Maize B73 Small RNA miRNA Abundances

The data below are based on the microRNAs listed in the miRBase registry. Adjust libraries/reads to display on the control panel.

        

        miRNA         miRNA sequence Len Sum (norm) Average Max Min (>0)  1.0Fertile_r11.0Fertile_r21.0Fertile_r31.5Fertile_r11.5Fertile_r21.5Fertile_r32.0Fertile_r12.0Fertile_r22.0Fertile_r31.0 ms23_r11.0 ms23_r21.5 ms23_r11.5 ms23_r22.0 ms23_r12.0 ms23_r2ms32F_1_0mm_r1ms32F_1_0mm_r2ms32F_1_0mm_r3ms32F_1_5mm_r1ms32F_1_5mm_r2ms32F_1_5mm_r3ms32F_2_0mm_r1ms32F_2_0mm_r2ms32F_2_0mm_r3ms32_1_0mm_r1ms32_1_0mm_r2ms32_1_0mm_r3ms32_1_5mm_r1ms32_1_5mm_r2ms32_1_5mm_r3ms32_2_0mm_r1ms32_2_0mm_r2ms32_2_0mm_r351ms_1_0mm_151ms_1_0mm_251ms_1_5mm_151ms_1_5mm_251ms_2_0mm_151ms_2_0mm_251ms_3_0mm_151ms_3_0mm_251ms_3_0mm_3122ms_1mm_1122ms_1mm_2122ms_1mm_3122ms_1_5mm1122ms_1_5mm2122ms_2mm_1122ms_2mm_2122ms_3mm_1122ms_3mm_2HiII_1_0mm_1HiII_1_0mm_2HiII_1_5mm_1HiII_1_5mm_2HiII_2_0mm_1HiII_2_0mm_2HiII_3_0mm_1HiII_3_0mm_2
zma-miR11969-3p UUAUACCCAUCUCUCACCUUGCAA 24 25 0 8 1    1 0 8 0 0 3 0 0 0 0 4 1 4 1 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR11969-5p GCAAGGUCAGAGAAGGAUAUAAUC 24 4 0 1 1    0 0 0 0 0 0 0 0 0 1 0 1 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR11970-3p UGGUUUGGUUGCACGUUUGCA 21 71 1 16 1    16 2 6 1 0 9 10 0 10 0 0 0 0 0 0 0 0 0 1 1 0 1 0 0 0 1 0 0 1 0 2 0 3 1 1 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 1 0 0
zma-miR11970-5p CAAGCGUGCAAGCAAACCAUU 21 33 1 4 1    0 0 1 0 0 2 1 0 0 0 0 0 0 0 0 3 0 0 0 3 0 0 1 0 1 0 0 0 3 0 0 0 0 3 4 3 2 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 2 1 1 0 0 0
zma-miR1432-3p GGGUGUCAUCUCGCCUGAAGCA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR1432-5p CUCAGGAGAGAUGACACCGAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR156a-3p GCUCACUUCUCUCUCUGUCAGU 22 117 2 51 1    0 0 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 51 12 0 0 0 0 0 0 0 3 18 14 0 0 1 0 0 1 2 12
zma-miR156a-5p UGACAGAAGAGAGUGAGCAC 20 1,835 31 182 2    2 37 53 10 22 40 13 8 17 27 17 49 28 17 21 50 17 72 40 56 34 46 11 5 43 37 80 77 20 7 51 46 82 43 8 2 16 5 8 182 22 0 3 24 7 33 26 29 8 72 49 13 6 9 18 4 30 29 54
zma-miR156b-3p GCUCACCCUCUAUCUGUCAGU 21 19 0 7 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 7 0 0 0 0 0 1 0 0 0 2 2 0 0 0 0 0 1 0 0
zma-miR156b-5p UGACAGAAGAGAGUGAGCAC 20 1,835 31 182 2    2 37 53 10 22 40 13 8 17 27 17 49 28 17 21 50 17 72 40 56 34 46 11 5 43 37 80 77 20 7 51 46 82 43 8 2 16 5 8 182 22 0 3 24 7 33 26 29 8 72 49 13 6 9 18 4 30 29 54
zma-miR156c UGACAGAAGAGAGUGAGCAC 20 1,835 31 182 2    2 37 53 10 22 40 13 8 17 27 17 49 28 17 21 50 17 72 40 56 34 46 11 5 43 37 80 77 20 7 51 46 82 43 8 2 16 5 8 182 22 0 3 24 7 33 26 29 8 72 49 13 6 9 18 4 30 29 54
zma-miR156d-3p GCUCACUUCUCUUUCUGUCAGC 22 527 9 55 1    1 0 13 0 1 7 1 2 4 0 0 4 0 0 1 0 2 0 0 2 0 1 1 0 0 1 0 0 0 0 0 0 0 53 9 3 55 5 5 36 5 0 3 26 3 41 31 17 10 15 8 7 2 25 29 4 37 21 36
zma-miR156d-5p UGACAGAAGAGAGUGAGCAC 20 1,835 31 182 2    2 37 53 10 22 40 13 8 17 27 17 49 28 17 21 50 17 72 40 56 34 46 11 5 43 37 80 77 20 7 51 46 82 43 8 2 16 5 8 182 22 0 3 24 7 33 26 29 8 72 49 13 6 9 18 4 30 29 54
zma-miR156e-3p GCUCACUGCUCUCUCUGUCAUC 22 33 1 5 1    0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 1 4 1 0 0 1 1 0 3 2 2 0 0 0 1 0 3 0 3 5 0 0 0 0 0 0 3 0
zma-miR156e-5p UGACAGAAGAGAGUGAGCAC 20 1,835 31 182 2    2 37 53 10 22 40 13 8 17 27 17 49 28 17 21 50 17 72 40 56 34 46 11 5 43 37 80 77 20 7 51 46 82 43 8 2 16 5 8 182 22 0 3 24 7 33 26 29 8 72 49 13 6 9 18 4 30 29 54
zma-miR156f-3p GCUCACUUCUCUUUCUGUCAGC 22 527 9 55 1    1 0 13 0 1 7 1 2 4 0 0 4 0 0 1 0 2 0 0 2 0 1 1 0 0 1 0 0 0 0 0 0 0 53 9 3 55 5 5 36 5 0 3 26 3 41 31 17 10 15 8 7 2 25 29 4 37 21 36
zma-miR156f-5p UGACAGAAGAGAGUGAGCAC 20 1,835 31 182 2    2 37 53 10 22 40 13 8 17 27 17 49 28 17 21 50 17 72 40 56 34 46 11 5 43 37 80 77 20 7 51 46 82 43 8 2 16 5 8 182 22 0 3 24 7 33 26 29 8 72 49 13 6 9 18 4 30 29 54
zma-miR156g-3p GCUCACUUCUCUUUCUGUCAGC 22 527 9 55 1    1 0 13 0 1 7 1 2 4 0 0 4 0 0 1 0 2 0 0 2 0 1 1 0 0 1 0 0 0 0 0 0 0 53 9 3 55 5 5 36 5 0 3 26 3 41 31 17 10 15 8 7 2 25 29 4 37 21 36
zma-miR156g-5p UGACAGAAGAGAGUGAGCAC 20 1,835 31 182 2    2 37 53 10 22 40 13 8 17 27 17 49 28 17 21 50 17 72 40 56 34 46 11 5 43 37 80 77 20 7 51 46 82 43 8 2 16 5 8 182 22 0 3 24 7 33 26 29 8 72 49 13 6 9 18 4 30 29 54
zma-miR156h-3p GCUCACUGCUCUUUCUGUCAUC 22 43 1 7 1    0 0 1 0 0 1 0 0 0 1 0 1 0 0 0 2 2 7 0 2 0 0 0 1 2 1 5 1 0 0 1 0 3 2 0 0 0 0 0 1 0 0 3 4 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0
zma-miR156h-5p UGACAGAAGAGAGUGAGCAC 20 1,835 31 182 2    2 37 53 10 22 40 13 8 17 27 17 49 28 17 21 50 17 72 40 56 34 46 11 5 43 37 80 77 20 7 51 46 82 43 8 2 16 5 8 182 22 0 3 24 7 33 26 29 8 72 49 13 6 9 18 4 30 29 54
zma-miR156i-3p GCUCACUGCUCUAUCUGUCAUC 22 10 0 9 1    0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 9 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR156i-5p UGACAGAAGAGAGUGAGCAC 20 1,835 31 182 2    2 37 53 10 22 40 13 8 17 27 17 49 28 17 21 50 17 72 40 56 34 46 11 5 43 37 80 77 20 7 51 46 82 43 8 2 16 5 8 182 22 0 3 24 7 33 26 29 8 72 49 13 6 9 18 4 30 29 54
zma-miR156j-3p UGCUCUCUGCUCUCACUGUCAUC 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR156j-5p UGACAGAAGAGAGAGAGCACA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR156k-3p GCUCGCUUCUCUUUCUGUCAGC 22 227 4 42 1    1 0 4 1 0 0 2 0 1 0 0 1 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 4 0 0 12 5 6 42 6 0 1 3 0 10 9 16 3 30 23 1 1 3 1 3 5 13 19
zma-miR156k-5p UGACAGAAGAGAGCGAGCAC 20 329 6 21 1    1 8 11 3 0 7 3 4 4 5 5 9 6 12 4 5 2 13 11 7 6 5 11 6 3 4 6 15 1 0 17 7 12 4 1 0 4 2 2 21 3 0 2 4 1 6 6 4 5 9 11 1 1 2 5 2 5 5 10
zma-miR156l-3p GCUCACUGCUCUAUCUGUCACC 22 97 2 12 1    0 0 11 1 0 5 2 0 0 1 0 0 1 0 0 0 2 2 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 12 0 0 1 1 0 0 3 0 1 7 0 2 2 7 3 5 8 0 0 1 0 1 2 10 4
zma-miR156l-5p UGACAGAAGAGAGUGAGCAC 20 1,835 31 182 2    2 37 53 10 22 40 13 8 17 27 17 49 28 17 21 50 17 72 40 56 34 46 11 5 43 37 80 77 20 7 51 46 82 43 8 2 16 5 8 182 22 0 3 24 7 33 26 29 8 72 49 13 6 9 18 4 30 29 54
zma-miR159a-3p UUUGGAUUGAAGGGAGCUCUG 21 92,438 1,567 19,739 47    138 1,345 3,995 2,901 8,858 2,941 1,130 19,739 1,620 127 47 97 87 91 108 444 225 624 2,651 1,125 1,138 2,988 3,285 3,183 362 466 464 693 414 167 563 309 500 712 490 913 12,770 1,853 1,851 803 611 1,973 97 115 134 78 109 102 113 144 300 69 48 376 821 1,055 1,154 1,524 1,398
zma-miR159a-5p GAGCUCCUAUCAUUCCAAUGA 21 74 1 9 1    0 0 4 0 0 8 0 0 0 1 0 0 0 0 0 0 0 2 0 0 0 2 0 0 0 0 1 0 0 0 2 0 0 3 1 0 3 1 0 3 1 2 1 1 4 2 1 3 1 5 9 0 4 4 1 0 1 3 0
zma-miR159b-3p UUUGGAUUGAAGGGAGCUCUG 21 92,438 1,567 19,739 47    138 1,345 3,995 2,901 8,858 2,941 1,130 19,739 1,620 127 47 97 87 91 108 444 225 624 2,651 1,125 1,138 2,988 3,285 3,183 362 466 464 693 414 167 563 309 500 712 490 913 12,770 1,853 1,851 803 611 1,973 97 115 134 78 109 102 113 144 300 69 48 376 821 1,055 1,154 1,524 1,398
zma-miR159b-5p GUGCUCCCUUCAAACCAAUAA 21 1,399 24 580 1    12 0 128 8 1 580 192 2 251 0 0 0 0 0 0 0 0 0 5 5 11 9 6 10 0 0 0 0 0 0 0 0 0 1 0 4 19 24 23 1 1 0 0 0 0 0 1 0 0 0 0 3 0 18 13 16 10 29 16
zma-miR159c-3p CUUGGAUUGAAGGGAGCUCCU 21 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR159c-5p GAGCUCCCUUCGAUCCAAUCC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR159d-3p CUUGGAUUGAAGGGAGCUCCU 21 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR159d-5p GAGCUCCCUUCGAUCCAAUCC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR159e-3p AUUGGUUUGAAGGGAGCUCCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR159e-5p CAGCUCCUGCAGCAUCUGUUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR159f-3p UUUGGAUUGAAGGGAGCUCUG 21 92,438 1,567 19,739 47    138 1,345 3,995 2,901 8,858 2,941 1,130 19,739 1,620 127 47 97 87 91 108 444 225 624 2,651 1,125 1,138 2,988 3,285 3,183 362 466 464 693 414 167 563 309 500 712 490 913 12,770 1,853 1,851 803 611 1,973 97 115 134 78 109 102 113 144 300 69 48 376 821 1,055 1,154 1,524 1,398
zma-miR159f-5p GAGCUCCUCUCAUUCCAAUGA 21 1 0 1 1    0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR159g-3p UUUGGAGUGAAGGGAGUUCUG 21 14 0 4 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 2 1 0 3 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0
zma-miR159g-5p GUGCUCCCUUCACACCAAUAA 21 900 15 374 1    10 0 71 2 0 374 137 1 178 0 0 0 0 0 0 0 0 0 10 0 3 5 5 0 0 0 0 0 0 0 0 0 0 0 0 3 14 14 11 0 1 0 0 0 0 0 0 0 0 0 0 0 0 10 6 9 7 19 10
zma-miR159h-3p UUUGGAGUGAAGGGAGCUCUG 21 15,897 269 1,936 1    6 14 98 238 262 201 95 705 100 0 0 0 0 0 0 30 0 81 1,662 404 522 1,936 1,776 1,842 1 0 0 4 0 0 1 2 1 0 0 36 1,044 817 919 227 223 10 0 2 1 1 0 3 0 0 2 3 1 105 351 430 513 602 626
zma-miR159h-5p GUGCUCCCUUCACACCAAUAA 21 900 15 374 1    10 0 71 2 0 374 137 1 178 0 0 0 0 0 0 0 0 0 10 0 3 5 5 0 0 0 0 0 0 0 0 0 0 0 0 3 14 14 11 0 1 0 0 0 0 0 0 0 0 0 0 0 0 10 6 9 7 19 10
zma-miR159i-3p UUUGGAGUGAAGGGAGCUCUG 21 15,897 269 1,936 1    6 14 98 238 262 201 95 705 100 0 0 0 0 0 0 30 0 81 1,662 404 522 1,936 1,776 1,842 1 0 0 4 0 0 1 2 1 0 0 36 1,044 817 919 227 223 10 0 2 1 1 0 3 0 0 2 3 1 105 351 430 513 602 626
zma-miR159i-5p GUGCUCCCUUCACACCAAUAA 21 900 15 374 1    10 0 71 2 0 374 137 1 178 0 0 0 0 0 0 0 0 0 10 0 3 5 5 0 0 0 0 0 0 0 0 0 0 0 0 3 14 14 11 0 1 0 0 0 0 0 0 0 0 0 0 0 0 10 6 9 7 19 10
zma-miR159j-3p UUUGGAUUGAAGGGAGCUCUG 21 92,438 1,567 19,739 47    138 1,345 3,995 2,901 8,858 2,941 1,130 19,739 1,620 127 47 97 87 91 108 444 225 624 2,651 1,125 1,138 2,988 3,285 3,183 362 466 464 693 414 167 563 309 500 712 490 913 12,770 1,853 1,851 803 611 1,973 97 115 134 78 109 102 113 144 300 69 48 376 821 1,055 1,154 1,524 1,398
zma-miR159j-5p GUGCUCCCUUCAAACCAAUAA 21 1,399 24 580 1    12 0 128 8 1 580 192 2 251 0 0 0 0 0 0 0 0 0 5 5 11 9 6 10 0 0 0 0 0 0 0 0 0 1 0 4 19 24 23 1 1 0 0 0 0 0 1 0 0 0 0 3 0 18 13 16 10 29 16
zma-miR159k-3p UUUGGAUUGAAGGGAGCUCUG 21 92,438 1,567 19,739 47    138 1,345 3,995 2,901 8,858 2,941 1,130 19,739 1,620 127 47 97 87 91 108 444 225 624 2,651 1,125 1,138 2,988 3,285 3,183 362 466 464 693 414 167 563 309 500 712 490 913 12,770 1,853 1,851 803 611 1,973 97 115 134 78 109 102 113 144 300 69 48 376 821 1,055 1,154 1,524 1,398
zma-miR159k-5p GUGCUCCCUUCAAACCAAUAA 21 1,399 24 580 1    12 0 128 8 1 580 192 2 251 0 0 0 0 0 0 0 0 0 5 5 11 9 6 10 0 0 0 0 0 0 0 0 0 1 0 4 19 24 23 1 1 0 0 0 0 0 1 0 0 0 0 3 0 18 13 16 10 29 16
zma-miR160a-3p GCGUGCAAGGGGCCAAGCAUG 21 14 0 3 1    0 0 0 0 0 1 0 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 1 0 0 0 0 1 0 0 1 0 1 1 0 0 0 0 0 0 0 0 0 2 0 3
zma-miR160a-5p UGCCUGGCUCCCUGUAUGCCA 21 2,877 49 346 1    13 3 346 10 9 197 31 0 27 278 132 158 150 181 205 63 42 86 14 25 24 4 1 14 92 44 106 90 4 1 80 55 51 90 21 10 36 5 1 6 3 0 13 11 18 6 9 13 5 5 6 14 14 14 6 4 10 8 13
zma-miR160b-3p GCGUGCAAGGAGCCAAGCAUG 21 26 0 3 1    0 0 3 0 0 2 0 0 0 1 0 0 1 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 3 0 0 0 0 0 3 0 1 0 0 0 0 0 1 1 3 0 0 0 0 0 2 0 2 0 1 0 0 0 0
zma-miR160b-5p UGCCUGGCUCCCUGUAUGCCA 21 2,877 49 346 1    13 3 346 10 9 197 31 0 27 278 132 158 150 181 205 63 42 86 14 25 24 4 1 14 92 44 106 90 4 1 80 55 51 90 21 10 36 5 1 6 3 0 13 11 18 6 9 13 5 5 6 14 14 14 6 4 10 8 13
zma-miR160c-3p GCGUGCAUGGUGCCAAGCAUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR160c-5p UGCCUGGCUCCCUGUAUGCCA 21 2,877 49 346 1    13 3 346 10 9 197 31 0 27 278 132 158 150 181 205 63 42 86 14 25 24 4 1 14 92 44 106 90 4 1 80 55 51 90 21 10 36 5 1 6 3 0 13 11 18 6 9 13 5 5 6 14 14 14 6 4 10 8 13
zma-miR160d-3p GCGUGCGUGGAGCCAAGCAUG 21 12 0 2 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 2 1 0 0 1 0 1 1 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 1 0 0 0 1
zma-miR160d-5p UGCCUGGCUCCCUGUAUGCCA 21 2,877 49 346 1    13 3 346 10 9 197 31 0 27 278 132 158 150 181 205 63 42 86 14 25 24 4 1 14 92 44 106 90 4 1 80 55 51 90 21 10 36 5 1 6 3 0 13 11 18 6 9 13 5 5 6 14 14 14 6 4 10 8 13
zma-miR160e UGCCUGGCUCCCUGUAUGCCA 21 2,877 49 346 1    13 3 346 10 9 197 31 0 27 278 132 158 150 181 205 63 42 86 14 25 24 4 1 14 92 44 106 90 4 1 80 55 51 90 21 10 36 5 1 6 3 0 13 11 18 6 9 13 5 5 6 14 14 14 6 4 10 8 13
zma-miR160f-3p GCGUGCGAGGUGCCAGGCAUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR160f-5p UGCCUGGCUCCCUGUAUGCCG 21 29 0 5 1    0 0 0 0 0 0 0 0 0 1 1 2 0 1 1 2 0 0 1 2 2 0 0 0 1 2 4 2 0 0 5 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR160g-3p GCGUGCAAGGAGCCAAGCAUG 21 26 0 3 1    0 0 3 0 0 2 0 0 0 1 0 0 1 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 3 0 0 0 0 0 3 0 1 0 0 0 0 0 1 1 3 0 0 0 0 0 2 0 2 0 1 0 0 0 0
zma-miR160g-5p UGCCUGGCUCCCUGUAUGCCA 21 2,877 49 346 1    13 3 346 10 9 197 31 0 27 278 132 158 150 181 205 63 42 86 14 25 24 4 1 14 92 44 106 90 4 1 80 55 51 90 21 10 36 5 1 6 3 0 13 11 18 6 9 13 5 5 6 14 14 14 6 4 10 8 13
zma-miR162-3p UCGAUAAACCUCUGCAUCCA 20 81 1 11 1    0 3 2 0 0 1 3 0 0 2 3 1 2 1 1 2 0 5 1 0 2 1 0 1 1 1 10 11 0 0 11 7 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 0 0 1 0 0 0
zma-miR162-5p GGGCGCAGUGGUUUAUCGAUC 21 137 2 17 1    0 0 0 0 0 1 0 0 0 0 0 0 1 0 0 3 2 8 1 7 11 0 1 1 5 2 17 15 14 1 11 1 11 3 0 1 1 0 0 0 0 0 1 1 1 1 2 1 1 3 3 1 0 1 1 2 0 0 0
zma-miR164a-3p CACGUGUUCUCCUUCUCCAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR164a-5p UGGAGAAGCAGGGCACGUGCA 21 2,305 39 175 1    46 33 35 28 39 83 135 113 90 27 13 43 44 66 59 37 34 42 42 63 65 40 38 47 32 45 57 122 53 30 172 91 175 22 9 14 22 4 3 40 11 8 1 2 1 2 2 9 5 18 30 3 2 3 3 1 5 19 27
zma-miR164b-3p AUGUGCCCAUCUUCUCCACC 20 6 0 2 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 1 0 2 0 0 0 1
zma-miR164b-5p UGGAGAAGCAGGGCACGUGCA 21 2,305 39 175 1    46 33 35 28 39 83 135 113 90 27 13 43 44 66 59 37 34 42 42 63 65 40 38 47 32 45 57 122 53 30 172 91 175 22 9 14 22 4 3 40 11 8 1 2 1 2 2 9 5 18 30 3 2 3 3 1 5 19 27
zma-miR164c-3p CAUGUGCCCUUCUUCUCCAUC 21 312 5 34 1    0 0 5 2 0 7 14 2 15 0 0 1 1 0 5 0 2 0 8 3 8 7 13 18 1 2 7 17 6 1 34 17 32 3 0 1 1 2 2 7 5 2 1 1 0 1 2 1 3 11 15 0 0 0 0 0 2 11 13
zma-miR164c-5p UGGAGAAGCAGGGCACGUGCA 21 2,305 39 175 1    46 33 35 28 39 83 135 113 90 27 13 43 44 66 59 37 34 42 42 63 65 40 38 47 32 45 57 122 53 30 172 91 175 22 9 14 22 4 3 40 11 8 1 2 1 2 2 9 5 18 30 3 2 3 3 1 5 19 27
zma-miR164d-3p CACGUGGUCUCCUUCUCCAU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR164d-5p UGGAGAAGCAGGGCACGUGCA 21 2,305 39 175 1    46 33 35 28 39 83 135 113 90 27 13 43 44 66 59 37 34 42 42 63 65 40 38 47 32 45 57 122 53 30 172 91 175 22 9 14 22 4 3 40 11 8 1 2 1 2 2 9 5 18 30 3 2 3 3 1 5 19 27
zma-miR164e-3p CAUGUGUCCGCCCUCUCCACC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR164e-5p UGGAGAAGCAGGACACGUGAG 21 4 0 1 1    0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR164f-3p CACGUGCGCUCCUUCUCCAAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR164f-5p UGGAGAAGCAGGGCACGUGCU 21 12 0 4 1    0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 1 0 1 0 0 0 0 0 1 0 0 1 4 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR164g-3p CACGUGCUCCCCUUCUCCACC 21 1,060 18 124 1    25 14 43 12 2 72 34 2 24 40 20 17 32 10 17 19 25 54 8 35 35 5 4 10 36 38 52 122 3 0 124 32 55 4 4 2 0 2 1 1 0 0 1 3 3 2 1 6 0 2 0 1 1 1 0 1 3 0 0
zma-miR164g-5p UGGAGAAGCAGGGCACGUGCA 21 2,305 39 175 1    46 33 35 28 39 83 135 113 90 27 13 43 44 66 59 37 34 42 42 63 65 40 38 47 32 45 57 122 53 30 172 91 175 22 9 14 22 4 3 40 11 8 1 2 1 2 2 9 5 18 30 3 2 3 3 1 5 19 27
zma-miR164h-3p CAUGUGCCCUUCUUCUCCAUC 21 312 5 34 1    0 0 5 2 0 7 14 2 15 0 0 1 1 0 5 0 2 0 8 3 8 7 13 18 1 2 7 17 6 1 34 17 32 3 0 1 1 2 2 7 5 2 1 1 0 1 2 1 3 11 15 0 0 0 0 0 2 11 13
zma-miR164h-5p UGGAGAAGCAGGGCACGUGUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR166a-3p UCGGACCAGGCUUCAUUCCCC 21 2,011,234 34,089 313,118 809    11,337 42,055 142,227 29,593 43,625 198,454 26,437 16,226 33,324 313,118 181,174 261,238 198,285 152,910 150,987 5,171 3,843 11,315 3,408 9,515 6,378 2,664 2,389 2,798 7,421 7,023 11,828 12,813 2,459 809 10,309 6,064 8,748 28,436 10,082 4,213 9,926 860 970 3,201 1,303 2,291 1,627 1,920 2,468 1,963 1,671 3,275 1,337 3,730 2,476 1,318 1,692 1,737 1,276 1,163 1,265 2,654 2,435
zma-miR166a-5p GGAAUGUUGUCUGGCUCGGGG 21 606 10 159 1    2 1 11 2 0 9 4 1 4 3 1 0 2 2 0 11 5 24 8 22 11 5 5 3 12 23 16 17 36 6 14 17 20 43 10 6 11 2 1 2 2 0 2 5 3 1 6 1 3 159 12 3 1 4 5 2 15 3 7
zma-miR166b-3p UCGGACCAGGCUUCAUUCCC 20 13,731 233 2,098 2    73 436 940 171 505 973 165 134 206 2,098 721 1,474 860 733 822 167 102 289 82 155 128 82 60 76 157 157 256 254 23 11 278 117 157 227 90 65 79 2 9 26 19 56 25 15 28 21 7 23 13 32 20 19 16 10 10 8 14 16 19
zma-miR166b-5p GGAAUGUUGUCUGGUUCAAGG 21 9,814 166 694 5    207 98 672 30 5 694 79 15 131 354 127 147 265 194 198 202 133 439 58 310 231 25 38 27 277 309 547 377 285 108 394 130 270 248 267 49 304 32 41 49 26 8 74 114 173 89 77 109 48 69 47 95 93 123 107 64 59 43 30
zma-miR166c-3p UCGGACCAGGCUUCAUUCCC 20 13,731 233 2,098 2    73 436 940 171 505 973 165 134 206 2,098 721 1,474 860 733 822 167 102 289 82 155 128 82 60 76 157 157 256 254 23 11 278 117 157 227 90 65 79 2 9 26 19 56 25 15 28 21 7 23 13 32 20 19 16 10 10 8 14 16 19
zma-miR166c-5p GGAAUGUUGUCUGGCUCGAGG 21 3,342 57 365 4    21 21 47 7 15 36 13 10 21 28 7 7 14 9 8 77 65 224 36 168 95 28 38 31 174 216 192 365 187 77 155 58 179 220 60 32 87 8 5 13 4 18 13 18 16 22 17 29 13 18 15 16 9 13 10 12 18 14 13
zma-miR166d-3p UCGGACCAGGCUUCAUUCCC 20 13,731 233 2,098 2    73 436 940 171 505 973 165 134 206 2,098 721 1,474 860 733 822 167 102 289 82 155 128 82 60 76 157 157 256 254 23 11 278 117 157 227 90 65 79 2 9 26 19 56 25 15 28 21 7 23 13 32 20 19 16 10 10 8 14 16 19
zma-miR166d-5p GGAAUGUUGUCUGGUUCAAGG 21 9,814 166 694 5    207 98 672 30 5 694 79 15 131 354 127 147 265 194 198 202 133 439 58 310 231 25 38 27 277 309 547 377 285 108 394 130 270 248 267 49 304 32 41 49 26 8 74 114 173 89 77 109 48 69 47 95 93 123 107 64 59 43 30
zma-miR166e UCGGACCAGGCUUCAUUCCC 20 13,731 233 2,098 2    73 436 940 171 505 973 165 134 206 2,098 721 1,474 860 733 822 167 102 289 82 155 128 82 60 76 157 157 256 254 23 11 278 117 157 227 90 65 79 2 9 26 19 56 25 15 28 21 7 23 13 32 20 19 16 10 10 8 14 16 19
zma-miR166f UCGGACCAGGCUUCAUUCCC 20 13,731 233 2,098 2    73 436 940 171 505 973 165 134 206 2,098 721 1,474 860 733 822 167 102 289 82 155 128 82 60 76 157 157 256 254 23 11 278 117 157 227 90 65 79 2 9 26 19 56 25 15 28 21 7 23 13 32 20 19 16 10 10 8 14 16 19
zma-miR166g-3p UCGGACCAGGCUUCAUUCCC 20 13,731 233 2,098 2    73 436 940 171 505 973 165 134 206 2,098 721 1,474 860 733 822 167 102 289 82 155 128 82 60 76 157 157 256 254 23 11 278 117 157 227 90 65 79 2 9 26 19 56 25 15 28 21 7 23 13 32 20 19 16 10 10 8 14 16 19
zma-miR166g-5p GGAAUGUUGUCUGGUUGGAGA 21 455 8 28 1    2 3 16 2 3 13 9 0 12 8 1 14 6 13 13 5 2 3 3 8 14 6 3 3 10 8 5 27 18 5 17 11 24 28 13 2 17 1 3 8 6 5 1 2 6 4 2 12 1 9 18 3 0 3 4 4 5 5 6
zma-miR166h-3p UCGGACCAGGCUUCAUUCCC 20 13,731 233 2,098 2    73 436 940 171 505 973 165 134 206 2,098 721 1,474 860 733 822 167 102 289 82 155 128 82 60 76 157 157 256 254 23 11 278 117 157 227 90 65 79 2 9 26 19 56 25 15 28 21 7 23 13 32 20 19 16 10 10 8 14 16 19
zma-miR166h-5p GGAAUGACGUCCGGUCCGAAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR166i-3p UCGGACCAGGCUUCAUUCCC 20 13,731 233 2,098 2    73 436 940 171 505 973 165 134 206 2,098 721 1,474 860 733 822 167 102 289 82 155 128 82 60 76 157 157 256 254 23 11 278 117 157 227 90 65 79 2 9 26 19 56 25 15 28 21 7 23 13 32 20 19 16 10 10 8 14 16 19
zma-miR166i-5p GGAAUGUCGUCUGGCGCGAGA 21 42 1 5 1    0 2 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 3 0 2 5 2 3 0 1 2 0 0 1 0 5 0 0 2 1 3 0 0 0 0 0 0 0 0 2 0 0 0 0 0 1 0 3
zma-miR166j-3p UCGGACCAGGCUUCAAUCCCU 21 138,496 2,347 12,533 159    890 5,046 4,965 2,560 6,678 8,785 1,259 4,054 1,354 12,533 4,308 5,214 5,760 4,848 4,660 1,979 1,470 3,694 1,331 2,843 2,203 1,170 844 911 1,953 2,539 3,841 3,732 1,160 483 4,271 1,954 3,119 9,293 3,230 2,233 2,633 230 159 506 211 809 525 485 752 498 394 509 296 460 471 328 353 325 257 218 260 342 308
zma-miR166j-5p GGUUUGUUUGUCUGGUUCAAGG 22 984 17 106 1    41 13 106 1 6 64 20 1 12 11 7 9 16 15 17 27 17 50 7 36 34 4 6 4 36 32 67 61 29 10 48 14 24 28 5 5 10 4 3 1 1 0 6 13 6 4 9 12 1 0 5 6 6 3 7 0 2 2 0
zma-miR166k-3p UCGGACCAGGCUUCAAUCCCU 21 138,496 2,347 12,533 159    890 5,046 4,965 2,560 6,678 8,785 1,259 4,054 1,354 12,533 4,308 5,214 5,760 4,848 4,660 1,979 1,470 3,694 1,331 2,843 2,203 1,170 844 911 1,953 2,539 3,841 3,732 1,160 483 4,271 1,954 3,119 9,293 3,230 2,233 2,633 230 159 506 211 809 525 485 752 498 394 509 296 460 471 328 353 325 257 218 260 342 308
zma-miR166k-5p GGAUUGUUGUCUGGCUCGGGG 21 811 14 90 1    4 16 87 1 11 90 2 1 4 51 10 7 19 4 6 14 11 40 3 18 14 1 1 3 30 29 58 29 19 5 18 5 8 44 19 4 16 3 1 8 1 0 18 13 18 5 6 6 1 3 0 1 9 5 4 2 2 2 1
zma-miR166l-3p UCGGACCAGGCUUCAUUCCUC 21 118,503 2,009 11,488 267    512 2,111 3,806 1,337 2,170 6,613 1,029 991 1,024 11,488 4,963 6,191 5,289 4,594 4,287 1,350 1,182 2,360 1,024 2,071 1,414 965 720 662 2,531 2,687 2,379 3,865 1,401 565 1,935 1,074 1,755 9,077 2,794 867 4,353 309 267 784 436 348 1,118 1,052 1,893 815 735 856 484 693 955 823 592 620 428 311 333 591 624
zma-miR166l-5p GAAUGGAGGCUGGUCCAAGA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR166m-3p UCGGACCAGGCUUCAUUCCUC 21 118,503 2,009 11,488 267    512 2,111 3,806 1,337 2,170 6,613 1,029 991 1,024 11,488 4,963 6,191 5,289 4,594 4,287 1,350 1,182 2,360 1,024 2,071 1,414 965 720 662 2,531 2,687 2,379 3,865 1,401 565 1,935 1,074 1,755 9,077 2,794 867 4,353 309 267 784 436 348 1,118 1,052 1,893 815 735 856 484 693 955 823 592 620 428 311 333 591 624
zma-miR166m-5p GGAAUGUUGGCUGGCUCGAGG 21 5,533 94 584 1    27 30 69 13 6 87 19 10 16 70 23 30 35 24 20 196 177 365 65 209 168 30 28 36 347 584 471 513 310 111 254 106 222 306 134 42 90 5 4 4 3 5 35 42 55 8 11 14 5 5 6 20 21 11 16 6 10 3 1
zma-miR166n-3p UCGGACCAGGCUUCAAUCCCU 21 138,496 2,347 12,533 159    890 5,046 4,965 2,560 6,678 8,785 1,259 4,054 1,354 12,533 4,308 5,214 5,760 4,848 4,660 1,979 1,470 3,694 1,331 2,843 2,203 1,170 844 911 1,953 2,539 3,841 3,732 1,160 483 4,271 1,954 3,119 9,293 3,230 2,233 2,633 230 159 506 211 809 525 485 752 498 394 509 296 460 471 328 353 325 257 218 260 342 308
zma-miR166n-5p GGAUUGUUGUCUGGCUCGGUG 21 2,533 43 174 1    7 2 94 9 1 112 9 1 7 85 12 19 19 9 14 35 37 89 18 60 43 10 13 12 44 137 97 118 103 46 57 29 76 135 174 41 96 16 10 10 6 12 52 45 118 33 30 49 28 17 33 30 39 35 32 11 16 19 22
zma-miR167a-3p GAUCAUGCAUGACAGCCUCAUU 22 20 0 3 1    2 0 1 0 0 3 2 0 0 0 0 0 0 0 1 0 0 0 1 1 1 1 0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 0 0 1 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 1 0 0 1
zma-miR167a-5p UGAAGCUGCCAGCAUGAUCUA 21 10,745 182 1,230 10    51 33 464 33 18 494 50 22 47 309 154 128 225 146 168 463 380 933 209 645 408 163 149 88 244 300 1,230 200 236 91 640 346 790 61 43 14 42 21 10 22 13 0 58 48 60 23 46 30 28 30 36 64 51 33 31 22 12 39 51
zma-miR167b-3p GAUCAUGCUGUGACAGUUUCACU 23 2 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR167b-5p UGAAGCUGCCAGCAUGAUCUA 21 10,745 182 1,230 10    51 33 464 33 18 494 50 22 47 309 154 128 225 146 168 463 380 933 209 645 408 163 149 88 244 300 1,230 200 236 91 640 346 790 61 43 14 42 21 10 22 13 0 58 48 60 23 46 30 28 30 36 64 51 33 31 22 12 39 51
zma-miR167c-3p GAUCAUGCUGUGGCAGCCUCACU 23 3,841 65 326 5    41 34 158 58 14 222 35 23 32 80 19 22 37 13 14 74 91 156 66 112 53 68 36 40 157 125 132 326 157 87 110 89 146 133 80 14 62 14 24 44 35 5 31 67 22 54 58 45 27 41 29 39 21 38 24 10 29 22 46
zma-miR167c-5p UGAAGCUGCCAGCAUGAUCUA 21 10,745 182 1,230 10    51 33 464 33 18 494 50 22 47 309 154 128 225 146 168 463 380 933 209 645 408 163 149 88 244 300 1,230 200 236 91 640 346 790 61 43 14 42 21 10 22 13 0 58 48 60 23 46 30 28 30 36 64 51 33 31 22 12 39 51
zma-miR167d-3p GGUCAUGCUGCUGCAGCCUCACU 23 684 12 89 1    1 0 3 2 6 9 1 0 0 3 0 1 0 1 1 0 0 0 0 5 1 0 3 0 2 1 6 11 4 1 1 1 5 89 28 13 38 8 10 20 4 2 30 41 16 26 32 36 18 68 12 9 15 18 15 9 8 13 37
zma-miR167d-5p UGAAGCUGCCAGCAUGAUCUA 21 10,745 182 1,230 10    51 33 464 33 18 494 50 22 47 309 154 128 225 146 168 463 380 933 209 645 408 163 149 88 244 300 1,230 200 236 91 640 346 790 61 43 14 42 21 10 22 13 0 58 48 60 23 46 30 28 30 36 64 51 33 31 22 12 39 51
zma-miR167e-3p GAUCAUGCUGUGCAGUUUCAUC 22 250 4 113 1    0 0 1 0 0 2 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 3 3 0 1 0 1 113 102 5 5 3 1 0 1 0 0 0 0 0 1 2 0 0 0 2 0
zma-miR167e-5p UGAAGCUGCCAGCAUGAUCUG 21 2,356 40 155 1    8 32 152 26 26 143 15 19 24 36 25 42 34 29 22 74 42 103 47 155 74 46 60 56 66 78 113 119 93 39 130 91 128 2 4 3 6 1 3 109 28 7 5 2 3 2 3 1 4 6 2 1 1 3 4 1 0 5 3
zma-miR167f-3p GAUCGUGCUGCGCAGUUUCACC 22 2 0 2 2    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR167f-5p UGAAGCUGCCAGCAUGAUCUG 21 2,356 40 155 1    8 32 152 26 26 143 15 19 24 36 25 42 34 29 22 74 42 103 47 155 74 46 60 56 66 78 113 119 93 39 130 91 128 2 4 3 6 1 3 109 28 7 5 2 3 2 3 1 4 6 2 1 1 3 4 1 0 5 3
zma-miR167g-3p GGUCAUGCUGUAGUUUCAUC 20 584 10 108 1    1 0 0 1 0 1 0 1 0 0 1 2 0 0 1 16 6 12 11 10 17 6 5 4 46 19 33 108 32 14 32 17 17 16 11 19 6 4 5 7 10 13 5 8 4 6 5 12 4 2 8 3 1 1 3 5 4 5 4
zma-miR167g-5p UGAAGCUGCCAGCAUGAUCUG 21 2,356 40 155 1    8 32 152 26 26 143 15 19 24 36 25 42 34 29 22 74 42 103 47 155 74 46 60 56 66 78 113 119 93 39 130 91 128 2 4 3 6 1 3 109 28 7 5 2 3 2 3 1 4 6 2 1 1 3 4 1 0 5 3
zma-miR167h-3p GAUCAUGUUGCAGCUUCAC 19 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR167h-5p UGAAGCUGCCAGCAUGAUCUG 21 2,356 40 155 1    8 32 152 26 26 143 15 19 24 36 25 42 34 29 22 74 42 103 47 155 74 46 60 56 66 78 113 119 93 39 130 91 128 2 4 3 6 1 3 109 28 7 5 2 3 2 3 1 4 6 2 1 1 3 4 1 0 5 3
zma-miR167i-3p GAUCAUGUUGCAGCUUCAC 19 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR167i-5p UGAAGCUGCCAGCAUGAUCUG 21 2,356 40 155 1    8 32 152 26 26 143 15 19 24 36 25 42 34 29 22 74 42 103 47 155 74 46 60 56 66 78 113 119 93 39 130 91 128 2 4 3 6 1 3 109 28 7 5 2 3 2 3 1 4 6 2 1 1 3 4 1 0 5 3
zma-miR167j-3p GAUCAUGUGGCAGUUUCAUU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR167j-5p UGAAGCUGCCAGCAUGAUCUG 21 2,356 40 155 1    8 32 152 26 26 143 15 19 24 36 25 42 34 29 22 74 42 103 47 155 74 46 60 56 66 78 113 119 93 39 130 91 128 2 4 3 6 1 3 109 28 7 5 2 3 2 3 1 4 6 2 1 1 3 4 1 0 5 3
zma-miR168a-3p CCCGCCUUGCACCAAGUGAA 20 497 8 142 1    2 52 25 12 65 11 10 142 20 2 1 2 2 2 5 2 0 2 3 1 1 2 0 0 0 0 1 4 1 0 2 0 4 6 0 2 4 1 0 20 11 2 1 2 1 2 2 6 4 5 12 3 1 3 3 3 1 10 16
zma-miR168a-5p UCGCUUGGUGCAGAUCGGGAC 21 349,592 5,925 102,935 515    1,340 6,117 6,765 2,357 5,308 5,380 1,252 8,929 1,549 4,729 1,673 3,261 5,211 3,563 4,958 1,217 973 2,444 804 1,397 1,673 711 515 515 1,050 1,040 1,957 3,483 2,434 1,049 3,535 2,156 3,207 102,935 32,340 31,025 16,650 1,345 891 4,622 3,097 18,024 1,674 3,349 3,511 3,832 4,566 2,654 2,154 3,430 5,552 2,094 1,580 2,001 1,262 965 1,181 2,680 3,626
zma-miR168b-3p CCCGCCUUGCAUCAAGUGAA 20 472 8 92 1    3 77 64 5 48 28 9 92 10 6 0 4 2 6 3 2 0 3 2 3 1 0 0 1 2 0 5 9 1 0 1 2 4 12 4 2 4 2 2 4 2 0 1 4 4 6 6 4 3 2 5 3 0 1 2 0 2 3 1
zma-miR168b-5p UCGCUUGGUGCAGAUCGGGAC 21 349,592 5,925 102,935 515    1,340 6,117 6,765 2,357 5,308 5,380 1,252 8,929 1,549 4,729 1,673 3,261 5,211 3,563 4,958 1,217 973 2,444 804 1,397 1,673 711 515 515 1,050 1,040 1,957 3,483 2,434 1,049 3,535 2,156 3,207 102,935 32,340 31,025 16,650 1,345 891 4,622 3,097 18,024 1,674 3,349 3,511 3,832 4,566 2,654 2,154 3,430 5,552 2,094 1,580 2,001 1,262 965 1,181 2,680 3,626
zma-miR169a-3p GGCAAGUUGUUCUUGGCUACA 21 5 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1
zma-miR169a-5p CAGCCAAGGAUGACUUGCCGA 21 252 4 26 1    7 5 22 10 6 25 15 7 7 15 9 4 20 11 26 0 0 0 0 2 1 0 0 0 1 1 0 0 3 2 1 0 1 15 10 5 7 0 1 0 1 2 1 1 1 0 0 0 1 2 2 0 0 0 2 0 0 0 0
zma-miR169b-3p GGCAAGUUGUUCUUGGCUACA 21 5 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1
zma-miR169b-5p CAGCCAAGGAUGACUUGCCGA 21 252 4 26 1    7 5 22 10 6 25 15 7 7 15 9 4 20 11 26 0 0 0 0 2 1 0 0 0 1 1 0 0 3 2 1 0 1 15 10 5 7 0 1 0 1 2 1 1 1 0 0 0 1 2 2 0 0 0 2 0 0 0 0
zma-miR169c-3p GGCAAGUCUGUCCUUGGCUACA 22 6 0 2 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 1 1 0 2 0
zma-miR169c-5p CAGCCAAGGAUGACUUGCCGG 21 19 0 3 1    0 0 2 0 0 2 1 0 0 0 1 1 1 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 3 1 1 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169d UAGCCAAGGAGACUGCCUAUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169e UAGCCAAGGAGACUGCCUACG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169f-3p GGCAUGUCUUCCUUGGCUACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169f-5p UAGCCAAGGAUGACUUGCCUA 21 5 0 2 1    0 0 0 0 0 0 2 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169g UAGCCAAGGAUGACUUGCCUA 21 5 0 2 1    0 0 0 0 0 0 2 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169h UAGCCAAGGAUGACUUGCCUA 21 5 0 2 1    0 0 0 0 0 0 2 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169i-3p GGCAGUCUCCUUGGCUAG 18 10 0 2 1    0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 0 0 0 0 1 0 0 0 0 0 2 0 0 0 0 0 0 0 2 0
zma-miR169i-5p UAGCCAAGGAUGACUUGCCUG 21 71 1 11 1    2 0 1 11 0 0 7 1 7 0 1 0 4 1 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 2 0 1 1 0 0 1 0 1 2 0 0 0 0 0 5 2 0 0 0 2 1 3 5 4
zma-miR169j-3p GGCAGUCUCCUUGGCUAG 18 10 0 2 1    0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 0 0 0 0 1 0 0 0 0 0 2 0 0 0 0 0 0 0 2 0
zma-miR169j-5p UAGCCAAGGAUGACUUGCCUG 21 71 1 11 1    2 0 1 11 0 0 7 1 7 0 1 0 4 1 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 2 0 1 1 0 0 1 0 1 2 0 0 0 0 0 5 2 0 0 0 2 1 3 5 4
zma-miR169k-3p GGCAGUCUCCUUGGCUAG 18 10 0 2 1    0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 0 0 0 0 1 0 0 0 0 0 2 0 0 0 0 0 0 0 2 0
zma-miR169k-5p UAGCCAAGGAUGACUUGCCUG 21 71 1 11 1    2 0 1 11 0 0 7 1 7 0 1 0 4 1 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 2 0 1 1 0 0 1 0 1 2 0 0 0 0 0 5 2 0 0 0 2 1 3 5 4
zma-miR169l-3p GGCAAAUCAUCCCUGCUACC 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169l-5p UAGCCAGGGAUGAUUUGCCUG 21 3 0 1 1    0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169m-3p GGCAUCCAUUCUUGGCUAAG 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169m-5p UAGCCAAGAAUGGCUUGCCUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169n-3p GGCAGGCCUUCUUGGCUAAG 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169n-5p UAGCCAAGAAUGGCUUGCCUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169o-3p GGCAGGUCUUCUUGGCUAGC 20 508 9 44 1    2 0 20 31 2 32 26 2 15 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 7 2 1 30 28 44 7 11 2 1 0 0 26 28 43 17 11 11 1 0 10 22 21 30 14 10
zma-miR169o-5p UAGCCAAGAAUGACUUGCCUA 21 25 0 4 1    1 0 4 0 0 2 1 0 2 0 0 0 0 1 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 2 0 2 3 1 0 0 0 0 0 0 0 2 0 1 0 0 0 0 0 0 0 2 0 0 0
zma-miR169p-3p GGCAAGUCAUCUGGGGCUACG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169p-5p UAGCCAAGGAUGACUUGCCGG 21 6 0 3 1    0 0 3 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169q-3p GGCAGGCCUUCUGGCUAAG 19 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169q-5p UAGCCAAGAAUGGCUUGCCUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169r-3p GGCAAGUUGUCCUUGGCUACA 21 13 0 3 1    0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 2 0 1 1 0 1 0 0 0 0 0 0 1 0 0 3 0 0 0 0 0 0 0 1
zma-miR169r-5p CAGCCAAGGAUGACUUGCCGG 21 19 0 3 1    0 0 2 0 0 2 1 0 0 0 1 1 1 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 3 1 1 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171a-3p UGAUUGAGCCGCGCCAAUAU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171a-5p UAUUGGCGAGGUUCAAUCAGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171b-3p UUGAGCCGUGCCAAUAUCAC 20 18 0 5 1    0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 1 0 0 0 5 2 0 0 3 0 3 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171b-5p GAUAUUGGCGCGGUUCAAUC 20 2 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171c-3p UGACUGAGCCGUGCCAAUAUC 21 2 0 1 1    1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171c-5p UAUUGGUGCGGUUCAAUCAGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171d-3p UGAUUGAGCCGUGCCAAUAUC 21 6,045 102 953 12    92 21 953 67 37 639 126 19 93 354 156 175 398 212 322 29 37 42 24 73 40 26 18 12 133 117 18 143 166 65 37 37 34 266 91 57 84 14 22 93 17 18 42 52 39 46 38 65 31 62 35 17 52 35 20 20 32 34 48
zma-miR171d-5p UGUUGGCUCGGCUCACUCAGA 21 8,372 142 723 2    49 36 200 57 17 262 23 14 36 116 30 25 62 32 61 327 310 619 181 458 349 98 128 64 636 615 572 723 369 168 291 148 251 158 89 20 105 10 14 33 9 2 53 79 54 41 50 33 19 30 27 22 51 36 31 9 19 21 30
zma-miR171e-3p UGAUUGAGCCGUGCCAAUAUC 21 6,045 102 953 12    92 21 953 67 37 639 126 19 93 354 156 175 398 212 322 29 37 42 24 73 40 26 18 12 133 117 18 143 166 65 37 37 34 266 91 57 84 14 22 93 17 18 42 52 39 46 38 65 31 62 35 17 52 35 20 20 32 34 48
zma-miR171e-5p UGUUGGCUCGGCUCACUCAGA 21 8,372 142 723 2    49 36 200 57 17 262 23 14 36 116 30 25 62 32 61 327 310 619 181 458 349 98 128 64 636 615 572 723 369 168 291 148 251 158 89 20 105 10 14 33 9 2 53 79 54 41 50 33 19 30 27 22 51 36 31 9 19 21 30
zma-miR171f-3p UUGAGCCGUGCCAAUAUCACA 21 17 0 5 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 3 5 0 0 0 0 1 1 1 4 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171f-5p CGAUGUUGGCAUGGCUCAAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171g-3p GAGGUGAGCCGAGCCAAUAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171g-5p UAUUGACUUGGCUCAUCUCUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171h-3p GUGAGCCGAACCAAUAUCACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171h-5p UGGUAUUGUUUCGGCUCAUGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171i-3p UGAUUGAGCCGUGCCAAUAUC 21 6,045 102 953 12    92 21 953 67 37 639 126 19 93 354 156 175 398 212 322 29 37 42 24 73 40 26 18 12 133 117 18 143 166 65 37 37 34 266 91 57 84 14 22 93 17 18 42 52 39 46 38 65 31 62 35 17 52 35 20 20 32 34 48
zma-miR171i-5p UGUUGGCACGGUUCAAUCAAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171j-3p UGAUUGAGCCGUGCCAAUAUC 21 6,045 102 953 12    92 21 953 67 37 639 126 19 93 354 156 175 398 212 322 29 37 42 24 73 40 26 18 12 133 117 18 143 166 65 37 37 34 266 91 57 84 14 22 93 17 18 42 52 39 46 38 65 31 62 35 17 52 35 20 20 32 34 48
zma-miR171j-5p UAUUGACGCGGUUCAAUUCGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171k-3p GUGAGCCGAACCAAUAUCACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171k-5p UGGUAUUGUUUCGGCUCAUGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171l-3p GGAUUGAGCCGCGUCAAUAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171l-5p UAUUGGCGUGCCUCAAUCCGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171m-3p GGAUUGAGCCGCGUCAAUAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171m-5p UAUUGGCGCGCCUCAAUCCGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171n-3p UGAUUGAGCCGCGCCAAUAUC 21 8 0 2 1    0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 1 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0
zma-miR171n-5p UAUUGGUGAGGUUCAAUCCGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR172a AGAAUCUUGAUGAUGCUGCA 20 169 3 38 1    0 0 2 0 0 0 0 3 0 0 0 0 1 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 0 1 0 1 0 0 1 3 38 28 0 1 0 1 4 2 10 6 6 12 1 1 1 6 3 4 13 18
zma-miR172b-3p AGAAUCUUGAUGAUGCUGCA 20 169 3 38 1    0 0 2 0 0 0 0 3 0 0 0 0 1 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 0 1 0 1 0 0 1 3 38 28 0 1 0 1 4 2 10 6 6 12 1 1 1 6 3 4 13 18
zma-miR172b-5p CAGCACCAUCAAGAUUCACA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR172c-3p AGAAUCUUGAUGAUGCUGCA 20 169 3 38 1    0 0 2 0 0 0 0 3 0 0 0 0 1 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 0 1 0 1 0 0 1 3 38 28 0 1 0 1 4 2 10 6 6 12 1 1 1 6 3 4 13 18
zma-miR172c-5p CAGCACCACCAAGAUUCACA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR172d-3p AGAAUCUUGAUGAUGCUGCA 20 169 3 38 1    0 0 2 0 0 0 0 3 0 0 0 0 1 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 0 1 0 1 0 0 1 3 38 28 0 1 0 1 4 2 10 6 6 12 1 1 1 6 3 4 13 18
zma-miR172d-5p CAGCACCAUCAAGAUUCACA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR172e GGAAUCUUGAUGAUGCUGCAU 21 1,350 23 204 1    2 0 44 2 3 106 21 4 12 1 0 2 7 5 5 2 0 0 7 9 7 11 5 4 1 0 4 12 4 2 9 6 18 10 1 1 47 16 19 204 73 2 4 3 3 29 31 95 47 104 40 1 1 24 37 26 49 61 107
zma-miR2118a UUCCUGAUGCCUCUCAUUCCUA 22 29,691 503 3,980 3    331 60 2,542 62 41 3,980 240 21 152 3,829 1,987 1,805 2,041 1,332 1,142 444 469 1,064 162 603 433 54 117 59 652 709 1,173 1,037 381 145 688 151 312 330 112 19 67 16 28 0 3 0 88 107 91 52 46 49 18 8 11 93 126 77 55 22 20 22 13
zma-miR2118b UUCCCGAUGCCUCCCAUUCCUA 22 36,664 621 4,833 2    535 532 4,067 141 470 4,250 605 236 528 4,833 3,514 3,877 3,015 2,209 2,003 239 259 355 110 333 227 85 53 51 323 361 330 550 152 110 177 119 132 216 66 27 68 38 35 20 31 2 83 116 55 76 71 178 39 44 49 68 89 68 84 40 79 141 100
zma-miR2118c UUCCUAAUGCCUCCCAUUCCUA 22 15,160 257 2,929 1    320 8 1,803 19 1 2,929 486 6 281 2,498 1,236 1,032 1,057 753 619 66 66 128 31 136 85 23 19 22 132 106 181 163 63 22 84 43 67 94 39 6 30 7 12 6 2 0 45 61 48 14 22 35 13 12 24 45 49 33 29 11 14 14 10
zma-miR2118d UUCCUGAUGCCUCCCAUGCCUA 22 39,213 665 6,542 2    770 43 6,542 65 26 5,504 765 24 489 6,330 3,803 3,866 2,866 2,599 2,406 123 130 245 40 177 119 33 37 37 165 206 241 263 119 64 138 74 116 234 78 46 49 12 11 2 6 3 27 38 18 20 15 39 10 11 9 14 26 33 16 9 10 30 22
zma-miR2118e UUCCUGAUGUCUCCCAUUCCUA 22 3,283 56 582 1    42 5 545 7 2 582 46 0 15 275 149 128 100 81 81 40 51 108 10 58 33 6 4 1 72 48 127 65 32 17 53 12 20 72 55 6 13 2 9 0 0 0 33 49 31 13 14 23 5 5 2 12 73 15 16 9 8 2 1
zma-miR2118f UUCCCAAUGCCUUCCAUGCCUA 22 1,018 17 189 1    11 8 189 9 9 137 13 2 6 76 54 45 37 32 51 5 17 40 3 16 10 4 3 3 18 18 24 34 14 6 9 4 25 18 3 3 4 3 1 1 0 0 5 0 7 2 5 3 3 0 0 6 2 7 5 2 3 0 3
zma-miR2118g UUCCUGAUGCCUCCUAUUCCUA 22 23,297 395 3,112 2    260 27 2,370 37 16 2,818 274 11 219 3,112 2,003 1,934 1,678 1,256 1,035 244 295 625 86 358 283 72 71 73 342 306 556 521 192 108 322 133 159 115 37 12 63 23 25 2 2 0 124 149 125 50 104 93 63 17 134 72 106 51 43 20 25 27 19
zma-miR2275a-3p UUUGUUUUCCUCCAAUAUCUCA 22 77,733 1,318 9,331 2    852 33 7,231 169 33 9,331 716 37 518 2,931 1,756 4,204 5,507 7,359 7,473 1,231 770 1,627 761 3,842 2,511 447 566 538 735 837 1,946 1,416 1,697 1,187 1,583 1,367 3,548 564 78 82 214 51 42 18 19 2 60 118 58 113 214 151 146 90 167 110 88 185 76 82 49 136 61
zma-miR2275a-5p AGAGUUGGAGGAAAGCAAACC 21 505,341 8,565 65,777 50    948 2,393 2,026 131 405 1,492 50 56 72 2,201 1,304 3,186 920 2,718 3,052 2,711 2,880 5,783 806 4,897 3,310 309 1,014 115 3,445 4,968 5,428 6,330 5,112 2,866 2,212 778 2,532 35,207 5,501 2,568 6,950 7,367 9,882 478 510 403 11,076 42,760 9,093 28,690 52,681 65,777 27,184 20,752 22,504 18,607 15,252 28,021 6,120 5,996 2,406 1,833 1,273
zma-miR2275b-3p UUCAGUUUCCUCUAAUAUCUCA 22 119,780 2,030 25,586 2    586 49 25,586 79 39 8,002 727 20 677 2,206 1,778 4,697 4,426 7,805 6,443 2,928 1,291 3,975 2,143 5,391 5,694 1,111 1,508 1,226 494 614 4,687 1,368 846 601 5,955 2,967 5,361 978 230 240 628 223 178 73 42 2 153 397 189 426 578 538 381 218 325 242 260 613 350 242 243 433 318
zma-miR2275b-5p AGGAUUAGAGGCAACUGAACC 21 801,010 13,576 49,843 420    13,608 19,006 42,084 8,538 4,348 49,843 2,553 2,544 2,810 7,320 3,608 7,251 6,987 9,925 11,474 15,999 9,557 31,413 14,443 32,137 30,840 5,357 17,710 3,312 16,382 11,304 22,604 31,212 20,824 8,672 10,888 6,573 14,943 21,069 7,220 23,169 13,117 11,045 15,100 420 932 2,382 8,988 29,799 12,296 17,577 30,869 11,684 6,950 3,035 4,827 14,823 9,838 26,408 12,480 13,436 5,798 1,046 633
zma-miR2275c-3p UUCAGUUUCCUCUAAUAUCUCA 22 119,780 2,030 25,586 2    586 49 25,586 79 39 8,002 727 20 677 2,206 1,778 4,697 4,426 7,805 6,443 2,928 1,291 3,975 2,143 5,391 5,694 1,111 1,508 1,226 494 614 4,687 1,368 846 601 5,955 2,967 5,361 978 230 240 628 223 178 73 42 2 153 397 189 426 578 538 381 218 325 242 260 613 350 242 243 433 318
zma-miR2275c-5p AGGAUUAGAGGGACUUGAACC 21 34,617 587 4,721 1    556 2,053 1,111 1,654 2,390 3,786 415 521 383 3 0 1 4 1 5 0 0 8 1,174 1,419 1,364 235 690 122 1 0 2 7 9 5 1 1 1 148 3 4,721 1,682 427 390 7 8 49 1 2 1 779 970 290 230 74 198 7 1 3,097 2,172 953 392 53 40
zma-miR2275d-3p UUUGUUUUCCUCUAAUAUCUCA 22 40 1 5 1    0 0 3 0 0 1 0 0 0 1 0 1 0 2 4 3 0 0 0 5 1 1 1 0 0 2 4 1 1 1 1 4 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR2275d-5p AGAGUUGGAGGAAAGAAAACU 21 2 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR319a-3p UUGGACUGAAGGGUGCUCCC 20 2,008 34 270 1    17 81 270 37 57 232 24 45 36 121 48 73 58 40 41 46 29 82 7 46 19 9 6 5 85 89 124 77 6 1 58 19 51 16 14 5 5 0 1 2 1 0 1 2 6 1 2 3 3 3 2 0 1 0 0 1 0 0 0
zma-miR319a-5p GAGCUCUCUUCAGUCCACUC 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR319b-3p UUGGACUGAAGGGUGCUCCC 20 2,008 34 270 1    17 81 270 37 57 232 24 45 36 121 48 73 58 40 41 46 29 82 7 46 19 9 6 5 85 89 124 77 6 1 58 19 51 16 14 5 5 0 1 2 1 0 1 2 6 1 2 3 3 3 2 0 1 0 0 1 0 0 0
zma-miR319b-5p AGAGCGUCCUUCAGUCCACUC 21 2,082 35 227 1    1 1 6 2 0 7 0 0 2 1 1 1 2 1 0 2 0 0 0 3 1 0 0 0 2 0 0 0 0 1 0 2 1 80 25 38 50 51 36 227 64 21 56 93 31 94 110 129 100 114 149 42 32 95 66 29 122 93 98
zma-miR319c-3p UUGGACUGAAGGGUGCUCCC 20 2,008 34 270 1    17 81 270 37 57 232 24 45 36 121 48 73 58 40 41 46 29 82 7 46 19 9 6 5 85 89 124 77 6 1 58 19 51 16 14 5 5 0 1 2 1 0 1 2 6 1 2 3 3 3 2 0 1 0 0 1 0 0 0
zma-miR319c-5p GAGCUCUCUUCAGUCCACUC 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR319d-3p UUGGACUGAAGGGUGCUCCC 20 2,008 34 270 1    17 81 270 37 57 232 24 45 36 121 48 73 58 40 41 46 29 82 7 46 19 9 6 5 85 89 124 77 6 1 58 19 51 16 14 5 5 0 1 2 1 0 1 2 6 1 2 3 3 3 2 0 1 0 0 1 0 0 0
zma-miR319d-5p AGAGCGUCCUUCAGUCCACUC 21 2,082 35 227 1    1 1 6 2 0 7 0 0 2 1 1 1 2 1 0 2 0 0 0 3 1 0 0 0 2 0 0 0 0 1 0 2 1 80 25 38 50 51 36 227 64 21 56 93 31 94 110 129 100 114 149 42 32 95 66 29 122 93 98
zma-miR390a-3p CGCUAUCUAUCCUGAGCUCCA 21 857 15 152 1    0 2 9 2 5 31 4 0 5 1 0 1 1 2 2 29 9 17 21 48 22 40 8 18 14 3 24 56 30 7 152 66 95 10 5 4 13 4 1 7 3 2 1 0 1 2 1 7 6 9 11 1 2 3 3 5 4 13 15
zma-miR390a-5p AAGCUCAGGAGGGAUAGCGCC 21 93,013 1,576 16,459 19    27 19