Medicago miRNA Abundances

The data below are based on the microRNAs listed in the Sanger registry. Adjust libraries/reads to display on the control panel.

        

        miRNA         miRNA sequence Len Sum (norm) Average Max Min (>0)  1507OE1507OE_22109OE2109OE_22118aOE2118aOE_22118bOE2118bOE_22118cOE2118cOE_4MtOE_controlMtOE_control_2MIM1507_1MIM1507_2MIM2109_1MIM2109_2MIM2118_1MIM2118_2MIMall_v2_1MIMall_v2_2MIMck_1MIMck_2
mtr-miR1507-3p CCUCGUUCCAUACAUCAUCUAG 22 1,874,300 85,195 1,259,150 781    1,259,150 348,428 10,368 8,312 12,685 13,498 12,335 10,236 14,008 14,329 21,335 9,193 4,912 781 23,609 21,394 16,976 10,239 14,984 9,369 18,215 19,944
mtr-miR1507-5p AGAGUUGUAUGGAACGAAAGAU 22 171 8 17 1    10 15 7 16 5 17 11 14 14 1 5 8 4 3 13 5 2 4 9 0 5 3
mtr-miR1509a-3p ACCGGAUUUCCUUGAUUAAAG 21 15,860 721 1,446 232    281 889 368 1,446 412 1,342 347 1,145 398 936 232 1,028 753 353 1,110 484 811 723 902 574 794 532
mtr-miR1509a-5p UUAAUCUAGGAAAAUACGGUG 21 455 21 129 3    3 10 17 6 10 9 13 8 13 5 7 12 10 114 11 7 16 15 12 129 14 14
mtr-miR1509b UUAAUCUAGGAAAUUACACUCG 22 9,369 426 705 183    183 459 325 377 343 352 486 441 361 243 323 342 705 461 587 339 497 481 520 449 554 541
mtr-miR1510a-3p CGGAGGAUUAGGUAAAACAAC 21 90,105 4,096 6,791 965    3,242 5,750 2,722 5,993 965 3,491 1,329 4,317 1,588 966 2,054 4,152 6,060 1,852 6,781 5,744 6,489 6,029 5,601 3,554 6,791 4,635
mtr-miR1510a-5p UUGUCUUACCCAUUCCUCCCA 21 9,072 412 596 293    383 477 474 347 416 438 575 429 596 360 468 316 490 304 450 411 375 407 313 367 293 383
mtr-miR1510b-3p ACAUGGUCGGUAUCCCUGGAA 21 12,909 587 1,101 306    306 543 830 419 1,101 639 929 494 868 379 610 578 637 355 641 308 648 312 578 348 704 682
mtr-miR1510b-5p CCAUGGAUCCCUACCAUGUGG 21 471 21 79 3    12 28 53 6 79 16 38 31 46 3 17 26 12 19 8 3 11 9 8 12 16 18
mtr-miR156a UGACAGAAGAGAGAGAGCACA 21 14 2 4 1    1 1 1 4 1 0 0 0 0 0 0 1 0 0 0 0 1 0 0 0 3 1
mtr-miR156b-3p UGCUCACUCUCUAUCUGUCACC 22 19 2 5 1    0 0 1 0 2 0 1 0 0 1 5 1 2 0 0 1 0 0 1 0 1 3
mtr-miR156b-5p UGACAGAAGAGAGUGAGCAC 20 23,061 1,048 2,180 421    524 903 623 1,011 495 1,217 664 1,015 562 421 786 1,323 2,015 860 1,044 921 1,309 585 1,721 2,180 1,580 1,302
mtr-miR156c-3p UGCUUACUCUCUAUCUGUCACC 22 1,445 66 169 20    33 23 61 36 74 44 65 52 37 20 83 48 169 27 64 37 143 29 128 25 110 137
mtr-miR156c-5p UGACAGAAGAGAGUGAGCAC 20 23,061 1,048 2,180 421    524 903 623 1,011 495 1,217 664 1,015 562 421 786 1,323 2,015 860 1,044 921 1,309 585 1,721 2,180 1,580 1,302
mtr-miR156d-3p UGCUCACUCAUCUUUCUGUCAAA 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR156d-5p UGACAGAAGAGAGUGAGCAC 20 23,061 1,048 2,180 421    524 903 623 1,011 495 1,217 664 1,015 562 421 786 1,323 2,015 860 1,044 921 1,309 585 1,721 2,180 1,580 1,302
mtr-miR156e UUGACAGAAGAUAGAGAGCAC 21 1,281 58 158 11    70 11 99 30 158 35 50 19 126 44 85 48 48 38 28 27 22 29 63 25 104 122
mtr-miR156f UUGACAGAAGAUAGAGAGCAC 21 1,281 58 158 11    70 11 99 30 158 35 50 19 126 44 85 48 48 38 28 27 22 29 63 25 104 122
mtr-miR156g-3p GCUCUCUAGACUUCUGUCAUC 21 328 15 32 3    21 4 32 16 17 17 24 14 23 26 9 10 9 3 8 19 8 6 21 12 15 14
mtr-miR156g-5p UUGACAGAAGAUAGAGGGCAC 21 4,920 224 565 30    315 30 482 98 461 129 460 79 565 180 484 85 250 46 74 186 128 116 222 152 173 205
mtr-miR156h-3p GCUCUUUAUUCUUCUGUCAUC 21 16 2 3 1    1 0 3 0 3 1 1 1 0 0 1 0 0 0 0 0 0 0 2 0 0 3
mtr-miR156h-5p UUGACAGAAGAUAGAGAGCAC 21 1,281 58 158 11    70 11 99 30 158 35 50 19 126 44 85 48 48 38 28 27 22 29 63 25 104 122
mtr-miR156i-3p UGCUCACUUCUCUUUCUGUCAUC 23 121 6 10 1    8 6 8 4 8 2 10 6 7 4 10 1 4 3 8 3 2 1 7 6 5 8
mtr-miR156i-5p UGACAGAAGAGAGUGAGCAC 20 23,061 1,048 2,180 421    524 903 623 1,011 495 1,217 664 1,015 562 421 786 1,323 2,015 860 1,044 921 1,309 585 1,721 2,180 1,580 1,302
mtr-miR156j UGACAGAAGAGGGUGAGCAC 20 72 10 27 1    0 0 0 0 0 0 1 0 1 0 0 0 0 5 0 15 0 4 0 27 0 19
mtr-miR159a UUUGGAUUGAAGGGAGCUCUA 21 2,840,642 129,120 232,772 65,911    65,911 101,762 162,642 207,443 164,955 119,881 146,135 164,797 148,563 99,947 93,144 232,772 121,106 74,706 132,836 66,651 174,968 101,094 134,935 68,657 142,105 115,632
mtr-miR159b AUUGGAGUGAAGGGAGCUCCA 21 436 20 57 5    8 17 24 18 28 12 19 33 21 19 11 14 30 5 38 57 11 23 14 18 6 10
mtr-miR160a UGCCUGGCUCCCUGUAUGCCA 21 2,323 106 179 62    79 94 179 108 151 92 159 89 163 87 101 75 104 98 102 62 91 110 84 96 89 110
mtr-miR160b UGCCUGGCUCCCUGUAUGCCA 21 2,323 106 179 62    79 94 179 108 151 92 159 89 163 87 101 75 104 98 102 62 91 110 84 96 89 110
mtr-miR160c UGCCUGGCUCCCUGAAUGCCA 21 54 3 6 1    1 3 3 2 1 1 2 2 0 3 0 3 2 3 2 6 1 4 0 6 3 6
mtr-miR160d UGCCUGGCUCCCUGUAUGCCA 21 2,323 106 179 62    79 94 179 108 151 92 159 89 163 87 101 75 104 98 102 62 91 110 84 96 89 110
mtr-miR160e UGCCUGGCUCCCUGUAUGCCA 21 2,323 106 179 62    79 94 179 108 151 92 159 89 163 87 101 75 104 98 102 62 91 110 84 96 89 110
mtr-miR160f GCGUGAAGGGAGUCAAGCAGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR162 UCGAUAAACCUCUGCAUCCAG 21 85,396 3,882 5,848 1,841    3,300 4,612 3,160 4,740 4,024 5,030 3,354 4,039 3,465 3,483 3,842 3,431 4,563 1,841 5,848 4,542 4,450 3,791 4,037 2,219 3,596 4,029
mtr-miR164a UGGAGAAGCAGGGCACGUGCA 21 940 43 77 19    27 61 48 62 43 53 54 77 64 41 20 53 30 27 47 19 25 39 31 31 56 32
mtr-miR164b UGGAGAAGCAGGGCACGUGCA 21 940 43 77 19    27 61 48 62 43 53 54 77 64 41 20 53 30 27 47 19 25 39 31 31 56 32
mtr-miR164c UGGAGAAGCAGGGCACGUGCA 21 940 43 77 19    27 61 48 62 43 53 54 77 64 41 20 53 30 27 47 19 25 39 31 31 56 32
mtr-miR164d UGGAGAAGCAGGGCACAUGCU 21 72 5 22 1    0 3 5 22 4 1 6 7 2 4 1 4 2 0 4 0 0 0 1 0 2 4
mtr-miR166a UCGGACCAGGCUUCAUUCCCC 21 52,824,581 2,401,117 3,765,179 1,499,333    2,788,069 1,993,879 2,328,222 1,768,499 2,611,400 1,991,729 2,644,836 1,499,333 2,694,822 2,167,420 3,765,179 1,815,778 2,417,855 1,860,239 2,445,504 3,195,999 2,013,428 2,839,843 2,098,796 2,035,229 2,511,905 3,336,617
mtr-miR166b UCGGACCAGGCUUCAUUCCUA 21 39,330 1,788 2,480 755    755 2,092 1,909 2,184 1,965 1,816 1,605 2,315 1,922 1,209 1,344 2,310 1,844 1,242 2,357 1,400 2,355 1,391 1,649 1,293 2,480 1,893
mtr-miR166c UCGGACCAGGCUUCAUUCCUC 21 4,879 222 521 112    320 154 280 152 335 145 308 112 365 521 431 142 157 146 145 186 135 192 130 117 159 247
mtr-miR166d UCGGGCCAGGCUUCAUCCCCC 21 22 2 4 1    1 1 0 0 4 0 1 1 0 2 2 0 0 0 0 3 0 3 1 0 0 3
mtr-miR166e-3p UCGGACCAGGCUUCAUUCCCC 21 52,824,581 2,401,117 3,765,179 1,499,333    2,788,069 1,993,879 2,328,222 1,768,499 2,611,400 1,991,729 2,644,836 1,499,333 2,694,822 2,167,420 3,765,179 1,815,778 2,417,855 1,860,239 2,445,504 3,195,999 2,013,428 2,839,843 2,098,796 2,035,229 2,511,905 3,336,617
mtr-miR166e-5p GGAAUGUUGGCUGGCUCGAGG 21 49,718 2,260 5,426 500    896 2,557 1,746 5,426 500 3,354 1,113 5,142 1,172 1,553 819 3,477 2,351 1,071 2,950 2,280 2,252 2,488 2,891 1,571 2,347 1,762
mtr-miR166f UCGGACCAGGCUUCAUUCCUC 21 4,879 222 521 112    320 154 280 152 335 145 308 112 365 521 431 142 157 146 145 186 135 192 130 117 159 247
mtr-miR166g-3p UCGGACCAGGCUUCAUUCCCC 21 52,824,581 2,401,117 3,765,179 1,499,333    2,788,069 1,993,879 2,328,222 1,768,499 2,611,400 1,991,729 2,644,836 1,499,333 2,694,822 2,167,420 3,765,179 1,815,778 2,417,855 1,860,239 2,445,504 3,195,999 2,013,428 2,839,843 2,098,796 2,035,229 2,511,905 3,336,617
mtr-miR166g-5p GGAAUGUUGUCUGGCUCGAGG 21 35,766 1,626 3,396 275    275 566 1,940 3,396 552 2,486 1,258 3,212 1,586 2,999 799 1,867 1,547 469 2,300 1,560 1,411 1,865 2,175 920 1,563 1,020
mtr-miR167a UGAAGCUGCCAGCAUGAUCUA 21 1,202 55 96 8    17 52 55 44 72 80 42 60 44 21 26 74 79 8 47 48 43 95 72 43 84 96
mtr-miR167b-3p GAUCAUGUUGGAGCUUCACC 20 41 3 8 1    2 3 5 4 2 0 2 2 4 2 0 0 2 0 1 0 2 1 8 0 1 0
mtr-miR167b-5p UGAAGCUGCCAGCAUGAUCUG 21 10,707 487 1,092 184    184 239 513 391 477 466 377 255 444 301 319 319 704 439 482 322 699 603 520 518 1,092 1,043
mtr-miR168a UUGCUUGGUGCUGGUCGGGAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR168b UCGCUUGGUGCAGGUCGGGAA 21 156,529 7,115 11,032 3,007    3,670 10,687 5,158 10,272 4,368 11,032 3,463 9,207 5,433 5,035 5,135 9,559 8,094 3,007 10,776 6,237 9,744 5,897 7,888 5,013 8,895 7,959
mtr-miR168c-3p CCCGCCUUGCAUCAACUGAAU 21 29,345 1,334 4,585 190    646 2,394 947 3,358 688 4,585 541 2,129 859 2,001 398 1,664 1,072 190 1,508 1,220 934 836 959 580 825 1,011
mtr-miR168c-5p UCGCUUGGUGCAGGUCGGGAA 21 156,529 7,115 11,032 3,007    3,670 10,687 5,158 10,272 4,368 11,032 3,463 9,207 5,433 5,035 5,135 9,559 8,094 3,007 10,776 6,237 9,744 5,897 7,888 5,013 8,895 7,959
mtr-miR169a CAGCCAAGGAUGACUUGCCGA 21 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0
mtr-miR169b CAGCCAAGGAUGACUUGCCGG 21 15 2 4 1    0 1 0 0 0 0 0 0 0 0 0 0 1 3 0 0 1 3 1 4 1 0
mtr-miR169c CAGCCAAGGGUGAUUUGCCGG 21 28 2 4 1    2 0 3 0 1 0 2 0 1 2 2 0 1 0 2 0 2 4 2 2 0 2
mtr-miR169d-3p GGCAGGUCAUCCUUCGGCUAUA 22 39 2 6 1    1 3 0 0 2 1 0 0 0 2 0 1 4 5 3 3 1 3 1 6 2 1
mtr-miR169d-5p AAGCCAAGGAUGACUUGCCGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR169e-3p GGCAGGUCAUCCUUCGGCUAUA 22 39 2 6 1    1 3 0 0 2 1 0 0 0 2 0 1 4 5 3 3 1 3 1 6 2 1
mtr-miR169e-5p GAGCCAAGGAUGACUUGCCGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR169f AAGCCAAGGAUGACUUGCCUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR169g CAGCCAAGGAUGACUUGCCGG 21 15 2 4 1    0 1 0 0 0 0 0 0 0 0 0 0 1 3 0 0 1 3 1 4 1 0
mtr-miR169h UGAGCCAAAGAUGACUUGCCGG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR169i UGAGCCAAAGAUGACUUGCCGG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR169j UGAGCCAGGAUGACUUGCCGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR169k UGAGCCAGGAUGGCUUGCCGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR169l-3p GGCAAGUUUUUCCUUGGCUAUA 22 22 2 6 1    0 0 2 0 1 0 2 0 1 1 0 0 0 5 0 0 0 2 0 6 1 1
mtr-miR169l-5p CAGCCAAGGAUGACUUGCCGG 21 15 2 4 1    0 1 0 0 0 0 0 0 0 0 0 0 1 3 0 0 1 3 1 4 1 0
mtr-miR171a UGAUUGAGUCGUGCCAAUAUC 21 10 1 2 1    2 0 0 0 1 0 0 0 1 0 1 0 1 0 0 0 0 2 0 2 0 0
mtr-miR171b UGAUUGAGCCGCGUCAAUAUC 21 832 38 90 10    18 31 71 26 90 27 55 39 58 10 31 26 20 38 51 13 42 31 51 23 34 47
mtr-miR171c UGAUUGAGCCGUGCCAAUAUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR171d UGAUUGAGCCGUGCCAAUAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR171e-3p AGAUUGAGCCGCGCCAAUAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR171e-5p CGAUGUUGGUGAGGUUCAAUC 21 1,060 48 284 3    11 14 46 74 51 38 284 60 41 11 32 30 41 3 40 25 36 41 88 31 30 33
mtr-miR171f UUGAGCCGUGCCAAUAUCACG 21 33 2 5 1    1 5 2 2 1 1 1 4 2 1 2 0 2 0 1 1 1 0 1 2 2 1
mtr-miR171g CGAGCCGAAUCAAUAUCACUC 21 34,129 1,551 3,338 471    471 576 1,129 768 1,184 1,207 1,094 1,574 939 972 1,100 1,246 3,223 1,879 1,852 2,481 3,338 1,989 1,656 1,698 2,036 1,717
mtr-miR171h CGAGCCGAAUCAAUAUCACUC 21 34,129 1,551 3,338 471    471 576 1,129 768 1,184 1,207 1,094 1,574 939 972 1,100 1,246 3,223 1,879 1,852 2,481 3,338 1,989 1,656 1,698 2,036 1,717
mtr-miR172a AGAAUCCUGAUGAUGCUGCAG 21 2,752 125 635 1    8 635 11 289 21 83 4 186 19 1 12 202 321 19 108 64 266 187 143 37 57 79
mtr-miR172b AGAAUCUUGAUGAUGCUGCAU 21 179 8 24 1    3 24 1 12 4 11 3 20 6 1 3 8 11 3 16 11 10 8 13 2 6 3
mtr-miR172c-3p AGAAUCUUGAUGAUGCUGCAU 21 179 8 24 1    3 24 1 12 4 11 3 20 6 1 3 8 11 3 16 11 10 8 13 2 6 3
mtr-miR172c-5p GUAGCAUCAUCAAGAUUCACA 21 37 3 8 1    0 4 0 8 0 5 0 8 1 0 0 4 1 0 0 2 1 2 0 0 0 1
mtr-miR172d-3p AGAAUCUUGAUGAUGCUGCA 20 22 2 5 1    0 1 0 0 1 2 0 0 0 0 1 0 5 0 1 2 2 0 1 4 0 2
mtr-miR172d-5p AGUGGAGCAUCAUCAAGAUUCACA 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2086-3p GACAUGAAUGCAGAACUGGAA 21 6,078 276 486 87    143 399 160 441 91 486 118 439 152 342 106 304 344 87 413 318 293 312 368 248 313 201
mtr-miR2086-5p CCAGUUCUGCGUUCAUGUCCC 21 1,185 54 92 22    35 79 52 74 22 92 34 70 42 58 36 68 49 27 57 77 46 67 49 53 31 67
mtr-miR2087-3p CUGCAGUCGGUUUCUUACUUC 21 12 1 2 1    0 0 1 0 1 0 1 0 0 1 0 0 0 0 0 0 2 0 1 2 2 1
mtr-miR2087-5p GAAGUAAAGAACCGGCUGCAG 21 21 2 4 1    0 1 1 0 1 2 1 1 4 1 0 1 0 0 0 0 0 3 2 0 2 1
mtr-miR2088-3p UCCAAUGUAAUCUAGGUCUA 20 137 6 24 1    1 3 5 4 6 7 2 6 9 6 1 7 6 24 4 7 9 5 3 8 10 4
mtr-miR2088-5p AGGCCUAGAUUACAUUGGAC 20 89 5 14 1    0 6 1 6 0 1 0 9 0 6 1 8 3 14 4 9 2 3 3 12 1 0
mtr-miR2089-3p AGGAUUGGUGUAAUAGGUAAAA 22 524 24 78 2    32 54 14 36 2 2 6 27 78 27 7 37 20 3 28 24 16 23 31 20 25 12
mtr-miR2089-5p UUACCUAUUCCACCAAUUCCAU 22 39,904 1,814 23,049 14    108 126 175 76 212 134 196 109 14,514 23,049 154 70 151 87 133 158 72 32 24 14 161 149
mtr-miR2111a-3p AGCCUUGGAAUGCAGAUUAUC 21 3 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 1 1
mtr-miR2111a-5p UAAUCUGCAUCCUGAGGUUUA 21 5 1 1 1    0 0 1 0 1 0 0 0 1 1 0 0 0 0 1 0 0 0 0 0 0 0
mtr-miR2111b UAAUCUGCAUCCUGAGGUUUA 21 5 1 1 1    0 0 1 0 1 0 0 0 1 1 0 0 0 0 1 0 0 0 0 0 0 0
mtr-miR2111c UAAUCUGCAUCCUGAGGUUUA 21 5 1 1 1    0 0 1 0 1 0 0 0 1 1 0 0 0 0 1 0 0 0 0 0 0 0
mtr-miR2111d-3p AUCCUUAGAAUGCAGAUUAUC 21 2 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0
mtr-miR2111d-5p UAAUCUGCAUCCUGAGGUUUA 21 5 1 1 1    0 0 1 0 1 0 0 0 1 1 0 0 0 0 1 0 0 0 0 0 0 0
mtr-miR2111e-3p AGCCUUGGGAUGCUGAUUAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2111e-5p UAAUCUGCAUCCUGAGGUUUA 21 5 1 1 1    0 0 1 0 1 0 0 0 1 1 0 0 0 0 1 0 0 0 0 0 0 0
mtr-miR2111f UAAUCUGCAUCCUGAGGUUUA 21 5 1 1 1    0 0 1 0 1 0 0 0 1 1 0 0 0 0 1 0 0 0 0 0 0 0
mtr-miR2111g-3p AGCCUCGGAGUGCGGAUUAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2111g-5p UAAUCUGCAUCCUGAGGUUUA 21 5 1 1 1    0 0 1 0 1 0 0 0 1 1 0 0 0 0 1 0 0 0 0 0 0 0
mtr-miR2111h UAAUCUGCAUCCUGAGGUUUA 21 5 1 1 1    0 0 1 0 1 0 0 0 1 1 0 0 0 0 1 0 0 0 0 0 0 0
mtr-miR2111i UAAUCUGCAUCCUGAGGUUUA 21 5 1 1 1    0 0 1 0 1 0 0 0 1 1 0 0 0 0 1 0 0 0 0 0 0 0
mtr-miR2111j UAAUCUGCAUCCUGAGGUUUA 21 5 1 1 1    0 0 1 0 1 0 0 0 1 1 0 0 0 0 1 0 0 0 0 0 0 0
mtr-miR2111k UAAUCUGCAUCCUGAGGUUUA 21 5 1 1 1    0 0 1 0 1 0 0 0 1 1 0 0 0 0 1 0 0 0 0 0 0 0
mtr-miR2111l AUCCUUGGAAUGCAGAUUAUC 21 9 2 5 1    1 0 1 0 1 0 0 0 0 5 0 0 0 0 0 1 0 0 0 0 0 0
mtr-miR2111m-3p GUCCUCGGGAUACAGAUUACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2111m-5p UAAUCUGCAUCCUGAGGUUUA 21 5 1 1 1    0 0 1 0 1 0 0 0 1 1 0 0 0 0 1 0 0 0 0 0 0 0
mtr-miR2111n UAAUCUGCAUCCUGAGGUUUA 21 5 1 1 1    0 0 1 0 1 0 0 0 1 1 0 0 0 0 1 0 0 0 0 0 0 0
mtr-miR2111o UAAUCUGCAUCCUGAGGUUUA 21 5 1 1 1    0 0 1 0 1 0 0 0 1 1 0 0 0 0 1 0 0 0 0 0 0 0
mtr-miR2118 UUACCGAUUCCACCCAUUCCUA 22 92,392 4,200 47,217 193    956 1,620 1,473 1,057 47,217 24,996 1,632 1,334 1,553 1,420 1,165 1,021 811 572 1,274 709 548 433 310 193 1,103 995
mtr-miR2119 UCAAAGGGAGGUGUGGAGUAG 21 51 3 8 1    2 1 3 2 2 1 1 4 0 0 1 3 3 3 8 1 3 1 3 4 2 3
mtr-miR2199 UGAUACACUAGCACGGAUCAC 21 2,932 133 257 43    100 257 183 175 251 210 244 193 220 75 98 105 53 60 228 110 43 61 61 78 74 53
mtr-miR2585a CAGGAUUAGCGAUUACAGGGAC 22 4 1 2 1    0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 0 0 2 0 0
mtr-miR2585b CAGGAUUAGCGAUUACAGGGAC 22 4 1 2 1    0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 0 0 2 0 0
mtr-miR2585c CAGGAUUAGCGAUUACAGGGAC 22 4 1 2 1    0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 0 0 2 0 0
mtr-miR2585d CAGGAUUAGCGAUUACAGGGAC 22 4 1 2 1    0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 0 0 2 0 0
mtr-miR2586a CGAGGAGUGUCCGUGCUUCAU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2586b CGGUGUCGUAUCGGUGUUGGAC 22 2 1 1 1    0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0
mtr-miR2587a UUGACCGUUCAUAUGAACCCUG 22 17 1 2 1    0 1 1 0 1 1 0 2 1 1 1 1 1 0 1 1 1 0 1 0 2 0
mtr-miR2587b UUGACCGUUCAUAUGAACCCUG 22 17 1 2 1    0 1 1 0 1 1 0 2 1 1 1 1 1 0 1 1 1 0 1 0 2 0
mtr-miR2587c UUGACCGUUCAUAUGAACCCUG 22 17 1 2 1    0 1 1 0 1 1 0 2 1 1 1 1 1 0 1 1 1 0 1 0 2 0
mtr-miR2587d UUGACCGUUCAUAUGAACCCUG 22 17 1 2 1    0 1 1 0 1 1 0 2 1 1 1 1 1 0 1 1 1 0 1 0 2 0
mtr-miR2587e UUGACCGUUCAUAUGAACCCUG 22 17 1 2 1    0 1 1 0 1 1 0 2 1 1 1 1 1 0 1 1 1 0 1 0 2 0
mtr-miR2587f UUGACCGUUCAUAUGAACCCUG 22 17 1 2 1    0 1 1 0 1 1 0 2 1 1 1 1 1 0 1 1 1 0 1 0 2 0
mtr-miR2587g UUGACCGUUCAUAUGAACCCUG 22 17 1 2 1    0 1 1 0 1 1 0 2 1 1 1 1 1 0 1 1 1 0 1 0 2 0
mtr-miR2588a UAACACUGUGCAACUAAGUCC 21 13 2 3 1    0 0 0 0 0 0 3 1 1 0 0 0 0 3 2 0 0 0 0 2 1 0
mtr-miR2588b UAACACUGUGCAACUAAGUCC 21 13 2 3 1    0 0 0 0 0 0 3 1 1 0 0 0 0 3 2 0 0 0 0 2 1 0
mtr-miR2589 GGCAUCCACGUGUGCUUCACCG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2590a AUCUAAAGGUGAUUAUUGUGCC 22 14 1 3 1    0 0 1 0 3 0 0 0 1 1 1 0 0 0 0 0 1 2 1 0 1 2
mtr-miR2590b AUCUAAAGGUGAUUAUUGUGCC 22 14 1 3 1    0 0 1 0 3 0 0 0 1 1 1 0 0 0 0 0 1 2 1 0 1 2
mtr-miR2590c AUCUAAAGGUGAUUAUUGUGCC 22 14 1 3 1    0 0 1 0 3 0 0 0 1 1 1 0 0 0 0 0 1 2 1 0 1 2
mtr-miR2590d AUCUAAAGGUGAUUAUUGUGCC 22 14 1 3 1    0 0 1 0 3 0 0 0 1 1 1 0 0 0 0 0 1 2 1 0 1 2
mtr-miR2590e AUCUAAAGGUGAUUAUUGUGCC 22 14 1 3 1    0 0 1 0 3 0 0 0 1 1 1 0 0 0 0 0 1 2 1 0 1 2
mtr-miR2590f AUCUAAAGGUGAUUAUUGUGCC 22 14 1 3 1    0 0 1 0 3 0 0 0 1 1 1 0 0 0 0 0 1 2 1 0 1 2
mtr-miR2590g AAAUGAGACUGAAAUCUAAAGGUG 24 305 14 28 3    9 17 10 14 27 17 12 25 13 13 7 11 11 3 13 7 25 13 15 4 28 11
mtr-miR2590h AGAAUGACAUGGCAGAAUAAUCAC 24 326 15 26 7    7 14 10 14 7 24 10 19 8 14 10 18 17 11 21 21 19 26 19 14 7 16
mtr-miR2590i AGAAUGACAUGGCAGAAUAAUCAC 24 326 15 26 7    7 14 10 14 7 24 10 19 8 14 10 18 17 11 21 21 19 26 19 14 7 16
mtr-miR2590j AGAAUGACAUGGCAGAAUAAUCAC 24 326 15 26 7    7 14 10 14 7 24 10 19 8 14 10 18 17 11 21 21 19 26 19 14 7 16
mtr-miR2591 GGAACUUCUACGGUACACCUGC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2592a-3p GAAAAACAUGAAUGUCGAGCG 21 4,442 202 384 108    154 235 218 281 108 232 145 200 197 209 117 228 190 157 384 184 229 122 196 147 283 226
mtr-miR2592a-5p CCCGGCAUUCAUGUUUUCCU 20 1 1 1 1    0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2592a.2-3p AAAUGCUUGAGUCCUGUUGUU 21 783 36 51 12    25 51 29 36 41 49 33 35 33 12 37 35 34 35 50 37 43 17 38 25 43 45
mtr-miR2592ab CAACAGGACUCAAGCAUUUCGC 22 1,003 46 74 24    26 59 37 24 39 53 43 52 26 25 54 45 58 38 57 35 74 35 42 51 73 57
mtr-miR2592ac CAACAGGACUCAAGCAUUUCGC 22 1,003 46 74 24    26 59 37 24 39 53 43 52 26 25 54 45 58 38 57 35 74 35 42 51 73 57
mtr-miR2592ad CAACAGGACUCAAGCAUUUCGC 22 1,003 46 74 24    26 59 37 24 39 53 43 52 26 25 54 45 58 38 57 35 74 35 42 51 73 57
mtr-miR2592ae CAACAGGACUCAAGCAUUUCG 21 425 19 34 9    12 20 26 14 19 13 25 19 21 19 15 16 25 27 28 10 15 9 18 18 34 22
mtr-miR2592af CAACAGGACUCAAGCAUUUCGC 22 1,003 46 74 24    26 59 37 24 39 53 43 52 26 25 54 45 58 38 57 35 74 35 42 51 73 57
mtr-miR2592ah CAACAGGACUCAAGCAUUUCGC 22 1,003 46 74 24    26 59 37 24 39 53 43 52 26 25 54 45 58 38 57 35 74 35 42 51 73 57
mtr-miR2592ai CAACAGGACUCAAGCAUUUCGC 22 1,003 46 74 24    26 59 37 24 39 53 43 52 26 25 54 45 58 38 57 35 74 35 42 51 73 57
mtr-miR2592aj CAACAGGACUCAAGCAUUUCGC 22 1,003 46 74 24    26 59 37 24 39 53 43 52 26 25 54 45 58 38 57 35 74 35 42 51 73 57
mtr-miR2592al CAACAGGACUCAAGCAUUUCGC 22 1,003 46 74 24    26 59 37 24 39 53 43 52 26 25 54 45 58 38 57 35 74 35 42 51 73 57
mtr-miR2592am CAACAGGACUCAAGCAUUUCGC 22 1,003 46 74 24    26 59 37 24 39 53 43 52 26 25 54 45 58 38 57 35 74 35 42 51 73 57
mtr-miR2592an AAAUGCUUGAGUCCUGUUGUU 21 783 36 51 12    25 51 29 36 41 49 33 35 33 12 37 35 34 35 50 37 43 17 38 25 43 45
mtr-miR2592ao AAAUGCUUGAGUCCUGUUGUU 21 783 36 51 12    25 51 29 36 41 49 33 35 33 12 37 35 34 35 50 37 43 17 38 25 43 45
mtr-miR2592ap AGGCUGGUUUAGAUGAAGGUA 21 155 8 16 1    2 9 0 16 1 11 0 6 7 3 2 14 6 3 15 5 8 7 10 14 10 6
mtr-miR2592aq AGGCUGGUUUAGAUGAAGGUA 21 155 8 16 1    2 9 0 16 1 11 0 6 7 3 2 14 6 3 15 5 8 7 10 14 10 6
mtr-miR2592ar AGGCUGGUUUAGAUGAAGGUA 21 155 8 16 1    2 9 0 16 1 11 0 6 7 3 2 14 6 3 15 5 8 7 10 14 10 6
mtr-miR2592as AGGCUGGUUUAGAUGAAGGUA 21 155 8 16 1    2 9 0 16 1 11 0 6 7 3 2 14 6 3 15 5 8 7 10 14 10 6
mtr-miR2592at AGGCUGGUUUAGAUGAAGGUA 21 155 8 16 1    2 9 0 16 1 11 0 6 7 3 2 14 6 3 15 5 8 7 10 14 10 6
mtr-miR2592au AGGCUGGUUUAGAUGAAGGUA 21 155 8 16 1    2 9 0 16 1 11 0 6 7 3 2 14 6 3 15 5 8 7 10 14 10 6
mtr-miR2592av AGGCUGGUUUAGAUGAAGGUA 21 155 8 16 1    2 9 0 16 1 11 0 6 7 3 2 14 6 3 15 5 8 7 10 14 10 6
mtr-miR2592aw AGGCUGGUUUAGAUGAAGGUA 21 155 8 16 1    2 9 0 16 1 11 0 6 7 3 2 14 6 3 15 5 8 7 10 14 10 6
mtr-miR2592ax AGGCUGGUUUAGAUGAAGGUA 21 155 8 16 1    2 9 0 16 1 11 0 6 7 3 2 14 6 3 15 5 8 7 10 14 10 6
mtr-miR2592ay AGGCUGGUUUAGAUGAAGGUA 21 155 8 16 1    2 9 0 16 1 11 0 6 7 3 2 14 6 3 15 5 8 7 10 14 10 6
mtr-miR2592az AGGCUGGUUUAGAUGAAGGUA 21 155 8 16 1    2 9 0 16 1 11 0 6 7 3 2 14 6 3 15 5 8 7 10 14 10 6
mtr-miR2592b-3p AAAUGCUUGAGUCCUGUUGUU 21 783 36 51 12    25 51 29 36 41 49 33 35 33 12 37 35 34 35 50 37 43 17 38 25 43 45
mtr-miR2592b-5p ACAACAGGACUCAAGCAUUUC 21 107 5 8 2    4 5 3 0 5 0 5 2 5 7 7 8 7 8 7 3 7 3 6 6 4 5
mtr-miR2592ba AGGCUGGUUUAGAUGAAGGUA 21 155 8 16 1    2 9 0 16 1 11 0 6 7 3 2 14 6 3 15 5 8 7 10 14 10 6
mtr-miR2592bb AGGCUGGUUUAGAUGAAGGUA 21 155 8 16 1    2 9 0 16 1 11 0 6 7 3 2 14 6 3 15 5 8 7 10 14 10 6
mtr-miR2592bc AGGCUGGUUUAGAUGAAGGUA 21 155 8 16 1    2 9 0 16 1 11 0 6 7 3 2 14 6 3 15 5 8 7 10 14 10 6
mtr-miR2592bd AGGCUGGUUUAGAUGAAGGUA 21 155 8 16 1    2 9 0 16 1 11 0 6 7 3 2 14 6 3 15 5 8 7 10 14 10 6
mtr-miR2592be AGGCUGGUUUAGAUGAAGGUA 21 155 8 16 1    2 9 0 16 1 11 0 6 7 3 2 14 6 3 15 5 8 7 10 14 10 6
mtr-miR2592bf AGGCUGGUUUAGAUGAAGGUA 21 155 8 16 1    2 9 0 16 1 11 0 6 7 3 2 14 6 3 15 5 8 7 10 14 10 6
mtr-miR2592bg AGGCUGGUUUAGAUGAAGGUA 21 155 8 16 1    2 9 0 16 1 11 0 6 7 3 2 14 6 3 15 5 8 7 10 14 10 6
mtr-miR2592bi UGGAACAUUGGGAAUGCCGGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2592bj UGGAACAUUGGGAAUGCCGGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2592bk UGGAACAUUGGGAAUGCCGGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2592bl-3p GAGUAAUUCAAACUUGUUAAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2592bl-5p UGGCAAGUUUGAAUUUACCUCA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2592bm-3p GGAAAACAUGAAUGUCGGGUG 21 7 1 1 1    1 0 1 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 1 0 1 1
mtr-miR2592bm-5p CUCGGCAUUCAUGUUUUUCCUU 22 126 6 10 2    3 7 9 2 8 7 9 8 4 2 4 7 6 3 7 3 10 4 10 2 5 6
mtr-miR2592bn-3p GGAAAACAUGAAUGUCGGGUG 21 7 1 1 1    1 0 1 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 1 0 1 1
mtr-miR2592bn-5p CUCGGCAUUCAUGUUUUUCCUU 22 126 6 10 2    3 7 9 2 8 7 9 8 4 2 4 7 6 3 7 3 10 4 10 2 5 6
mtr-miR2592bo-3p AAAUGCUUGAGUCCUGUUGUU 21 783 36 51 12    25 51 29 36 41 49 33 35 33 12 37 35 34 35 50 37 43 17 38 25 43 45
mtr-miR2592bo-5p CGGCCAGGACUCAAGCAUUUCG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2592bp-3p CGGCAGAACUCCAGCAUUCGA 21 2 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 1 0
mtr-miR2592bp-5p AAAUGCUUGAGUCCUGUUGUU 21 783 36 51 12    25 51 29 36 41 49 33 35 33 12 37 35 34 35 50 37 43 17 38 25 43 45
mtr-miR2592bq-3p AAAUGCUUGAGUCAUGUUGUU 21 421 19 82 1    10 21 25 22 33 38 38 17 22 11 82 4 2 5 1 6 15 3 17 8 20 21
mtr-miR2592bq-5p CGACCAUGACUCAAGUAUUAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2592br-3p AAAUGCUUGAGUCCUGUUGUU 21 783 36 51 12    25 51 29 36 41 49 33 35 33 12 37 35 34 35 50 37 43 17 38 25 43 45
mtr-miR2592br-5p GACUAGGACUCAAGUAUUUCG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2592c AAAUGCUUGAGUCCUGUUGUU 21 783 36 51 12    25 51 29 36 41 49 33 35 33 12 37 35 34 35 50 37 43 17 38 25 43 45
mtr-miR2592d-3p AAAUGCUUGAGUCCUGUUGUU 21 783 36 51 12    25 51 29 36 41 49 33 35 33 12 37 35 34 35 50 37 43 17 38 25 43 45
mtr-miR2592d-5p CAACAGGACUCAAGCAUUUCGC 22 1,003 46 74 24    26 59 37 24 39 53 43 52 26 25 54 45 58 38 57 35 74 35 42 51 73 57
mtr-miR2592e-3p AAAUGCUUGAGUCCUGUUGUU 21 783 36 51 12    25 51 29 36 41 49 33 35 33 12 37 35 34 35 50 37 43 17 38 25 43 45
mtr-miR2592e-5p CAACAGGACUCAAGCAUUUCGC 22 1,003 46 74 24    26 59 37 24 39 53 43 52 26 25 54 45 58 38 57 35 74 35 42 51 73 57
mtr-miR2592f AAAUGCUUGAGUCCUGUUGUU 21 783 36 51 12    25 51 29 36 41 49 33 35 33 12 37 35 34 35 50 37 43 17 38 25 43 45
mtr-miR2592g AAAUGCUUGAGUCCUGUUGUU 21 783 36 51 12    25 51 29 36 41 49 33 35 33 12 37 35 34 35 50 37 43 17 38 25 43 45
mtr-miR2592h AAAUGCUUGAGUCCUGUUGUU 21 783 36 51 12    25 51 29 36 41 49 33 35 33 12 37 35 34 35 50 37 43 17 38 25 43 45
mtr-miR2592i AAAUGCUUGAGUCCUGUUGUU 21 783 36 51 12    25 51 29 36 41 49 33 35 33 12 37 35 34 35 50 37 43 17 38 25 43 45
mtr-miR2592j AAAUGCUUGAGUCCUGUUGUU 21 783 36 51 12    25 51 29 36 41 49 33 35 33 12 37 35 34 35 50 37 43 17 38 25 43 45
mtr-miR2592k AAAUGCUUGAGUCCUGUUGUU 21 783 36 51 12    25 51 29 36 41 49 33 35 33 12 37 35 34 35 50 37 43 17 38 25 43 45
mtr-miR2592l AAAUGCUUGAGUCCUGUUGUU 21 783 36 51 12    25 51 29 36 41 49 33 35 33 12 37 35 34 35 50 37 43 17 38 25 43 45
mtr-miR2592m AAAUGCUUGAGUCCUGUUGUU 21 783 36 51 12    25 51 29 36 41 49 33 35 33 12 37 35 34 35 50 37 43 17 38 25 43 45
mtr-miR2592n AAAUGCUUGAGUCCUGUUGUU 21 783 36 51 12    25 51 29 36 41 49 33 35 33 12 37 35 34 35 50 37 43 17 38 25 43 45
mtr-miR2592o-3p AAAUGCUUGAGUCCUGUUGUU 21 783 36 51 12    25 51 29 36 41 49 33 35 33 12 37 35 34 35 50 37 43 17 38 25 43 45
mtr-miR2592o-5p CAACAGGACUCAAGCAUUUCGC 22 1,003 46 74 24    26 59 37 24 39 53 43 52 26 25 54 45 58 38 57 35 74 35 42 51 73 57
mtr-miR2592p AAAUGCUUGAGUCCUGUUGUU 21 783 36 51 12    25 51 29 36 41 49 33 35 33 12 37 35 34 35 50 37 43 17 38 25 43 45
mtr-miR2592q-3p AAAUGCUUGAGUCCUGUUGUU 21 783 36 51 12    25 51 29 36 41 49 33 35 33 12 37 35 34 35 50 37 43 17 38 25 43 45
mtr-miR2592q-5p CAACAGGACUCAAGCAUUUCGC 22 1,003 46 74 24    26 59 37 24 39 53 43 52 26 25 54 45 58 38 57 35 74 35 42 51 73 57
mtr-miR2592r AAAUGCUUGAGUCCUGUUGUU 21 783 36 51 12    25 51 29 36 41 49 33 35 33 12 37 35 34 35 50 37 43 17 38 25 43 45
mtr-miR2592s-3p AAAUGCUUGAGUCAUGUUGUU 21 421 19 82 1    10 21 25 22 33 38 38 17 22 11 82 4 2 5 1 6 15 3 17 8 20 21
mtr-miR2592s-5p ACAACAGGACUCAAGCAUUUC 21 107 5 8 2    4 5 3 0 5 0 5 2 5 7 7 8 7 8 7 3 7 3 6 6 4 5
mtr-miR2592t CAACAGGACUCAAGCAUUUCGC 22 1,003 46 74 24    26 59 37 24 39 53 43 52 26 25 54 45 58 38 57 35 74 35 42 51 73 57
mtr-miR2592u CAACAGGACUCAAGCAUUUCGC 22 1,003 46 74 24    26 59 37 24 39 53 43 52 26 25 54 45 58 38 57 35 74 35 42 51 73 57
mtr-miR2592v CAACAGGACUCAAGCAUUUCGC 22 1,003 46 74 24    26 59 37 24 39 53 43 52 26 25 54 45 58 38 57 35 74 35 42 51 73 57
mtr-miR2592w CAACAGGACUCAAGCAUUUCGC 22 1,003 46 74 24    26 59 37 24 39 53 43 52 26 25 54 45 58 38 57 35 74 35 42 51 73 57
mtr-miR2592x CAACAGGACUCAAGCAUUUCGC 22 1,003 46 74 24    26 59 37 24 39 53 43 52 26 25 54 45 58 38 57 35 74 35 42 51 73 57
mtr-miR2592y CAACAGGACUCAAGCAUUUCGC 22 1,003 46 74 24    26 59 37 24 39 53 43 52 26 25 54 45 58 38 57 35 74 35 42 51 73 57
mtr-miR2592z CAACAGGACUCAAGCAUUUCGC 22 1,003 46 74 24    26 59 37 24 39 53 43 52 26 25 54 45 58 38 57 35 74 35 42 51 73 57
mtr-miR2593a UUAAAUGAAUGAACCUAGAAU 21 179 9 18 2    2 9 9 14 13 18 6 10 8 5 2 10 11 3 16 3 7 6 10 0 10 7
mtr-miR2593b UUAAAUGAAUGAACCUAGAAU 21 179 9 18 2    2 9 9 14 13 18 6 10 8 5 2 10 11 3 16 3 7 6 10 0 10 7
mtr-miR2593c UUAAAUGAAUGAACCUAGAAU 21 179 9 18 2    2 9 9 14 13 18 6 10 8 5 2 10 11 3 16 3 7 6 10 0 10 7
mtr-miR2593d AUACAUCAUUGAUUGAAUGAACCU 24 200 9 17 1    4 8 9 12 7 10 6 14 1 7 7 7 10 5 17 11 9 15 8 12 15 6
mtr-miR2593e AUACAUCAUUGAUUGAAUGAACCU 24 200 9 17 1    4 8 9 12 7 10 6 14 1 7 7 7 10 5 17 11 9 15 8 12 15 6
mtr-miR2594 CCAUGGCCAAGGAUGCCAGAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2595 UACAUUUUCUUCUUUAUGUCU 21 68 3 8 1    1 3 2 2 3 5 4 2 2 6 4 1 3 5 5 4 3 8 2 0 0 3
mtr-miR2596 UCUAUUUCAUUGUUCCACACA 21 87 4 9 2    9 8 4 0 3 6 8 3 7 4 2 3 2 3 4 3 2 7 2 4 0 3
mtr-miR2597 UUUGGUACUUCGUCGAUUUGA 21 36,282 1,649 3,228 876    1,296 1,385 1,558 947 1,286 1,349 1,211 876 1,523 2,749 1,301 1,080 2,595 1,415 1,684 1,155 2,643 1,471 1,719 1,424 3,228 2,387
mtr-miR2598 CUAAGGGUGAUUAUUCUGCCA 21 4 2 3 1    0 0 0 0 0 0 0 1 0 0 0 0 0 3 0 0 0 0 0 0 0 0
mtr-miR2599 UGGGUACAAGGAAUCUACUUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2600a ACAUUAGCCAAUCACAAUGCC 21 11 2 3 1    0 0 3 0 1 0 0 0 0 1 1 0 1 0 0 0 0 0 0 0 2 2
mtr-miR2600b AAGCAUUGUGGCAUUGUGAUUGGU 24 246 11 32 2    6 12 15 16 10 18 4 16 12 32 9 12 13 5 10 10 10 9 7 8 10 2
mtr-miR2600c AAGCAUUGUGGCAUUGUGAUUGGU 24 246 11 32 2    6 12 15 16 10 18 4 16 12 32 9 12 13 5 10 10 10 9 7 8 10 2
mtr-miR2600d AAGCAUUGUGGCAUUGUGAUUGGU 24 246 11 32 2    6 12 15 16 10 18 4 16 12 32 9 12 13 5 10 10 10 9 7 8 10 2
mtr-miR2600e AAGCAUUGUGGCAUUGUGAUUGGC 24 612 28 47 14    21 46 31 24 34 29 27 35 21 47 24 20 28 14 33 23 40 25 31 20 25 14
mtr-miR2601 UAUUUGGUAUCGCUUUGGUCCC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2602a UGGCAGUGAUUGCCACGUCAU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2602b UGGCAGUGAUUGCCACGUCAU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2603 UUUGGUAUUGGUCCCUGCACUU 22 1 1 1 1    0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2604 UAAUUUUUAUGUGGGAGUGUU 21 2 1 1 1    0 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2605 ACUUAGUUUAUAUGACCUAC 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2606a UACAAUUCCUUAGGUGCUUUU 21 1 1 1 1    0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2606b UACAAUUCCUUAGGUGCUUUU 21 1 1 1 1    0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2606c AGUUAAGAACCAUACAAAAAACAC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2607 AUGUGAUUAUGUGAUAAGUGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2608 GUUGUACAUAUAUCACUACUCU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2609a UGGAAGUAAUAGGUUCUCACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2609b UGGAAGUAAUAGGUUCUCACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2610a AGAUUGAGACUUGUAUGGCUU 21 56 3 6 1    2 1 5 2 1 6 3 2 2 1 1 5 5 3 2 2 3 2 4 2 2 0
mtr-miR2610b AGAUUGAGACUUGUAUGGCUU 21 56 3 6 1    2 1 5 2 1 6 3 2 2 1 1 5 5 3 2 2 3 2 4 2 2 0
mtr-miR2611 UAUUUGUCAGUGUUUGAUGAA 21 4 1 2 1    0 1 0 0 0 2 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2612 UGAUAGUGUCAACUAGUACAG 21 174 8 23 2    4 13 7 4 6 11 6 17 4 7 2 12 2 8 10 23 7 6 13 4 6 2
mtr-miR2613 CGGUCGCCGGUGGUCAAUGGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2614 CGGUUCGACUCGUUAGGUUC 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2615a CCUGAUCGCAUUUUAAAAGGC 21 6 2 3 1    0 0 0 0 0 0 0 0 0 0 0 0 1 3 0 0 0 0 1 0 0 1
mtr-miR2615b CCUGAUCGCAUUUUAAAAGGC 21 6 2 3 1    0 0 0 0 0 0 0 0 0 0 0 0 1 3 0 0 0 0 1 0 0 1
mtr-miR2615c CCUGAUCGCAUUUUAAAAGGC 21 6 2 3 1    0 0 0 0 0 0 0 0 0 0 0 0 1 3 0 0 0 0 1 0 0 1
mtr-miR2616 AUUGGGUUUGGUUCGGGCGGAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2617a UGUAGUGUAGCAUGCCCGUU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2617b UGUAGUGUAGCAUGCCCGUU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2617c UGUAGUGUAGCAUGCCCGUU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2618a GUGAAUUCAGUUUACGUACGUU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2618b GUGAAUUCAGUUUACGUACGUU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2619a ACAUAGGAGGCUGUUUUGUAU 21 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1
mtr-miR2619b-3p CCAAAGAAUCAAUACAUAGGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2619b-5p AUAUGUUUUGAUUCUUUGGCA 21 68 3 8 1    2 8 1 0 3 6 4 2 4 4 3 1 8 3 3 1 3 2 3 0 4 3
mtr-miR2620 UUCUGAUAGACACCGGCUCUGC 22 1,203 55 81 24    51 46 81 62 56 40 66 46 60 49 54 65 51 24 59 67 75 51 52 29 54 65
mtr-miR2621 AGCUUGGGCUAGGAAUUUGUGC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2622 UUUGUGUGCCAUCGUGAACUUA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2623 UCGGCUGUACUGUCCUUCAUG 21 133 6 12 1    1 9 5 4 4 10 5 11 7 12 3 10 5 5 7 4 6 7 5 6 6 1
mtr-miR2624 CGAAAGACGAGGUUGCCGGCU 21 1 1 1 1    0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2625 CCAUCGUGCCACGUUACGAUCC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2626 AACGUCGGGAUUUAGGGUGUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2627 UUUCGGUAGUUAACUGCUGAGG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2628 CAUGAAAGAAUGAUGAGUAA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2629a AGUUUUCCUCGGUAGUUAACU 21 9 2 4 1    0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 1 0 1 0 4 1 0
mtr-miR2629b AGUUUUCCUCGGUAGUUAACU 21 9 2 4 1    0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 1 0 1 0 4 1 0
mtr-miR2629c AGUUUUCCUCGGUAGUUAACU 21 9 2 4 1    0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 1 0 1 0 4 1 0
mtr-miR2629d AGUUUUCCUCGGUAGUUAACU 21 9 2 4 1    0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 1 0 1 0 4 1 0
mtr-miR2629e AGUUUUCCUCGGUAGUUAACU 21 9 2 4 1    0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 1 0 1 0 4 1 0
mtr-miR2629f AGUUUUCCUCGGUAGUUAACU 21 9 2 4 1    0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 1 0 1 0 4 1 0
mtr-miR2629g AGUUUUCCUCGGUAGUUAACU 21 9 2 4 1    0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 1 0 1 0 4 1 0
mtr-miR2629h GCAGAAGAUCCUCGGCAGUUAACU 24 77 4 10 1    1 6 2 10 9 2 2 3 7 4 0 5 4 0 1 3 5 3 3 0 2 5
mtr-miR2630a UGGUUUUGGUCCUUGGUAUUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2630b UGGUUUUGGUCCUUGGUAUUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2630c UGGUUUUGGUCCUUGGUAUUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2630d UGGUUUUGGUCCUUGGUAUUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2630e UGGUUUUGGUCCUUGGUAUUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2630f UGGUUUUGGUCCUUGGUAUUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2630g UGGUUUUGGUCCUUGGUAUUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2630h UGGUUUUGGUCCUUGGUAUUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2630i UGGUUUUGGUCCUUGGUAUUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2630j UGGUUUUGGUCCUUGGUAUUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2630k UGGUUUUGGUCCUUGGUAUUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2630l UGGUUUUGGUCCUUGGUAUUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2630m UGGUUUUGGUCCUUGGUAUUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2630n UGGUUUUGGUCCUUGGUAUUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2630o UGGUUUUGGUCCUUGGUAUUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2630p UGGUUUUGGUCCUUGGUAUUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2630q UGGUUUUGGUCCUUGGUAUUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2630r UGGUUUUGGUCCUUGGUAUUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2630s UGGUUUUGGUCCUUGGUAUUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2630t UGGUUUUGGUCCUUGGUAUUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2630u UGGUUUUGGUCCUUGGUAUUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2630v UGGUUUUGGUCCUUGGUAUUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2630w UGGUUUUGGUCCUUGGUAUUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2630x UGGUUUUGGUCCUUGGUAUUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2630y UGGUUUUGGUCCUUGGUAUUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2631 UGACACGCCACGUGGCACACU 21 9 2 3 2    0 0 3 0 2 0 0 0 2 0 2 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2632a CCUGAAGUUACUAAUCCUUCCA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2632b CCUGAAGUUACUAAUCCUUCCA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2632c CCUGAAGUUACUAAUCCUUCCA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2633 UGACAUUUUGCUCCAGAUUCA 21 44 3 6 1    2 1 2 0 6 2 2 1 6 2 3 0 3 0 4 3 1 3 2 0 0 1
mtr-miR2634 UUUAUUCUCAGUUUGUUGCUC 21 2,882 131 247 56    56 127 108 130 117 154 114 159 149 181 73 149 134 79 247 117 147 94 159 137 150 101
mtr-miR2635 AUUAUUGUCAACGUGACUAG 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2636 UUUGGUUAGUGUGCUGAAUAU 21 38 2 7 1    1 3 2 2 1 0 1 2 4 7 1 0 1 0 3 1 2 0 1 2 2 2
mtr-miR2637 AAAUACUUCCUCUGAUCACUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2638a AUGAUUAAUAUUUGCAGUGGC 21 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0
mtr-miR2638b AUGAUUAAUAUUUGCAGUGGC 21 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0
mtr-miR2639 UAGUCGGCUUACGUCACCUUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2640 UUCCUUGCCGGAGCUGGACUAC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2641 GUUUGAUCCUUUACGUUUAU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2642 AUGAGUUUCAUCAAAUCAUGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2643a UUUGGGAUCAGAAAUUAGAGA 21 2,267 103 154 43    59 114 104 128 107 111 113 126 140 53 123 135 125 43 105 76 116 54 109 45 154 127
mtr-miR2643b-3p UUUGGGAUCAGAAAUUAGAGA 21 2,267 103 154 43    59 114 104 128 107 111 113 126 140 53 123 135 125 43 105 76 116 54 109 45 154 127
mtr-miR2643b-5p UCUAAUCUCUGUUCCCAAUUA 21 173 8 19 1    5 14 1 12 4 19 6 7 6 7 6 10 10 11 6 7 13 4 8 2 9 6
mtr-miR2644 CACUUCAGAUUGAUGGUGUGU 21 2 1 1 1    0 0 0 0 0 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0
mtr-miR2645 UUUCUAGAGAUGAGCAUAUAU 21 3 1 1 1    0 0 0 0 0 0 0 0 0 1 0 0 0 0 1 0 1 0 0 0 0 0
mtr-miR2646a CAUGACAUUUAGUGAUGAUGU 21 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0
mtr-miR2646b CAUGACAUUUAGUGAUGAUGU 21 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0
mtr-miR2647a AUUCACGGGGACGAACCUCCU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2647b AUUCACGGGGACGAACCUCCU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2647c AUUCACGGGGACGAACCUCCU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2648 UAGCCAAUGGGAAUAACAGAU 21 94 4 10 1    2 6 4 6 6 4 3 3 4 1 8 1 4 5 1 3 4 5 3 6 5 10
mtr-miR2649 AAAGGUGCCAAUUAUGAGUGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2650 AACUUAAAUAUGUUUUCAGUCC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2651 UUUGAUUGGUAUGCCUGCAUU 21 1,119 51 95 19    33 42 74 42 87 45 95 72 72 40 40 57 50 19 64 19 50 20 60 21 65 52
mtr-miR2652a UAUGCAGGGUGCAUAAGGAUU 21 2 1 1 1    0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2652b UAUGCAGGGUGCAUAAGGAUU 21 2 1 1 1    0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2652c UAUGCAGGGUGCAUAAGGAUU 21 2 1 1 1    0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2652d UAUGCAGGGUGCAUAAGGAUU 21 2 1 1 1    0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2652e UAUGCAGGGUGCAUAAGGAUU 21 2 1 1 1    0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2652f UAUGCAGGGUGCAUAAGGAUU 21 2 1 1 1    0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2652g UAUGCAGGGUGCAUAAGGAUU 21 2 1 1 1    0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2652h UAUGCAGGGUGCAUAAGGAUU 21 2 1 1 1    0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2652i UAUGCAGGGUGCAUAAGGAUU 21 2 1 1 1    0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2652j UAUGCAGGGUGCAUAAGGAUU 21 2 1 1 1    0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2652k UAUGCAGGGUGCAUAAGGAUU 21 2 1 1 1    0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2652l UAUGCAGGGUGCAUAAGGAUU 21 2 1 1 1    0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2652m UAUGCAGGGUGCAUAAGGAUU 21 2 1 1 1    0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2653a UCACGCUGCUGUGAACAUGAU 21 5 1 1 1    0 1 1 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 1 0 0 0
mtr-miR2653b UCACGCUGCUGUGAACAUGAU 21 5 1 1 1    0 1 1 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 1 0 0 0
mtr-miR2653c UCACGCUGCUGUGAACAUGAU 21 5 1 1 1    0 1 1 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 1 0 0 0
mtr-miR2653d UCACGCUGCUGUGAACAUGAU 21 5 1 1 1    0 1 1 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 1 0 0 0
mtr-miR2654 AUUCAGGGACAAAGUGUGCG 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2655a CGUUUAGGUCCCUUAACUUUA 21 2 1 1 1    0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0
mtr-miR2655b CGUUUUGGUCCCUUAACUUUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2655c CGUUUAGGUCCCUUAACUUUA 21 2 1 1 1    0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0
mtr-miR2655d CGUUUAGGUCCCUUAACUUUA 21 2 1 1 1    0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0
mtr-miR2655e CGUUUAGGUCCCUUAACUUUA 21 2 1 1 1    0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0
mtr-miR2655f CGUUUAGGUCCCUUAACUUUA 21 2 1 1 1    0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0
mtr-miR2655g CGUUUAGGUCCCUUAACUUUA 21 2 1 1 1    0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0
mtr-miR2655h CGUUUAGGUCCCUUAACUUUA 21 2 1 1 1    0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0
mtr-miR2655i CGUUUAGGUCCCUUAACUUUA 21 2 1 1 1    0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0
mtr-miR2655j CGUUUAGGUCCCUUAACUUUA 21 2 1 1 1    0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0
mtr-miR2655k CGUUUAGGUCCCUUAACUUUA 21 2 1 1 1    0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0
mtr-miR2655l CGUUUAGGUCCCUUAACUUUA 21 2 1 1 1    0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0
mtr-miR2655m CGUUUAGGUCCCUUAACUUUA 21 2 1 1 1    0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0
mtr-miR2655n CGUUUAGGUCCCUUAACUUUA 21 2 1 1 1    0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0
mtr-miR2655o CGUUUAGGUCCCUUAACUUUA 21 2 1 1 1    0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0
mtr-miR2656a AAGUUGCAUAAUCGAGUUGG 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2656b AAGUUGCAUAAUCGAGUUGG 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2656c AAGUUGCAUAAUCGAGUUGG 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2656d AAGUUGCAUAAUCGAGUUGG 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2656e AAGUUGCAUAAUCGAGUUGG 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2657 UGUUAUUUCAUCGAUUUUGUUG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2658 AUGUGACCUUGUAUAUGAUC 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2659a CCAUGGGUGCGACUUGGUAAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2659b CCAUGGGUGCGACUUGGUAAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2659c CCAUGGGUGCGACUUGGUAAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2659d CCAUGGGUGCGACUUGGUAAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2659e CCAUGGGUGCGACUUGGUAAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2659f CCAUGGGUGCGACUUGGUAAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2659g CCAUGGGUGCGACUUGGUAAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2659h CCAUGGGUGCGACUUGGUAAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2659i CCAUGGGUGCGACUUGGUAAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2659j CCAUGGGUGCGACUUGGUAAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2659k CCAUGGGUGCGACUUGGUAAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2660 UAAGACAUCAGCUAUAAGCUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2661 UAGGUUUGAGAAAAUGGGCAG 21 162 8 47 1    2 1 5 0 47 6 6 2 5 7 6 5 1 11 4 5 7 24 0 2 10 6
mtr-miR2662 GAGUAAAAAUGUGAACCGAAU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2663 UUAGAGAGGGCGUUACAAUU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2664a AAUUGUGGUGGGUUGACAGUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2664b AAUUGUGGUGGGUUGACAGUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2665 UGAUUUCAGGUCAAGAAUUGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2666 CGAAAGUGAGGAUAUCAAGGA 21 459 21 52 2    17 24 48 18 32 19 52 31 37 10 24 20 18 14 10 2 20 18 6 8 17 14
mtr-miR2667a UCCUUGAUCUGACGGCUACC 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2667b UCCUUGAUCUGACGGCUACC 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2668 UUCAUCCUUGCAAUUAGGGGUC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2669a AAAGUUCAGUCUUCAUAGUAUC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2669b AAAGUUCAGUCUUCAUAGUAUC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2670a CAAGAAGGUUGCUCACUAUUU 21 11 1 4 1    0 0 0 0 1 1 0 1 4 1 0 0 0 0 1 1 0 0 0 0 0 1
mtr-miR2670b CAAGAAGGUUGCUCACUAUUU 21 11 1 4 1    0 0 0 0 1 1 0 1 4 1 0 0 0 0 1 1 0 0 0 0 0 1
mtr-miR2670c CAAGAAGGUUGCUCACUAUUU 21 11 1 4 1    0 0 0 0 1 1 0 1 4 1 0 0 0 0 1 1 0 0 0 0 0 1
mtr-miR2670d CAAGAAGGUUGCUCACUAUUU 21 11 1 4 1    0 0 0 0 1 1 0 1 4 1 0 0 0 0 1 1 0 0 0 0 0 1
mtr-miR2670e UCUCAACAGGACGGAUCACUA 21 16 2 5 1    0 1 0 0 5 0 2 1 0 0 0 1 1 0 1 0 1 2 1 0 0 0
mtr-miR2670f AGUGGUCUGUUAGGUUGGGGA 21 28 2 5 1    0 2 1 4 1 1 0 3 0 2 0 0 2 0 1 1 2 5 1 0 2 0
mtr-miR2670g AGUGGUCUGUUAGGUUGGGGA 21 28 2 5 1    0 2 1 4 1 1 0 3 0 2 0 0 2 0 1 1 2 5 1 0 2 0
mtr-miR2671a UUAAAAGUUUCGUUUCGGUCC 21 3 1 1 1    0 0 0 0 1 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0
mtr-miR2671b UUAAAAGUUUCGUUUCGGUCC 21 3 1 1 1    0 0 0 0 1 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0
mtr-miR2671c UUAAAAGUUUCGUUUCGGUCC 21 3 1 1 1    0 0 0 0 1 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0
mtr-miR2671d UUAAAAGUUUCGUUUCGGUCC 21 3 1 1 1    0 0 0 0 1 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0
mtr-miR2671e UUAAAAGUUUCGUUUCGGUCC 21 3 1 1 1    0 0 0 0 1 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0
mtr-miR2671f UUAAAAGUUUCGUUUCGGUCC 21 3 1 1 1    0 0 0 0 1 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0
mtr-miR2671g UUAAAAGUUUCGUUUCGGUCC 21 3 1 1 1    0 0 0 0 1 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0
mtr-miR2671h UUAAAAGUUUCGUUUCGGUCC 21 3 1 1 1    0 0 0 0 1 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0
mtr-miR2671i UUAAAAGUUUCGUUUCGGUCC 21 3 1 1 1    0 0 0 0 1 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0
mtr-miR2671j UUAAAAGUUUCGUUUCGGUCC 21 3 1 1 1    0 0 0 0 1 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0
mtr-miR2672 UUAAUCGACCAAGUGGGUACUA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2673a CCUCUUCCUCUUCCUCUUCCAC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2673b CCUCUUCCUCUUCCUCUUCCAC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2674 CACUCGCUUUGGAAGUCAUGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2675 CGAGGCAUAUUUGCAGGGAUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2676a CAUUGUUUGGAUAAUAAUUUG 21 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0
mtr-miR2676b CAUUGUUUGGAUAAUAAUUUG 21 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0
mtr-miR2676c CAUUGUUUGGAUAAUAAUUUG 21 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0
mtr-miR2676d CAUUGUUUGGAUAAUAAUUUG 21 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0
mtr-miR2676e CAUUGUUUGGAUAAUAAUUUG 21 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0
mtr-miR2676f CAUUGUUUGGAUAAUAAUUUG 21 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0
mtr-miR2677 UUUAUUGAUAUUGCUAAUAGAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2678 UGAAAUUGUUGCGAGUGUCUU 21 55 3 10 1    2 1 10 10 3 5 5 2 1 3 3 3 1 0 0 1 0 1 0 0 2 2
mtr-miR2679a CUUUUCACUUUCGAACGGGUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2679b CUUUUCACUUUCGAACGGGUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2679c CUUUUCACUUUCGAACGGGUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2680a UCCUCGGUACCUAUGUUGAU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2680b UCCUCGGUACCUAUGUUGAU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2680c UCCUCGGUACCUAUGUUGAU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2680d UCCUCGGUACCUAUGUUGAU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2680e UCCUCGGUACCUAUGUUGAU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR319a-3p UUGGACUGAAGGGAGCUCCC 20 66,710 3,032 4,247 1,810    1,913 4,081 3,635 3,727 4,247 3,849 3,596 4,195 3,754 2,235 2,436 4,129 2,180 2,747 3,371 2,963 2,643 3,116 1,891 2,364 1,828 1,810
mtr-miR319a-5p AGAGCUUCCUUCAGUCCACUC 21 29 2 4 1    3 1 0 2 1 1 0 0 4 1 0 1 2 3 2 2 2 1 1 0 0 2
mtr-miR319b-3p UUGGACUGAAGGGAGCUCCC 20 66,710 3,032 4,247 1,810    1,913 4,081 3,635 3,727 4,247 3,849 3,596 4,195 3,754 2,235 2,436 4,129 2,180 2,747 3,371 2,963 2,643 3,116 1,891 2,364 1,828 1,810
mtr-miR319b-5p GAGCUUUCUUUAGUCCACUCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR319c-3p UUGGACUGAAGGGAGCUCCCA 21 132 6 16 2    2 4 4 16 8 5 8 9 7 9 3 4 5 0 5 6 2 12 8 8 2 5
mtr-miR319c-5p GGAGUUCCUUGCAGCCCAAAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR319d-3p UUGGACUGAAGGGAGCUCCCU 21 73,231 3,329 6,794 904    1,992 5,049 3,893 3,925 3,858 2,877 4,704 6,225 3,884 3,205 3,544 2,580 1,529 3,300 2,444 3,467 1,648 6,794 2,797 3,505 904 1,107
mtr-miR319d-5p AGAGCUCUCUUCAGUCCACUC 21 51 3 7 1    0 3 5 2 4 4 3 3 1 2 1 7 1 3 3 3 0 2 1 2 0 1
mtr-miR390 AAGCUCAGGAGGGAUAGCGCC 21 12,307 559 1,019 212    473 636 456 554 377 463 688 567 504 359 462 398 821 212 898 561 708 891 1,019 404 458 398
mtr-miR393a UCCAAAGGGAUCGCAUUGAUC 21 129 6 19 2    3 4 3 4 4 4 8 2 5 3 4 5 5 19 6 5 11 6 6 12 4 6
mtr-miR393b-3p UUUGGGAUCAUGCUAUCCCUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR393b-5p UCCAAAGGGAUCGCAUUGAUC 21 129 6 19 2    3 4 3 4 4 4 8 2 5 3 4 5 5 19 6 5 11 6 6 12 4 6
mtr-miR395a AUGAAGUGUUUGGGGGAACUC 21 12 1 3 1    0 1 1 0 0 0 0 1 1 1 1 3 0 0 1 1 0 0 0 0 1 0
mtr-miR395b AUGAAGUAUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR395c AUGAAGUGUUUGGGGGAACUC 21 12 1 3 1    0 1 1 0 0 0 0 1 1 1 1 3 0 0 1 1 0 0 0 0 1 0
mtr-miR395d AUGAAGUGUUUGGGGGAACUC 21 12 1 3 1    0 1 1 0 0 0 0 1 1 1 1 3 0 0 1 1 0 0 0 0 1 0
mtr-miR395e AUGAAGUGUUUGGGGGAACUC 21 12 1 3 1    0 1 1 0 0 0 0 1 1 1 1 3 0 0 1 1 0 0 0 0 1 0
mtr-miR395f AUGAAGUGUUUGGGGGAACUC 21 12 1 3 1    0 1 1 0 0 0 0 1 1 1 1 3 0 0 1 1 0 0 0 0 1 0
mtr-miR395g UUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR395h AUGAAGUGUUUGGGGGAACUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR395i AUGAAGUGUUUGGGGGAACUC 21 12 1 3 1    0 1 1 0 0 0 0 1 1 1 1 3 0 0 1 1 0 0 0 0 1 0
mtr-miR395j AUGAAGUGUUUGGGGGAACUC 21 12 1 3 1    0 1 1 0 0 0 0 1 1 1 1 3 0 0 1 1 0 0 0 0 1 0
mtr-miR395k UUGAAGCGUUUGGGGGAACUC 21 15 2 3 1    0 0 0 0 0 0 0 2 0 0 2 0 0 3 0 2 1 1 1 2 1 0
mtr-miR395l AUGAAGUGUUUGGGGGAACUC 21 12 1 3 1    0 1 1 0 0 0 0 1 1 1 1 3 0 0 1 1 0 0 0 0 1 0
mtr-miR395m AUGAAGUGUUUGGGGGAACUC 21 12 1 3 1    0 1 1 0 0 0 0 1 1 1 1 3 0 0 1 1 0 0 0 0 1 0
mtr-miR395n AUGAAGUGUUUGGGGGAACUC 21 12 1 3 1    0 1 1 0 0 0 0 1 1 1 1 3 0 0 1 1 0 0 0 0 1 0
mtr-miR395o AUGAAGUGUUUGGGGGAACUC 21 12 1 3 1    0 1 1 0 0 0 0 1 1 1 1 3 0 0 1 1 0 0 0 0 1 0
mtr-miR396a-3p GCUCAAGAAAGCUGUGGGAGA 21 5,451 248 899 32    63 593 69 321 67 709 201 899 85 286 32 142 167 33 503 188 190 232 249 129 158 135
mtr-miR396a-5p UUCCACAGCUUUCUUGAACUU 21 450,093 20,459 38,591 14,245    14,924 14,774 16,502 16,917 20,478 22,941 16,775 15,783 19,316 16,678 24,550 14,245 25,958 14,920 32,282 38,591 20,530 24,849 18,147 17,432 21,643 21,858
mtr-miR396b-3p GUUCAAUAAAGCUGUGGGAAG 21 27,679 1,258 2,201 366    1,845 1,492 1,765 1,202 952 2,201 1,663 1,511 1,650 1,184 1,163 916 827 366 1,676 745 894 1,388 1,324 742 1,105 1,068
mtr-miR396b-5p UUCCACAGCUUUCUUGAACUG 21 968,946 44,043 58,977 18,202    35,609 47,883 53,338 54,645 51,075 52,568 53,235 55,419 55,827 37,112 43,186 58,977 35,387 25,991 48,236 18,202 47,152 26,261 57,705 25,379 50,676 35,083
mtr-miR396c AUUCAAGAAGGUCGUGGAAAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR397-3p UCUACGCUACACUCAAUUAUG 21 268 12 23 3    7 13 13 10 21 17 16 14 14 12 13 12 6 3 16 6 11 23 13 12 9 7
mtr-miR397-5p UCAUUGAGUGCAGCGUUGAUG 21 2,881 131 278 44    71 112 208 106 278 129 204 135 237 78 100 132 95 84 198 44 111 178 145 88 67 81
mtr-miR398a-3p UGUGUUCUCAGGUCACCCCUU 21 393 18 44 7    10 11 44 28 31 10 26 17 39 9 19 7 14 8 16 8 14 21 13 18 14 16
mtr-miR398a-5p GGAGUGACACUGAGAACACAAG 22 2,908 132 573 11    93 59 118 185 41 157 50 101 82 50 36 89 250 11 573 104 176 59 107 74 290 203
mtr-miR398b UGUGUUCUCAGGUCGCCCCUG 21 2,301,202 104,600 189,420 49,059    125,387 97,959 140,672 82,035 181,783 81,789 189,420 100,318 157,044 91,756 150,438 105,203 67,006 97,078 52,402 49,059 83,816 107,344 112,699 75,114 65,051 87,829
mtr-miR398c UGUGUUCUCAGGUCGCCCCUG 21 2,301,202 104,600 189,420 49,059    125,387 97,959 140,672 82,035 181,783 81,789 189,420 100,318 157,044 91,756 150,438 105,203 67,006 97,078 52,402 49,059 83,816 107,344 112,699 75,114 65,051 87,829
mtr-miR399a UGCCAAAGGAGAUUUGCCCAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR399b UGCCAAAGGAGAGCUGCCCUG 21 9 2 2 1    0 1 0 2 1 0 0 0 0 1 2 0 0 0 0 2 0 0 0 0 0 0
mtr-miR399c UGCCAAAGGAGAUUUGCCCUG 21 265 12 42 1    7 1 16 8 34 2 4 2 12 4 9 19 18 11 12 42 17 2 3 8 18 16
mtr-miR399d UGCCAAAGGAGAGCUGCCCUA 21 15 1 2 1    1 1 1 2 1 0 1 0 0 1 0 0 1 0 0 1 1 1 1 0 0 2
mtr-miR399e UGCCAAAGGAGAUUUGCCCAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR399f UGCCAAAGGAGAUUUGCCCAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR399g UGCCAAAGGAGAUUUGCCCAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR399h UGCCAAAGGAGAUUUGCCCUG 21 265 12 42 1    7 1 16 8 34 2 4 2 12 4 9 19 18 11 12 42 17 2 3 8 18 16
mtr-miR399i UGCCAAAGGAGAUUUGCCCUG 21 265 12 42 1    7 1 16 8 34 2 4 2 12 4 9 19 18 11 12 42 17 2 3 8 18 16
mtr-miR399j CGCCAAAGAAGAUUUGCCCCG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR399k UGCCAAAGAAGAUUUGCCCUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR399l UGCCAAAGGAGAGUUGCCCUG 21 39 3 17 1    0 0 2 0 1 0 3 1 0 1 0 0 3 0 4 17 1 2 0 2 1 1
mtr-miR399m UGCCAAAGGAGAGCUGCCCUA 21 15 1 2 1    1 1 1 2 1 0 1 0 0 1 0 0 1 0 0 1 1 1 1 0 0 2
mtr-miR399n UGCCAAAGGAGAGCUGCCCUA 21 15 1 2 1    1 1 1 2 1 0 1 0 0 1 0 0 1 0 0 1 1 1 1 0 0 2
mtr-miR399o UGCCAAAGGAGAGCUGCCCUG 21 9 2 2 1    0 1 0 2 1 0 0 0 0 1 2 0 0 0 0 2 0 0 0 0 0 0
mtr-miR399p UGCCAAAGGAGAGUUGCCCUG 21 39 3 17 1    0 0 2 0 1 0 3 1 0 1 0 0 3 0 4 17 1 2 0 2 1 1
mtr-miR399q UGCCAAAGGAGAGCUGCUCUU 21 3 1 1 1    0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 1 0 0 0 0 0
mtr-miR399r UGCCAAAGAAGAUUUGCCCCG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR399s-3p UGCCAAAGGAGAUUUGCCCAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR399s-5p GGGUGAGUUCUCCAUUGGCAGG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR399t-3p UGCCAAAGGAGAUUUGCCCAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR399t-5p GGGUGAGUUCUCCAUUGGCAGGU 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR408-3p AUGCACUGCCUCUUCCCUGGC 21 194,611 8,846 13,772 4,770    7,340 7,704 9,983 8,066 13,076 9,015 11,140 8,408 11,557 7,413 10,958 7,686 8,685 4,770 13,772 5,311 9,304 9,825 10,431 5,130 6,566 8,471
mtr-miR408-5p ACAGGGAACAUGCAGAGCAUG 21 508 23 47 9    18 15 34 14 37 18 25 28 36 9 21 14 23 24 47 17 20 21 26 25 11 25
mtr-miR4414a-3p AUCCAACGAUGCGGGAGCUGC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR4414a-5p AGCUGCUGACUCGUUGGUUCA 21 16 2 4 1    1 0 3 0 1 0 4 0 1 1 2 1 0 0 0 0 0 0 0 2 0 0
mtr-miR4414b UGUGAAUGAUGCGGGAGCUAA 21 14 2 4 1    0 0 0 0 1 4 0 2 1 0 0 0 1 3 1 0 0 0 0 0 1 0
mtr-miR482-3p CUUACCUACACCUCCCAUGCC 21 3 3 3 3    0 0 0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR482-5p GGCAUGGGAUAGUAGGGAAGA 21 9,418 448 3,719 35    125 129 133 175 46 109 3,719 3,614 90 125 110 93 97 0 175 178 65 65 112 35 122 101
mtr-miR5037a AACCCUCAAAGGCUUCCACGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR5037b AACCCUCAAAGGCUUCCACGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR5037c AACCCUCAAAGGCUUCCACGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR5204 GCUGGAAGGUUUUGUAGGAAC 21 6 2 3 1    0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 3 1 0 0 0 0 0
mtr-miR5205a CAUACAAUUUGGGACGGAGGGAG 23 30 2 5 1    1 1 2 2 1 4 0 1 0 2 1 3 1 0 0 5 1 3 0 0 1 1
mtr-miR5205b CUUAUAAUUAGGGACGGAGGGAGU 24 155 7 18 1    7 11 11 18 6 18 8 12 9 2 3 7 3 0 1 7 2 5 7 8 4 6
mtr-miR5205c CUUAUAAUUAGGGACGGAGGUAGU 24 137 7 12 2    4 8 5 0 5 12 5 8 9 5 5 5 2 3 8 7 7 8 8 12 2 9
mtr-miR5205d CUUAUAAUUAGGGACGGAGGUAGU 24 137 7 12 2    4 8 5 0 5 12 5 8 9 5 5 5 2 3 8 7 7 8 8 12 2 9
mtr-miR5206a AUGGGAUCCUGUUGGUGGGUUAC 23 3 1 1 1    0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 0 0 0 0 0 0 1
mtr-miR5206b GUGGGAUCCGUUGAUGGGUUAC 22 7 2 4 1    0 0 0 0 1 0 0 0 1 0 0 1 0 0 0 4 0 0 0 0 0 0
mtr-miR5207 CAUUAAUGUGGGUUUGGACGGUU 23 24 2 4 1    0 1 0 2 0 2 1 2 0 3 0 0 1 0 1 0 2 1 3 4 1 0
mtr-miR5208a AACAUGGAUGUUGUGAGUUUGUU 23 9 1 2 1    0 1 0 0 1 0 2 2 0 0 0 1 0 0 0 0 1 0 1 0 0 0
mtr-miR5208b AACAUGGAUGUUGUGAGUUUGUU 23 9 1 2 1    0 1 0 0 1 0 2 2 0 0 0 1 0 0 0 0 1 0 1 0 0 0
mtr-miR5208c AACAUGGAUGUUGUGAGUUUGUU 23 9 1 2 1    0 1 0 0 1 0 2 2 0 0 0 1 0 0 0 0 1 0 1 0 0 0
mtr-miR5208d CAUAUUAGUCAUAUUUGUAGGCAU 24 34 2 6 1    2 6 2 4 1 1 1 3 0 0 0 1 0 0 2 2 2 0 2 0 2 3
mtr-miR5209 CGAGGAGGCGGUAUUGUUUGAA 22 70 4 8 1    2 6 4 0 5 5 0 5 2 1 5 3 4 0 5 2 2 3 3 8 2 3
mtr-miR5210 UAAAUGUGUUGGAAUUAAGGUU 22 35 2 6 1    0 2 0 0 1 1 2 2 0 1 3 1 2 5 1 2 0 3 0 6 1 2
mtr-miR5211 UCGCAGGAGUGAUGGGACCGGC 22 1,087 49 169 11    11 39 21 46 16 38 30 57 33 11 22 75 92 43 47 82 26 169 49 119 25 36
mtr-miR5212-3p CCAAGGAAAUAGAUAUCCAGC 21 449 20 44 6    7 23 10 44 14 27 11 23 12 12 6 25 37 14 40 9 26 35 15 10 33 16
mtr-miR5212-5p UGGAUUUCGUAUUUCUUUGGUA 22 2,112 96 207 31    52 81 108 100 101 74 118 115 103 74 70 106 31 203 40 77 37 125 48 207 92 150
mtr-miR5213-3p CAGAGUGCAGAUACACGCAUC 21 33,631 1,529 8,503 545    716 823 8,503 5,538 1,609 1,105 1,419 1,170 1,366 551 951 986 980 545 1,218 914 767 1,103 921 932 641 873
mtr-miR5213-5p UACGUGUGUCUUCACCUCUGAA 22 305,886 13,904 152,338 227    3,520 3,853 152,338 66,382 5,907 4,214 8,634 4,999 8,433 10,963 3,592 4,441 4,657 3,276 1,139 327 4,734 4,682 738 227 3,788 5,042
mtr-miR5214-3p UGAUAGAGCUAGACCAUCGGAG 22 1,869 85 138 19    45 104 59 82 60 103 79 130 98 89 38 117 78 19 138 62 107 74 102 61 115 109
mtr-miR5214-5p UAGCUCUAUUAACAAUUAAAU 21 358 16 37 2    2 19 12 14 7 18 13 22 13 4 9 25 29 16 37 19 18 7 24 8 24 18
mtr-miR5215 AGGAGGAUGAGCUACCUGCUU 21 3,600 164 311 54    57 284 85 261 83 253 89 237 102 97 84 142 187 54 311 163 164 160 186 147 261 193
mtr-miR5216a UUAGGAGUGAAAAACGGUGGAA 22 21 2 4 1    0 1 1 2 0 0 1 2 4 0 1 0 0 0 1 1 2 0 1 2 1 1
mtr-miR5216b UUAGGAGUGAAAAACGGUGGAA 22 21 2 4 1    0 1 1 2 0 0 1 2 4 0 1 0 0 0 1 1 2 0 1 2 1 1
mtr-miR5217 AGGUCAUUUUGAACGGUCGGAU 22 2 2 2 2    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2
mtr-miR5218 UGAGACUUGGUAGUAAGAUGAU 22 49 3 6 1    3 5 1 2 2 2 1 2 2 2 0 0 4 0 1 3 3 5 1 6 2 2
mtr-miR5219 UCAUGGAAUCUCAGCUGCUGCA 22 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0
mtr-miR5221 AGGAGAGAUGGUGUUUUGACUU 22 31 2 5 1    0 0 0 2 1 5 0 2 5 0 4 0 2 0 1 2 2 0 1 0 3 1
mtr-miR5222 UUACAGGAGAAGAAUGUAUGGC 22 15 1 2 1    0 2 1 0 1 1 1 1 1 0 2 0 0 0 0 0 0 0 1 2 0 2
mtr-miR5223 CGUGGAAUUUACUUGAAGAUGC 22 1 1 1 1    0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR5224a UCGAGGACAUGAGGGACGUUAU 22 36 2 6 1    3 2 1 6 2 0 0 3 2 1 3 0 2 0 1 1 2 2 1 0 2 2
mtr-miR5224b CGGAAGAGGAUUGUCGAGGACA 22 661 30 52 14    21 23 50 32 24 22 43 25 27 21 27 19 34 16 37 14 52 31 41 33 40 29
mtr-miR5225a UCAGUCGCAGGAGAGAUGACAC 22 0 0 0 0    0 0 0