Medicago miRNA Abundances

The data below are based on the microRNAs listed in the Sanger registry. Adjust libraries/reads to display on the control panel.


        miRNA         miRNA sequence Len Sum (norm) Average Max Min (>0)  GMA01GMA02GMA03GMA04GMA05bGMA06bGMA07bPVU01PVU02PVU03PVU04AHY01AHY02MSDL1MYR1MINFMND1MRG1MLEFMRMI1MTR01Mtrdr6_1Mtrdr6_2Mtrdr6_WT_1Mtrdr6_WT_2
mtr-miR1507-3p CCUCGUUCCAUACAUCAUCUAG 22 12,713 978 2,772 1    0 0 0 0 0 0 0 0 0 0 0 0 1 905 2,365 2,772 1,396 829 1,425 870 747 461 336 282 324
mtr-miR1507-5p AGAGUUGUAUGGAACGAAAGAU 22 363 40 65 1    0 0 0 0 0 0 0 0 0 0 0 0 0 47 65 58 39 65 38 49 0 1 0 1 0
mtr-miR1509a-3p ACCGGAUUUCCUUGAUUAAAG 21 78 7 18 1    0 0 0 0 0 0 0 0 0 0 0 0 0 2 9 15 3 1 6 2 18 4 5 5 8
mtr-miR1509a-5p UUAAUCUAGGAAAAUACGGUG 21 84 9 23 1    0 0 0 0 0 0 0 0 0 0 0 0 0 7 12 10 23 18 5 0 7 1 0 0 1
mtr-miR1509b UUAAUCUAGGAAAUUACACUCG 22 29 3 5 1    0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 5 3 0 3 1 4 4 1 1 4
mtr-miR1510a-3p CGGAGGAUUAGGUAAAACAAC 21 5,957 496 1,242 29    0 0 0 0 0 0 0 0 0 0 0 0 0 606 75 161 32 29 396 48 1,242 855 874 742 897
mtr-miR1510a-5p UUGUCUUACCCAUUCCUCCCA 21 1,209 101 324 18    0 0 0 0 0 0 0 0 0 0 0 0 0 324 97 158 90 93 135 18 57 75 62 68 32
mtr-miR1510b-3p ACAUGGUCGGUAUCCCUGGAA 21 1,670 139 382 39    0 0 0 0 0 0 0 0 0 0 0 0 0 382 113 229 74 84 223 76 277 41 79 53 39
mtr-miR1510b-5p CCAUGGAUCCCUACCAUGUGG 21 21 3 11 1    0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 3 0 0 2 11 0 1 1 1
mtr-miR156a UGACAGAAGAGAGAGAGCACA 21 23 4 13 1    0 0 0 2 1 1 0 0 0 0 0 0 0 13 0 0 0 0 2 0 4 0 0 0 0
mtr-miR156b-3p UGCUCACUCUCUAUCUGUCACC 22 4 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 1 0 1
mtr-miR156b-5p UGACAGAAGAGAGUGAGCAC 20 316,684 13,769 88,193 1    899 6,080 2,186 8,741 1 0 0 20,793 967 34,248 32,278 2,821 3,273 88,193 16,002 1,599 12,027 8,868 58,334 9,678 7,076 581 703 709 627
mtr-miR156c-3p UGCUUACUCUCUAUCUGUCACC 22 42 5 11 1    0 0 0 0 0 0 0 0 0 0 0 0 0 11 1 0 0 1 4 2 0 5 7 5 6
mtr-miR156c-5p UGACAGAAGAGAGUGAGCAC 20 316,684 13,769 88,193 1    899 6,080 2,186 8,741 1 0 0 20,793 967 34,248 32,278 2,821 3,273 88,193 16,002 1,599 12,027 8,868 58,334 9,678 7,076 581 703 709 627
mtr-miR156d-3p UGCUCACUCAUCUUUCUGUCAAA 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR156d-5p UGACAGAAGAGAGUGAGCAC 20 316,684 13,769 88,193 1    899 6,080 2,186 8,741 1 0 0 20,793 967 34,248 32,278 2,821 3,273 88,193 16,002 1,599 12,027 8,868 58,334 9,678 7,076 581 703 709 627
mtr-miR156e UUGACAGAAGAUAGAGAGCAC 21 393,416 15,737 203,119 41    10,407 2,537 1,459 1,895 10,341 12,705 8,797 31,288 37,315 25,850 5,718 4,205 12,820 203,119 10,851 1,109 5,089 41 2,809 597 189 855 1,227 857 1,336
mtr-miR156f UUGACAGAAGAUAGAGAGCAC 21 393,416 15,737 203,119 41    10,407 2,537 1,459 1,895 10,341 12,705 8,797 31,288 37,315 25,850 5,718 4,205 12,820 203,119 10,851 1,109 5,089 41 2,809 597 189 855 1,227 857 1,336
mtr-miR156g-3p GCUCUCUAGACUUCUGUCAUC 21 1,965 218 524 5    0 0 0 0 0 0 0 0 0 0 0 0 0 12 5 19 14 0 44 0 0 376 524 474 497
mtr-miR156g-5p UUGACAGAAGAUAGAGGGCAC 21 56,933 2,277 18,290 1    9 1 1 3 3 6 4 16 24 60 9 4 4 7,158 3,744 15,526 6,794 2,062 18,290 27 92 737 847 916 596
mtr-miR156h-3p GCUCUUUAUUCUUCUGUCAUC 21 333 56 107 1    0 0 0 0 0 0 0 0 0 0 0 0 0 78 1 0 0 0 0 0 0 34 107 29 84
mtr-miR156h-5p UUGACAGAAGAUAGAGAGCAC 21 393,416 15,737 203,119 41    10,407 2,537 1,459 1,895 10,341 12,705 8,797 31,288 37,315 25,850 5,718 4,205 12,820 203,119 10,851 1,109 5,089 41 2,809 597 189 855 1,227 857 1,336
mtr-miR156i-3p UGCUCACUUCUCUUUCUGUCAUC 23 10 1 4 1    0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 1 1 4 0 1 1 1
mtr-miR156i-5p UGACAGAAGAGAGUGAGCAC 20 316,684 13,769 88,193 1    899 6,080 2,186 8,741 1 0 0 20,793 967 34,248 32,278 2,821 3,273 88,193 16,002 1,599 12,027 8,868 58,334 9,678 7,076 581 703 709 627
mtr-miR156j UGACAGAAGAGGGUGAGCAC 20 193 10 43 1    1 3 2 5 0 0 0 9 0 23 39 2 1 43 5 2 8 11 34 2 0 1 1 0 1
mtr-miR159a UUUGGAUUGAAGGGAGCUCUA 21 144,047 5,762 41,159 52    259 284 241 236 108 121 409 214 52 127 174 209 133 435 224 279 382 427 368 182 249 37,414 29,255 31,106 41,159
mtr-miR159b AUUGGAGUGAAGGGAGCUCCA 21 2,571 143 601 1    184 16 0 0 277 576 15 1 1 3 0 445 601 1 116 0 163 168 0 1 0 1 1 0 1
mtr-miR160a UGCCUGGCUCCCUGUAUGCCA 21 4,941 198 1,413 2    125 116 7 68 25 55 56 209 61 414 48 351 423 15 165 196 1,413 368 49 514 245 2 10 3 3
mtr-miR160b UGCCUGGCUCCCUGUAUGCCA 21 4,941 198 1,413 2    125 116 7 68 25 55 56 209 61 414 48 351 423 15 165 196 1,413 368 49 514 245 2 10 3 3
mtr-miR160c UGCCUGGCUCCCUGAAUGCCA 21 136 10 53 1    2 0 0 0 1 1 0 25 0 0 0 6 53 0 4 14 9 17 1 0 0 1 1 1 0
mtr-miR160d UGCCUGGCUCCCUGUAUGCCA 21 4,941 198 1,413 2    125 116 7 68 25 55 56 209 61 414 48 351 423 15 165 196 1,413 368 49 514 245 2 10 3 3
mtr-miR160e UGCCUGGCUCCCUGUAUGCCA 21 4,941 198 1,413 2    125 116 7 68 25 55 56 209 61 414 48 351 423 15 165 196 1,413 368 49 514 245 2 10 3 3
mtr-miR160f GCGUGAAGGGAGUCAAGCAGG 21 5 2 3 1    0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 0 1 1 0 0 0 0 0 0
mtr-miR162 UCGAUAAACCUCUGCAUCCAG 21 2,337 93 238 11    24 96 87 57 18 33 115 105 18 150 57 13 104 238 209 117 102 178 131 212 11 68 76 55 63
mtr-miR164a UGGAGAAGCAGGGCACGUGCA 21 9,144 366 1,954 5    363 23 781 165 157 378 375 411 212 96 31 23 85 308 1,169 604 198 1,954 967 772 39 12 10 5 6
mtr-miR164b UGGAGAAGCAGGGCACGUGCA 21 9,144 366 1,954 5    363 23 781 165 157 378 375 411 212 96 31 23 85 308 1,169 604 198 1,954 967 772 39 12 10 5 6
mtr-miR164c UGGAGAAGCAGGGCACGUGCA 21 9,144 366 1,954 5    363 23 781 165 157 378 375 411 212 96 31 23 85 308 1,169 604 198 1,954 967 772 39 12 10 5 6
mtr-miR164d UGGAGAAGCAGGGCACAUGCU 21 42 5 23 1    1 2 1 0 0 0 0 0 0 0 0 0 0 0 1 0 23 11 0 2 0 0 1 0 0
mtr-miR166a UCGGACCAGGCUUCAUUCCCC 21 1,014,590 40,584 127,159 2,547    4,432 40,886 15,702 7,125 16,228 10,892 20,507 13,228 5,690 16,952 4,135 2,547 25,853 15,078 97,682 53,039 102,353 69,610 47,226 17,230 7,546 103,689 120,129 127,159 69,672
mtr-miR166b UCGGACCAGGCUUCAUUCCUA 21 110,019 5,501 39,578 1    1 2 1 0 1 0 1 0 2 1 0 0 4 1,657 17,689 14,752 39,578 28,856 3,499 2,805 825 66 85 92 102
mtr-miR166c UCGGACCAGGCUUCAUUCCUC 21 18,905 756 8,396 12    168 1,187 608 169 538 333 636 413 210 500 70 54 8,396 56 226 1,000 2,622 1,000 283 94 274 18 20 18 12
mtr-miR166d UCGGGCCAGGCUUCAUCCCCC 21 5 2 3 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 1 0 0 1
mtr-miR166e-3p UCGGACCAGGCUUCAUUCCCC 21 1,014,590 40,584 127,159 2,547    4,432 40,886 15,702 7,125 16,228 10,892 20,507 13,228 5,690 16,952 4,135 2,547 25,853 15,078 97,682 53,039 102,353 69,610 47,226 17,230 7,546 103,689 120,129 127,159 69,672
mtr-miR166e-5p GGAAUGUUGGCUGGCUCGAGG 21 1,924 92 248 1    0 0 120 1 10 102 7 3 28 1 0 0 4 181 248 146 54 179 147 90 14 189 144 115 141
mtr-miR166f UCGGACCAGGCUUCAUUCCUC 21 18,905 756 8,396 12    168 1,187 608 169 538 333 636 413 210 500 70 54 8,396 56 226 1,000 2,622 1,000 283 94 274 18 20 18 12
mtr-miR166g-3p UCGGACCAGGCUUCAUUCCCC 21 1,014,590 40,584 127,159 2,547    4,432 40,886 15,702 7,125 16,228 10,892 20,507 13,228 5,690 16,952 4,135 2,547 25,853 15,078 97,682 53,039 102,353 69,610 47,226 17,230 7,546 103,689 120,129 127,159 69,672
mtr-miR166g-5p GGAAUGUUGUCUGGCUCGAGG 21 6,034 241 747 13    81 328 108 32 107 92 214 163 118 69 13 115 385 650 456 568 323 245 747 395 25 246 166 156 232
mtr-miR167a UGAAGCUGCCAGCAUGAUCUA 21 12,272 491 1,997 1    41 305 217 127 94 179 70 321 128 1,737 314 1,612 71 291 1,997 554 1,329 883 1,013 928 57 1 1 1 1
mtr-miR167b-3p GAUCAUGUUGGAGCUUCACC 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR167b-5p UGAAGCUGCCAGCAUGAUCUG 21 13,440 560 5,328 1    43 437 144 188 11 71 4 59 45 186 9 1 0 1,646 1,211 1,149 1,496 801 5,328 470 103 8 9 8 13
mtr-miR168a UUGCUUGGUGCUGGUCGGGAA 21 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0
mtr-miR168b UCGCUUGGUGCAGGUCGGGAA 21 80,552 3,222 9,116 211    2,520 1,478 3,749 768 3,070 3,020 6,305 5,138 1,521 1,047 3,807 1,083 4,632 7,369 5,100 4,568 2,622 8,432 9,116 2,664 1,544 230 247 311 211
mtr-miR168c-3p CCCGCCUUGCAUCAACUGAAU 21 1,316 53 257 4    15 9 6 5 31 37 26 13 24 5 17 17 66 184 121 128 65 44 257 154 4 24 28 19 17
mtr-miR168c-5p UCGCUUGGUGCAGGUCGGGAA 21 80,552 3,222 9,116 211    2,520 1,478 3,749 768 3,070 3,020 6,305 5,138 1,521 1,047 3,807 1,083 4,632 7,369 5,100 4,568 2,622 8,432 9,116 2,664 1,544 230 247 311 211
mtr-miR169a CAGCCAAGGAUGACUUGCCGA 21 176 16 91 1    0 0 11 50 0 3 3 0 2 0 4 0 1 0 1 91 7 3 0 0 0 0 0 0 0
mtr-miR169b CAGCCAAGGAUGACUUGCCGG 21 21,452 894 14,022 1    27 215 345 126 559 1,169 1,193 95 1,514 40 14,022 17 1,946 71 6 7 1 1 22 37 36 1 1 0 1
mtr-miR169c CAGCCAAGGGUGAUUUGCCGG 21 753 34 317 1    106 2 4 0 6 19 4 317 24 17 48 0 0 142 2 1 17 1 2 6 4 6 10 6 9
mtr-miR169d-3p GGCAGGUCAUCCUUCGGCUAUA 22 380 35 165 1    0 0 0 0 0 0 0 0 0 0 0 0 0 11 165 39 105 13 39 2 0 2 1 2 1
mtr-miR169d-5p AAGCCAAGGAUGACUUGCCGG 21 620 33 121 1    64 45 2 1 4 3 4 65 45 11 96 121 42 1 37 0 61 6 11 0 0 1 0 0 0
mtr-miR169e-3p GGCAGGUCAUCCUUCGGCUAUA 22 380 35 165 1    0 0 0 0 0 0 0 0 0 0 0 0 0 11 165 39 105 13 39 2 0 2 1 2 1
mtr-miR169e-5p GAGCCAAGGAUGACUUGCCGG 21 30 3 9 1    0 1 0 0 0 0 0 0 0 0 4 0 0 1 5 1 9 1 1 2 4 0 0 1 0
mtr-miR169f AAGCCAAGGAUGACUUGCCUA 21 1 1 1 1    1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR169g CAGCCAAGGAUGACUUGCCGG 21 21,452 894 14,022 1    27 215 345 126 559 1,169 1,193 95 1,514 40 14,022 17 1,946 71 6 7 1 1 22 37 36 1 1 0 1
mtr-miR169h UGAGCCAAAGAUGACUUGCCGG 22 142 18 71 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 29 2 71 3 34 0 0 1 0 1 1
mtr-miR169i UGAGCCAAAGAUGACUUGCCGG 22 142 18 71 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 29 2 71 3 34 0 0 1 0 1 1
mtr-miR169j UGAGCCAGGAUGACUUGCCGG 21 54 11 40 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 1 40 1 8 0 0 0 0 0 0
mtr-miR169k UGAGCCAGGAUGGCUUGCCGG 21 20 2 7 1    3 2 0 0 0 1 1 0 0 0 0 0 0 0 7 0 2 0 2 0 0 1 0 1 0
mtr-miR169l-3p GGCAAGUUUUUCCUUGGCUAUA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR169l-5p CAGCCAAGGAUGACUUGCCGG 21 21,452 894 14,022 1    27 215 345 126 559 1,169 1,193 95 1,514 40 14,022 17 1,946 71 6 7 1 1 22 37 36 1 1 0 1
mtr-miR171a UGAUUGAGUCGUGCCAAUAUC 21 476 37 294 1    0 0 2 0 0 0 0 44 0 3 0 0 1 2 31 294 0 1 92 0 0 1 2 2 1
mtr-miR171b UGAUUGAGCCGCGUCAAUAUC 21 75 5 21 1    1 0 0 0 0 0 0 6 0 4 0 2 5 1 4 3 16 4 2 5 21 0 1 0 0
mtr-miR171c UGAUUGAGCCGUGCCAAUAUU 21 54 5 18 1    0 0 2 0 0 1 0 0 1 0 17 0 1 0 0 8 0 0 2 0 18 1 1 1 1
mtr-miR171d UGAUUGAGCCGUGCCAAUAUC 21 1,915 120 581 1    95 43 581 20 87 86 25 3 213 0 563 0 151 1 0 26 0 0 2 0 18 0 0 0 1
mtr-miR171e-3p AGAUUGAGCCGCGCCAAUAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR171e-5p CGAUGUUGGUGAGGUUCAAUC 21 124 5 24 1    15 1 3 2 1 12 1 8 1 1 4 0 1 3 24 1 3 17 2 2 4 7 4 3 4
mtr-miR171f UUGAGCCGUGCCAAUAUCACG 21 38 3 18 1    0 0 0 1 0 1 1 0 0 0 0 0 7 1 1 4 0 0 1 0 18 1 1 0 1
mtr-miR171g CGAGCCGAAUCAAUAUCACUC 21 2,458 137 1,154 1    72 203 1 0 4 6 2 0 0 0 0 16 0 3 1,154 4 671 24 33 260 0 1 1 1 2
mtr-miR171h CGAGCCGAAUCAAUAUCACUC 21 2,458 137 1,154 1    72 203 1 0 4 6 2 0 0 0 0 16 0 3 1,154 4 671 24 33 260 0 1 1 1 2
mtr-miR172a AGAAUCCUGAUGAUGCUGCAG 21 1,252 157 528 7    0 0 0 0 0 0 0 0 0 0 0 7 0 0 171 528 58 286 49 85 68 0 0 0 0
mtr-miR172b AGAAUCUUGAUGAUGCUGCAU 21 44,000 1,833 10,884 1    1,051 319 1,466 59 1,321 683 256 2,923 2,419 321 1,034 2,275 1,783 24 826 2,380 6,680 10,884 5,764 202 1,327 1 1 1 0
mtr-miR172c-3p AGAAUCUUGAUGAUGCUGCAU 21 44,000 1,833 10,884 1    1,051 319 1,466 59 1,321 683 256 2,923 2,419 321 1,034 2,275 1,783 24 826 2,380 6,680 10,884 5,764 202 1,327 1 1 1 0
mtr-miR172c-5p GUAGCAUCAUCAAGAUUCACA 21 15 2 6 1    0 0 0 0 0 1 0 1 3 0 0 0 6 0 1 1 1 0 1 0 0 0 0 0 0
mtr-miR172d-3p AGAAUCUUGAUGAUGCUGCA 20 955 56 481 2    19 4 20 2 0 0 0 53 36 7 17 481 49 0 10 26 52 99 50 2 28 0 0 0 0
mtr-miR172d-5p AGUGGAGCAUCAUCAAGAUUCACA 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2086-3p GACAUGAAUGCAGAACUGGAA 21 14,920 1,243 3,554 17    0 0 0 0 0 0 0 0 0 0 0 0 0 3,554 1,990 2,363 606 1,036 1,771 1,298 2,223 22 19 17 21
mtr-miR2086-5p CCAGUUCUGCGUUCAUGUCCC 21 168 14 43 2    0 0 0 0 0 0 0 0 0 0 0 0 0 43 14 26 2 9 16 4 4 12 19 11 8
mtr-miR2087-3p CUGCAGUCGGUUUCUUACUUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2087-5p GAAGUAAAGAACCGGCUGCAG 21 24 3 7 1    0 0 0 0 0 0 0 0 0 0 0 0 0 2 5 1 0 2 7 6 0 0 0 0 1
mtr-miR2088-3p UCCAAUGUAAUCUAGGUCUA 20 18 2 7 1    0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 7 1 1 3 1 0 1 1 0 1
mtr-miR2088-5p AGGCCUAGAUUACAUUGGAC 20 22 2 6 1    0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 6 1 1 4 2 0 1 3 1 1
mtr-miR2089-3p AGGAUUGGUGUAAUAGGUAAAA 22 575 48 145 1    0 0 0 0 0 0 0 0 0 0 0 0 0 123 145 51 36 41 103 64 4 2 1 3 2
mtr-miR2089-5p UUACCUAUUCCACCAAUUCCAU 22 402 34 91 4    0 0 0 0 0 0 0 0 0 0 0 0 0 27 80 45 50 91 31 51 4 7 6 4 6
mtr-miR2111a-3p AGCCUUGGAAUGCAGAUUAUC 21 38 4 11 1    0 0 0 0 0 0 0 0 0 0 0 0 0 9 1 3 0 5 11 0 0 5 1 1 2
mtr-miR2111a-5p UAAUCUGCAUCCUGAGGUUUA 21 645 29 126 1    0 0 1 2 6 6 6 1 5 4 39 1 2 21 59 126 54 116 103 0 32 20 21 7 13
mtr-miR2111b UAAUCUGCAUCCUGAGGUUUA 21 645 29 126 1    0 0 1 2 6 6 6 1 5 4 39 1 2 21 59 126 54 116 103 0 32 20 21 7 13
mtr-miR2111c UAAUCUGCAUCCUGAGGUUUA 21 645 29 126 1    0 0 1 2 6 6 6 1 5 4 39 1 2 21 59 126 54 116 103 0 32 20 21 7 13
mtr-miR2111d-3p AUCCUUAGAAUGCAGAUUAUC 21 77 11 21 1    0 0 0 0 0 0 0 0 0 0 0 0 0 6 18 10 1 20 21 0 0 0 1 0 0
mtr-miR2111d-5p UAAUCUGCAUCCUGAGGUUUA 21 645 29 126 1    0 0 1 2 6 6 6 1 5 4 39 1 2 21 59 126 54 116 103 0 32 20 21 7 13
mtr-miR2111e-3p AGCCUUGGGAUGCUGAUUAUC 21 15 3 6 1    0 0 0 0 0 0 0 0 0 0 0 0 0 2 1 1 1 6 4 0 0 0 0 0 0
mtr-miR2111e-5p UAAUCUGCAUCCUGAGGUUUA 21 645 29 126 1    0 0 1 2 6 6 6 1 5 4 39 1 2 21 59 126 54 116 103 0 32 20 21 7 13
mtr-miR2111f UAAUCUGCAUCCUGAGGUUUA 21 645 29 126 1    0 0 1 2 6 6 6 1 5 4 39 1 2 21 59 126 54 116 103 0 32 20 21 7 13
mtr-miR2111g-3p AGCCUCGGAGUGCGGAUUAUC 21 200 20 48 1    0 0 0 0 0 0 0 0 0 0 0 0 0 17 7 15 1 31 7 0 0 48 15 25 34
mtr-miR2111g-5p UAAUCUGCAUCCUGAGGUUUA 21 645 29 126 1    0 0 1 2 6 6 6 1 5 4 39 1 2 21 59 126 54 116 103 0 32 20 21 7 13
mtr-miR2111h UAAUCUGCAUCCUGAGGUUUA 21 645 29 126 1    0 0 1 2 6 6 6 1 5 4 39 1 2 21 59 126 54 116 103 0 32 20 21 7 13
mtr-miR2111i UAAUCUGCAUCCUGAGGUUUA 21 645 29 126 1    0 0 1 2 6 6 6 1 5 4 39 1 2 21 59 126 54 116 103 0 32 20 21 7 13
mtr-miR2111j UAAUCUGCAUCCUGAGGUUUA 21 645 29 126 1    0 0 1 2 6 6 6 1 5 4 39 1 2 21 59 126 54 116 103 0 32 20 21 7 13
mtr-miR2111k UAAUCUGCAUCCUGAGGUUUA 21 645 29 126 1    0 0 1 2 6 6 6 1 5 4 39 1 2 21 59 126 54 116 103 0 32 20 21 7 13
mtr-miR2111l AUCCUUGGAAUGCAGAUUAUC 21 145 15 41 1    0 0 0 0 0 0 0 0 0 0 0 0 0 8 7 7 1 15 11 0 0 30 14 11 41
mtr-miR2111m-3p GUCCUCGGGAUACAGAUUACU 21 60 8 25 1    0 0 0 0 0 0 0 0 0 0 0 0 0 1 7 5 1 17 3 0 25 0 0 0 1
mtr-miR2111m-5p UAAUCUGCAUCCUGAGGUUUA 21 645 29 126 1    0 0 1 2 6 6 6 1 5 4 39 1 2 21 59 126 54 116 103 0 32 20 21 7 13
mtr-miR2111n UAAUCUGCAUCCUGAGGUUUA 21 645 29 126 1    0 0 1 2 6 6 6 1 5 4 39 1 2 21 59 126 54 116 103 0 32 20 21 7 13
mtr-miR2111o UAAUCUGCAUCCUGAGGUUUA 21 645 29 126 1    0 0 1 2 6 6 6 1 5 4 39 1 2 21 59 126 54 116 103 0 32 20 21 7 13
mtr-miR2118 UUACCGAUUCCACCCAUUCCUA 22 3,000 250 760 39    0 0 0 0 0 0 0 0 0 0 0 0 0 237 414 760 183 208 452 475 39 63 58 71 40
mtr-miR2119 UCAAAGGGAGGUGUGGAGUAG 21 63 9 32 1    0 0 0 0 0 0 0 0 0 0 0 0 0 1 14 32 0 5 8 2 0 1 0 0 0
mtr-miR2199 UGAUACACUAGCACGGAUCAC 21 6,669 513 1,635 1    0 0 0 0 0 0 1 0 0 0 0 0 0 1,625 155 1,261 554 1,635 556 66 736 20 27 16 17
mtr-miR2585a CAGGAUUAGCGAUUACAGGGAC 22 12 4 10 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 10 1 0 1 0 0 0 0 0
mtr-miR2585b CAGGAUUAGCGAUUACAGGGAC 22 12 4 10 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 10 1 0 1 0 0 0 0 0
mtr-miR2585c CAGGAUUAGCGAUUACAGGGAC 22 12 4 10 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 10 1 0 1 0 0 0 0 0
mtr-miR2585d CAGGAUUAGCGAUUACAGGGAC 22 12 4 10 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 10 1 0 1 0 0 0 0 0
mtr-miR2586a CGAGGAGUGUCCGUGCUUCAU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2586b CGGUGUCGUAUCGGUGUUGGAC 22 18 4 7 1    0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 0 7 1 0 7 0 0 0 0 0
mtr-miR2587a UUGACCGUUCAUAUGAACCCUG 22 11 4 9 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 9 0 0 0 0 0 1 1 0
mtr-miR2587b UUGACCGUUCAUAUGAACCCUG 22 11 4 9 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 9 0 0 0 0 0 1 1 0
mtr-miR2587c UUGACCGUUCAUAUGAACCCUG 22 11 4 9 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 9 0 0 0 0 0 1 1 0
mtr-miR2587d UUGACCGUUCAUAUGAACCCUG 22 11 4 9 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 9 0 0 0 0 0 1 1 0
mtr-miR2587e UUGACCGUUCAUAUGAACCCUG 22 11 4 9 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 9 0 0 0 0 0 1 1 0
mtr-miR2587f UUGACCGUUCAUAUGAACCCUG 22 11 4 9 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 9 0 0 0 0 0 1 1 0
mtr-miR2587g UUGACCGUUCAUAUGAACCCUG 22 11 4 9 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 9 0 0 0 0 0 1 1 0
mtr-miR2588a UAACACUGUGCAACUAAGUCC 21 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1
mtr-miR2588b UAACACUGUGCAACUAAGUCC 21 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1
mtr-miR2589 GGCAUCCACGUGUGCUUCACCG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2590a AUCUAAAGGUGAUUAUUGUGCC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2590b AUCUAAAGGUGAUUAUUGUGCC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2590c AUCUAAAGGUGAUUAUUGUGCC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2590d AUCUAAAGGUGAUUAUUGUGCC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2590e AUCUAAAGGUGAUUAUUGUGCC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2590f AUCUAAAGGUGAUUAUUGUGCC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2590g AAAUGAGACUGAAAUCUAAAGGUG 24 89 8 19 1    0 0 0 0 0 0 0 0 0 0 0 0 0 4 14 3 15 15 13 19 0 1 1 1 3
mtr-miR2590h AGAAUGACAUGGCAGAAUAAUCAC 24 345 29 77 1    0 0 0 0 0 0 0 0 0 0 0 0 0 40 56 46 21 39 77 41 21 1 1 1 1
mtr-miR2590i AGAAUGACAUGGCAGAAUAAUCAC 24 345 29 77 1    0 0 0 0 0 0 0 0 0 0 0 0 0 40 56 46 21 39 77 41 21 1 1 1 1
mtr-miR2590j AGAAUGACAUGGCAGAAUAAUCAC 24 345 29 77 1    0 0 0 0 0 0 0 0 0 0 0 0 0 40 56 46 21 39 77 41 21 1 1 1 1
mtr-miR2591 GGAACUUCUACGGUACACCUGC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2592a-3p GAAAAACAUGAAUGUCGAGCG 21 582 53 167 6    0 0 0 0 0 0 0 0 0 0 0 0 0 12 7 10 6 14 8 15 0 138 95 110 167
mtr-miR2592a-5p CCCGGCAUUCAUGUUUUCCU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2592a.2-3p AAAUGCUUGAGUCCUGUUGUU 21 61 6 20 1    0 0 0 0 0 0 0 0 0 0 0 0 0 15 7 7 2 3 20 2 0 1 2 1 1
mtr-miR2592ab CAACAGGACUCAAGCAUUUCGC 22 163 14 34 4    0 0 0 0 0 0 0 0 0 0 0 0 0 13 34 34 15 9 19 10 4 7 4 8 6
mtr-miR2592ac CAACAGGACUCAAGCAUUUCGC 22 163 14 34 4    0 0 0 0 0 0 0 0 0 0 0 0 0 13 34 34 15 9 19 10 4 7 4 8 6
mtr-miR2592ad CAACAGGACUCAAGCAUUUCGC 22 163 14 34 4    0 0 0 0 0 0 0 0 0 0 0 0 0 13 34 34 15 9 19 10 4 7 4 8 6
mtr-miR2592ae CAACAGGACUCAAGCAUUUCG 21 286 24 79 4    0 0 0 0 0 0 0 0 0 0 0 0 0 32 41 79 35 20 39 9 11 6 4 4 6
mtr-miR2592af CAACAGGACUCAAGCAUUUCGC 22 163 14 34 4    0 0 0 0 0 0 0 0 0 0 0 0 0 13 34 34 15 9 19 10 4 7 4 8 6
mtr-miR2592ah CAACAGGACUCAAGCAUUUCGC 22 163 14 34 4    0 0 0 0 0 0 0 0 0 0 0 0 0 13 34 34 15 9 19 10 4 7 4 8 6
mtr-miR2592ai CAACAGGACUCAAGCAUUUCGC 22 163 14 34 4    0 0 0 0 0 0 0 0 0 0 0 0 0 13 34 34 15 9 19 10 4 7 4 8 6
mtr-miR2592aj CAACAGGACUCAAGCAUUUCGC 22 163 14 34 4    0 0 0 0 0 0 0 0 0 0 0 0 0 13 34 34 15 9 19 10 4 7 4 8 6
mtr-miR2592al CAACAGGACUCAAGCAUUUCGC 22 163 14 34 4    0 0 0 0 0 0 0 0 0 0 0 0 0 13 34 34 15 9 19 10 4 7 4 8 6
mtr-miR2592am CAACAGGACUCAAGCAUUUCGC 22 163 14 34 4    0 0 0 0 0 0 0 0 0 0 0 0 0 13 34 34 15 9 19 10 4 7 4 8 6
mtr-miR2592an AAAUGCUUGAGUCCUGUUGUU 21 61 6 20 1    0 0 0 0 0 0 0 0 0 0 0 0 0 15 7 7 2 3 20 2 0 1 2 1 1
mtr-miR2592ao AAAUGCUUGAGUCCUGUUGUU 21 61 6 20 1    0 0 0 0 0 0 0 0 0 0 0 0 0 15 7 7 2 3 20 2 0 1 2 1 1
mtr-miR2592ap AGGCUGGUUUAGAUGAAGGUA 21 883 74 341 1    0 0 0 0 0 0 0 0 0 0 0 0 0 163 85 125 29 95 341 29 11 1 1 1 2
mtr-miR2592aq AGGCUGGUUUAGAUGAAGGUA 21 883 74 341 1    0 0 0 0 0 0 0 0 0 0 0 0 0 163 85 125 29 95 341 29 11 1 1 1 2
mtr-miR2592ar AGGCUGGUUUAGAUGAAGGUA 21 883 74 341 1    0 0 0 0 0 0 0 0 0 0 0 0 0 163 85 125 29 95 341 29 11 1 1 1 2
mtr-miR2592as AGGCUGGUUUAGAUGAAGGUA 21 883 74 341 1    0 0 0 0 0 0 0 0 0 0 0 0 0 163 85 125 29 95 341 29 11 1 1 1 2
mtr-miR2592at AGGCUGGUUUAGAUGAAGGUA 21 883 74 341 1    0 0 0 0 0 0 0 0 0 0 0 0 0 163 85 125 29 95 341 29 11 1 1 1 2
mtr-miR2592au AGGCUGGUUUAGAUGAAGGUA 21 883 74 341 1    0 0 0 0 0 0 0 0 0 0 0 0 0 163 85 125 29 95 341 29 11 1 1 1 2
mtr-miR2592av AGGCUGGUUUAGAUGAAGGUA 21 883 74 341 1    0 0 0 0 0 0 0 0 0 0 0 0 0 163 85 125 29 95 341 29 11 1 1 1 2
mtr-miR2592aw AGGCUGGUUUAGAUGAAGGUA 21 883 74 341 1    0 0 0 0 0 0 0 0 0 0 0 0 0 163 85 125 29 95 341 29 11 1 1 1 2
mtr-miR2592ax AGGCUGGUUUAGAUGAAGGUA 21 883 74 341 1    0 0 0 0 0 0 0 0 0 0 0 0 0 163 85 125 29 95 341 29 11 1 1 1 2
mtr-miR2592ay AGGCUGGUUUAGAUGAAGGUA 21 883 74 341 1    0 0 0 0 0 0 0 0 0 0 0 0 0 163 85 125 29 95 341 29 11 1 1 1 2
mtr-miR2592az AGGCUGGUUUAGAUGAAGGUA 21 883 74 341 1    0 0 0 0 0 0 0 0 0 0 0 0 0 163 85 125 29 95 341 29 11 1 1 1 2
mtr-miR2592b-3p AAAUGCUUGAGUCCUGUUGUU 21 61 6 20 1    0 0 0 0 0 0 0 0 0 0 0 0 0 15 7 7 2 3 20 2 0 1 2 1 1
mtr-miR2592b-5p ACAACAGGACUCAAGCAUUUC 21 11 1 3 1    0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 0 0 0 2 0 1 1 1 3
mtr-miR2592ba AGGCUGGUUUAGAUGAAGGUA 21 883 74 341 1    0 0 0 0 0 0 0 0 0 0 0 0 0 163 85 125 29 95 341 29 11 1 1 1 2
mtr-miR2592bb AGGCUGGUUUAGAUGAAGGUA 21 883 74 341 1    0 0 0 0 0 0 0 0 0 0 0 0 0 163 85 125 29 95 341 29 11 1 1 1 2
mtr-miR2592bc AGGCUGGUUUAGAUGAAGGUA 21 883 74 341 1    0 0 0 0 0 0 0 0 0 0 0 0 0 163 85 125 29 95 341 29 11 1 1 1 2
mtr-miR2592bd AGGCUGGUUUAGAUGAAGGUA 21 883 74 341 1    0 0 0 0 0 0 0 0 0 0 0 0 0 163 85 125 29 95 341 29 11 1 1 1 2
mtr-miR2592be AGGCUGGUUUAGAUGAAGGUA 21 883 74 341 1    0 0 0 0 0 0 0 0 0 0 0 0 0 163 85 125 29 95 341 29 11 1 1 1 2
mtr-miR2592bf AGGCUGGUUUAGAUGAAGGUA 21 883 74 341 1    0 0 0 0 0 0 0 0 0 0 0 0 0 163 85 125 29 95 341 29 11 1 1 1 2
mtr-miR2592bg AGGCUGGUUUAGAUGAAGGUA 21 883 74 341 1    0 0 0 0 0 0 0 0 0 0 0 0 0 163 85 125 29 95 341 29 11 1 1 1 2
mtr-miR2592bi UGGAACAUUGGGAAUGCCGGU 21 64 8 13 4    0 0 0 0 0 0 0 0 0 0 0 0 0 9 7 4 7 13 7 10 7 0 0 0 0
mtr-miR2592bj UGGAACAUUGGGAAUGCCGGU 21 64 8 13 4    0 0 0 0 0 0 0 0 0 0 0 0 0 9 7 4 7 13 7 10 7 0 0 0 0
mtr-miR2592bk UGGAACAUUGGGAAUGCCGGU 21 64 8 13 4    0 0 0 0 0 0 0 0 0 0 0 0 0 9 7 4 7 13 7 10 7 0 0 0 0
mtr-miR2592bl-3p GAGUAAUUCAAACUUGUUAAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2592bl-5p UGGCAAGUUUGAAUUUACCUCA 22 17 4 8 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 7 8 0 0 0 0 0
mtr-miR2592bm-3p GGAAAACAUGAAUGUCGGGUG 21 132 15 98 1    0 0 0 0 0 0 0 0 0 0 0 0 0 13 1 10 2 0 98 0 0 3 1 3 1
mtr-miR2592bm-5p CUCGGCAUUCAUGUUUUUCCUU 22 84 8 34 1    0 0 0 0 0 0 0 0 0 0 0 0 0 10 11 14 5 4 34 1 0 1 1 1 2
mtr-miR2592bn-3p GGAAAACAUGAAUGUCGGGUG 21 132 15 98 1    0 0 0 0 0 0 0 0 0 0 0 0 0 13 1 10 2 0 98 0 0 3 1 3 1
mtr-miR2592bn-5p CUCGGCAUUCAUGUUUUUCCUU 22 84 8 34 1    0 0 0 0 0 0 0 0 0 0 0 0 0 10 11 14 5 4 34 1 0 1 1 1 2
mtr-miR2592bo-3p AAAUGCUUGAGUCCUGUUGUU 21 61 6 20 1    0 0 0 0 0 0 0 0 0 0 0 0 0 15 7 7 2 3 20 2 0 1 2 1 1
mtr-miR2592bo-5p CGGCCAGGACUCAAGCAUUUCG 22 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0
mtr-miR2592bp-3p CGGCAGAACUCCAGCAUUCGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2592bp-5p AAAUGCUUGAGUCCUGUUGUU 21 61 6 20 1    0 0 0 0 0 0 0 0 0 0 0 0 0 15 7 7 2 3 20 2 0 1 2 1 1
mtr-miR2592bq-3p AAAUGCUUGAGUCAUGUUGUU 21 7 2 3 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 3 0 0 2 0 1 0 0 0
mtr-miR2592bq-5p CGACCAUGACUCAAGUAUUAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2592br-3p AAAUGCUUGAGUCCUGUUGUU 21 61 6 20 1    0 0 0 0 0 0 0 0 0 0 0 0 0 15 7 7 2 3 20 2 0 1 2 1 1
mtr-miR2592br-5p GACUAGGACUCAAGUAUUUCG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2592c AAAUGCUUGAGUCCUGUUGUU 21 61 6 20 1    0 0 0 0 0 0 0 0 0 0 0 0 0 15 7 7 2 3 20 2 0 1 2 1 1
mtr-miR2592d-3p AAAUGCUUGAGUCCUGUUGUU 21 61 6 20 1    0 0 0 0 0 0 0 0 0 0 0 0 0 15 7 7 2 3 20 2 0 1 2 1 1
mtr-miR2592d-5p CAACAGGACUCAAGCAUUUCGC 22 163 14 34 4    0 0 0 0 0 0 0 0 0 0 0 0 0 13 34 34 15 9 19 10 4 7 4 8 6
mtr-miR2592e-3p AAAUGCUUGAGUCCUGUUGUU 21 61 6 20 1    0 0 0 0 0 0 0 0 0 0 0 0 0 15 7 7 2 3 20 2 0 1 2 1 1
mtr-miR2592e-5p CAACAGGACUCAAGCAUUUCGC 22 163 14 34 4    0 0 0 0 0 0 0 0 0 0 0 0 0 13 34 34 15 9 19 10 4 7 4 8 6
mtr-miR2592f AAAUGCUUGAGUCCUGUUGUU 21 61 6 20 1    0 0 0 0 0 0 0 0 0 0 0 0 0 15 7 7 2 3 20 2 0 1 2 1 1
mtr-miR2592g AAAUGCUUGAGUCCUGUUGUU 21 61 6 20 1    0 0 0 0 0 0 0 0 0 0 0 0 0 15 7 7 2 3 20 2 0 1 2 1 1
mtr-miR2592h AAAUGCUUGAGUCCUGUUGUU 21 61 6 20 1    0 0 0 0 0 0 0 0 0 0 0 0 0 15 7 7 2 3 20 2 0 1 2 1 1
mtr-miR2592i AAAUGCUUGAGUCCUGUUGUU 21 61 6 20 1    0 0 0 0 0 0 0 0 0 0 0 0 0 15 7 7 2 3 20 2 0 1 2 1 1
mtr-miR2592j AAAUGCUUGAGUCCUGUUGUU 21 61 6 20 1    0 0 0 0 0 0 0 0 0 0 0 0 0 15 7 7 2 3 20 2 0 1 2 1 1
mtr-miR2592k AAAUGCUUGAGUCCUGUUGUU 21 61 6 20 1    0 0 0 0 0 0 0 0 0 0 0 0 0 15 7 7 2 3 20 2 0 1 2 1 1
mtr-miR2592l AAAUGCUUGAGUCCUGUUGUU 21 61 6 20 1    0 0 0 0 0 0 0 0 0 0 0 0 0 15 7 7 2 3 20 2 0 1 2 1 1
mtr-miR2592m AAAUGCUUGAGUCCUGUUGUU 21 61 6 20 1    0 0 0 0 0 0 0 0 0 0 0 0 0 15 7 7 2 3 20 2 0 1 2 1 1
mtr-miR2592n AAAUGCUUGAGUCCUGUUGUU 21 61 6 20 1    0 0 0 0 0 0 0 0 0 0 0 0 0 15 7 7 2 3 20 2 0 1 2 1 1
mtr-miR2592o-3p AAAUGCUUGAGUCCUGUUGUU 21 61 6 20 1    0 0 0 0 0 0 0 0 0 0 0 0 0 15 7 7 2 3 20 2 0 1 2 1 1
mtr-miR2592o-5p CAACAGGACUCAAGCAUUUCGC 22 163 14 34 4    0 0 0 0 0 0 0 0 0 0 0 0 0 13 34 34 15 9 19 10 4 7 4 8 6
mtr-miR2592p AAAUGCUUGAGUCCUGUUGUU 21 61 6 20 1    0 0 0 0 0 0 0 0 0 0 0 0 0 15 7 7 2 3 20 2 0 1 2 1 1
mtr-miR2592q-3p AAAUGCUUGAGUCCUGUUGUU 21 61 6 20 1    0 0 0 0 0 0 0 0 0 0 0 0 0 15 7 7 2 3 20 2 0 1 2 1 1
mtr-miR2592q-5p CAACAGGACUCAAGCAUUUCGC 22 163 14 34 4    0 0 0 0 0 0 0 0 0 0 0 0 0 13 34 34 15 9 19 10 4 7 4 8 6
mtr-miR2592r AAAUGCUUGAGUCCUGUUGUU 21 61 6 20 1    0 0 0 0 0 0 0 0 0 0 0 0 0 15 7 7 2 3 20 2 0 1 2 1 1
mtr-miR2592s-3p AAAUGCUUGAGUCAUGUUGUU 21 7 2 3 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 3 0 0 2 0 1 0 0 0
mtr-miR2592s-5p ACAACAGGACUCAAGCAUUUC 21 11 1 3 1    0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 0 0 0 2 0 1 1 1 3
mtr-miR2592t CAACAGGACUCAAGCAUUUCGC 22 163 14 34 4    0 0 0 0 0 0 0 0 0 0 0 0 0 13 34 34 15 9 19 10 4 7 4 8 6
mtr-miR2592u CAACAGGACUCAAGCAUUUCGC 22 163 14 34 4    0 0 0 0 0 0 0 0 0 0 0 0 0 13 34 34 15 9 19 10 4 7 4 8 6
mtr-miR2592v CAACAGGACUCAAGCAUUUCGC 22 163 14 34 4    0 0 0 0 0 0 0 0 0 0 0 0 0 13 34 34 15 9 19 10 4 7 4 8 6
mtr-miR2592w CAACAGGACUCAAGCAUUUCGC 22 163 14 34 4    0 0 0 0 0 0 0 0 0 0 0 0 0 13 34 34 15 9 19 10 4 7 4 8 6
mtr-miR2592x CAACAGGACUCAAGCAUUUCGC 22 163 14 34 4    0 0 0 0 0 0 0 0 0 0 0 0 0 13 34 34 15 9 19 10 4 7 4 8 6
mtr-miR2592y CAACAGGACUCAAGCAUUUCGC 22 163 14 34 4    0 0 0 0 0 0 0 0 0 0 0 0 0 13 34 34 15 9 19 10 4 7 4 8 6
mtr-miR2592z CAACAGGACUCAAGCAUUUCGC 22 163 14 34 4    0 0 0 0 0 0 0 0 0 0 0 0 0 13 34 34 15 9 19 10 4 7 4 8 6
mtr-miR2593a UUAAAUGAAUGAACCUAGAAU 21 13 3 5 1    0 0 0 0 0 0 0 0 0 0 0 0 0 2 1 3 5 0 2 0 0 0 0 0 0
mtr-miR2593b UUAAAUGAAUGAACCUAGAAU 21 13 3 5 1    0 0 0 0 0 0 0 0 0 0 0 0 0 2 1 3 5 0 2 0 0 0 0 0 0
mtr-miR2593c UUAAAUGAAUGAACCUAGAAU 21 13 3 5 1    0 0 0 0 0 0 0 0 0 0 0 0 0 2 1 3 5 0 2 0 0 0 0 0 0
mtr-miR2593d AUACAUCAUUGAUUGAAUGAACCU 24 94 13 31 2    0 0 0 0 0 0 0 0 0 0 0 0 0 4 18 15 31 15 9 2 0 0 0 0 0
mtr-miR2593e AUACAUCAUUGAUUGAAUGAACCU 24 94 13 31 2    0 0 0 0 0 0 0 0 0 0 0 0 0 4 18 15 31 15 9 2 0 0 0 0 0
mtr-miR2594 CCAUGGCCAAGGAUGCCAGAG 21 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0
mtr-miR2595 UACAUUUUCUUCUUUAUGUCU 21 4 2 3 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 3 0 0 0 0 0 0 0 0 0
mtr-miR2596 UCUAUUUCAUUGUUCCACACA 21 4 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 1 1 0 1
mtr-miR2597 UUUGGUACUUCGUCGAUUUGA 21 165 15 43 1    0 0 0 0 0 0 0 0 0 0 0 0 0 1 9 3 6 14 2 12 0 43 25 16 34
mtr-miR2598 CUAAGGGUGAUUAUUCUGCCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2599 UGGGUACAAGGAAUCUACUUU 21 2 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 1 0 0 0 0 0
mtr-miR2600a ACAUUAGCCAAUCACAAUGCC 21 6 3 4 2    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 4 0 0 0 0
mtr-miR2600b AAGCAUUGUGGCAUUGUGAUUGGU 24 114 10 27 1    0 0 0 0 0 0 0 0 0 0 0 0 0 6 22 10 19 27 20 5 0 1 1 1 2
mtr-miR2600c AAGCAUUGUGGCAUUGUGAUUGGU 24 114 10 27 1    0 0 0 0 0 0 0 0 0 0 0 0 0 6 22 10 19 27 20 5 0 1 1 1 2
mtr-miR2600d AAGCAUUGUGGCAUUGUGAUUGGU 24 114 10 27 1    0 0 0 0 0 0 0 0 0 0 0 0 0 6 22 10 19 27 20 5 0 1 1 1 2
mtr-miR2600e AAGCAUUGUGGCAUUGUGAUUGGC 24 77 6 16 1    0 0 0 0 0 0 0 0 0 0 0 0 0 3 11 3 9 16 12 5 14 1 1 1 1
mtr-miR2601 UAUUUGGUAUCGCUUUGGUCCC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2602a UGGCAGUGAUUGCCACGUCAU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2602b UGGCAGUGAUUGCCACGUCAU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2603 UUUGGUAUUGGUCCCUGCACUU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2604 UAAUUUUUAUGUGGGAGUGUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2605 ACUUAGUUUAUAUGACCUAC 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2606a UACAAUUCCUUAGGUGCUUUU 21 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0
mtr-miR2606b UACAAUUCCUUAGGUGCUUUU 21 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0
mtr-miR2606c AGUUAAGAACCAUACAAAAAACAC 24 14 2 3 1    0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 1 3 3 2 2 0 0 0 0 0
mtr-miR2607 AUGUGAUUAUGUGAUAAGUGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2608 GUUGUACAUAUAUCACUACUCU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2609a UGGAAGUAAUAGGUUCUCACU 21 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0
mtr-miR2609b UGGAAGUAAUAGGUUCUCACU 21 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0
mtr-miR2610a AGAUUGAGACUUGUAUGGCUU 21 19 2 4 1    0 0 0 0 0 0 0 0 0 0 0 0 0 1 3 2 0 0 4 2 4 1 1 0 1
mtr-miR2610b AGAUUGAGACUUGUAUGGCUU 21 19 2 4 1    0 0 0 0 0 0 0 0 0 0 0 0 0 1 3 2 0 0 4 2 4 1 1 0 1
mtr-miR2611 UAUUUGUCAGUGUUUGAUGAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2612 UGAUAGUGUCAACUAGUACAG 21 8 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 1 0 1 0 1 1 1 1
mtr-miR2613 CGGUCGCCGGUGGUCAAUGGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2614 CGGUUCGACUCGUUAGGUUC 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2615a CCUGAUCGCAUUUUAAAAGGC 21 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0
mtr-miR2615b CCUGAUCGCAUUUUAAAAGGC 21 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0
mtr-miR2615c CCUGAUCGCAUUUUAAAAGGC 21 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0
mtr-miR2616 AUUGGGUUUGGUUCGGGCGGAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2617a UGUAGUGUAGCAUGCCCGUU 20 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0
mtr-miR2617b UGUAGUGUAGCAUGCCCGUU 20 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0
mtr-miR2617c UGUAGUGUAGCAUGCCCGUU 20 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0
mtr-miR2618a GUGAAUUCAGUUUACGUACGUU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2618b GUGAAUUCAGUUUACGUACGUU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2619a ACAUAGGAGGCUGUUUUGUAU 21 2 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 1
mtr-miR2619b-3p CCAAAGAAUCAAUACAUAGGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2619b-5p AUAUGUUUUGAUUCUUUGGCA 21 18 4 6 2    0 0 0 0 0 0 0 0 0 0 0 0 0 6 3 2 5 0 2 0 0 0 0 0 0
mtr-miR2620 UUCUGAUAGACACCGGCUCUGC 22 32 3 7 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 5 2 1 0 4 4 7 3 4
mtr-miR2621 AGCUUGGGCUAGGAAUUUGUGC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2622 UUUGUGUGCCAUCGUGAACUUA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2623 UCGGCUGUACUGUCCUUCAUG 21 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0
mtr-miR2624 CGAAAGACGAGGUUGCCGGCU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2625 CCAUCGUGCCACGUUACGAUCC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2626 AACGUCGGGAUUUAGGGUGUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2627 UUUCGGUAGUUAACUGCUGAGG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2628 CAUGAAAGAAUGAUGAGUAA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2629a AGUUUUCCUCGGUAGUUAACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2629b AGUUUUCCUCGGUAGUUAACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2629c AGUUUUCCUCGGUAGUUAACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2629d AGUUUUCCUCGGUAGUUAACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2629e AGUUUUCCUCGGUAGUUAACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2629f AGUUUUCCUCGGUAGUUAACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2629g AGUUUUCCUCGGUAGUUAACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2629h GCAGAAGAUCCUCGGCAGUUAACU 24 63 6 21 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 4 2 9 7 12 21 1 1 2 0
mtr-miR2630a UGGUUUUGGUCCUUGGUAUUU 21 16 2 7 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 1 1 2 7 1 0 0 1 0 0
mtr-miR2630b UGGUUUUGGUCCUUGGUAUUU 21 16 2 7 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 1 1 2 7 1 0 0 1 0 0
mtr-miR2630c UGGUUUUGGUCCUUGGUAUUU 21 16 2 7 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 1 1 2 7 1 0 0 1 0 0
mtr-miR2630d UGGUUUUGGUCCUUGGUAUUU 21 16 2 7 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 1 1 2 7 1 0 0 1 0 0
mtr-miR2630e UGGUUUUGGUCCUUGGUAUUU 21 16 2 7 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 1 1 2 7 1 0 0 1 0 0
mtr-miR2630f UGGUUUUGGUCCUUGGUAUUU 21 16 2 7 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 1 1 2 7 1 0 0 1 0 0
mtr-miR2630g UGGUUUUGGUCCUUGGUAUUU 21 16 2 7 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 1 1 2 7 1 0 0 1 0 0
mtr-miR2630h UGGUUUUGGUCCUUGGUAUUU 21 16 2 7 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 1 1 2 7 1 0 0 1 0 0
mtr-miR2630i UGGUUUUGGUCCUUGGUAUUU 21 16 2 7 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 1 1 2 7 1 0 0 1 0 0
mtr-miR2630j UGGUUUUGGUCCUUGGUAUUU 21 16 2 7 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 1 1 2 7 1 0 0 1 0 0
mtr-miR2630k UGGUUUUGGUCCUUGGUAUUU 21 16 2 7 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 1 1 2 7 1 0 0 1 0 0
mtr-miR2630l UGGUUUUGGUCCUUGGUAUUU 21 16 2 7 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 1 1 2 7 1 0 0 1 0 0
mtr-miR2630m UGGUUUUGGUCCUUGGUAUUU 21 16 2 7 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 1 1 2 7 1 0 0 1 0 0
mtr-miR2630n UGGUUUUGGUCCUUGGUAUUU 21 16 2 7 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 1 1 2 7 1 0 0 1 0 0
mtr-miR2630o UGGUUUUGGUCCUUGGUAUUU 21 16 2 7 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 1 1 2 7 1 0 0 1 0 0
mtr-miR2630p UGGUUUUGGUCCUUGGUAUUU 21 16 2 7 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 1 1 2 7 1 0 0 1 0 0
mtr-miR2630q UGGUUUUGGUCCUUGGUAUUU 21 16 2 7 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 1 1 2 7 1 0 0 1 0 0
mtr-miR2630r UGGUUUUGGUCCUUGGUAUUU 21 16 2 7 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 1 1 2 7 1 0 0 1 0 0
mtr-miR2630s UGGUUUUGGUCCUUGGUAUUU 21 16 2 7 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 1 1 2 7 1 0 0 1 0 0
mtr-miR2630t UGGUUUUGGUCCUUGGUAUUU 21 16 2 7 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 1 1 2 7 1 0 0 1 0 0
mtr-miR2630u UGGUUUUGGUCCUUGGUAUUU 21 16 2 7 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 1 1 2 7 1 0 0 1 0 0
mtr-miR2630v UGGUUUUGGUCCUUGGUAUUU 21 16 2 7 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 1 1 2 7 1 0 0 1 0 0
mtr-miR2630w UGGUUUUGGUCCUUGGUAUUU 21 16 2 7 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 1 1 2 7 1 0 0 1 0 0
mtr-miR2630x UGGUUUUGGUCCUUGGUAUUU 21 16 2 7 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 1 1 2 7 1 0 0 1 0 0
mtr-miR2630y UGGUUUUGGUCCUUGGUAUUU 21 16 2 7 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 1 1 2 7 1 0 0 1 0 0
mtr-miR2631 UGACACGCCACGUGGCACACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2632a CCUGAAGUUACUAAUCCUUCCA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2632b CCUGAAGUUACUAAUCCUUCCA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2632c CCUGAAGUUACUAAUCCUUCCA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2633 UGACAUUUUGCUCCAGAUUCA 21 296 30 127 1    0 0 0 0 0 0 0 0 0 0 0 0 0 11 49 127 29 44 31 0 0 1 2 1 1
mtr-miR2634 UUUAUUCUCAGUUUGUUGCUC 21 37 4 9 1    0 0 0 0 0 0 0 0 0 0 0 0 0 1 7 9 2 3 3 0 0 3 1 1 7
mtr-miR2635 AUUAUUGUCAACGUGACUAG 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2636 UUUGGUUAGUGUGCUGAAUAU 21 8 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 1 1 0 0 1 1 1 1
mtr-miR2637 AAAUACUUCCUCUGAUCACUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2638a AUGAUUAAUAUUUGCAGUGGC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2638b AUGAUUAAUAUUUGCAGUGGC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2639 UAGUCGGCUUACGUCACCUUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2640 UUCCUUGCCGGAGCUGGACUAC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2641 GUUUGAUCCUUUACGUUUAU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2642 AUGAGUUUCAUCAAAUCAUGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2643a UUUGGGAUCAGAAAUUAGAGA 21 255 23 59 3    0 0 0 0 0 0 0 0 0 0 0 0 0 59 46 39 12 15 52 10 0 8 3 3 8
mtr-miR2643b-3p UUUGGGAUCAGAAAUUAGAGA 21 255 23 59 3    0 0 0 0 0 0 0 0 0 0 0 0 0 59 46 39 12 15 52 10 0 8 3 3 8
mtr-miR2643b-5p UCUAAUCUCUGUUCCCAAUUA 21 5 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 1 1 0 1
mtr-miR2644 CACUUCAGAUUGAUGGUGUGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2645 UUUCUAGAGAUGAGCAUAUAU 21 8 2 4 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 4 0 1 0 0 0 0 1
mtr-miR2646a CAUGACAUUUAGUGAUGAUGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2646b CAUGACAUUUAGUGAUGAUGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2647a AUUCACGGGGACGAACCUCCU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2647b AUUCACGGGGACGAACCUCCU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2647c AUUCACGGGGACGAACCUCCU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2648 UAGCCAAUGGGAAUAACAGAU 21 40 4 9 1    0 0 0 0 0 0 0 0 0 0 0 0 0 3 5 9 3 0 6 2 4 2 3 1 2
mtr-miR2649 AAAGGUGCCAAUUAUGAGUGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2650 AACUUAAAUAUGUUUUCAGUCC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2651 UUUGAUUGGUAUGCCUGCAUU 21 364 30 148 2    0 0 0 0 0 0 0 0 0 0 0 0 0 148 39 26 32 17 20 41 28 3 4 2 4
mtr-miR2652a UAUGCAGGGUGCAUAAGGAUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2652b UAUGCAGGGUGCAUAAGGAUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2652c UAUGCAGGGUGCAUAAGGAUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2652d UAUGCAGGGUGCAUAAGGAUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2652e UAUGCAGGGUGCAUAAGGAUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2652f UAUGCAGGGUGCAUAAGGAUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2652g UAUGCAGGGUGCAUAAGGAUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2652h UAUGCAGGGUGCAUAAGGAUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2652i UAUGCAGGGUGCAUAAGGAUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2652j UAUGCAGGGUGCAUAAGGAUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2652k UAUGCAGGGUGCAUAAGGAUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2652l UAUGCAGGGUGCAUAAGGAUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2652m UAUGCAGGGUGCAUAAGGAUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2653a UCACGCUGCUGUGAACAUGAU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2653b UCACGCUGCUGUGAACAUGAU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2653c UCACGCUGCUGUGAACAUGAU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2653d UCACGCUGCUGUGAACAUGAU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2654 AUUCAGGGACAAAGUGUGCG 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2655a CGUUUAGGUCCCUUAACUUUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2655b CGUUUUGGUCCCUUAACUUUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2655c CGUUUAGGUCCCUUAACUUUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2655d CGUUUAGGUCCCUUAACUUUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2655e CGUUUAGGUCCCUUAACUUUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2655f CGUUUAGGUCCCUUAACUUUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2655g CGUUUAGGUCCCUUAACUUUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2655h CGUUUAGGUCCCUUAACUUUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2655i CGUUUAGGUCCCUUAACUUUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2655j CGUUUAGGUCCCUUAACUUUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2655k CGUUUAGGUCCCUUAACUUUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2655l CGUUUAGGUCCCUUAACUUUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2655m CGUUUAGGUCCCUUAACUUUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2655n CGUUUAGGUCCCUUAACUUUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2655o CGUUUAGGUCCCUUAACUUUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2656a AAGUUGCAUAAUCGAGUUGG 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2656b AAGUUGCAUAAUCGAGUUGG 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2656c AAGUUGCAUAAUCGAGUUGG 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2656d AAGUUGCAUAAUCGAGUUGG 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2656e AAGUUGCAUAAUCGAGUUGG 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2657 UGUUAUUUCAUCGAUUUUGUUG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2658 AUGUGACCUUGUAUAUGAUC 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2659a CCAUGGGUGCGACUUGGUAAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2659b CCAUGGGUGCGACUUGGUAAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2659c CCAUGGGUGCGACUUGGUAAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2659d CCAUGGGUGCGACUUGGUAAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2659e CCAUGGGUGCGACUUGGUAAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2659f CCAUGGGUGCGACUUGGUAAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2659g CCAUGGGUGCGACUUGGUAAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2659h CCAUGGGUGCGACUUGGUAAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2659i CCAUGGGUGCGACUUGGUAAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2659j CCAUGGGUGCGACUUGGUAAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2659k CCAUGGGUGCGACUUGGUAAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2660 UAAGACAUCAGCUAUAAGCUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2661 UAGGUUUGAGAAAAUGGGCAG 21 520 43 214 1    0 0 0 0 0 0 0 0 0 0 0 0 0 24 9 214 9 140 58 29 18 8 8 1 2
mtr-miR2662 GAGUAAAAAUGUGAACCGAAU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2663 UUAGAGAGGGCGUUACAAUU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2664a AAUUGUGGUGGGUUGACAGUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2664b AAUUGUGGUGGGUUGACAGUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2665 UGAUUUCAGGUCAAGAAUUGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2666 CGAAAGUGAGGAUAUCAAGGA 21 101 9 20 1    0 0 0 0 0 0 0 0 0 0 0 0 0 3 20 8 19 15 13 9 11 0 1 1 1
mtr-miR2667a UCCUUGAUCUGACGGCUACC 20 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1
mtr-miR2667b UCCUUGAUCUGACGGCUACC 20 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1
mtr-miR2668 UUCAUCCUUGCAAUUAGGGGUC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2669a AAAGUUCAGUCUUCAUAGUAUC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2669b AAAGUUCAGUCUUCAUAGUAUC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2670a CAAGAAGGUUGCUCACUAUUU 21 7 1 2 1    0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 1 0 1 2 0 0 0 0 0
mtr-miR2670b CAAGAAGGUUGCUCACUAUUU 21 7 1 2 1    0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 1 0 1 2 0 0 0 0 0
mtr-miR2670c CAAGAAGGUUGCUCACUAUUU 21 7 1 2 1    0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 1 0 1 2 0 0 0 0 0
mtr-miR2670d CAAGAAGGUUGCUCACUAUUU 21 7 1 2 1    0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 1 0 1 2 0 0 0 0 0
mtr-miR2670e UCUCAACAGGACGGAUCACUA 21 149 19 70 1    0 0 0 0 0 0 0 0 0 0 0 0 0 3 70 4 2 62 6 0 0 1 1 0 0
mtr-miR2670f AGUGGUCUGUUAGGUUGGGGA 21 8 2 4 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 0 0 1 0 0 0 0 1 1 1
mtr-miR2670g AGUGGUCUGUUAGGUUGGGGA 21 8 2 4 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 0 0 1 0 0 0 0 1 1 1
mtr-miR2671a UUAAAAGUUUCGUUUCGGUCC 21 3 2 2 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 1 0 0
mtr-miR2671b UUAAAAGUUUCGUUUCGGUCC 21 3 2 2 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 1 0 0
mtr-miR2671c UUAAAAGUUUCGUUUCGGUCC 21 3 2 2 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 1 0 0
mtr-miR2671d UUAAAAGUUUCGUUUCGGUCC 21 3 2 2 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 1 0 0
mtr-miR2671e UUAAAAGUUUCGUUUCGGUCC 21 3 2 2 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 1 0 0
mtr-miR2671f UUAAAAGUUUCGUUUCGGUCC 21 3 2 2 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 1 0 0
mtr-miR2671g UUAAAAGUUUCGUUUCGGUCC 21 3 2 2 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 1 0 0
mtr-miR2671h UUAAAAGUUUCGUUUCGGUCC 21 3 2 2 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 1 0 0
mtr-miR2671i UUAAAAGUUUCGUUUCGGUCC 21 3 2 2 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 1 0 0
mtr-miR2671j UUAAAAGUUUCGUUUCGGUCC 21 3 2 2 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 1 0 0
mtr-miR2672 UUAAUCGACCAAGUGGGUACUA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2673a CCUCUUCCUCUUCCUCUUCCAC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2673b CCUCUUCCUCUUCCUCUUCCAC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2674 CACUCGCUUUGGAAGUCAUGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2675 CGAGGCAUAUUUGCAGGGAUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2676a CAUUGUUUGGAUAAUAAUUUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2676b CAUUGUUUGGAUAAUAAUUUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2676c CAUUGUUUGGAUAAUAAUUUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2676d CAUUGUUUGGAUAAUAAUUUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2676e CAUUGUUUGGAUAAUAAUUUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2676f CAUUGUUUGGAUAAUAAUUUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2677 UUUAUUGAUAUUGCUAAUAGAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2678 UGAAAUUGUUGCGAGUGUCUU 21 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1
mtr-miR2679a CUUUUCACUUUCGAACGGGUG 21 11 2 7 1    0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 7 0 1 0 0 0 0 0 1 1
mtr-miR2679b CUUUUCACUUUCGAACGGGUG 21 11 2 7 1    0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 7 0 1 0 0 0 0 0 1 1
mtr-miR2679c CUUUUCACUUUCGAACGGGUG 21 11 2 7 1    0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 7 0 1 0 0 0 0 0 1 1
mtr-miR2680a UCCUCGGUACCUAUGUUGAU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2680b UCCUCGGUACCUAUGUUGAU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2680c UCCUCGGUACCUAUGUUGAU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2680d UCCUCGGUACCUAUGUUGAU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR2680e UCCUCGGUACCUAUGUUGAU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR319a-3p UUGGACUGAAGGGAGCUCCC 20 11,727 586 3,779 1    1 1 11 2 0 0 0 4 16 1 0 2 4 5 4 2 1 3 3 0 11 2,975 2,633 2,269 3,779
mtr-miR319a-5p AGAGCUUCCUUCAGUCCACUC 21 7 1 1 1    1 0 0 0 1 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1
mtr-miR319b-3p UUGGACUGAAGGGAGCUCCC 20 11,727 586 3,779 1    1 1 11 2 0 0 0 4 16 1 0 2 4 5 4 2 1 3 3 0 11 2,975 2,633 2,269 3,779
mtr-miR319b-5p GAGCUUUCUUUAGUCCACUCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR319c-3p UUGGACUGAAGGGAGCUCCCA 21 441 63 156 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 4 156 85 73 121
mtr-miR319c-5p GGAGUUCCUUGCAGCCCAAAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR319d-3p UUGGACUGAAGGGAGCUCCCU 21 10,813 470 3,789 1    8 2 40 10 6 12 62 6 11 1 0 0 33 2 3 15 2 17 11 2 4 3,049 1,925 1,803 3,789
mtr-miR319d-5p AGAGCUCUCUUCAGUCCACUC 21 5 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 1 1 1
mtr-miR390 AAGCUCAGGAGGGAUAGCGCC 21 7,460 298 2,303 14    97 481 467 58 168 173 111 71 368 26 2,303 427 669 122 267 239 710 176 160 46 231 23 34 19 14
mtr-miR393a UCCAAAGGGAUCGCAUUGAUC 21 114 10 36 1    36 30 14 0 0 0 2 5 0 7 0 13 2 0 2 1 0 0 0 0 0 1 1 0 0
mtr-miR393b-3p UUUGGGAUCAUGCUAUCCCUU 21 15 3 10 1    1 0 0 10 2 1 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR393b-5p UCCAAAGGGAUCGCAUUGAUC 21 114 10 36 1    36 30 14 0 0 0 2 5 0 7 0 13 2 0 2 1 0 0 0 0 0 1 1 0 0
mtr-miR395a AUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR395b AUGAAGUAUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR395c AUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR395d AUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR395e AUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR395f AUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR395g UUGAAGUGUUUGGGGGAACUC 21 1 1 1 1    0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR395h AUGAAGUGUUUGGGGGAACUU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR395i AUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR395j AUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR395k UUGAAGCGUUUGGGGGAACUC 21 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0
mtr-miR395l AUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR395m AUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR395n AUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR395o AUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR396a-3p GCUCAAGAAAGCUGUGGGAGA 21 24,287 971 7,055 25    138 27 189 271 4,108 748 7,055 456 4,127 48 166 298 215 3,474 253 519 67 91 1,733 31 96 42 25 41 69
mtr-miR396a-5p UUCCACAGCUUUCUUGAACUU 21 4,015 167 629 1    7 1 1 4 8 24 11 2 1 6 52 0 14 446 345 282 95 346 629 27 4 555 306 374 475
mtr-miR396b-3p GUUCAAUAAAGCUGUGGGAAG 21 1,784 78 285 4    53 136 23 10 73 22 98 34 65 4 0 31 52 115 60 20 10 9 196 16 0 285 182 126 164
mtr-miR396b-5p UUCCACAGCUUUCUUGAACUG 21 9,537 381 1,356 9    117 63 11 57 97 1,082 55 70 9 377 105 22 477 30 1,018 264 873 1,356 992 1,214 75 241 207 175 550
mtr-miR396c AUUCAAGAAGGUCGUGGAAAA 21 402 80 366 1    0 0 0 0 0 0 0 0 0 0 0 0 0 4 0 25 0 0 6 0 366 0 0 0 1
mtr-miR397-3p UCUACGCUACACUCAAUUAUG 21 3 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 1 0 0 0
mtr-miR397-5p UCAUUGAGUGCAGCGUUGAUG 21 2,405 115 1,930 1    213 23 8 3 1 3 1 1,930 0 4 4 37 123 1 24 0 0 5 13 2 0 1 7 1 1
mtr-miR398a-3p UGUGUUCUCAGGUCACCCCUU 21 37 5 22 1    4 0 0 0 0 0 0 4 0 0 0 0 22 0 2 1 0 2 0 0 0 1 1 0 0
mtr-miR398a-5p GGAGUGACACUGAGAACACAAG 22 375 34 134 1    0 0 0 0 0 0 0 0 0 0 0 0 0 1 50 116 2 24 44 134 0 1 1 1 1
mtr-miR398b UGUGUUCUCAGGUCGCCCCUG 21 28,374 1,576 15,876 1    41 13 0 0 1 0 0 92 0 0 0 31 7 1 62 1 36 364 66 43 7 4,134 15,876 4,550 3,049
mtr-miR398c UGUGUUCUCAGGUCGCCCCUG 21 28,374 1,576 15,876 1    41 13 0 0 1 0 0 92 0 0 0 31 7 1 62 1 36 364 66 43 7 4,134 15,876 4,550 3,049
mtr-miR399a UGCCAAAGGAGAUUUGCCCAG 21 230 23 92 1    0 0 92 2 3 4 1 60 2 0 0 28 37 0 1 0 0 0 0 0 0 0 0 0 0
mtr-miR399b UGCCAAAGGAGAGCUGCCCUG 21 38 5 17 1    0 1 3 0 0 0 0 0 1 0 0 11 17 0 2 1 0 2 0 0 0 0 0 0 0
mtr-miR399c UGCCAAAGGAGAUUUGCCCUG 21 56 8 26 1    0 0 0 0 0 0 0 1 0 0 0 26 25 1 1 0 0 1 1 0 0 0 0 0 0
mtr-miR399d UGCCAAAGGAGAGCUGCCCUA 21 16 5 8 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 8 7 0 0 0 0 0 0 0
mtr-miR399e UGCCAAAGGAGAUUUGCCCAG 21 230 23 92 1    0 0 92 2 3 4 1 60 2 0 0 28 37 0 1 0 0 0 0 0 0 0 0 0 0
mtr-miR399f UGCCAAAGGAGAUUUGCCCAG 21 230 23 92 1    0 0 92 2 3 4 1 60 2 0 0 28 37 0 1 0 0 0 0 0 0 0 0 0 0
mtr-miR399g UGCCAAAGGAGAUUUGCCCAG 21 230 23 92 1    0 0 92 2 3 4 1 60 2 0 0 28 37 0 1 0 0 0 0 0 0 0 0 0 0
mtr-miR399h UGCCAAAGGAGAUUUGCCCUG 21 56 8 26 1    0 0 0 0 0 0 0 1 0 0 0 26 25 1 1 0 0 1 1 0 0 0 0 0 0
mtr-miR399i UGCCAAAGGAGAUUUGCCCUG 21 56 8 26 1    0 0 0 0 0 0 0 1 0 0 0 26 25 1 1 0 0 1 1 0 0 0 0 0 0
mtr-miR399j CGCCAAAGAAGAUUUGCCCCG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR399k UGCCAAAGAAGAUUUGCCCUG 21 2 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0
mtr-miR399l UGCCAAAGGAGAGUUGCCCUG 21 538 49 300 1    14 182 6 0 0 0 0 7 1 1 17 300 7 1 0 2 0 0 0 0 0 0 0 0 0
mtr-miR399m UGCCAAAGGAGAGCUGCCCUA 21 16 5 8 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 8 7 0 0 0 0 0 0 0
mtr-miR399n UGCCAAAGGAGAGCUGCCCUA 21 16 5 8 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 8 7 0 0 0 0 0 0 0
mtr-miR399o UGCCAAAGGAGAGCUGCCCUG 21 38 5 17 1    0 1 3 0 0 0 0 0 1 0 0 11 17 0 2 1 0 2 0 0 0 0 0 0 0
mtr-miR399p UGCCAAAGGAGAGUUGCCCUG 21 538 49 300 1    14 182 6 0 0 0 0 7 1 1 17 300 7 1 0 2 0 0 0 0 0 0 0 0 0
mtr-miR399q UGCCAAAGGAGAGCUGCUCUU 21 6 3 5 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 5 0 0 0 0 0 0 0
mtr-miR399r UGCCAAAGAAGAUUUGCCCCG 21 10 5 6 4    0 0 0 0 0 0 0 0 0 0 0 4 6 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR399s-3p UGCCAAAGGAGAUUUGCCCAG 21 230 23 92 1    0 0 92 2 3 4 1 60 2 0 0 28 37 0 1 0 0 0 0 0 0 0 0 0 0
mtr-miR399s-5p GGGUGAGUUCUCCAUUGGCAGG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR399t-3p UGCCAAAGGAGAUUUGCCCAG 21 230 23 92 1    0 0 92 2 3 4 1 60 2 0 0 28 37 0 1 0 0 0 0 0 0 0 0 0 0
mtr-miR399t-5p GGGUGAGUUCUCCAUUGGCAGGU 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR408-3p AUGCACUGCCUCUUCCCUGGC 21 1,023 47 153 1    153 85 3 0 3 4 0 74 2 1 0 11 7 3 140 10 35 99 88 148 18 19 91 18 11
mtr-miR408-5p ACAGGGAACAUGCAGAGCAUG 21 572 64 192 1    0 0 0 0 0 0 0 0 0 0 0 0 0 10 192 4 14 92 123 72 64 1 0 0 0
mtr-miR4414a-3p AUCCAACGAUGCGGGAGCUGC 21 412 24 129 1    1 1 66 7 17 40 44 0 0 0 0 0 0 27 11 56 0 0 129 1 7 2 1 1 1
mtr-miR4414a-5p AGCUGCUGACUCGUUGGUUCA 21 6,482 499 2,917 1    0 0 1 1 0 0 0 0 0 0 0 0 0 342 311 2,810 16 5 2,917 0 18 17 9 15 20
mtr-miR4414b UGUGAAUGAUGCGGGAGCUAA 21 439 40 106 1    0 0 0 0 0 0 0 0 0 0 0 0 0 103 106 51 23 24 78 0 50 1 1 1 1
mtr-miR482-3p CUUACCUACACCUCCCAUGCC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
mtr-miR482-5p GGCAUGGGAUAGUAGGGAAGA 21 1,340 112 593 4    0 0 0 0 0 0 0 0 0 0 0 0 0 593 98 73 27 40 223 46 210 14 7 4 5
mtr-miR5037a AACCCUCAAAGGCUUCCACGG 21 152 30 111 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 111 0 29 1 9 2 0 0 0 0 0
mtr-miR5037b AACCCUCAAAGGCUUCCACGG 21 152 30 111 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 111 0 29 1 9 2 0 0 0 0 0
mtr-miR5037c AACCCUCAAAGGCUUCCACGG 21 152 30 111 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 111 0 29 1 9 2