Maize miRNA Abundances

The data below are based on the microRNAs listed in the Sanger registry. Adjust libraries/reads to display on the control panel.

        

        miRNA         miRNA sequence Len Sum (norm) Average Max Min (>0)  dcl5_1F_1_5mmdcl5_1F_2_0mmdcl5_1_1_5mmdcl5_1_2_0mmdcl5_2_1_5mm_adcl5_2_2_0mmdcl5_3_1_5mmdcl5_3_2_0mm_adcl5_3_2_0mm_bdcl5_4_1_5mmdcl5_4_2_0mmsTP_dcl5_1_2asTP_dcl5_2_3asTR_dcl5_1_2asTR_dcl5_2_3a
zma-miR11969-3p UUAUACCCAUCUCUCACCUUGCAA 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR11969-5p GCAAGGUCAGAGAAGGAUAUAAUC 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR11970-3p UGGUUUGGUUGCACGUUUGCA 21 8 2 3 1    2 0 0 0 0 0 3 0 0 0 2 0 0 1 0
zma-miR11970-5p CAAGCGUGCAAGCAAACCAUU 21 4 1 2 1    0 0 0 0 1 0 2 0 0 0 0 0 0 1 0
zma-miR1432-3p GGGUGUCAUCUCGCCUGAAGCA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR1432-5p CUCAGGAGAGAUGACACCGAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR156a-3p GCUCACUUCUCUCUCUGUCAGU 22 9 9 9 9    0 0 0 0 0 0 0 0 0 0 0 0 0 0 9
zma-miR156a-5p UGACAGAAGAGAGUGAGCAC 20 4,428 295 1,235 10    12 10 77 910 66 87 24 115 176 34 25 608 546 503 1,235
zma-miR156b-3p GCUCACCCUCUAUCUGUCAGU 21 93 13 31 1    0 1 0 27 3 0 0 0 0 0 0 8 20 3 31
zma-miR156b-5p UGACAGAAGAGAGUGAGCAC 20 4,428 295 1,235 10    12 10 77 910 66 87 24 115 176 34 25 608 546 503 1,235
zma-miR156c UGACAGAAGAGAGUGAGCAC 20 4,428 295 1,235 10    12 10 77 910 66 87 24 115 176 34 25 608 546 503 1,235
zma-miR156d-3p GCUCACUUCUCUUUCUGUCAGC 22 131 13 38 1    2 1 0 38 0 0 2 4 2 0 0 14 20 21 27
zma-miR156d-5p UGACAGAAGAGAGUGAGCAC 20 4,428 295 1,235 10    12 10 77 910 66 87 24 115 176 34 25 608 546 503 1,235
zma-miR156e-3p GCUCACUGCUCUCUCUGUCAUC 22 17 3 10 1    0 1 0 0 1 0 0 0 0 0 0 1 1 3 10
zma-miR156e-5p UGACAGAAGAGAGUGAGCAC 20 4,428 295 1,235 10    12 10 77 910 66 87 24 115 176 34 25 608 546 503 1,235
zma-miR156f-3p GCUCACUUCUCUUUCUGUCAGC 22 131 13 38 1    2 1 0 38 0 0 2 4 2 0 0 14 20 21 27
zma-miR156f-5p UGACAGAAGAGAGUGAGCAC 20 4,428 295 1,235 10    12 10 77 910 66 87 24 115 176 34 25 608 546 503 1,235
zma-miR156g-3p GCUCACUUCUCUUUCUGUCAGC 22 131 13 38 1    2 1 0 38 0 0 2 4 2 0 0 14 20 21 27
zma-miR156g-5p UGACAGAAGAGAGUGAGCAC 20 4,428 295 1,235 10    12 10 77 910 66 87 24 115 176 34 25 608 546 503 1,235
zma-miR156h-3p GCUCACUGCUCUUUCUGUCAUC 22 4 1 2 1    0 0 0 0 0 0 0 0 0 0 0 1 0 1 2
zma-miR156h-5p UGACAGAAGAGAGUGAGCAC 20 4,428 295 1,235 10    12 10 77 910 66 87 24 115 176 34 25 608 546 503 1,235
zma-miR156i-3p GCUCACUGCUCUAUCUGUCAUC 22 24 5 16 1    0 0 0 16 2 0 0 0 0 0 0 1 0 1 4
zma-miR156i-5p UGACAGAAGAGAGUGAGCAC 20 4,428 295 1,235 10    12 10 77 910 66 87 24 115 176 34 25 608 546 503 1,235
zma-miR156j-3p UGCUCUCUGCUCUCACUGUCAUC 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR156j-5p UGACAGAAGAGAGAGAGCACA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR156k-3p GCUCGCUUCUCUUUCUGUCAGC 22 8 3 5 1    0 0 0 5 2 0 0 0 0 0 0 1 0 0 0
zma-miR156k-5p UGACAGAAGAGAGCGAGCAC 20 63 6 16 2    0 0 2 16 2 3 5 4 0 0 2 4 9 4 12
zma-miR156l-3p GCUCACUGCUCUAUCUGUCACC 22 467 31 169 2    2 5 12 169 9 10 11 31 20 3 6 36 21 54 78
zma-miR156l-5p UGACAGAAGAGAGUGAGCAC 20 4,428 295 1,235 10    12 10 77 910 66 87 24 115 176 34 25 608 546 503 1,235
zma-miR159a-3p UUUGGAUUGAAGGGAGCUCUG 21 329,103 21,940 73,649 3,040    4,063 3,040 14,772 14,563 6,233 8,566 6,391 18,544 12,515 5,361 6,757 50,179 48,542 55,928 73,649
zma-miR159a-5p GAGCUCCUAUCAUUCCAAUGA 21 452 45 184 2    3 5 0 5 0 3 2 0 9 0 0 184 103 88 50
zma-miR159b-3p UUUGGAUUGAAGGGAGCUCUG 21 329,103 21,940 73,649 3,040    4,063 3,040 14,772 14,563 6,233 8,566 6,391 18,544 12,515 5,361 6,757 50,179 48,542 55,928 73,649
zma-miR159b-5p GUGCUCCCUUCAAACCAAUAA 21 470 31 112 3    20 3 59 38 22 17 34 93 112 14 6 12 10 11 19
zma-miR159c-3p CUUGGAUUGAAGGGAGCUCCU 21 75 8 24 1    2 1 0 0 2 0 2 4 2 0 0 7 19 24 12
zma-miR159c-5p GAGCUCCCUUCGAUCCAAUCC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR159d-3p CUUGGAUUGAAGGGAGCUCCU 21 75 8 24 1    2 1 0 0 2 0 2 4 2 0 0 7 19 24 12
zma-miR159d-5p GAGCUCCCUUCGAUCCAAUCC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR159e-3p AUUGGUUUGAAGGGAGCUCCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR159e-5p CAGCUCCUGCAGCAUCUGUUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR159f-3p UUUGGAUUGAAGGGAGCUCUG 21 329,103 21,940 73,649 3,040    4,063 3,040 14,772 14,563 6,233 8,566 6,391 18,544 12,515 5,361 6,757 50,179 48,542 55,928 73,649
zma-miR159f-5p GAGCUCCUCUCAUUCCAAUGA 21 2 2 2 2    0 0 0 0 0 0 0 0 0 0 0 2 0 0 0
zma-miR159g-3p UUUGGAGUGAAGGGAGUUCUG 21 3 2 2 1    0 0 0 0 0 0 0 0 2 1 0 0 0 0 0
zma-miR159g-5p GUGCUCCCUUCACACCAAUAA 21 111 8 22 1    6 0 17 22 2 7 6 9 15 7 2 8 2 1 7
zma-miR159h-3p UUUGGAGUGAAGGGAGCUCUG 21 10,422 695 1,223 214    214 220 916 1,019 509 626 372 1,223 874 313 385 968 942 887 954
zma-miR159h-5p GUGCUCCCUUCACACCAAUAA 21 111 8 22 1    6 0 17 22 2 7 6 9 15 7 2 8 2 1 7
zma-miR159i-3p UUUGGAGUGAAGGGAGCUCUG 21 10,422 695 1,223 214    214 220 916 1,019 509 626 372 1,223 874 313 385 968 942 887 954
zma-miR159i-5p GUGCUCCCUUCACACCAAUAA 21 111 8 22 1    6 0 17 22 2 7 6 9 15 7 2 8 2 1 7
zma-miR159j-3p UUUGGAUUGAAGGGAGCUCUG 21 329,103 21,940 73,649 3,040    4,063 3,040 14,772 14,563 6,233 8,566 6,391 18,544 12,515 5,361 6,757 50,179 48,542 55,928 73,649
zma-miR159j-5p GUGCUCCCUUCAAACCAAUAA 21 470 31 112 3    20 3 59 38 22 17 34 93 112 14 6 12 10 11 19
zma-miR159k-3p UUUGGAUUGAAGGGAGCUCUG 21 329,103 21,940 73,649 3,040    4,063 3,040 14,772 14,563 6,233 8,566 6,391 18,544 12,515 5,361 6,757 50,179 48,542 55,928 73,649
zma-miR159k-5p GUGCUCCCUUCAAACCAAUAA 21 470 31 112 3    20 3 59 38 22 17 34 93 112 14 6 12 10 11 19
zma-miR160a-3p GCGUGCAAGGGGCCAAGCAUG 21 2 2 2 2    0 0 0 0 0 0 0 0 2 0 0 0 0 0 0
zma-miR160a-5p UGCCUGGCUCCCUGUAUGCCA 21 1,544 103 239 17    26 17 97 98 25 63 77 31 176 59 53 239 215 171 197
zma-miR160b-3p GCGUGCAAGGAGCCAAGCAUG 21 25 4 6 1    0 1 0 0 0 3 0 0 5 0 0 6 3 1 6
zma-miR160b-5p UGCCUGGCUCCCUGUAUGCCA 21 1,544 103 239 17    26 17 97 98 25 63 77 31 176 59 53 239 215 171 197
zma-miR160c-3p GCGUGCAUGGUGCCAAGCAUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR160c-5p UGCCUGGCUCCCUGUAUGCCA 21 1,544 103 239 17    26 17 97 98 25 63 77 31 176 59 53 239 215 171 197
zma-miR160d-3p GCGUGCGUGGAGCCAAGCAUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR160d-5p UGCCUGGCUCCCUGUAUGCCA 21 1,544 103 239 17    26 17 97 98 25 63 77 31 176 59 53 239 215 171 197
zma-miR160e UGCCUGGCUCCCUGUAUGCCA 21 1,544 103 239 17    26 17 97 98 25 63 77 31 176 59 53 239 215 171 197
zma-miR160f-3p GCGUGCGAGGUGCCAGGCAUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR160f-5p UGCCUGGCUCCCUGUAUGCCG 21 22 3 6 1    0 1 0 0 0 3 6 0 0 3 0 2 1 3 3
zma-miR160g-3p GCGUGCAAGGAGCCAAGCAUG 21 25 4 6 1    0 1 0 0 0 3 0 0 5 0 0 6 3 1 6
zma-miR160g-5p UGCCUGGCUCCCUGUAUGCCA 21 1,544 103 239 17    26 17 97 98 25 63 77 31 176 59 53 239 215 171 197
zma-miR162-3p UCGAUAAACCUCUGCAUCCA 20 68 8 23 1    0 0 0 0 1 3 0 0 5 4 2 23 7 12 11
zma-miR162-5p GGGCGCAGUGGUUUAUCGAUC 21 3 2 2 1    0 0 0 0 0 0 0 0 0 0 0 0 2 1 0
zma-miR164a-3p CACGUGUUCUCCUUCUCCAUC 21 4 2 3 1    0 0 0 0 0 0 0 0 0 0 0 3 0 1 0
zma-miR164a-5p UGGAGAAGCAGGGCACGUGCA 21 300 21 88 1    6 1 5 11 1 7 6 0 14 3 14 43 59 42 88
zma-miR164b-3p AUGUGCCCAUCUUCUCCACC 20 29 5 8 2    0 0 0 0 0 0 2 0 2 0 0 5 8 8 4
zma-miR164b-5p UGGAGAAGCAGGGCACGUGCA 21 300 21 88 1    6 1 5 11 1 7 6 0 14 3 14 43 59 42 88
zma-miR164c-3p CAUGUGCCCUUCUUCUCCAUC 21 73 6 11 1    3 1 5 0 0 3 5 9 11 4 4 2 8 7 11
zma-miR164c-5p UGGAGAAGCAGGGCACGUGCA 21 300 21 88 1    6 1 5 11 1 7 6 0 14 3 14 43 59 42 88
zma-miR164d-3p CACGUGGUCUCCUUCUCCAU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR164d-5p UGGAGAAGCAGGGCACGUGCA 21 300 21 88 1    6 1 5 11 1 7 6 0 14 3 14 43 59 42 88
zma-miR164e-3p CAUGUGUCCGCCCUCUCCACC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR164e-5p UGGAGAAGCAGGACACGUGAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR164f-3p CACGUGCGCUCCUUCUCCAAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR164f-5p UGGAGAAGCAGGGCACGUGCU 21 5 1 2 1    0 1 0 0 0 0 0 0 0 0 0 0 1 1 2
zma-miR164g-3p CACGUGCUCCCCUUCUCCACC 21 208 15 57 1    6 9 32 22 5 7 6 57 39 11 4 6 3 1 0
zma-miR164g-5p UGGAGAAGCAGGGCACGUGCA 21 300 21 88 1    6 1 5 11 1 7 6 0 14 3 14 43 59 42 88
zma-miR164h-3p CAUGUGCCCUUCUUCUCCAUC 21 73 6 11 1    3 1 5 0 0 3 5 9 11 4 4 2 8 7 11
zma-miR164h-5p UGGAGAAGCAGGGCACGUGUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR166a-3p UCGGACCAGGCUUCAUUCCCC 21 5,798,227 386,548 698,794 79,780    103,095 79,780 351,410 421,619 348,505 268,522 131,275 467,058 599,055 167,372 227,940 698,794 602,511 695,433 635,858
zma-miR166a-5p GGAAUGUUGUCUGGCUCGGGG 21 292 21 45 3    3 4 10 22 8 10 9 40 23 5 0 39 45 32 42
zma-miR166b-3p UCGGACCAGGCUUCAUUCCC 20 86,916 5,794 11,694 898    1,472 898 5,072 6,581 5,080 4,137 3,376 7,447 8,742 3,116 3,852 11,694 8,270 8,829 8,350
zma-miR166b-5p GGAAUGUUGUCUGGUUCAAGG 21 1,717 114 216 40    52 40 191 65 123 87 96 216 206 95 91 178 93 117 67
zma-miR166c-3p UCGGACCAGGCUUCAUUCCC 20 86,916 5,794 11,694 898    1,472 898 5,072 6,581 5,080 4,137 3,376 7,447 8,742 3,116 3,852 11,694 8,270 8,829 8,350
zma-miR166c-5p GGAAUGUUGUCUGGCUCGAGG 21 414 30 76 3    8 3 32 11 15 0 11 22 26 11 6 68 76 61 64
zma-miR166d-3p UCGGACCAGGCUUCAUUCCC 20 86,916 5,794 11,694 898    1,472 898 5,072 6,581 5,080 4,137 3,376 7,447 8,742 3,116 3,852 11,694 8,270 8,829 8,350
zma-miR166d-5p GGAAUGUUGUCUGGUUCAAGG 21 1,717 114 216 40    52 40 191 65 123 87 96 216 206 95 91 178 93 117 67
zma-miR166e UCGGACCAGGCUUCAUUCCC 20 86,916 5,794 11,694 898    1,472 898 5,072 6,581 5,080 4,137 3,376 7,447 8,742 3,116 3,852 11,694 8,270 8,829 8,350
zma-miR166f UCGGACCAGGCUUCAUUCCC 20 86,916 5,794 11,694 898    1,472 898 5,072 6,581 5,080 4,137 3,376 7,447 8,742 3,116 3,852 11,694 8,270 8,829 8,350
zma-miR166g-3p UCGGACCAGGCUUCAUUCCC 20 86,916 5,794 11,694 898    1,472 898 5,072 6,581 5,080 4,137 3,376 7,447 8,742 3,116 3,852 11,694 8,270 8,829 8,350
zma-miR166g-5p GGAAUGUUGUCUGGUUGGAGA 21 265 18 44 1    2 6 22 44 12 10 6 22 9 1 2 37 39 20 33
zma-miR166h-3p UCGGACCAGGCUUCAUUCCC 20 86,916 5,794 11,694 898    1,472 898 5,072 6,581 5,080 4,137 3,376 7,447 8,742 3,116 3,852 11,694 8,270 8,829 8,350
zma-miR166h-5p GGAAUGACGUCCGGUCCGAAC 21 7 2 3 1    0 0 0 0 1 0 0 0 0 0 0 3 3 0 0
zma-miR166i-3p UCGGACCAGGCUUCAUUCCC 20 86,916 5,794 11,694 898    1,472 898 5,072 6,581 5,080 4,137 3,376 7,447 8,742 3,116 3,852 11,694 8,270 8,829 8,350
zma-miR166i-5p GGAAUGUCGUCUGGCGCGAGA 21 3 2 2 1    0 0 0 0 0 0 0 0 0 0 2 0 0 1 0
zma-miR166j-3p UCGGACCAGGCUUCAAUCCCU 21 158,808 10,587 35,753 982    1,391 982 5,166 4,239 3,148 3,570 2,494 4,635 6,980 2,565 2,844 35,753 23,758 33,809 27,474
zma-miR166j-5p GGUUUGUUUGUCUGGUUCAAGG 22 124 8 27 2    2 3 12 5 6 3 3 9 6 7 2 27 17 13 9
zma-miR166k-3p UCGGACCAGGCUUCAAUCCCU 21 158,808 10,587 35,753 982    1,391 982 5,166 4,239 3,148 3,570 2,494 4,635 6,980 2,565 2,844 35,753 23,758 33,809 27,474
zma-miR166k-5p GGAUUGUUGUCUGGCUCGGGG 21 198 13 34 2    2 2 7 27 8 3 8 18 14 3 6 34 17 26 23
zma-miR166l-3p UCGGACCAGGCUUCAUUCCUC 21 96,771 6,451 19,250 678    1,177 678 3,846 3,612 3,032 2,818 1,557 3,823 4,664 2,230 2,142 19,165 12,787 19,250 15,990
zma-miR166l-5p GAAUGGAGGCUGGUCCAAGA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR166m-3p UCGGACCAGGCUUCAUUCCUC 21 96,771 6,451 19,250 678    1,177 678 3,846 3,612 3,032 2,818 1,557 3,823 4,664 2,230 2,142 19,165 12,787 19,250 15,990
zma-miR166m-5p GGAAUGUUGGCUGGCUCGAGG 21 598 40 82 13    20 13 74 33 31 35 38 49 82 34 19 61 40 53 16
zma-miR166n-3p UCGGACCAGGCUUCAAUCCCU 21 158,808 10,587 35,753 982    1,391 982 5,166 4,239 3,148 3,570 2,494 4,635 6,980 2,565 2,844 35,753 23,758 33,809 27,474
zma-miR166n-5p GGAUUGUUGUCUGGCUCGGUG 21 687 46 217 8    12 13 42 38 16 21 21 40 23 21 8 217 75 101 39
zma-miR167a-3p GAUCAUGCAUGACAGCCUCAUU 22 2 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 1 1
zma-miR167a-5p UGAAGCUGCCAGCAUGAUCUA 21 401 29 74 8    8 8 20 38 12 21 28 0 18 22 10 45 39 58 74
zma-miR167b-3p GAUCAUGCUGUGACAGUUUCACU 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR167b-5p UGAAGCUGCCAGCAUGAUCUA 21 401 29 74 8    8 8 20 38 12 21 28 0 18 22 10 45 39 58 74
zma-miR167c-3p GAUCAUGCUGUGGCAGCCUCACU 23 1,242 83 132 31    35 32 129 120 87 94 31 132 88 48 37 85 125 91 108
zma-miR167c-5p UGAAGCUGCCAGCAUGAUCUA 21 401 29 74 8    8 8 20 38 12 21 28 0 18 22 10 45 39 58 74
zma-miR167d-3p GGUCAUGCUGCUGCAGCCUCACU 23 223 15 41 2    3 2 12 16 5 3 2 9 17 7 10 40 30 26 41
zma-miR167d-5p UGAAGCUGCCAGCAUGAUCUA 21 401 29 74 8    8 8 20 38 12 21 28 0 18 22 10 45 39 58 74
zma-miR167e-3p GAUCAUGCUGUGCAGUUUCAUC 22 18 5 11 2    0 0 0 0 0 0 0 0 0 0 0 2 3 2 11
zma-miR167e-5p UGAAGCUGCCAGCAUGAUCUG 21 6,162 411 3,640 12    12 16 35 109 36 42 38 49 69 41 39 445 1,147 444 3,640
zma-miR167f-3p GAUCGUGCUGCGCAGUUUCACC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR167f-5p UGAAGCUGCCAGCAUGAUCUG 21 6,162 411 3,640 12    12 16 35 109 36 42 38 49 69 41 39 445 1,147 444 3,640
zma-miR167g-3p GGUCAUGCUGUAGUUUCAUC 20 12 3 5 2    0 0 0 5 0 0 2 0 0 0 0 0 0 2 3
zma-miR167g-5p UGAAGCUGCCAGCAUGAUCUG 21 6,162 411 3,640 12    12 16 35 109 36 42 38 49 69 41 39 445 1,147 444 3,640
zma-miR167h-3p GAUCAUGUUGCAGCUUCAC 19 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR167h-5p UGAAGCUGCCAGCAUGAUCUG 21 6,162 411 3,640 12    12 16 35 109 36 42 38 49 69 41 39 445 1,147 444 3,640
zma-miR167i-3p GAUCAUGUUGCAGCUUCAC 19 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR167i-5p UGAAGCUGCCAGCAUGAUCUG 21 6,162 411 3,640 12    12 16 35 109 36 42 38 49 69 41 39 445 1,147 444 3,640
zma-miR167j-3p GAUCAUGUGGCAGUUUCAUU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR167j-5p UGAAGCUGCCAGCAUGAUCUG 21 6,162 411 3,640 12    12 16 35 109 36 42 38 49 69 41 39 445 1,147 444 3,640
zma-miR168a-3p CCCGCCUUGCACCAAGUGAA 20 1,686 112 479 14    14 32 50 212 15 56 23 137 65 41 45 118 221 178 479
zma-miR168a-5p UCGCUUGGUGCAGAUCGGGAC 21 571,398 38,093 133,598 4,671    4,671 4,753 14,822 25,972 8,046 14,526 6,190 15,851 15,552 7,953 9,454 106,139 106,834 97,037 133,598
zma-miR168b-3p CCCGCCUUGCAUCAAGUGAA 20 3,318 221 541 22    28 80 116 354 22 157 47 252 203 124 212 379 362 441 541
zma-miR168b-5p UCGCUUGGUGCAGAUCGGGAC 21 571,398 38,093 133,598 4,671    4,671 4,753 14,822 25,972 8,046 14,526 6,190 15,851 15,552 7,953 9,454 106,139 106,834 97,037 133,598
zma-miR169a-3p GGCAAGUUGUUCUUGGCUACA 21 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 1
zma-miR169a-5p CAGCCAAGGAUGACUUGCCGA 21 97 9 24 2    0 3 5 0 0 3 2 0 2 3 6 20 13 24 16
zma-miR169b-3p GGCAAGUUGUUCUUGGCUACA 21 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 1
zma-miR169b-5p CAGCCAAGGAUGACUUGCCGA 21 97 9 24 2    0 3 5 0 0 3 2 0 2 3 6 20 13 24 16
zma-miR169c-3p GGCAAGUCUGUCCUUGGCUACA 22 31 5 11 1    0 0 0 0 0 0 2 0 0 1 0 11 7 2 8
zma-miR169c-5p CAGCCAAGGAUGACUUGCCGG 21 69 10 24 1    0 1 0 0 1 0 0 0 0 0 2 17 10 14 24
zma-miR169d UAGCCAAGGAGACUGCCUAUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169e UAGCCAAGGAGACUGCCUACG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169f-3p GGCAUGUCUUCCUUGGCUACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169f-5p UAGCCAAGGAUGACUUGCCUA 21 2 2 2 2    0 0 0 0 0 0 0 0 0 0 0 0 0 0 2
zma-miR169g UAGCCAAGGAUGACUUGCCUA 21 2 2 2 2    0 0 0 0 0 0 0 0 0 0 0 0 0 0 2
zma-miR169h UAGCCAAGGAUGACUUGCCUA 21 2 2 2 2    0 0 0 0 0 0 0 0 0 0 0 0 0 0 2
zma-miR169i-3p GGCAGUCUCCUUGGCUAG 18 57 5 12 1    0 0 2 0 2 3 9 9 3 12 4 1 5 2 5
zma-miR169i-5p UAGCCAAGGAUGACUUGCCUG 21 203 14 36 1    8 1 15 16 14 10 5 22 8 3 4 15 17 29 36
zma-miR169j-3p GGCAGUCUCCUUGGCUAG 18 57 5 12 1    0 0 2 0 2 3 9 9 3 12 4 1 5 2 5
zma-miR169j-5p UAGCCAAGGAUGACUUGCCUG 21 203 14 36 1    8 1 15 16 14 10 5 22 8 3 4 15 17 29 36
zma-miR169k-3p GGCAGUCUCCUUGGCUAG 18 57 5 12 1    0 0 2 0 2 3 9 9 3 12 4 1 5 2 5
zma-miR169k-5p UAGCCAAGGAUGACUUGCCUG 21 203 14 36 1    8 1 15 16 14 10 5 22 8 3 4 15 17 29 36
zma-miR169l-3p GGCAAAUCAUCCCUGCUACC 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169l-5p UAGCCAGGGAUGAUUUGCCUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169m-3p GGCAUCCAUUCUUGGCUAAG 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169m-5p UAGCCAAGAAUGGCUUGCCUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169n-3p GGCAGGCCUUCUUGGCUAAG 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169n-5p UAGCCAAGAAUGGCUUGCCUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169o-3p GGCAGGUCUUCUUGGCUAGC 20 1,864 124 247 42    107 127 131 169 247 101 47 234 151 76 53 130 96 153 42
zma-miR169o-5p UAGCCAAGAAUGACUUGCCUA 21 3 2 2 1    0 0 2 0 0 0 0 0 0 1 0 0 0 0 0
zma-miR169p-3p GGCAAGUCAUCUGGGGCUACG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169p-5p UAGCCAAGGAUGACUUGCCGG 21 16 4 10 1    0 0 0 0 0 0 0 0 0 0 0 1 10 2 3
zma-miR169q-3p GGCAGGCCUUCUGGCUAAG 19 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169q-5p UAGCCAAGAAUGGCUUGCCUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169r-3p GGCAAGUUGUCCUUGGCUACA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169r-5p CAGCCAAGGAUGACUUGCCGG 21 69 10 24 1    0 1 0 0 1 0 0 0 0 0 2 17 10 14 24
zma-miR171a-3p UGAUUGAGCCGCGCCAAUAU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171a-5p UAUUGGCGAGGUUCAAUCAGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171b-3p UUGAGCCGUGCCAAUAUCAC 20 8 2 4 1    0 0 0 0 1 0 0 0 0 0 0 4 2 1 0
zma-miR171b-5p GAUAUUGGCGCGGUUCAAUC 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171c-3p UGACUGAGCCGUGCCAAUAUC 21 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 1 0 0
zma-miR171c-5p UAUUGGUGCGGUUCAAUCAGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171d-3p UGAUUGAGCCGUGCCAAUAUC 21 670 45 170 2    2 6 30 71 22 21 20 9 25 30 37 87 66 74 170
zma-miR171d-5p UGUUGGCUCGGCUCACUCAGA 21 1,075 72 179 31    32 33 72 60 62 31 43 53 59 51 33 179 113 118 136
zma-miR171e-3p UGAUUGAGCCGUGCCAAUAUC 21 670 45 170 2    2 6 30 71 22 21 20 9 25 30 37 87 66 74 170
zma-miR171e-5p UGUUGGCUCGGCUCACUCAGA 21 1,075 72 179 31    32 33 72 60 62 31 43 53 59 51 33 179 113 118 136
zma-miR171f-3p UUGAGCCGUGCCAAUAUCACA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171f-5p CGAUGUUGGCAUGGCUCAAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171g-3p GAGGUGAGCCGAGCCAAUAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171g-5p UAUUGACUUGGCUCAUCUCUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171h-3p GUGAGCCGAACCAAUAUCACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171h-5p UGGUAUUGUUUCGGCUCAUGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171i-3p UGAUUGAGCCGUGCCAAUAUC 21 670 45 170 2    2 6 30 71 22 21 20 9 25 30 37 87 66 74 170
zma-miR171i-5p UGUUGGCACGGUUCAAUCAAA 21 2 2 2 2    0 0 0 0 0 0 0 0 0 0 0 0 0 0 2
zma-miR171j-3p UGAUUGAGCCGUGCCAAUAUC 21 670 45 170 2    2 6 30 71 22 21 20 9 25 30 37 87 66 74 170
zma-miR171j-5p UAUUGACGCGGUUCAAUUCGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171k-3p GUGAGCCGAACCAAUAUCACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171k-5p UGGUAUUGUUUCGGCUCAUGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171l-3p GGAUUGAGCCGCGUCAAUAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171l-5p UAUUGGCGUGCCUCAAUCCGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171m-3p GGAUUGAGCCGCGUCAAUAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171m-5p UAUUGGCGCGCCUCAAUCCGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171n-3p UGAUUGAGCCGCGCCAAUAUC 21 2 1 1 1    0 0 0 0 0 0 0 0 0 0 0 1 1 0 0
zma-miR171n-5p UAUUGGUGAGGUUCAAUCCGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR172a AGAAUCUUGAUGAUGCUGCA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR172b-3p AGAAUCUUGAUGAUGCUGCA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR172b-5p CAGCACCAUCAAGAUUCACA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR172c-3p AGAAUCUUGAUGAUGCUGCA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR172c-5p CAGCACCACCAAGAUUCACA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR172d-3p AGAAUCUUGAUGAUGCUGCA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR172d-5p CAGCACCAUCAAGAUUCACA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR172e GGAAUCUUGAUGAUGCUGCAU 21 354 24 71 5    14 12 37 71 5 38 9 26 26 15 21 8 44 9 19
zma-miR2118a UUCCUGAUGCCUCUCAUUCCUA 22 276 18 35 4    11 6 12 27 35 17 29 18 22 21 4 29 10 28 7
zma-miR2118b UUCCCGAUGCCUCCCAUUCCUA 22 2,762 184 428 39    131 68 270 212 187 428 274 252 267 228 228 55 47 76 39
zma-miR2118c UUCCUAAUGCCUCCCAUUCCUA 22 100 7 17 2    5 4 17 11 13 0 8 4 9 7 2 4 6 7 3
zma-miR2118d UUCCUGAUGCCUCCCAUGCCUA 22 448 30 67 3    28 12 67 38 41 31 28 53 59 21 21 11 17 18 3
zma-miR2118e UUCCUGAUGUCUCCCAUUCCUA 22 47 6 12 1    0 0 0 0 12 0 9 0 12 1 6 4 0 2 1
zma-miR2118f UUCCCAAUGCCUUCCAUGCCUA 22 87 6 15 2    5 4 15 5 4 7 12 4 5 5 4 8 5 2 2
zma-miR2118g UUCCUGAUGCCUCCUAUUCCUA 22 937 62 124 41    52 53 124 71 59 70 60 53 89 44 41 66 62 50 43
zma-miR2275a-3p UUUGUUUUCCUCCAAUAUCUCA 22 751 50 111 11    26 11 69 11 40 38 60 44 72 58 39 78 53 111 41
zma-miR2275a-5p AGAGUUGGAGGAAAGCAAACC 21 60,462 4,031 12,086 646    1,139 646 8,921 10,352 6,349 5,560 1,582 12,086 3,847 2,208 1,350 2,487 1,358 1,500 1,077
zma-miR2275b-3p UUCAGUUUCCUCUAAUAUCUCA 22 2,298 153 339 60    159 62 260 60 139 101 136 110 339 172 97 207 125 237 94
zma-miR2275b-5p AGGAUUAGAGGCAACUGAACC 21 234,103 15,607 39,906 1,512    16,220 10,699 25,443 14,917 13,853 7,401 11,215 25,598 11,845 6,898 1,512 39,906 16,623 26,054 5,919
zma-miR2275c-3p UUCAGUUUCCUCUAAUAUCUCA 22 2,298 153 339 60    159 62 260 60 139 101 136 110 339 172 97 207 125 237 94
zma-miR2275c-5p AGGAUUAGAGGGACUUGAACC 21 12,575 838 1,744 119    1,490 302 1,515 719 1,403 647 1,511 1,744 1,077 688 119 339 482 391 148
zma-miR2275d-3p UUUGUUUUCCUCUAAUAUCUCA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR2275d-5p AGAGUUGGAGGAAAGAAAACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR319a-3p UUGGACUGAAGGGUGCUCCC 20 7,282 485 1,881 18    40 19 77 136 42 70 18 53 60 55 39 1,881 1,533 1,446 1,813
zma-miR319a-5p GAGCUCUCUUCAGUCCACUC 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR319b-3p UUGGACUGAAGGGUGCUCCC 20 7,282 485 1,881 18    40 19 77 136 42 70 18 53 60 55 39 1,881 1,533 1,446 1,813
zma-miR319b-5p AGAGCGUCCUUCAGUCCACUC 21 394 36 136 1    2 1 0 11 3 3 3 9 0 0 0 64 117 45 136
zma-miR319c-3p UUGGACUGAAGGGUGCUCCC 20 7,282 485 1,881 18    40 19 77 136 42 70 18 53 60 55 39 1,881 1,533 1,446 1,813
zma-miR319c-5p GAGCUCUCUUCAGUCCACUC 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR319d-3p UUGGACUGAAGGGUGCUCCC 20 7,282 485 1,881 18    40 19 77 136 42 70 18 53 60 55 39 1,881 1,533 1,446 1,813
zma-miR319d-5p AGAGCGUCCUUCAGUCCACUC 21 394 36 136 1    2 1 0 11 3 3 3 9 0 0 0 64 117 45 136
zma-miR390a-3p CGCUAUCUAUCCUGAGCUCCA 21 80 7 17 1    0 3 2 11 4 0 0 4 5 1 2 17 13 7 11
zma-miR390a-5p AAGCUCAGGAGGGAUAGCGCC 21 4,855 324 692 86    86 167 255 692 150 275 86 428 279 110 233 590 654 377 473
zma-miR390b-3p CGCUAUCUAUCCUGAGCUCCA 21 80 7 17 1    0 3 2 11 4 0 0 4 5 1 2 17 13 7 11
zma-miR390b-5p AAGCUCAGGAGGGAUAGCGCC 21 4,855 324 692 86    86 167 255 692 150 275 86 428 279 110 233 590 654 377 473
zma-miR393a-3p AUCAGUGCAAUCCCUUUGGAAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR393a-5p UCCAAAGGGAUCGCAUUGAUCU 22 51 6 20 1    0 2 5 5 1 0 0 0 0 0 2 3 7 6 20
zma-miR393b-3p AUCAAUGCGAUCCUUUUGGAGG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR393b-5p UCCAAAGGGAUCGCAUUGAUCC 22 25 4 11 2    2 3 5 11 0 0 2 0 2 0 0 0 0 0 0
zma-miR393c-3p GUCAGUGCAAUCCCUUUGGAAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR393c-5p UCCAAAGGGAUCGCAUUGAUCU 22 51 6 20 1    0 2 5 5 1 0 0 0 0 0 2 3 7 6 20
zma-miR394a-3p AGGUGGGCAUACUGCCAAUG 20 3 2 2 1    0 0 0 0 1 0 0 0 2 0 0 0 0 0 0
zma-miR394a-5p UUGGCAUUCUGUCCACCUCC 20 988 66 133 19    20 19 37 60 55 77 34 40 52 56 45 111 127 122 133
zma-miR394b-3p AGGUGGGCAUACUGCCAAUG 20 3 2 2 1    0 0 0 0 1 0 0 0 2 0 0 0 0 0 0
zma-miR394b-5p UUGGCAUUCUGUCCACCUCC 20 988 66 133 19    20 19 37 60 55 77 34 40 52 56 45 111 127 122 133
zma-miR395a-3p GUGAAGUGUUUGGGGGAACUC 21 10 3 5 1    0 0 0 5 0 3 0 0 0 0 0 1 1 0 0
zma-miR395a-5p GUUCUCCUCAAACCACUUCAGUU 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395b-3p GUGAAGUGUUUGGGGGAACUC 21 10 3 5 1    0 0 0 5 0 3 0 0 0 0 0 1 1 0 0
zma-miR395b-5p GUUCCCUACAAGCACUUCACAA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395c-3p GUGAAGUGUUUGGAGGAACUC 21 2 2 2 2    0 0 2 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395c-5p GUUCCCUGCAAACACUUCACCA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395d-3p GUGAAGUGUUUGGGGGAACUC 21 10 3 5 1    0 0 0 5 0 3 0 0 0 0 0 1 1 0 0
zma-miR395d-5p GUUCUAUGCAAGCACUUCACGA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395e-3p GUGAAGUGUUUGGGGGAACUC 21 10 3 5 1    0 0 0 5 0 3 0 0 0 0 0 1 1 0 0
zma-miR395e-5p GUUCCCUUCAAGCACUUCACAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395f-3p GUGAAGUGUUUGGGGGAACUC 21 10 3 5 1    0 0 0 5 0 3 0 0 0 0 0 1 1 0 0
zma-miR395f-5p GUUACCUACAAGCACGUCUCGA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395g-3p GUGAAGUGUUUGGGGGAACUC 21 10 3 5 1    0 0 0 5 0 3 0 0 0 0 0 1 1 0 0
zma-miR395g-5p GUUCUAUGCAAGCACUUCACGA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395h-3p GUGAAGUGUUUGGGGGAACUC 21 10 3 5 1    0 0 0 5 0 3 0 0 0 0 0 1 1 0 0
zma-miR395h-5p GUUCCCUUCAAGCACUUCACAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395i-3p GUGAAGUGUUUGGGGGAACUC 21 10 3 5 1    0 0 0 5 0 3 0 0 0 0 0 1 1 0 0
zma-miR395i-5p GUUCCCUACAAGCACUUCACGA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395j-3p GUGAAGUGUUUGGGGGAACUC 21 10 3 5 1    0 0 0 5 0 3 0 0 0 0 0 1 1 0 0
zma-miR395j-5p GUUCCCUUCAAGCACUUCACAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395k-3p GUGAAGUGUUUGAGGAAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395k-5p GUUUCCUUCAAGCACUUCACAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395l-3p GUGAAGUGUUUGGAGGAACUC 21 2 2 2 2    0 0 2 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395l-5p GUUCCUUCCAAACACUUCACCA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395m-3p GUGAAGUGUUUGGAGGAACUC 21 2 2 2 2    0 0 2 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395m-5p GUUCCUUUCAAACACUUCACAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395n-3p GUGAAGUGUUUGGGGGAACUC 21 10 3 5 1    0 0 0 5 0 3 0 0 0 0 0 1 1 0 0
zma-miR395n-5p GUUCUCUACAAGCACUUCACGA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395o-3p GUGAAGUGUUUGGGUGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395o-5p GUUCUCUUCAAGCACUUCACGA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395p-3p GUGAAGUGUUUGGGGGAACUC 21 10 3 5 1    0 0 0 5 0 3 0 0 0 0 0 1 1 0 0
zma-miR395p-5p GUUCCCUUCAAGCACUUCACAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR396a-3p GUUCAAUAAAGCUGUGGGAAA 21 1,941 129 713 2    2 12 25 71 18 24 3 18 17 7 19 300 387 325 713
zma-miR396a-5p UUCCACAGCUUUCUUGAACUG 21 30,128 2,009 8,153 162    162 222 851 1,030 247 612 491 371 1,491 341 601 4,534 6,056 4,966 8,153
zma-miR396b-3p GUUCAAUAAAGCUGUGGGAAA 21 1,941 129 713 2    2 12 25 71 18 24 3 18 17 7 19 300 387 325 713
zma-miR396b-5p UUCCACAGCUUUCUUGAACUG 21 30,128 2,009 8,153 162    162 222 851 1,030 247 612 491 371 1,491 341 601 4,534 6,056 4,966 8,153
zma-miR396c UUCCACAGGCUUUCUUGAACUG 22 158 16 35 1    0 0 2 11 1 7 0 13 11 0 0 19 35 28 31
zma-miR396d UUCCACAGGCUUUCUUGAACUG 22 158 16 35 1    0 0 2 11 1 7 0 13 11 0 0 19 35 28 31
zma-miR396e-3p GGUCAAGAAAGCCGUGGGAAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR396e-5p UUCCACAGCUUUCUUGAACUU 21 15,885 1,059 5,202 24    63 59 198 294 24 35 44 62 125 34 33 5,202 2,778 4,254 2,680
zma-miR396f-3p GGUCAAGAAAGCUGUGGGAAG 21 699 70 232 1    0 1 2 5 0 3 0 0 0 3 2 212 165 232 74
zma-miR396f-5p UUCCACAGCUUUCUUGAACUU 21 15,885 1,059 5,202 24    63 59 198 294 24 35 44 62 125 34 33 5,202 2,778 4,254 2,680
zma-miR396g-3p GUUCAAGAAAGCUGUGGAAGA 21 2 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 1 1
zma-miR396g-5p UCCCACAGCUUUAUUGAACUG 21 266 20 86 1    0 1 5 11 5 17 9 0 18 4 16 18 49 27 86
zma-miR396h UCCCACAGCUUUAUUGAACUG 21 266 20 86 1    0 1 5 11 5 17 9 0 18 4 16 18 49 27 86
zma-miR397a-3p UAGCCGUUAGCGCUCAUUAACU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR397a-5p UCAUUGAGCGCAGCGUUGAUG 21 999 67 351 1    11 18 17 71 15 80 2 26 34 1 10 81 215 67 351
zma-miR397b-3p CCAGCGCUGCACUCAAUUACG 21 249 17 65 1    8 14 20 65 1 7 2 26 20 4 6 15 22 8 31
zma-miR397b-5p UCAUUGAGCGCAGCGUUGAUG 21 999 67 351 1    11 18 17 71 15 80 2 26 34 1 10 81 215 67 351
zma-miR398a-3p UGUGUUCUCAGGUCGCCCCCG 21 6,755 450 1,821 44    332 293 379 518 261 539 44 75 240 62 218 246 1,821 591 1,136
zma-miR398a-5p GGGGCGAACUGAGAACACAUG 21 4,207 280 823 21    393 279 478 823 337 449 21 57 176 36 72 117 525 130 314
zma-miR398b-3p UGUGUUCUCAGGUCGCCCCCG 21 6,755 450 1,821 44    332 293 379 518 261 539 44 75 240 62 218 246 1,821 591 1,136
zma-miR398b-5p GGGGCGGACUGGGAACACAUG 21 1,857 124 717 6    64 25 54 114 18 21 6 26 11 8 19 81 457 236 717
zma-miR399a-3p UGCCAAAGGAGAAUUGCCCUG 21 96 7 21 1    0 1 5 5 4 14 8 4 6 8 2 10 21 5 3
zma-miR399a-5p GUGCGGUUCUCCUCUGGCACG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR399b-3p UGCCAAAGGAGAGCUGUCCUG 21 6,987 466 1,666 33    34 36 99 33 1,666 1,364 129 569 891 481 607 68 659 244 107
zma-miR399b-5p GUGCAGCUCUCCUCUGGCAUG 21 3,921 261 1,131 11    31 26 47 11 1,001 1,131 58 269 502 243 348 14 167 58 15
zma-miR399c-3p UGCCAAAGGAGAAUUGCCCUG 21 96 7 21 1    0 1 5 5 4 14 8 4 6 8 2 10 21 5 3
zma-miR399c-5p GGGUACGUCUCCUUUGGCACA 21 17 3 5 2    2 0 0 5 0 0 2 0 3 0 0 0 5 0 0
zma-miR399d-3p UGCCAAAGGAGAGCUGCCCUG 21 2 2 2 2    0 0 0 0 2 0 0 0 0 0 0 0 0 0 0
zma-miR399d-5p GUGUGGCUCUCCUCUGGCAUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR399e-3p UGCCAAAGGAGAGUUGCCCUG 21 804 54 217 8    8 18 12 22 20 28 12 88 46 27 27 88 217 83 108
zma-miR399e-5p GGGCUUCUCUUUCUUGGCAGG 21 6 2 3 1    0 1 0 0 0 0 0 0 0 0 0 0 3 2 0
zma-miR399f-3p UGCCAAAGGAAAUUUGCCCCG 21 27 4 8 1    0 1 0 0 0 0 0 0 2 0 2 4 8 5 5
zma-miR399f-5p GGGCAACUUCUCCUUUGGCAGA 22 1 1 1 1    0 0 0 0 0 0 0 0 0 0 0 0 1 0 0
zma-miR399g-3p UGCCAAAGGGGAUUUGCCCGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR399g-5p GGGCAACCCCCCGUUGGCAGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR399h-3p UGCCAAAGGAGAAUUGCCCUG 21 96 7 21 1    0 1 5 5 4 14 8 4 6 8 2 10 21 5 3
zma-miR399h-5p GUGCAGUUCUCCUCUGGCACG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR399i-3p UGCCAAAGGAGAGUUGCCCUG 21 804 54 217 8    8 18 12 22 20 28 12 88 46 27 27 88 217 83 108
zma-miR399i-5p GUGCGGCUCUCCUCUGGCAUG 21 1 1 1 1    0 0 0 0 0 0 0 0 0 1 0 0 0 0 0
zma-miR399j-3p UGCCAAAGGAGAGUUGCCCUG 21 804 54 217 8    8 18 12 22 20 28 12 88 46 27 27 88 217 83 108
zma-miR399j-5p AGGCAGCUCUCCUCUGGCAGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR408a CUGCACUGCCUCUUCCCUGGC 21 140,028 9,335 26,050 482    3,467 5,487 9,166 21,929 3,783 9,481 482 8,842 14,813 1,219 6,494 5,463 26,050 7,724 15,628
zma-miR408b-3p CUGCACUGCCUCUUCCCUGGC 21 140,028 9,335 26,050 482    3,467 5,487 9,166 21,929 3,783 9,481 482 8,842 14,813 1,219 6,494 5,463 26,050 7,724 15,628
zma-miR408b-5p CAGGGACGAGGCAGAGCAUGG 21 4,526 302 693 63    197 86 693 621 362 675 70 433 508 63 86 169 201 140 222
zma-miR444a UGCAGUUGUUGUCUCAAGCUU 21 1,521 101 319 10    14 10 72 71 42 31 23 75 72 48 47 236 241 220 319
zma-miR444b UGCAGUUGUUGUCUCAAGCUU 21 1,521 101 319 10    14 10 72 71 42 31 23 75 72 48 47 236 241 220 319
zma-miR482-3p UCUUCCUUGUUCCUCCCAUU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR482-5p UGGGAGAUGAAGGAGCCUU 19 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR528a-3p CCUGUGCCUGCCUCUUCCAUU 21 7,742 516 2,141 57    488 513 1,148 2,141 263 1,162 57 300 304 108 154 227 418 174 285
zma-miR528a-5p UGGAAGGGGCAUGCAGAGGAG 21 39,851 2,657 9,332 430    1,435 1,687 3,247 4,489 672 5,052 553 1,143 3,696 430 1,568 885 9,332 2,190 3,472
zma-miR528b-3p CCUGUGCCUGCCUCUUCCAUU 21 7,742 516 2,141 57    488 513 1,148 2,141 263 1,162 57 300 304 108 154 227 418 174 285
zma-miR528b-5p UGGAAGGGGCAUGCAGAGGAG 21 39,851 2,657 9,332 430    1,435 1,687 3,247 4,489 672 5,052 553 1,143 3,696 430 1,568 885 9,332 2,190 3,472
zma-miR529-3p GCUGUACCCUCUCUCUUCUUC 21 366 24 69 2    6 8 12 33 13 7 12 40 15 10 2 55 31 69 53
zma-miR529-5p AGAAGAGAGAGAGUACAGCCU 21 99,763 6,651 26,412 278    278 395 2,230 1,825 673 1,033 1,814 2,163 4,140 1,683 1,535 18,877 15,094 21,611 26,412
zma-miR827-3p UUAGAUGACCAUCAGCAAACA 21 2,791 186 379 29    61 29 50 71 67 115 84 137 351 231 294 379 241 375 306
zma-miR827-5p UUUGUUGGUGGUCAUUUAACC 21 115 8 20 1    2 1 10 5 3 0 3 4 5 4 16 10 20 14 18