Medicago miRNA Abundances

The data below are based on the microRNAs listed in the Sanger registry. Adjust libraries/reads to display on the control panel.

        

        miRNA         miRNA sequence Len Sum (norm) Average Max Min (>0)  MEDFL3allGDN3GDN4
mtr-miR1507-3p CCUCGUUCCAUACAUCAUCUAG 22 0 0 0 0    0 0 0
mtr-miR1507-5p AGAGUUGUAUGGAACGAAAGAU 22 0 0 0 0    0 0 0
mtr-miR1509a-3p ACCGGAUUUCCUUGAUUAAAG 21 0 0 0 0    0 0 0
mtr-miR1509a-5p UUAAUCUAGGAAAAUACGGUG 21 0 0 0 0    0 0 0
mtr-miR1509b UUAAUCUAGGAAAUUACACUCG 22 0 0 0 0    0 0 0
mtr-miR1510a-3p CGGAGGAUUAGGUAAAACAAC 21 0 0 0 0    0 0 0
mtr-miR1510a-5p UUGUCUUACCCAUUCCUCCCA 21 0 0 0 0    0 0 0
mtr-miR1510b-3p ACAUGGUCGGUAUCCCUGGAA 21 0 0 0 0    0 0 0
mtr-miR1510b-5p CCAUGGAUCCCUACCAUGUGG 21 0 0 0 0    0 0 0
mtr-miR156a UGACAGAAGAGAGAGAGCACA 21 0 0 0 0    0 0 0
mtr-miR156b-3p UGCUCACUCUCUAUCUGUCACC 22 0 0 0 0    0 0 0
mtr-miR156b-5p UGACAGAAGAGAGUGAGCAC 20 14 5 12 1    12 1 1
mtr-miR156c-3p UGCUUACUCUCUAUCUGUCACC 22 0 0 0 0    0 0 0
mtr-miR156c-5p UGACAGAAGAGAGUGAGCAC 20 14 5 12 1    12 1 1
mtr-miR156d-3p UGCUCACUCAUCUUUCUGUCAAA 23 0 0 0 0    0 0 0
mtr-miR156d-5p UGACAGAAGAGAGUGAGCAC 20 14 5 12 1    12 1 1
mtr-miR156e UUGACAGAAGAUAGAGAGCAC 21 0 0 0 0    0 0 0
mtr-miR156f UUGACAGAAGAUAGAGAGCAC 21 0 0 0 0    0 0 0
mtr-miR156g-3p GCUCUCUAGACUUCUGUCAUC 21 0 0 0 0    0 0 0
mtr-miR156g-5p UUGACAGAAGAUAGAGGGCAC 21 0 0 0 0    0 0 0
mtr-miR156h-3p GCUCUUUAUUCUUCUGUCAUC 21 0 0 0 0    0 0 0
mtr-miR156h-5p UUGACAGAAGAUAGAGAGCAC 21 0 0 0 0    0 0 0
mtr-miR156i-3p UGCUCACUUCUCUUUCUGUCAUC 23 0 0 0 0    0 0 0
mtr-miR156i-5p UGACAGAAGAGAGUGAGCAC 20 14 5 12 1    12 1 1
mtr-miR156j UGACAGAAGAGGGUGAGCAC 20 0 0 0 0    0 0 0
mtr-miR159a UUUGGAUUGAAGGGAGCUCUA 21 0 0 0 0    0 0 0
mtr-miR159b AUUGGAGUGAAGGGAGCUCCA 21 0 0 0 0    0 0 0
mtr-miR160a UGCCUGGCUCCCUGUAUGCCA 21 0 0 0 0    0 0 0
mtr-miR160b UGCCUGGCUCCCUGUAUGCCA 21 0 0 0 0    0 0 0
mtr-miR160c UGCCUGGCUCCCUGAAUGCCA 21 0 0 0 0    0 0 0
mtr-miR160d UGCCUGGCUCCCUGUAUGCCA 21 0 0 0 0    0 0 0
mtr-miR160e UGCCUGGCUCCCUGUAUGCCA 21 0 0 0 0    0 0 0
mtr-miR160f GCGUGAAGGGAGUCAAGCAGG 21 0 0 0 0    0 0 0
mtr-miR162 UCGAUAAACCUCUGCAUCCAG 21 0 0 0 0    0 0 0
mtr-miR164a UGGAGAAGCAGGGCACGUGCA 21 0 0 0 0    0 0 0
mtr-miR164b UGGAGAAGCAGGGCACGUGCA 21 0 0 0 0    0 0 0
mtr-miR164c UGGAGAAGCAGGGCACGUGCA 21 0 0 0 0    0 0 0
mtr-miR164d UGGAGAAGCAGGGCACAUGCU 21 0 0 0 0    0 0 0
mtr-miR166a UCGGACCAGGCUUCAUUCCCC 21 0 0 0 0    0 0 0
mtr-miR166b UCGGACCAGGCUUCAUUCCUA 21 0 0 0 0    0 0 0
mtr-miR166c UCGGACCAGGCUUCAUUCCUC 21 0 0 0 0    0 0 0
mtr-miR166d UCGGGCCAGGCUUCAUCCCCC 21 0 0 0 0    0 0 0
mtr-miR166e-3p UCGGACCAGGCUUCAUUCCCC 21 0 0 0 0    0 0 0
mtr-miR166e-5p GGAAUGUUGGCUGGCUCGAGG 21 0 0 0 0    0 0 0
mtr-miR166f UCGGACCAGGCUUCAUUCCUC 21 0 0 0 0    0 0 0
mtr-miR166g-3p UCGGACCAGGCUUCAUUCCCC 21 0 0 0 0    0 0 0
mtr-miR166g-5p GGAAUGUUGUCUGGCUCGAGG 21 0 0 0 0    0 0 0
mtr-miR167a UGAAGCUGCCAGCAUGAUCUA 21 0 0 0 0    0 0 0
mtr-miR167b-3p GAUCAUGUUGGAGCUUCACC 20 0 0 0 0    0 0 0
mtr-miR167b-5p UGAAGCUGCCAGCAUGAUCUG 21 0 0 0 0    0 0 0
mtr-miR168a UUGCUUGGUGCUGGUCGGGAA 21 0 0 0 0    0 0 0
mtr-miR168b UCGCUUGGUGCAGGUCGGGAA 21 0 0 0 0    0 0 0
mtr-miR168c-3p CCCGCCUUGCAUCAACUGAAU 21 0 0 0 0    0 0 0
mtr-miR168c-5p UCGCUUGGUGCAGGUCGGGAA 21 0 0 0 0    0 0 0
mtr-miR169a CAGCCAAGGAUGACUUGCCGA 21 0 0 0 0    0 0 0
mtr-miR169b CAGCCAAGGAUGACUUGCCGG 21 0 0 0 0    0 0 0
mtr-miR169c CAGCCAAGGGUGAUUUGCCGG 21 0 0 0 0    0 0 0
mtr-miR169d-3p GGCAGGUCAUCCUUCGGCUAUA 22 0 0 0 0    0 0 0
mtr-miR169d-5p AAGCCAAGGAUGACUUGCCGG 21 0 0 0 0    0 0 0
mtr-miR169e-3p GGCAGGUCAUCCUUCGGCUAUA 22 0 0 0 0    0 0 0
mtr-miR169e-5p GAGCCAAGGAUGACUUGCCGG 21 0 0 0 0    0 0 0
mtr-miR169f AAGCCAAGGAUGACUUGCCUA 21 0 0 0 0    0 0 0
mtr-miR169g CAGCCAAGGAUGACUUGCCGG 21 0 0 0 0    0 0 0
mtr-miR169h UGAGCCAAAGAUGACUUGCCGG 22 0 0 0 0    0 0 0
mtr-miR169i UGAGCCAAAGAUGACUUGCCGG 22 0 0 0 0    0 0 0
mtr-miR169j UGAGCCAGGAUGACUUGCCGG 21 0 0 0 0    0 0 0
mtr-miR169k UGAGCCAGGAUGGCUUGCCGG 21 0 0 0 0    0 0 0
mtr-miR169l-3p GGCAAGUUUUUCCUUGGCUAUA 22 0 0 0 0    0 0 0
mtr-miR169l-5p CAGCCAAGGAUGACUUGCCGG 21 0 0 0 0    0 0 0
mtr-miR171a UGAUUGAGUCGUGCCAAUAUC 21 0 0 0 0    0 0 0
mtr-miR171b UGAUUGAGCCGCGUCAAUAUC 21 0 0 0 0    0 0 0
mtr-miR171c UGAUUGAGCCGUGCCAAUAUU 21 0 0 0 0    0 0 0
mtr-miR171d UGAUUGAGCCGUGCCAAUAUC 21 0 0 0 0    0 0 0
mtr-miR171e-3p AGAUUGAGCCGCGCCAAUAUC 21 0 0 0 0    0 0 0
mtr-miR171e-5p CGAUGUUGGUGAGGUUCAAUC 21 0 0 0 0    0 0 0
mtr-miR171f UUGAGCCGUGCCAAUAUCACG 21 0 0 0 0    0 0 0
mtr-miR171g CGAGCCGAAUCAAUAUCACUC 21 0 0 0 0    0 0 0
mtr-miR171h CGAGCCGAAUCAAUAUCACUC 21 0 0 0 0    0 0 0
mtr-miR172a AGAAUCCUGAUGAUGCUGCAG 21 0 0 0 0    0 0 0
mtr-miR172b AGAAUCUUGAUGAUGCUGCAU 21 0 0 0 0    0 0 0
mtr-miR172c-3p AGAAUCUUGAUGAUGCUGCAU 21 0 0 0 0    0 0 0
mtr-miR172c-5p GUAGCAUCAUCAAGAUUCACA 21 0 0 0 0    0 0 0
mtr-miR172d-3p AGAAUCUUGAUGAUGCUGCA 20 0 0 0 0    0 0 0
mtr-miR172d-5p AGUGGAGCAUCAUCAAGAUUCACA 24 0 0 0 0    0 0 0
mtr-miR2086-3p GACAUGAAUGCAGAACUGGAA 21 0 0 0 0    0 0 0
mtr-miR2086-5p CCAGUUCUGCGUUCAUGUCCC 21 0 0 0 0    0 0 0
mtr-miR2087-3p CUGCAGUCGGUUUCUUACUUC 21 0 0 0 0    0 0 0
mtr-miR2087-5p GAAGUAAAGAACCGGCUGCAG 21 0 0 0 0    0 0 0
mtr-miR2088-3p UCCAAUGUAAUCUAGGUCUA 20 5 5 5 5    5 0 0
mtr-miR2088-5p AGGCCUAGAUUACAUUGGAC 20 0 0 0 0    0 0 0
mtr-miR2089-3p AGGAUUGGUGUAAUAGGUAAAA 22 0 0 0 0    0 0 0
mtr-miR2089-5p UUACCUAUUCCACCAAUUCCAU 22 0 0 0 0    0 0 0
mtr-miR2111a-3p AGCCUUGGAAUGCAGAUUAUC 21 0 0 0 0    0 0 0
mtr-miR2111a-5p UAAUCUGCAUCCUGAGGUUUA 21 0 0 0 0    0 0 0
mtr-miR2111b UAAUCUGCAUCCUGAGGUUUA 21 0 0 0 0    0 0 0
mtr-miR2111c UAAUCUGCAUCCUGAGGUUUA 21 0 0 0 0    0 0 0
mtr-miR2111d-3p AUCCUUAGAAUGCAGAUUAUC 21 0 0 0 0    0 0 0
mtr-miR2111d-5p UAAUCUGCAUCCUGAGGUUUA 21 0 0 0 0    0 0 0
mtr-miR2111e-3p AGCCUUGGGAUGCUGAUUAUC 21 0 0 0 0    0 0 0
mtr-miR2111e-5p UAAUCUGCAUCCUGAGGUUUA 21 0 0 0 0    0 0 0
mtr-miR2111f UAAUCUGCAUCCUGAGGUUUA 21 0 0 0 0    0 0 0
mtr-miR2111g-3p AGCCUCGGAGUGCGGAUUAUC 21 0 0 0 0    0 0 0
mtr-miR2111g-5p UAAUCUGCAUCCUGAGGUUUA 21 0 0 0 0    0 0 0
mtr-miR2111h UAAUCUGCAUCCUGAGGUUUA 21 0 0 0 0    0 0 0
mtr-miR2111i UAAUCUGCAUCCUGAGGUUUA 21 0 0 0 0    0 0 0
mtr-miR2111j UAAUCUGCAUCCUGAGGUUUA 21 0 0 0 0    0 0 0
mtr-miR2111k UAAUCUGCAUCCUGAGGUUUA 21 0 0 0 0    0 0 0
mtr-miR2111l AUCCUUGGAAUGCAGAUUAUC 21 0 0 0 0    0 0 0
mtr-miR2111m-3p GUCCUCGGGAUACAGAUUACU 21 0 0 0 0    0 0 0
mtr-miR2111m-5p UAAUCUGCAUCCUGAGGUUUA 21 0 0 0 0    0 0 0
mtr-miR2111n UAAUCUGCAUCCUGAGGUUUA 21 0 0 0 0    0 0 0
mtr-miR2111o UAAUCUGCAUCCUGAGGUUUA 21 0 0 0 0    0 0 0
mtr-miR2118 UUACCGAUUCCACCCAUUCCUA 22 0 0 0 0    0 0 0
mtr-miR2119 UCAAAGGGAGGUGUGGAGUAG 21 0 0 0 0    0 0 0
mtr-miR2199 UGAUACACUAGCACGGAUCAC 21 0 0 0 0    0 0 0
mtr-miR2585a CAGGAUUAGCGAUUACAGGGAC 22 0 0 0 0    0 0 0
mtr-miR2585b CAGGAUUAGCGAUUACAGGGAC 22 0 0 0 0    0 0 0
mtr-miR2585c CAGGAUUAGCGAUUACAGGGAC 22 0 0 0 0    0 0 0
mtr-miR2585d CAGGAUUAGCGAUUACAGGGAC 22 0 0 0 0    0 0 0
mtr-miR2586a CGAGGAGUGUCCGUGCUUCAU 21 0 0 0 0    0 0 0
mtr-miR2586b CGGUGUCGUAUCGGUGUUGGAC 22 0 0 0 0    0 0 0
mtr-miR2587a UUGACCGUUCAUAUGAACCCUG 22 0 0 0 0    0 0 0
mtr-miR2587b UUGACCGUUCAUAUGAACCCUG 22 0 0 0 0    0 0 0
mtr-miR2587c UUGACCGUUCAUAUGAACCCUG 22 0 0 0 0    0 0 0
mtr-miR2587d UUGACCGUUCAUAUGAACCCUG 22 0 0 0 0    0 0 0
mtr-miR2587e UUGACCGUUCAUAUGAACCCUG 22 0 0 0 0    0 0 0
mtr-miR2587f UUGACCGUUCAUAUGAACCCUG 22 0 0 0 0    0 0 0
mtr-miR2587g UUGACCGUUCAUAUGAACCCUG 22 0 0 0 0    0 0 0
mtr-miR2588a UAACACUGUGCAACUAAGUCC 21 0 0 0 0    0 0 0
mtr-miR2588b UAACACUGUGCAACUAAGUCC 21 0 0 0 0    0 0 0
mtr-miR2589 GGCAUCCACGUGUGCUUCACCG 22 0 0 0 0    0 0 0
mtr-miR2590a AUCUAAAGGUGAUUAUUGUGCC 22 0 0 0 0    0 0 0
mtr-miR2590b AUCUAAAGGUGAUUAUUGUGCC 22 0 0 0 0    0 0 0
mtr-miR2590c AUCUAAAGGUGAUUAUUGUGCC 22 0 0 0 0    0 0 0
mtr-miR2590d AUCUAAAGGUGAUUAUUGUGCC 22 0 0 0 0    0 0 0
mtr-miR2590e AUCUAAAGGUGAUUAUUGUGCC 22 0 0 0 0    0 0 0
mtr-miR2590f AUCUAAAGGUGAUUAUUGUGCC 22 0 0 0 0    0 0 0
mtr-miR2590g AAAUGAGACUGAAAUCUAAAGGUG 24 0 0 0 0    0 0 0
mtr-miR2590h AGAAUGACAUGGCAGAAUAAUCAC 24 0 0 0 0    0 0 0
mtr-miR2590i AGAAUGACAUGGCAGAAUAAUCAC 24 0 0 0 0    0 0 0
mtr-miR2590j AGAAUGACAUGGCAGAAUAAUCAC 24 0 0 0 0    0 0 0
mtr-miR2591 GGAACUUCUACGGUACACCUGC 22 0 0 0 0    0 0 0
mtr-miR2592a-3p GAAAAACAUGAAUGUCGAGCG 21 0 0 0 0    0 0 0
mtr-miR2592a-5p CCCGGCAUUCAUGUUUUCCU 20 0 0 0 0    0 0 0
mtr-miR2592a.2-3p AAAUGCUUGAGUCCUGUUGUU 21 0 0 0 0    0 0 0
mtr-miR2592ab CAACAGGACUCAAGCAUUUCGC 22 0 0 0 0    0 0 0
mtr-miR2592ac CAACAGGACUCAAGCAUUUCGC 22 0 0 0 0    0 0 0
mtr-miR2592ad CAACAGGACUCAAGCAUUUCGC 22 0 0 0 0    0 0 0
mtr-miR2592ae CAACAGGACUCAAGCAUUUCG 21 0 0 0 0    0 0 0
mtr-miR2592af CAACAGGACUCAAGCAUUUCGC 22 0 0 0 0    0 0 0
mtr-miR2592ah CAACAGGACUCAAGCAUUUCGC 22 0 0 0 0    0 0 0
mtr-miR2592ai CAACAGGACUCAAGCAUUUCGC 22 0 0 0 0    0 0 0
mtr-miR2592aj CAACAGGACUCAAGCAUUUCGC 22 0 0 0 0    0 0 0
mtr-miR2592al CAACAGGACUCAAGCAUUUCGC 22 0 0 0 0    0 0 0
mtr-miR2592am CAACAGGACUCAAGCAUUUCGC 22 0 0 0 0    0 0 0
mtr-miR2592an AAAUGCUUGAGUCCUGUUGUU 21 0 0 0 0    0 0 0
mtr-miR2592ao AAAUGCUUGAGUCCUGUUGUU 21 0 0 0 0    0 0 0
mtr-miR2592ap AGGCUGGUUUAGAUGAAGGUA 21 0 0 0 0    0 0 0
mtr-miR2592aq AGGCUGGUUUAGAUGAAGGUA 21 0 0 0 0    0 0 0
mtr-miR2592ar AGGCUGGUUUAGAUGAAGGUA 21 0 0 0 0    0 0 0
mtr-miR2592as AGGCUGGUUUAGAUGAAGGUA 21 0 0 0 0    0 0 0
mtr-miR2592at AGGCUGGUUUAGAUGAAGGUA 21 0 0 0 0    0 0 0
mtr-miR2592au AGGCUGGUUUAGAUGAAGGUA 21 0 0 0 0    0 0 0
mtr-miR2592av AGGCUGGUUUAGAUGAAGGUA 21 0 0 0 0    0 0 0
mtr-miR2592aw AGGCUGGUUUAGAUGAAGGUA 21 0 0 0 0    0 0 0
mtr-miR2592ax AGGCUGGUUUAGAUGAAGGUA 21 0 0 0 0    0 0 0
mtr-miR2592ay AGGCUGGUUUAGAUGAAGGUA 21 0 0 0 0    0 0 0
mtr-miR2592az AGGCUGGUUUAGAUGAAGGUA 21 0 0 0 0    0 0 0
mtr-miR2592b-3p AAAUGCUUGAGUCCUGUUGUU 21 0 0 0 0    0 0 0
mtr-miR2592b-5p ACAACAGGACUCAAGCAUUUC 21 0 0 0 0    0 0 0
mtr-miR2592ba AGGCUGGUUUAGAUGAAGGUA 21 0 0 0 0    0 0 0
mtr-miR2592bb AGGCUGGUUUAGAUGAAGGUA 21 0 0 0 0    0 0 0
mtr-miR2592bc AGGCUGGUUUAGAUGAAGGUA 21 0 0 0 0    0 0 0
mtr-miR2592bd AGGCUGGUUUAGAUGAAGGUA 21 0 0 0 0    0 0 0
mtr-miR2592be AGGCUGGUUUAGAUGAAGGUA 21 0 0 0 0    0 0 0
mtr-miR2592bf AGGCUGGUUUAGAUGAAGGUA 21 0 0 0 0    0 0 0
mtr-miR2592bg AGGCUGGUUUAGAUGAAGGUA 21 0 0 0 0    0 0 0
mtr-miR2592bi UGGAACAUUGGGAAUGCCGGU 21 0 0 0 0    0 0 0
mtr-miR2592bj UGGAACAUUGGGAAUGCCGGU 21 0 0 0 0    0 0 0
mtr-miR2592bk UGGAACAUUGGGAAUGCCGGU 21 0 0 0 0    0 0 0
mtr-miR2592bl-3p GAGUAAUUCAAACUUGUUAAA 21 0 0 0 0    0 0 0
mtr-miR2592bl-5p UGGCAAGUUUGAAUUUACCUCA 22 0 0 0 0    0 0 0
mtr-miR2592bm-3p GGAAAACAUGAAUGUCGGGUG 21 0 0 0 0    0 0 0
mtr-miR2592bm-5p CUCGGCAUUCAUGUUUUUCCUU 22 0 0 0 0    0 0 0
mtr-miR2592bn-3p GGAAAACAUGAAUGUCGGGUG 21 0 0 0 0    0 0 0
mtr-miR2592bn-5p CUCGGCAUUCAUGUUUUUCCUU 22 0 0 0 0    0 0 0
mtr-miR2592bo-3p AAAUGCUUGAGUCCUGUUGUU 21 0 0 0 0    0 0 0
mtr-miR2592bo-5p CGGCCAGGACUCAAGCAUUUCG 22 0 0 0 0    0 0 0
mtr-miR2592bp-3p CGGCAGAACUCCAGCAUUCGA 21 0 0 0 0    0 0 0
mtr-miR2592bp-5p AAAUGCUUGAGUCCUGUUGUU 21 0 0 0 0    0 0 0
mtr-miR2592bq-3p AAAUGCUUGAGUCAUGUUGUU 21 0 0 0 0    0 0 0
mtr-miR2592bq-5p CGACCAUGACUCAAGUAUUAA 21 0 0 0 0    0 0 0
mtr-miR2592br-3p AAAUGCUUGAGUCCUGUUGUU 21 0 0 0 0    0 0 0
mtr-miR2592br-5p GACUAGGACUCAAGUAUUUCG 21 0 0 0 0    0 0 0
mtr-miR2592c AAAUGCUUGAGUCCUGUUGUU 21 0 0 0 0    0 0 0
mtr-miR2592d-3p AAAUGCUUGAGUCCUGUUGUU 21 0 0 0 0    0 0 0
mtr-miR2592d-5p CAACAGGACUCAAGCAUUUCGC 22 0 0 0 0    0 0 0
mtr-miR2592e-3p AAAUGCUUGAGUCCUGUUGUU 21 0 0 0 0    0 0 0
mtr-miR2592e-5p CAACAGGACUCAAGCAUUUCGC 22 0 0 0 0    0 0 0
mtr-miR2592f AAAUGCUUGAGUCCUGUUGUU 21 0 0 0 0    0 0 0
mtr-miR2592g AAAUGCUUGAGUCCUGUUGUU 21 0 0 0 0    0 0 0
mtr-miR2592h AAAUGCUUGAGUCCUGUUGUU 21 0 0 0 0    0 0 0
mtr-miR2592i AAAUGCUUGAGUCCUGUUGUU 21 0 0 0 0    0 0 0
mtr-miR2592j AAAUGCUUGAGUCCUGUUGUU 21 0 0 0 0    0 0 0
mtr-miR2592k AAAUGCUUGAGUCCUGUUGUU 21 0 0 0 0    0 0 0
mtr-miR2592l AAAUGCUUGAGUCCUGUUGUU 21 0 0 0 0    0 0 0
mtr-miR2592m AAAUGCUUGAGUCCUGUUGUU 21 0 0 0 0    0 0 0
mtr-miR2592n AAAUGCUUGAGUCCUGUUGUU 21 0 0 0 0    0 0 0
mtr-miR2592o-3p AAAUGCUUGAGUCCUGUUGUU 21 0 0 0 0    0 0 0
mtr-miR2592o-5p CAACAGGACUCAAGCAUUUCGC 22 0 0 0 0    0 0 0
mtr-miR2592p AAAUGCUUGAGUCCUGUUGUU 21 0 0 0 0    0 0 0
mtr-miR2592q-3p AAAUGCUUGAGUCCUGUUGUU 21 0 0 0 0    0 0 0
mtr-miR2592q-5p CAACAGGACUCAAGCAUUUCGC 22 0 0 0 0    0 0 0
mtr-miR2592r AAAUGCUUGAGUCCUGUUGUU 21 0 0 0 0    0 0 0
mtr-miR2592s-3p AAAUGCUUGAGUCAUGUUGUU 21 0 0 0 0    0 0 0
mtr-miR2592s-5p ACAACAGGACUCAAGCAUUUC 21 0 0 0 0    0 0 0
mtr-miR2592t CAACAGGACUCAAGCAUUUCGC 22 0 0 0 0    0 0 0
mtr-miR2592u CAACAGGACUCAAGCAUUUCGC 22 0 0 0 0    0 0 0
mtr-miR2592v CAACAGGACUCAAGCAUUUCGC 22 0 0 0 0    0 0 0
mtr-miR2592w CAACAGGACUCAAGCAUUUCGC 22 0 0 0 0    0 0 0
mtr-miR2592x CAACAGGACUCAAGCAUUUCGC 22 0 0 0 0    0 0 0
mtr-miR2592y CAACAGGACUCAAGCAUUUCGC 22 0 0 0 0    0 0 0
mtr-miR2592z CAACAGGACUCAAGCAUUUCGC 22 0 0 0 0    0 0 0
mtr-miR2593a UUAAAUGAAUGAACCUAGAAU 21 0 0 0 0    0 0 0
mtr-miR2593b UUAAAUGAAUGAACCUAGAAU 21 0 0 0 0    0 0 0
mtr-miR2593c UUAAAUGAAUGAACCUAGAAU 21 0 0 0 0    0 0 0
mtr-miR2593d AUACAUCAUUGAUUGAAUGAACCU 24 0 0 0 0    0 0 0
mtr-miR2593e AUACAUCAUUGAUUGAAUGAACCU 24 0 0 0 0    0 0 0
mtr-miR2594 CCAUGGCCAAGGAUGCCAGAG 21 0 0 0 0    0 0 0
mtr-miR2595 UACAUUUUCUUCUUUAUGUCU 21 0 0 0 0    0 0 0
mtr-miR2596 UCUAUUUCAUUGUUCCACACA 21 0 0 0 0    0 0 0
mtr-miR2597 UUUGGUACUUCGUCGAUUUGA 21 0 0 0 0    0 0 0
mtr-miR2598 CUAAGGGUGAUUAUUCUGCCA 21 0 0 0 0    0 0 0
mtr-miR2599 UGGGUACAAGGAAUCUACUUU 21 0 0 0 0    0 0 0
mtr-miR2600a ACAUUAGCCAAUCACAAUGCC 21 0 0 0 0    0 0 0
mtr-miR2600b AAGCAUUGUGGCAUUGUGAUUGGU 24 0 0 0 0    0 0 0
mtr-miR2600c AAGCAUUGUGGCAUUGUGAUUGGU 24 0 0 0 0    0 0 0
mtr-miR2600d AAGCAUUGUGGCAUUGUGAUUGGU 24 0 0 0 0    0 0 0
mtr-miR2600e AAGCAUUGUGGCAUUGUGAUUGGC 24 0 0 0 0    0 0 0
mtr-miR2601 UAUUUGGUAUCGCUUUGGUCCC 22 0 0 0 0    0 0 0
mtr-miR2602a UGGCAGUGAUUGCCACGUCAU 21 0 0 0 0    0 0 0
mtr-miR2602b UGGCAGUGAUUGCCACGUCAU 21 0 0 0 0    0 0 0
mtr-miR2603 UUUGGUAUUGGUCCCUGCACUU 22 0 0 0 0    0 0 0
mtr-miR2604 UAAUUUUUAUGUGGGAGUGUU 21 0 0 0 0    0 0 0
mtr-miR2605 ACUUAGUUUAUAUGACCUAC 20 0 0 0 0    0 0 0
mtr-miR2606a UACAAUUCCUUAGGUGCUUUU 21 0 0 0 0    0 0 0
mtr-miR2606b UACAAUUCCUUAGGUGCUUUU 21 0 0 0 0    0 0 0
mtr-miR2606c AGUUAAGAACCAUACAAAAAACAC 24 0 0 0 0    0 0 0
mtr-miR2607 AUGUGAUUAUGUGAUAAGUGU 21 0 0 0 0    0 0 0
mtr-miR2608 GUUGUACAUAUAUCACUACUCU 22 0 0 0 0    0 0 0
mtr-miR2609a UGGAAGUAAUAGGUUCUCACU 21 0 0 0 0    0 0 0
mtr-miR2609b UGGAAGUAAUAGGUUCUCACU 21 0 0 0 0    0 0 0
mtr-miR2610a AGAUUGAGACUUGUAUGGCUU 21 0 0 0 0    0 0 0
mtr-miR2610b AGAUUGAGACUUGUAUGGCUU 21 0 0 0 0    0 0 0
mtr-miR2611 UAUUUGUCAGUGUUUGAUGAA 21 0 0 0 0    0 0 0
mtr-miR2612 UGAUAGUGUCAACUAGUACAG 21 0 0 0 0    0 0 0
mtr-miR2613 CGGUCGCCGGUGGUCAAUGGU 21 0 0 0 0    0 0 0
mtr-miR2614 CGGUUCGACUCGUUAGGUUC 20 0 0 0 0    0 0 0
mtr-miR2615a CCUGAUCGCAUUUUAAAAGGC 21 0 0 0 0    0 0 0
mtr-miR2615b CCUGAUCGCAUUUUAAAAGGC 21 0 0 0 0    0 0 0
mtr-miR2615c CCUGAUCGCAUUUUAAAAGGC 21 0 0 0 0    0 0 0
mtr-miR2616 AUUGGGUUUGGUUCGGGCGGAU 22 0 0 0 0    0 0 0
mtr-miR2617a UGUAGUGUAGCAUGCCCGUU 20 0 0 0 0    0 0 0
mtr-miR2617b UGUAGUGUAGCAUGCCCGUU 20 0 0 0 0    0 0 0
mtr-miR2617c UGUAGUGUAGCAUGCCCGUU 20 0 0 0 0    0 0 0
mtr-miR2618a GUGAAUUCAGUUUACGUACGUU 22 0 0 0 0    0 0 0
mtr-miR2618b GUGAAUUCAGUUUACGUACGUU 22 0 0 0 0    0 0 0
mtr-miR2619a ACAUAGGAGGCUGUUUUGUAU 21 0 0 0 0    0 0 0
mtr-miR2619b-3p CCAAAGAAUCAAUACAUAGGG 21 0 0 0 0    0 0 0
mtr-miR2619b-5p AUAUGUUUUGAUUCUUUGGCA 21 0 0 0 0    0 0 0
mtr-miR2620 UUCUGAUAGACACCGGCUCUGC 22 0 0 0 0    0 0 0
mtr-miR2621 AGCUUGGGCUAGGAAUUUGUGC 22 0 0 0 0    0 0 0
mtr-miR2622 UUUGUGUGCCAUCGUGAACUUA 22 0 0 0 0    0 0 0
mtr-miR2623 UCGGCUGUACUGUCCUUCAUG 21 0 0 0 0    0 0 0
mtr-miR2624 CGAAAGACGAGGUUGCCGGCU 21 0 0 0 0    0 0 0
mtr-miR2625 CCAUCGUGCCACGUUACGAUCC 22 0 0 0 0    0 0 0
mtr-miR2626 AACGUCGGGAUUUAGGGUGUU 21 0 0 0 0    0 0 0
mtr-miR2627 UUUCGGUAGUUAACUGCUGAGG 22 0 0 0 0    0 0 0
mtr-miR2628 CAUGAAAGAAUGAUGAGUAA 20 0 0 0 0    0 0 0
mtr-miR2629a AGUUUUCCUCGGUAGUUAACU 21 0 0 0 0    0 0 0
mtr-miR2629b AGUUUUCCUCGGUAGUUAACU 21 0 0 0 0    0 0 0
mtr-miR2629c AGUUUUCCUCGGUAGUUAACU 21 0 0 0 0    0 0 0
mtr-miR2629d AGUUUUCCUCGGUAGUUAACU 21 0 0 0 0    0 0 0
mtr-miR2629e AGUUUUCCUCGGUAGUUAACU 21 0 0 0 0    0 0 0
mtr-miR2629f AGUUUUCCUCGGUAGUUAACU 21 0 0 0 0    0 0 0
mtr-miR2629g AGUUUUCCUCGGUAGUUAACU 21 0 0 0 0    0 0 0
mtr-miR2629h GCAGAAGAUCCUCGGCAGUUAACU 24 0 0 0 0    0 0 0
mtr-miR2630a UGGUUUUGGUCCUUGGUAUUU 21 0 0 0 0    0 0 0
mtr-miR2630b UGGUUUUGGUCCUUGGUAUUU 21 0 0 0 0    0 0 0
mtr-miR2630c UGGUUUUGGUCCUUGGUAUUU 21 0 0 0 0    0 0 0
mtr-miR2630d UGGUUUUGGUCCUUGGUAUUU 21 0 0 0 0    0 0 0
mtr-miR2630e UGGUUUUGGUCCUUGGUAUUU 21 0 0 0 0    0 0 0
mtr-miR2630f UGGUUUUGGUCCUUGGUAUUU 21 0 0 0 0    0 0 0
mtr-miR2630g UGGUUUUGGUCCUUGGUAUUU 21 0 0 0 0    0 0 0
mtr-miR2630h UGGUUUUGGUCCUUGGUAUUU 21 0 0 0 0    0 0 0
mtr-miR2630i UGGUUUUGGUCCUUGGUAUUU 21 0 0 0 0    0 0 0
mtr-miR2630j UGGUUUUGGUCCUUGGUAUUU 21 0 0 0 0    0 0 0
mtr-miR2630k UGGUUUUGGUCCUUGGUAUUU 21 0 0 0 0    0 0 0
mtr-miR2630l UGGUUUUGGUCCUUGGUAUUU 21 0 0 0 0    0 0 0
mtr-miR2630m UGGUUUUGGUCCUUGGUAUUU 21 0 0 0 0    0 0 0
mtr-miR2630n UGGUUUUGGUCCUUGGUAUUU 21 0 0 0 0    0 0 0
mtr-miR2630o UGGUUUUGGUCCUUGGUAUUU 21 0 0 0 0    0 0 0
mtr-miR2630p UGGUUUUGGUCCUUGGUAUUU 21 0 0 0 0    0 0 0
mtr-miR2630q UGGUUUUGGUCCUUGGUAUUU 21 0 0 0 0    0 0 0
mtr-miR2630r UGGUUUUGGUCCUUGGUAUUU 21 0 0 0 0    0 0 0
mtr-miR2630s UGGUUUUGGUCCUUGGUAUUU 21 0 0 0 0    0 0 0
mtr-miR2630t UGGUUUUGGUCCUUGGUAUUU 21 0 0 0 0    0 0 0
mtr-miR2630u UGGUUUUGGUCCUUGGUAUUU 21 0 0 0 0    0 0 0
mtr-miR2630v UGGUUUUGGUCCUUGGUAUUU 21 0 0 0 0    0 0 0
mtr-miR2630w UGGUUUUGGUCCUUGGUAUUU 21 0 0 0 0    0 0 0
mtr-miR2630x UGGUUUUGGUCCUUGGUAUUU 21 0 0 0 0    0 0 0
mtr-miR2630y UGGUUUUGGUCCUUGGUAUUU 21 0 0 0 0    0 0 0
mtr-miR2631 UGACACGCCACGUGGCACACU 21 0 0 0 0    0 0 0
mtr-miR2632a CCUGAAGUUACUAAUCCUUCCA 22 0 0 0 0    0 0 0
mtr-miR2632b CCUGAAGUUACUAAUCCUUCCA 22 0 0 0 0    0 0 0
mtr-miR2632c CCUGAAGUUACUAAUCCUUCCA 22 0 0 0 0    0 0 0
mtr-miR2633 UGACAUUUUGCUCCAGAUUCA 21 0 0 0 0    0 0 0
mtr-miR2634 UUUAUUCUCAGUUUGUUGCUC 21 0 0 0 0    0 0 0
mtr-miR2635 AUUAUUGUCAACGUGACUAG 20 0 0 0 0    0 0 0
mtr-miR2636 UUUGGUUAGUGUGCUGAAUAU 21 0 0 0 0    0 0 0
mtr-miR2637 AAAUACUUCCUCUGAUCACUG 21 0 0 0 0    0 0 0
mtr-miR2638a AUGAUUAAUAUUUGCAGUGGC 21 0 0 0 0    0 0 0
mtr-miR2638b AUGAUUAAUAUUUGCAGUGGC 21 0 0 0 0    0 0 0
mtr-miR2639 UAGUCGGCUUACGUCACCUUG 21 0 0 0 0    0 0 0
mtr-miR2640 UUCCUUGCCGGAGCUGGACUAC 22 0 0 0 0    0 0 0
mtr-miR2641 GUUUGAUCCUUUACGUUUAU 20 0 0 0 0    0 0 0
mtr-miR2642 AUGAGUUUCAUCAAAUCAUGU 21 0 0 0 0    0 0 0
mtr-miR2643a UUUGGGAUCAGAAAUUAGAGA 21 0 0 0 0    0 0 0
mtr-miR2643b-3p UUUGGGAUCAGAAAUUAGAGA 21 0 0 0 0    0 0 0
mtr-miR2643b-5p UCUAAUCUCUGUUCCCAAUUA 21 0 0 0 0    0 0 0
mtr-miR2644 CACUUCAGAUUGAUGGUGUGU 21 0 0 0 0    0 0 0
mtr-miR2645 UUUCUAGAGAUGAGCAUAUAU 21 0 0 0 0    0 0 0
mtr-miR2646a CAUGACAUUUAGUGAUGAUGU 21 0 0 0 0    0 0 0
mtr-miR2646b CAUGACAUUUAGUGAUGAUGU 21 0 0 0 0    0 0 0
mtr-miR2647a AUUCACGGGGACGAACCUCCU 21 0 0 0 0    0 0 0
mtr-miR2647b AUUCACGGGGACGAACCUCCU 21 0 0 0 0    0 0 0
mtr-miR2647c AUUCACGGGGACGAACCUCCU 21 0 0 0 0    0 0 0
mtr-miR2648 UAGCCAAUGGGAAUAACAGAU 21 0 0 0 0    0 0 0
mtr-miR2649 AAAGGUGCCAAUUAUGAGUGU 21 0 0 0 0    0 0 0
mtr-miR2650 AACUUAAAUAUGUUUUCAGUCC 22 0 0 0 0    0 0 0
mtr-miR2651 UUUGAUUGGUAUGCCUGCAUU 21 0 0 0 0    0 0 0
mtr-miR2652a UAUGCAGGGUGCAUAAGGAUU 21 0 0 0 0    0 0 0
mtr-miR2652b UAUGCAGGGUGCAUAAGGAUU 21 0 0 0 0    0 0 0
mtr-miR2652c UAUGCAGGGUGCAUAAGGAUU 21 0 0 0 0    0 0 0
mtr-miR2652d UAUGCAGGGUGCAUAAGGAUU 21 0 0 0 0    0 0 0
mtr-miR2652e UAUGCAGGGUGCAUAAGGAUU 21 0 0 0 0    0 0 0
mtr-miR2652f UAUGCAGGGUGCAUAAGGAUU 21 0 0 0 0    0 0 0
mtr-miR2652g UAUGCAGGGUGCAUAAGGAUU 21 0 0 0 0    0 0 0
mtr-miR2652h UAUGCAGGGUGCAUAAGGAUU 21 0 0 0 0    0 0 0
mtr-miR2652i UAUGCAGGGUGCAUAAGGAUU 21 0 0 0 0    0 0 0
mtr-miR2652j UAUGCAGGGUGCAUAAGGAUU 21 0 0 0 0    0 0 0
mtr-miR2652k UAUGCAGGGUGCAUAAGGAUU 21 0 0 0 0    0 0 0
mtr-miR2652l UAUGCAGGGUGCAUAAGGAUU 21 0 0 0 0    0 0 0
mtr-miR2652m UAUGCAGGGUGCAUAAGGAUU 21 0 0 0 0    0 0 0
mtr-miR2653a UCACGCUGCUGUGAACAUGAU 21 0 0 0 0    0 0 0
mtr-miR2653b UCACGCUGCUGUGAACAUGAU 21 0 0 0 0    0 0 0
mtr-miR2653c UCACGCUGCUGUGAACAUGAU 21 0 0 0 0    0 0 0
mtr-miR2653d UCACGCUGCUGUGAACAUGAU 21 0 0 0 0    0 0 0
mtr-miR2654 AUUCAGGGACAAAGUGUGCG 20 0 0 0 0    0 0 0
mtr-miR2655a CGUUUAGGUCCCUUAACUUUA 21 0 0 0 0    0 0 0
mtr-miR2655b CGUUUUGGUCCCUUAACUUUA 21 0 0 0 0    0 0 0
mtr-miR2655c CGUUUAGGUCCCUUAACUUUA 21 0 0 0 0    0 0 0
mtr-miR2655d CGUUUAGGUCCCUUAACUUUA 21 0 0 0 0    0 0 0
mtr-miR2655e CGUUUAGGUCCCUUAACUUUA 21 0 0 0 0    0 0 0
mtr-miR2655f CGUUUAGGUCCCUUAACUUUA 21 0 0 0 0    0 0 0
mtr-miR2655g CGUUUAGGUCCCUUAACUUUA 21 0 0 0 0    0 0 0
mtr-miR2655h CGUUUAGGUCCCUUAACUUUA 21 0 0 0 0    0 0 0
mtr-miR2655i CGUUUAGGUCCCUUAACUUUA 21 0 0 0 0    0 0 0
mtr-miR2655j CGUUUAGGUCCCUUAACUUUA 21 0 0 0 0    0 0 0
mtr-miR2655k CGUUUAGGUCCCUUAACUUUA 21 0 0 0 0    0 0 0
mtr-miR2655l CGUUUAGGUCCCUUAACUUUA 21 0 0 0 0    0 0 0
mtr-miR2655m CGUUUAGGUCCCUUAACUUUA 21 0 0 0 0    0 0 0
mtr-miR2655n CGUUUAGGUCCCUUAACUUUA 21 0 0 0 0    0 0 0
mtr-miR2655o CGUUUAGGUCCCUUAACUUUA 21 0 0 0 0    0 0 0
mtr-miR2656a AAGUUGCAUAAUCGAGUUGG 20 0 0 0 0    0 0 0
mtr-miR2656b AAGUUGCAUAAUCGAGUUGG 20 0 0 0 0    0 0 0
mtr-miR2656c AAGUUGCAUAAUCGAGUUGG 20 0 0 0 0    0 0 0
mtr-miR2656d AAGUUGCAUAAUCGAGUUGG 20 0 0 0 0    0 0 0
mtr-miR2656e AAGUUGCAUAAUCGAGUUGG 20 0 0 0 0    0 0 0
mtr-miR2657 UGUUAUUUCAUCGAUUUUGUUG 22 0 0 0 0    0 0 0
mtr-miR2658 AUGUGACCUUGUAUAUGAUC 20 0 0 0 0    0 0 0
mtr-miR2659a CCAUGGGUGCGACUUGGUAAG 21 0 0 0 0    0 0 0
mtr-miR2659b CCAUGGGUGCGACUUGGUAAG 21 0 0 0 0    0 0 0
mtr-miR2659c CCAUGGGUGCGACUUGGUAAG 21 0 0 0 0    0 0 0
mtr-miR2659d CCAUGGGUGCGACUUGGUAAG 21 0 0 0 0    0 0 0
mtr-miR2659e CCAUGGGUGCGACUUGGUAAG 21 0 0 0 0    0 0 0
mtr-miR2659f CCAUGGGUGCGACUUGGUAAG 21 0 0 0 0    0 0 0
mtr-miR2659g CCAUGGGUGCGACUUGGUAAG 21 0 0 0 0    0 0 0
mtr-miR2659h CCAUGGGUGCGACUUGGUAAG 21 0 0 0 0    0 0 0
mtr-miR2659i CCAUGGGUGCGACUUGGUAAG 21 0 0 0 0    0 0 0
mtr-miR2659j CCAUGGGUGCGACUUGGUAAG 21 0 0 0 0    0 0 0
mtr-miR2659k CCAUGGGUGCGACUUGGUAAG 21 0 0 0 0    0 0 0
mtr-miR2660 UAAGACAUCAGCUAUAAGCUA 21 0 0 0 0    0 0 0
mtr-miR2661 UAGGUUUGAGAAAAUGGGCAG 21 0 0 0 0    0 0 0
mtr-miR2662 GAGUAAAAAUGUGAACCGAAU 21 0 0 0 0    0 0 0
mtr-miR2663 UUAGAGAGGGCGUUACAAUU 20 0 0 0 0    0 0 0
mtr-miR2664a AAUUGUGGUGGGUUGACAGUC 21 0 0 0 0    0 0 0
mtr-miR2664b AAUUGUGGUGGGUUGACAGUC 21 0 0 0 0    0 0 0
mtr-miR2665 UGAUUUCAGGUCAAGAAUUGA 21 0 0 0 0    0 0 0
mtr-miR2666 CGAAAGUGAGGAUAUCAAGGA 21 0 0 0 0    0 0 0
mtr-miR2667a UCCUUGAUCUGACGGCUACC 20 0 0 0 0    0 0 0
mtr-miR2667b UCCUUGAUCUGACGGCUACC 20 0 0 0 0    0 0 0
mtr-miR2668 UUCAUCCUUGCAAUUAGGGGUC 22 0 0 0 0    0 0 0
mtr-miR2669a AAAGUUCAGUCUUCAUAGUAUC 22 0 0 0 0    0 0 0
mtr-miR2669b AAAGUUCAGUCUUCAUAGUAUC 22 0 0 0 0    0 0 0
mtr-miR2670a CAAGAAGGUUGCUCACUAUUU 21 0 0 0 0    0 0 0
mtr-miR2670b CAAGAAGGUUGCUCACUAUUU 21 0 0 0 0    0 0 0
mtr-miR2670c CAAGAAGGUUGCUCACUAUUU 21 0 0 0 0    0 0 0
mtr-miR2670d CAAGAAGGUUGCUCACUAUUU 21 0 0 0 0    0 0 0
mtr-miR2670e UCUCAACAGGACGGAUCACUA 21 0 0 0 0    0 0 0
mtr-miR2670f AGUGGUCUGUUAGGUUGGGGA 21 0 0 0 0    0 0 0
mtr-miR2670g AGUGGUCUGUUAGGUUGGGGA 21 0 0 0 0    0 0 0
mtr-miR2671a UUAAAAGUUUCGUUUCGGUCC 21 0 0 0 0    0 0 0
mtr-miR2671b UUAAAAGUUUCGUUUCGGUCC 21 0 0 0 0    0 0 0
mtr-miR2671c UUAAAAGUUUCGUUUCGGUCC 21 0 0 0 0    0 0 0
mtr-miR2671d UUAAAAGUUUCGUUUCGGUCC 21 0 0 0 0    0 0 0
mtr-miR2671e UUAAAAGUUUCGUUUCGGUCC 21 0 0 0 0    0 0 0
mtr-miR2671f UUAAAAGUUUCGUUUCGGUCC 21 0 0 0 0    0 0 0
mtr-miR2671g UUAAAAGUUUCGUUUCGGUCC 21 0 0 0 0    0 0 0
mtr-miR2671h UUAAAAGUUUCGUUUCGGUCC 21 0 0 0 0    0 0 0
mtr-miR2671i UUAAAAGUUUCGUUUCGGUCC 21 0 0 0 0    0 0 0
mtr-miR2671j UUAAAAGUUUCGUUUCGGUCC 21 0 0 0 0    0 0 0
mtr-miR2672 UUAAUCGACCAAGUGGGUACUA 22 0 0 0 0    0 0 0
mtr-miR2673a CCUCUUCCUCUUCCUCUUCCAC 22 0 0 0 0    0 0 0
mtr-miR2673b CCUCUUCCUCUUCCUCUUCCAC 22 0 0 0 0    0 0 0
mtr-miR2674 CACUCGCUUUGGAAGUCAUGG 21 0 0 0 0    0 0 0
mtr-miR2675 CGAGGCAUAUUUGCAGGGAUU 21 0 0 0 0    0 0 0
mtr-miR2676a CAUUGUUUGGAUAAUAAUUUG 21 0 0 0 0    0 0 0
mtr-miR2676b CAUUGUUUGGAUAAUAAUUUG 21 0 0 0 0    0 0 0
mtr-miR2676c CAUUGUUUGGAUAAUAAUUUG 21 0 0 0 0    0 0 0
mtr-miR2676d CAUUGUUUGGAUAAUAAUUUG 21 0 0 0 0    0 0 0
mtr-miR2676e CAUUGUUUGGAUAAUAAUUUG 21 0 0 0 0    0 0 0
mtr-miR2676f CAUUGUUUGGAUAAUAAUUUG 21 0 0 0 0    0 0 0
mtr-miR2677 UUUAUUGAUAUUGCUAAUAGAU 22 0 0 0 0    0 0 0
mtr-miR2678 UGAAAUUGUUGCGAGUGUCUU 21 0 0 0 0    0 0 0
mtr-miR2679a CUUUUCACUUUCGAACGGGUG 21 0 0 0 0    0 0 0
mtr-miR2679b CUUUUCACUUUCGAACGGGUG 21 0 0 0 0    0 0 0
mtr-miR2679c CUUUUCACUUUCGAACGGGUG 21 0 0 0 0    0 0 0
mtr-miR2680a UCCUCGGUACCUAUGUUGAU 20 0 0 0 0    0 0 0
mtr-miR2680b UCCUCGGUACCUAUGUUGAU 20 0 0 0 0    0 0 0
mtr-miR2680c UCCUCGGUACCUAUGUUGAU 20 0 0 0 0    0 0 0
mtr-miR2680d UCCUCGGUACCUAUGUUGAU 20 0 0 0 0    0 0 0
mtr-miR2680e UCCUCGGUACCUAUGUUGAU 20 0 0 0 0    0 0 0
mtr-miR319a-3p UUGGACUGAAGGGAGCUCCC 20 22 7 19 1    19 1 2
mtr-miR319a-5p AGAGCUUCCUUCAGUCCACUC 21 0 0 0 0    0 0 0
mtr-miR319b-3p UUGGACUGAAGGGAGCUCCC 20 22 7 19 1    19 1 2
mtr-miR319b-5p GAGCUUUCUUUAGUCCACUCA 21 0 0 0 0    0 0 0
mtr-miR319c-3p UUGGACUGAAGGGAGCUCCCA 21 0 0 0 0    0 0 0
mtr-miR319c-5p GGAGUUCCUUGCAGCCCAAAG 21 0 0 0 0    0 0 0
mtr-miR319d-3p UUGGACUGAAGGGAGCUCCCU 21 0 0 0 0    0 0 0
mtr-miR319d-5p AGAGCUCUCUUCAGUCCACUC 21 0 0 0 0    0 0 0
mtr-miR390 AAGCUCAGGAGGGAUAGCGCC 21 0 0 0 0    0 0 0
mtr-miR393a UCCAAAGGGAUCGCAUUGAUC 21 0 0 0 0    0 0 0
mtr-miR393b-3p UUUGGGAUCAUGCUAUCCCUU 21 0 0 0 0    0 0 0
mtr-miR393b-5p UCCAAAGGGAUCGCAUUGAUC 21 0 0 0 0    0 0 0
mtr-miR395a AUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0
mtr-miR395b AUGAAGUAUUUGGGGGAACUC 21 0 0 0 0    0 0 0
mtr-miR395c AUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0
mtr-miR395d AUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0
mtr-miR395e AUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0
mtr-miR395f AUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0
mtr-miR395g UUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0
mtr-miR395h AUGAAGUGUUUGGGGGAACUU 21 0 0 0 0    0 0 0
mtr-miR395i AUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0
mtr-miR395j AUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0
mtr-miR395k UUGAAGCGUUUGGGGGAACUC 21 0 0 0 0    0 0 0
mtr-miR395l AUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0
mtr-miR395m AUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0
mtr-miR395n AUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0
mtr-miR395o AUGAAGUGUUUGGGGGAACUC 21 0 0 0 0    0 0 0
mtr-miR396a-3p GCUCAAGAAAGCUGUGGGAGA 21 0 0 0 0    0 0 0
mtr-miR396a-5p UUCCACAGCUUUCUUGAACUU 21 0 0 0 0    0 0 0
mtr-miR396b-3p GUUCAAUAAAGCUGUGGGAAG 21 0 0 0 0    0 0 0
mtr-miR396b-5p UUCCACAGCUUUCUUGAACUG 21 0 0 0 0    0 0 0
mtr-miR396c AUUCAAGAAGGUCGUGGAAAA 21 0 0 0 0    0 0 0
mtr-miR397-3p UCUACGCUACACUCAAUUAUG 21 0 0 0 0    0 0 0
mtr-miR397-5p UCAUUGAGUGCAGCGUUGAUG 21 0 0 0 0    0 0 0
mtr-miR398a-3p UGUGUUCUCAGGUCACCCCUU 21 0 0 0 0    0 0 0
mtr-miR398a-5p GGAGUGACACUGAGAACACAAG 22 0 0 0 0    0 0 0
mtr-miR398b UGUGUUCUCAGGUCGCCCCUG 21 0 0 0 0    0 0 0
mtr-miR398c UGUGUUCUCAGGUCGCCCCUG 21 0 0 0 0    0 0 0
mtr-miR399a UGCCAAAGGAGAUUUGCCCAG 21 0 0 0 0    0 0 0
mtr-miR399b UGCCAAAGGAGAGCUGCCCUG 21 0 0 0 0    0 0 0
mtr-miR399c UGCCAAAGGAGAUUUGCCCUG 21 0 0 0 0    0 0 0
mtr-miR399d UGCCAAAGGAGAGCUGCCCUA 21 0 0 0 0    0 0 0
mtr-miR399e UGCCAAAGGAGAUUUGCCCAG 21 0 0 0 0    0 0 0
mtr-miR399f UGCCAAAGGAGAUUUGCCCAG 21 0 0 0 0    0 0 0
mtr-miR399g UGCCAAAGGAGAUUUGCCCAG 21 0 0 0 0    0 0 0
mtr-miR399h UGCCAAAGGAGAUUUGCCCUG 21 0 0 0 0    0 0 0
mtr-miR399i UGCCAAAGGAGAUUUGCCCUG 21 0 0 0 0    0 0 0
mtr-miR399j CGCCAAAGAAGAUUUGCCCCG 21 0 0 0 0    0 0 0
mtr-miR399k UGCCAAAGAAGAUUUGCCCUG 21 0 0 0 0    0 0 0
mtr-miR399l UGCCAAAGGAGAGUUGCCCUG 21 0 0 0 0    0 0 0
mtr-miR399m UGCCAAAGGAGAGCUGCCCUA 21 0 0 0 0    0 0 0
mtr-miR399n UGCCAAAGGAGAGCUGCCCUA 21 0 0 0 0    0 0 0
mtr-miR399o UGCCAAAGGAGAGCUGCCCUG 21 0 0 0 0    0 0 0
mtr-miR399p UGCCAAAGGAGAGUUGCCCUG 21 0 0 0 0    0 0 0
mtr-miR399q UGCCAAAGGAGAGCUGCUCUU 21 0 0 0 0    0 0 0
mtr-miR399r UGCCAAAGAAGAUUUGCCCCG 21 0 0 0 0    0 0 0
mtr-miR399s-3p UGCCAAAGGAGAUUUGCCCAG 21 0 0 0 0    0 0 0
mtr-miR399s-5p GGGUGAGUUCUCCAUUGGCAGG 22 0 0 0 0    0 0 0
mtr-miR399t-3p UGCCAAAGGAGAUUUGCCCAG 21 0 0 0 0    0 0 0
mtr-miR399t-5p GGGUGAGUUCUCCAUUGGCAGGU 23 0 0 0 0    0 0 0
mtr-miR408-3p AUGCACUGCCUCUUCCCUGGC 21 0 0 0 0    0 0 0
mtr-miR408-5p ACAGGGAACAUGCAGAGCAUG 21 0 0 0 0    0 0 0
mtr-miR4414a-3p AUCCAACGAUGCGGGAGCUGC 21 0 0 0 0    0 0 0
mtr-miR4414a-5p AGCUGCUGACUCGUUGGUUCA 21 0 0 0 0    0 0 0
mtr-miR4414b UGUGAAUGAUGCGGGAGCUAA 21 0 0 0 0    0 0 0
mtr-miR482-3p CUUACCUACACCUCCCAUGCC 21 0 0 0 0    0 0 0
mtr-miR482-5p GGCAUGGGAUAGUAGGGAAGA 21 0 0 0 0    0 0 0
mtr-miR5037a AACCCUCAAAGGCUUCCACGG 21 0 0 0 0    0 0 0
mtr-miR5037b AACCCUCAAAGGCUUCCACGG 21 0 0 0 0    0 0 0
mtr-miR5037c AACCCUCAAAGGCUUCCACGG 21 0 0 0 0    0 0 0
mtr-miR5204 GCUGGAAGGUUUUGUAGGAAC 21 0 0 0 0    0 0 0
mtr-miR5205a CAUACAAUUUGGGACGGAGGGAG 23 0 0 0 0    0 0 0
mtr-miR5205b CUUAUAAUUAGGGACGGAGGGAGU 24 0 0 0 0    0 0 0
mtr-miR5205c CUUAUAAUUAGGGACGGAGGUAGU 24 0 0 0 0    0 0 0
mtr-miR5205d CUUAUAAUUAGGGACGGAGGUAGU 24 0 0 0 0    0 0 0
mtr-miR5206a AUGGGAUCCUGUUGGUGGGUUAC 23 0 0 0 0    0 0 0
mtr-miR5206b GUGGGAUCCGUUGAUGGGUUAC 22 0 0 0 0    0 0 0
mtr-miR5207 CAUUAAUGUGGGUUUGGACGGUU 23 0 0 0 0    0 0 0
mtr-miR5208a AACAUGGAUGUUGUGAGUUUGUU 23 0 0 0 0    0 0 0
mtr-miR5208b AACAUGGAUGUUGUGAGUUUGUU 23 0 0 0 0    0 0 0
mtr-miR5208c AACAUGGAUGUUGUGAGUUUGUU 23 0 0 0 0    0 0 0
mtr-miR5208d CAUAUUAGUCAUAUUUGUAGGCAU 24 0 0 0 0    0 0 0
mtr-miR5209 CGAGGAGGCGGUAUUGUUUGAA 22 0 0 0 0    0 0 0
mtr-miR5210 UAAAUGUGUUGGAAUUAAGGUU 22 0 0 0 0    0 0 0
mtr-miR5211 UCGCAGGAGUGAUGGGACCGGC 22 0 0 0 0    0 0 0
mtr-miR5212-3p CCAAGGAAAUAGAUAUCCAGC 21 0 0 0 0    0 0 0
mtr-miR5212-5p UGGAUUUCGUAUUUCUUUGGUA 22 0 0 0 0    0 0 0
mtr-miR5213-3p CAGAGUGCAGAUACACGCAUC 21 0 0 0 0    0 0 0
mtr-miR5213-5p UACGUGUGUCUUCACCUCUGAA 22 0 0 0 0    0 0 0
mtr-miR5214-3p UGAUAGAGCUAGACCAUCGGAG 22 0 0 0 0    0 0 0
mtr-miR5214-5p UAGCUCUAUUAACAAUUAAAU 21 0 0 0 0    0 0 0
mtr-miR5215 AGGAGGAUGAGCUACCUGCUU 21 0 0 0 0    0 0 0
mtr-miR5216a UUAGGAGUGAAAAACGGUGGAA 22 0 0 0 0    0 0 0
mtr-miR5216b UUAGGAGUGAAAAACGGUGGAA 22 0 0 0 0    0 0 0
mtr-miR5217 AGGUCAUUUUGAACGGUCGGAU 22 0 0 0 0    0 0 0
mtr-miR5218 UGAGACUUGGUAGUAAGAUGAU 22 0 0 0 0    0 0 0
mtr-miR5219 UCAUGGAAUCUCAGCUGCUGCA 22 0 0 0 0    0 0 0
mtr-miR5221 AGGAGAGAUGGUGUUUUGACUU 22 0 0 0 0    0 0 0
mtr-miR5222 UUACAGGAGAAGAAUGUAUGGC 22 0 0 0 0    0 0 0
mtr-miR5223 CGUGGAAUUUACUUGAAGAUGC 22 0 0 0 0    0 0 0
mtr-miR5224a UCGAGGACAUGAGGGACGUUAU 22 0 0 0 0    0 0 0
mtr-miR5224b CGGAAGAGGAUUGUCGAGGACA 22 0 0 0 0    0 0 0
mtr-miR5225a UCAGUCGCAGGAGAGAUGACAC 22 0 0 0 0    0 0 0
mtr-miR5225b UCGCAGGAGAGAUGACACCUUC 22 0 0 0 0    0 0 0
mtr-miR5225c UCGCAGGAGAGAUGACACCUUC 22 0 0 0 0    0 0 0
mtr-miR5226 UUUGUACAACUUGGAGGAUUCA 22 0 0 0 0    0 0 0
mtr-miR5227 UGAAGAGAAGAAGAUUGAUGAA 22 0 0 0 0    0 0 0
mtr-miR5228 UCUGGUGUACAACUUGAUGGA 21 0 0 0 0    0 0 0
mtr-miR5229a UUAGCAGGAAGAGUGACUAUG 21 0 0 0 0    0 0 0
mtr-miR5229b UUAGCAGGAAGAGUGACUAUG 21 0 0 0 0    0 0 0
mtr-miR5230 CAAAUCUUGAAUCGAUUGGCA 21 0 0 0 0    0 0 0
mtr-miR5231 UUAUGCAAGUAGAUAAGCUCA 21 0 0 0 0    0 0 0
mtr-miR5232 UACAUGUCGCUCUCACCUGAA 21 0 0 0 0    0 0 0
mtr-miR5233 GAGGAGGAUGGCCGUCUGGAC 21 0 0 0 0    0 0 0
mtr-miR5234 UUUUGUUGUGGAUGGCAGAAG 21 0 0 0 0    0 0 0
mtr-miR5235a AUAAGGUCAAUGAUUGGCGUG 21 0 0 0 0    0 0 0
mtr-miR5235b AUAAGGUCAAUGAUUGGCGUG 21 0 0 0 0    0 0 0
mtr-miR5236a UGAAUUUCGGGCAGAUUUGGU 21 0 0 0 0    0 0 0
mtr-miR5236b UGAAUUUCGGGCAGAUUUGGU 21 0 0 0 0    0 0 0
mtr-miR5236c UGAAUUUCGGGCAGAUUUGGU 21 0 0 0 0    0 0 0
mtr-miR5236d UGAAUUUCGGGCAGAUUUGGU 21 0 0 0 0    0 0 0
mtr-miR5236e UGAAUUUCGGGCAGAUUUGGU 21 0 0 0 0    0 0 0
mtr-miR5237 UUCAAAAGAUUUAGUUGGGAU 21 0 0 0 0    0 0 0
mtr-miR5238 UGUAGAAAAAACAAAGGGCAA 21 0 0 0 0    0 0 0
mtr-miR5239 UGGGAGAAAAGAUAGAAUGUG 21 0 0 0 0    0 0 0
mtr-miR5240 UUGAAAAAAUUGUGGAUUUGA 21 0 0 0 0    0 0 0
mtr-miR5241a UGACUGAAUGGAAGAGUGCAU 21 0 0 0 0    0 0 0
mtr-miR5241b UGACUGAAUGGAAGAGUGCAU 21 0 0 0 0    0 0 0
mtr-miR5241c UGACUGAAUGGAAGAGUGCAU 21 0 0 0 0    0 0 0
mtr-miR5242 UUGUAGAAACAAGCGAUGUCA 21 0 0 0 0    0 0 0
mtr-miR5243 UGGGCAGAGAAAUCGUGAGGC 21 0 0 0 0    0 0 0
mtr-miR5244 UAUCUCAUGAAGAUUGUUGGU 21 0 0 0 0    0 0 0
mtr-miR5245 CAUCGUAGAACACAGGCAGUA 21 0 0 0 0    0 0 0
mtr-miR5246 UUGCAGACAGCUUUGAAGGUU 21 0 0 0 0    0 0 0
mtr-miR5247 GCAGGAGCAAGCAUCUGAUGA 21 0 0 0 0    0 0 0
mtr-miR5248 UUUUUAGUUGGCAUGCAUUCA 21 0 0 0 0    0 0 0
mtr-miR5249 ACUUAGGGGGCAGUUUUGUAG 21 0 0 0 0    0 0 0
mtr-miR5250 UGAGAAUGUUAGAUACGGAAC 21 0 0 0 0    0 0 0
mtr-miR5251 AGUAGAUCUAGUUGGUGUCUU 21 0 0 0 0    0 0 0
mtr-miR5252 UGAGAGCUCACUGAAGUCUGC 21 0 0 0 0    0 0 0
mtr-miR5253 GAUGAAAAUGAUUAUGUUGGA 21 0 0 0 0    0 0 0
mtr-miR5254 AGGAGGUGGAAGCAUUUGUGA 21 0 0 0 0    0 0 0
mtr-miR5255 UGACUUGAUAGAGGACAUGGG 21 0 0 0 0    0 0 0
mtr-miR5256 UAAUGGAUUAUGUAAGAUUAA 21 0 0 0 0    0 0 0
mtr-miR5257 ACAAGUAGAACCUUUUUUCUG 21 0 0 0 0    0 0 0
mtr-miR5258 UCAAGUGACAAGGAAGAUCUU 21 0 0 0 0    0 0 0
mtr-miR5259 CAAGGGGUAUUGCGGAGGAUA 21 0 0 0 0    0 0 0
mtr-miR5260 UUUGUAUUGUUGACAUGGCUU 21 0 0 0 0    0 0 0
mtr-miR5261 UCAUUGUAGAUGGCUUUGGCU 21 0 0 0 0    0 0 0
mtr-miR5262 UCUGUCAGUAGACUCAAUUUC 21 0 0 0 0    0 0 0
mtr-miR5263 UGACUAAAACUAGUAACGGGG 21 0 0 0 0    0 0 0
mtr-miR5264 UUGAUCAAGGACUUUGCAUC 20 0 0 0 0    0 0 0
mtr-miR5265 AAGUGAUGUUGGAAUGGUUA 20 38 13 23 6    9 6 23
mtr-miR5266 CUGGGGGACUGUCUGGGGCG 20 0 0 0 0    0 0 0
mtr-miR5267a AGGCAUUUGCUAGAAUACACCCAC 24 0 0 0 0    0 0 0
mtr-miR5267b AGGCAUUUGCUAGAAUACACCCAC 24 0 0 0 0    0 0 0
mtr-miR5267c AGGCAUUUGCUAGAAUACACCCAC 24 0 0 0 0    0 0 0
mtr-miR5267d AGGCAUUUGCUAGAAUACACCCAC 24 0 0 0 0    0 0 0
mtr-miR5267e AGGCAUUUGCUAGAAUACACCCAC 24 0 0 0 0    0 0 0
mtr-miR5267f AGGCAUUUGCUAGAAUACACCCAC 24 0 0 0 0    0 0 0
mtr-miR5267g AGGCAUUUGCUAGAAUACACCCAC 24 0 0 0 0    0 0 0
mtr-miR5267h AGGCAUUUGCUAGAAUACACCCAC 24 0 0 0 0    0 0 0
mtr-miR5267i AGGCAUUUGCUAGAAUACACCCAC 24 0 0 0 0    0 0 0
mtr-miR5267j AGGCAUUUGCUAGAAUACACCCAC 24 0 0 0 0    0 0 0
mtr-miR5267k AGGCAUUUGCUAGAAUACACCCAC 24 0 0 0 0    0 0 0
mtr-miR5267l AGGCAUUUGCUAGGAUACACCCAC 24 0 0 0 0    0 0 0
mtr-miR5267m AGGCAUUUGCUAGAAUACACCCAC 24 0 0 0 0    0 0 0
mtr-miR5267n AGGCAUUUGCUAGAAUACACCCAC 24 0 0 0 0    0 0 0
mtr-miR5267o AGGCAUUUGCUAGGAUACACCCAC 24 0 0 0 0    0 0 0
mtr-miR5268a CCAGAGUGGAAUGAAGAUAUGGUU 24 0 0 0 0    0 0 0
mtr-miR5268b CCAGAGUGGAAUGAAGAUAUGGUU 24 0 0 0 0    0 0 0
mtr-miR5269a AAAGUGGUGGAACAUACAUUGAUU 24 0 0 0 0    0 0 0
mtr-miR5269b AAAGUGGUGGGACAUACAUUGAUU 24 0 0 0 0    0 0 0
mtr-miR5270a GAGGAGGAGUAGUUUUAGGUCAUU 24 0 0 0 0    0 0 0
mtr-miR5270b GAGGAGGAGUAGUUUUAGGUCAUU 24 0 0 0 0    0 0 0
mtr-miR5271a CGGAUAAUUGUGGUUACUAACGGU 24 0 0 0 0    0 0 0
mtr-miR5271b CGGAUAAUUGUGGUUACUAACGGU 24 0 0 0 0    0 0 0
mtr-miR5271c CGGAUAAUUGUGGUUACUAACGGU 24 0 0 0 0    0 0 0
mtr-miR5271d CGGAUAAUUGUGGUUACUAACGGU 24 0 0 0 0    0 0 0
mtr-miR5271e CGGAUAAUUGUGGUUACUAACGGU 24 0 0 0 0    0 0 0
mtr-miR5272a GAAUUGAUUUAUGUUUGGAUACAC 24 0 0 0 0    0 0 0
mtr-miR5272b GAAUUGAUUUAUGUUUGGAUACAC 24 0 0 0 0    0 0 0
mtr-miR5272c GAAUUGAUUUAUGUUUGGAUACAC 24 0 0 0 0    0 0 0
mtr-miR5272d GAAUUGAUUUAUGUUUGGAUACAC 24 0 0 0 0    0 0 0
mtr-miR5272e GAAUUGAUUUAUGUUUGGAUACAC 24 0 0 0 0    0 0 0
mtr-miR5272f GAAUUGAUUAUGUUUGGAUACACU 24 0 0 0 0    0 0 0
mtr-miR5273 UAGGGGCUGUAGUUUGAGAAGAGG 24 0 0 0 0    0 0 0
mtr-miR5274a CGUUCUACAAUAUGACGGAGUGUA 24 0 0 0 0    0 0 0
mtr-miR5274b-3p CAUUUACACUCCGUCAUAUUG 21 0 0 0 0    0 0 0
mtr-miR5274b-5p AUAUGACGGAGUGUAAAUGCC 21 0 0 0 0    0 0 0
mtr-miR5275 AGCUGGAGUCACAUGCUUGAAUUU 24 0 0 0 0    0 0 0
mtr-miR5276 AGGGGGAGCACCUUGCUGGGGCAU 24 0 0 0 0    0 0 0
mtr-miR5277 AGGUUGUUUCUUGAAGUGCAAGGC 24 0 0 0 0    0 0 0
mtr-miR5278 GAAAUUAUCUGCAGGAAAUGUGAA 24 0 0 0 0    0 0 0
mtr-miR5279 CGGAACCACUCGGAUGACUCGGUU 24 0 0 0 0    0 0 0
mtr-miR5280 UAAUUAGAAACGGGCCGUGAUGGG 24 0 0 0 0    0 0 0
mtr-miR5281a CUCUUGUAAAUAGGAUCGGAGGGA 24 0 0 0 0    0 0 0
mtr-miR5281b UCUUAUAAAUAGGACCGGAGGGAG 24 0 0 0 0    0 0 0
mtr-miR5281c UCUUAUAAAUAGGACCGGAGGGAG 24 0 0 0 0    0 0 0
mtr-miR5281d UCUUAUAAAUAGGACCGGAGGGAG 24 0 0 0 0    0 0 0
mtr-miR5281e UCUUAUAAAUAGGACCGGAGGGAG 24 0 0 0 0    0 0 0
mtr-miR5281f UCUUAUAAAUAGGACCGGAGGGAG 24 0 0 0 0    0 0 0
mtr-miR5282 GACGGAAUUAGAGAGGGAUUUCAU 24 0 0 0 0    0 0 0
mtr-miR5283 CGUGCGUAUCGGGAUGUAUCGGAA 24 0 0 0 0    0 0 0
mtr-miR5284a GAGGGACCAAAAGUGGAAGAAUCU 24 0 0 0 0    0 0 0
mtr-miR5284b GAGGGAUCAAAAGUGGAAGAAUCU 24 0 0 0 0    0 0 0
mtr-miR5284c GAGGGACCAAAAGUGGAAGAAUCU 24 0 0 0 0    0 0 0
mtr-miR5284d GAGGGACCAAAAGUGGAAGAAUCU 24 0 0 0 0    0 0 0
mtr-miR5284e GAGGGACCAAAAGUGGAAGAAUCU 24 0 0 0 0    0 0 0
mtr-miR5284f GAGGGACCAAAAGUGGAAGAAUCU 24 0 0 0 0    0 0 0
mtr-miR5284g GAGGGACCAAAAGUGGAAGAAUCU 24 0 0 0 0    0 0 0
mtr-miR5284h GAGGGAUCAAAAGUGGAGGAAUCU 24 0 0 0 0    0 0 0
mtr-miR5285a UGGGACUUUGGGUAGAAUUAGGCG 24 0 0 0 0    0 0 0
mtr-miR5285b UGGGACUUUGGGUAGAAUUAGGCG 24 0 0 0 0    0 0 0
mtr-miR5285c UGGGACUUUGGGUAGAAUUAGGCG 24 0 0 0 0    0 0 0
mtr-miR5286a CAGGACAAACUGGAGGCAAGGGAC 24 0 0 0 0    0 0 0
mtr-miR5286b ACAAACUGGAGGCAAGGGACAGGA 24 0 0 0 0    0 0 0
mtr-miR5287a UGCUUAUAUUAGUGACCGGAGGAU 24 0 0 0 0    0 0 0
mtr-miR5287b UGCUUAUAAUAGUGAUCGGAGGGU 24 0 0 0 0    0 0 0
mtr-miR5288 CAGCAUUGAAGAACAUAGGGAUUA 24 0 0 0 0    0 0 0
mtr-miR5289a CGAGGAAAACUGAAAACUUCGGCA 24 0 0 0 0    0 0 0
mtr-miR5289b CGAGGAAAACUGAAAACUUCGGCA 24 0 0 0 0    0 0 0
mtr-miR5290 AAUUUGGAGAGAGAUAGACACAUA 24 0 0 0 0    0 0 0
mtr-miR5291a GUUUGAUGGAUGGAUUGGAUGGAU 24 0 0 0 0    0 0 0
mtr-miR5291b GUUUGAUGGAUGGAUUGGAUGGAU 24 0 0 0 0    0 0 0
mtr-miR5291c GUUUGAUGGAUGGAUUGGAUGGAU 24 0 0 0 0    0 0 0
mtr-miR5292a AUUCAGAUGAUAGCAACAAAGAGC 24 0 0 0 0    0 0 0
mtr-miR5292b GAUUCAGAUGAUAGCAACAAAGAG 24 0 0 0 0    0 0 0
mtr-miR5293 GAUGAAGAAGUGGAAGGAAGAAGA 24 0 0 0 0    0 0 0
mtr-miR5294a GCUAAACGGAAUGAGGGUAGUCAU 24 0 0 0 0    0 0 0
mtr-miR5294b GCUAAACGGAAUGAGGGUAGUCAU 24 0 0 0 0    0 0 0
mtr-miR5294c GCUAAACGGAAUGAGGGUAGUCAU 24 0 0 0 0    0 0 0
mtr-miR5295a UCGGCUCUGGGAAUGAAAAGAGGC 24 0 0 0 0    0 0 0
mtr-miR5295b UCGGCUCUGGGAAUGAAAAGAGGC 24 0 0 0 0    0 0 0
mtr-miR5295c UCGGCUCUGGGAAUGAAAAGAGGC 24 0 0 0 0    0 0 0
mtr-miR5295d UCGGCUCUGGGAAUGAAAAGAGGC 24 0 0 0 0    0 0 0
mtr-miR5296 AUUUUGUGUGGGUGUAAGAGGUGU 24 0 0 0 0    0 0 0
mtr-miR5297 AUCGGGAAGUAUCGGAUAAUUAUU 24 0 0 0 0    0 0 0
mtr-miR5298a UGGAUAUGAUAUGAAGAUGAAGAA 24 0 0 0 0    0 0 0
mtr-miR5298b UGAUGGAGAUGAUAUGAAGAUGAA 24 0 0 0 0    0 0 0
mtr-miR5298c UGAUGGAGAUGAUAUGAAGAUGAA 24 0 0 0 0    0 0 0
mtr-miR5298d UGGAGAUGAUAUGAAGAUGAAAAA 24 0 0 0 0    0 0 0
mtr-miR5299 UUCAUUGGUAUUGUAAAGCGACAU 24 0 0 0 0    0 0 0
mtr-miR530 UGCAUUUGCACCUGCACUUUC 21 0 0 0 0    0 0 0
mtr-miR5554a-3p ACCAUCGUUGCAGAUGCUCAUC 22 0 0 0 0    0 0 0
mtr-miR5554a-5p UGUGCAUCUUGAACAAUGGUAU 22 0 0 0 0    0 0 0
mtr-miR5554b-3p ACCAUCGUUGCAGAUGCUCAUC 22 0 0 0 0    0 0 0
mtr-miR5554b-5p UGUGCAUCUUGAACAAUGGUAU 22 0 0 0 0    0 0 0
mtr-miR5554c-3p ACCAUCGUUGCAGAUGCUCAUC 22 0 0 0 0    0 0 0
mtr-miR5554c-5p UGUGCAUCUUGAACAAUGGUAU 22 0 0 0 0    0 0 0
mtr-miR5555-3p AAGUCGUAUUACACUCUUAGA 21 0 0 0 0    0 0 0
mtr-miR5555-5p UAAGAGUAUAAUAUGACUUUG 21 0 0 0 0    0 0 0
mtr-miR5556-3p UGAUGACGGAAGAAAUCCAAA 21 0 0 0 0    0 0 0
mtr-miR5556-5p UGGAAUUCUUCCGCCAUCCAA 21 0 0 0 0    0 0 0
mtr-miR5557-3p UGCUUCCUUAGUACUUGUUGA 21 0 0 0 0    0 0 0
mtr-miR5557-5p AACAAGUACUAAGGAAGCACA 21 0 0 0 0    0 0 0
mtr-miR5558-3p UAGAUUUAGAAUUAGAAAAGC 21 0 0 0 0    0 0 0
mtr-miR5558-5p UUUUCCAAUUCUAAGUCUAUC 21 0 0 0 0    0 0 0
mtr-miR5559-3p UCUAAUUAUUCACCAAGUAAA 21 0 0 0 0    0 0 0
mtr-miR5559-5p UACUUGGUGAAUUGUUGGAUC 21 0 0 0 0    0 0 0
mtr-miR5560-3p UGCCGGCUCAAUGAAUGCGGAG 22 0 0 0 0    0 0 0
mtr-miR5560-5p CUCAUUCACUCAGCCGGUACA 21 0 0 0 0    0 0 0
mtr-miR5561-3p GUCUAUCUCUCUCUAAAUGGA 21 0 0 0 0    0 0 0
mtr-miR5561-5p CAUUUGGAGAGACAUAGACAA 21 0 0 0 0    0 0 0
mtr-miR5562-3p AUGUGGAGAAGGCUGCAAC 19 0 0 0 0    0 0 0
mtr-miR5562-5p UGUGGAGUCUUUUGCAUGAAG 21 0 0 0 0    0 0 0
mtr-miR5563-3p ACUGAGUUGCCUAAUGUCGUU 21 0 0 0 0    0 0 0
mtr-miR5563-5p UGAUAUCAGGCAACUCGGUCC 21 0 0 0 0    0 0 0
mtr-miR5740 UGAACAGAAAGAACAUUUGGC 21 0 0 0 0    0 0 0
mtr-miR5741a UAGGGACUAAAUUGAUGGUUU 21 0 0 0 0    0 0 0
mtr-miR5741b UAGGGACUAAAUUGAUGGUUU 21 0 0 0 0    0 0 0
mtr-miR5741c UAGGGACUAAAUUGAUGGUUU 21 0 0 0 0    0 0 0
mtr-miR5741d UAGGGACUAAAUUGAUGGUUU 21 0 0 0 0    0 0 0
mtr-miR5741e UAGGGACUAAAUUGAUGGUUU 21 0 0 0 0    0 0 0
mtr-miR5742 CCACAUCAAUGGUCGUUGGAU 21 0 0 0 0    0 0 0
mtr-miR5743a UGAGAACUGUUUUCCGCACCUU 22 0 0 0 0    0 0 0
mtr-miR5743b UGAGAACUGUUUUCCGCACCUU 22 0 0 0 0    0 0 0
mtr-miR5744 UAGGUAUUUUAAGGAGCACGUU 22 0 0 0 0    0 0 0
mtr-miR5745a CGUGACAACACAUCAUUGGAUGCA 24 0 0 0 0    0 0 0
mtr-miR5745b UUUAAUUUAUAUACAUCGUCA 21 0 0 0 0    0 0 0
mtr-miR5746 UGGAUUCAACUCUAAGUGUCGGUU 24 0 0 0 0    0 0 0
mtr-miR5747 AAAAGAAUACUCAUACAUAACAUU 24 0 0 0 0    0 0 0
mtr-miR5748 ACAAAGACAUUGGAAGGCUUA 21 0 0 0 0    0 0 0
mtr-miR5749 UUCGGGUUGAUAAUAUUUUCUU 22 0 0 0 0    0 0 0
mtr-miR5750 AAGAGAGAUAGAUCAGAAUUGACA 24 0 0 0 0    0 0 0
mtr-miR5751 UUGAUUUGAUCAGAUGGUUUU 21 0 0 0 0    0 0 0
mtr-miR5752a CAUUGUUUGGUUUAGUACAAA 21 0 0 0 0    0 0 0
mtr-miR5752b CAUUGUUUGGUUUAGUACAAA 21 0 0 0 0    0 0 0
mtr-miR5753 AUUUUGAUUGGUGCCAACUAA 21 0 0 0 0    0 0 0
mtr-miR5754 UAUUGCACUCAUCUUCCAUGGC 22 0 0 0 0    0 0 0
mtr-miR5755 CUUUAACGCGGGAAAGACACA 21 0 0 0 0    0 0 0
mtr-miR5756 CCGACCGGAUUCUCAGACGGG 21 0 0 0 0    0 0 0
mtr-miR5757 UAGAGAUUUGUUUAACAGCCA 21 0 0 0 0    0 0 0
mtr-miR5758 UAAGUUGGAAGAAUGUAUUUG 21 0 0 0 0    0 0 0
mtr-miR5759 AAGGGGGUGAAAAGAUUCAAA 21 0 0 0 0    0 0 0
mtr-miR5760 UGCUUUAAGGAUAUUUGUUAAGGA 24 0 0 0 0    0 0 0
mtr-miR7696a-3p UUGAAUUAUGAGAACUUGAAG 21 0 0 0 0    0 0 0
mtr-miR7696a-5p UCAAGUUCUCAUAAUUCAAAA 21 0 0 0 0    0 0 0
mtr-miR7696b-3p UUGAAUUAUGAGAACUUGAAG 21 0 0 0 0    0 0 0
mtr-miR7696b-5p UCAAGUUCUCAUAAUUCAAAA 21 0 0 0 0    0 0 0
mtr-miR7696c-3p UUUUGAAUUAUGAGAACUUGA 21 0 0 0 0    0 0 0
mtr-miR7696c-5p AAGUUCUCAUAAUUCAAAAAG 21 0 0 0 0    0 0 0
mtr-miR7696d-3p UUUUGAAUUAUGAGAACUUGA 21 0 0 0 0    0 0 0
mtr-miR7696d-5p AAGUUCUCAUAAUUCAAAACG 21 0 0 0 0    0 0 0
mtr-miR7697-3p UCCGAUCAAAUAGAUCGGAUA 21 0 0 0 0    0 0 0
mtr-miR7697-5p UCCGAGAUAUUUGAUCGGAGG 21 0 0 0 0    0 0 0
mtr-miR7698-3p CAGACAACUUUGAUGAAAAGC 21 0 0 0 0    0 0 0
mtr-miR7698-5p UUUUCAUCAAAGUUUUCUGGA 21 0 0 0 0    0 0 0
mtr-miR7699-3p UGUAAUCAAUGCAUUAAAUGC 21 0 0 0 0    0 0 0
mtr-miR7699-5p AUUUAAUGCAUUGAUUACACA 21 0 0 0 0    0 0 0
mtr-miR7700-5p GUGGAGUGUGGGACAGCUUGC 21 0 0 0 0    0 0 0
mtr-miR7701-3p UUAGGUUCAUUCAAUUAAUGA 21 0 0 0 0    0 0 0
mtr-miR7701-5p AUUAAAUGAAUGAAUCUAAAA 21 0 0 0 0    0 0 0