-miR2670b CAAGAAGGUUGCUCACUAUUU 21 19 1 4 1    0 0 0 0 1 1 0 1 4 1 0 0 0 0 1 1 0 0 0 0 0 1 1 0 1 0 2 2 0 0 2 0
mtr-miR2670c