Maize B73 Small RNA miRNA Abundances

The data below are based on the microRNAs listed in the miRBase registry. Adjust libraries/reads to display on the control panel.


        miRNA         miRNA sequence Len Sum (norm) Average Max Min (>0)  dcl5_1F_1_5mmdcl5_1F_2_0mmdcl5_1_1_5mmdcl5_1_2_0mmdcl5_2_1_5mm_adcl5_2_2_0mmdcl5_3_1_5mmdcl5_3_2_0mm_adcl5_3_2_0mm_bdcl5_4_1_5mmdcl5_4_2_0mmdcl5_5_1_5mmdcl5_5_2_0mmsTP_dcl5_1_2asTP_dcl5_2_3asTR_dcl5_1_2asTR_dcl5_2_3adcl5mu01_1dcl5mu02_1dcl5mu03_1dcl5mu04_1TR_W23_2_0mm_1TR_W23_2_0mm_2TP_W23_2_0mm_1TP_W23_2_0mm_2
zma-miR11969-3p UUAUACCCAUCUCUCACCUUGCAA 24 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR11969-5p GCAAGGUCAGAGAAGGAUAUAAUC 24 2 0 2 2    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0
zma-miR11970-3p UGGUUUGGUUGCACGUUUGCA 21 8 0 3 1    2 0 0 0 0 0 3 0 0 0 2 0 0 0 0 1 0 0 0 0 0 0 0 0 0
zma-miR11970-5p CAAGCGUGCAAGCAAACCAUU 21 9 0 3 1    0 0 0 0 1 0 2 0 0 0 0 3 0 0 0 1 0 0 0 2 0 0 0 0 0
zma-miR1432-3p GGGUGUCAUCUCGCCUGAAGCA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR1432-5p CUCAGGAGAGAUGACACCGAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR156a-3p GCUCACUUCUCUCUCUGUCAGU 22 19 1 9 2    0 0 0 0 0 0 0 0 0 0 0 0 6 0 0 0 9 0 0 0 0 2 0 2 0
zma-miR156a-5p UGACAGAAGAGAGUGAGCAC 20 4,536 181 1,235 3    12 10 77 910 66 87 24 115 176 34 25 29 30 608 546 503 1,235 4 3 5 3 7 14 3 10
zma-miR156b-3p GCUCACCCUCUAUCUGUCAGU 21 95 4 31 1    0 1 0 27 3 0 0 0 0 0 0 0 2 8 20 3 31 0 0 0 0 0 0 0 0
zma-miR156b-5p UGACAGAAGAGAGUGAGCAC 20 4,536 181 1,235 3    12 10 77 910 66 87 24 115 176 34 25 29 30 608 546 503 1,235 4 3 5 3 7 14 3 10
zma-miR156c UGACAGAAGAGAGUGAGCAC 20 4,536 181 1,235 3    12 10 77 910 66 87 24 115 176 34 25 29 30 608 546 503 1,235 4 3 5 3 7 14 3 10
zma-miR156d-3p GCUCACUUCUCUUUCUGUCAGC 22 186 7 38 1    2 1 0 38 0 0 2 4 2 0 0 10 6 14 20 21 27 1 0 7 10 11 3 0 7
zma-miR156d-5p UGACAGAAGAGAGUGAGCAC 20 4,536 181 1,235 3    12 10 77 910 66 87 24 115 176 34 25 29 30 608 546 503 1,235 4 3 5 3 7 14 3 10
zma-miR156e-3p GCUCACUGCUCUCUCUGUCAUC 22 21 1 10 1    0 1 0 0 1 0 0 0 0 0 0 0 2 1 1 3 10 0 2 0 0 0 0 0 0
zma-miR156e-5p UGACAGAAGAGAGUGAGCAC 20 4,536 181 1,235 3    12 10 77 910 66 87 24 115 176 34 25 29 30 608 546 503 1,235 4 3 5 3 7 14 3 10
zma-miR156f-3p GCUCACUUCUCUUUCUGUCAGC 22 186 7 38 1    2 1 0 38 0 0 2 4 2 0 0 10 6 14 20 21 27 1 0 7 10 11 3 0 7
zma-miR156f-5p UGACAGAAGAGAGUGAGCAC 20 4,536 181 1,235 3    12 10 77 910 66 87 24 115 176 34 25 29 30 608 546 503 1,235 4 3 5 3 7 14 3 10
zma-miR156g-3p GCUCACUUCUCUUUCUGUCAGC 22 186 7 38 1    2 1 0 38 0 0 2 4 2 0 0 10 6 14 20 21 27 1 0 7 10 11 3 0 7
zma-miR156g-5p UGACAGAAGAGAGUGAGCAC 20 4,536 181 1,235 3    12 10 77 910 66 87 24 115 176 34 25 29 30 608 546 503 1,235 4 3 5 3 7 14 3 10
zma-miR156h-3p GCUCACUGCUCUUUCUGUCAUC 22 4 0 2 1    0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 2 0 0 0 0 0 0 0 0
zma-miR156h-5p UGACAGAAGAGAGUGAGCAC 20 4,536 181 1,235 3    12 10 77 910 66 87 24 115 176 34 25 29 30 608 546 503 1,235 4 3 5 3 7 14 3 10
zma-miR156i-3p GCUCACUGCUCUAUCUGUCAUC 22 26 1 16 1    0 0 0 16 2 0 0 0 0 0 0 0 2 1 0 1 4 0 0 0 0 0 0 0 0
zma-miR156i-5p UGACAGAAGAGAGUGAGCAC 20 4,536 181 1,235 3    12 10 77 910 66 87 24 115 176 34 25 29 30 608 546 503 1,235 4 3 5 3 7 14 3 10
zma-miR156j-3p UGCUCUCUGCUCUCACUGUCAUC 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR156j-5p UGACAGAAGAGAGAGAGCACA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR156k-3p GCUCGCUUCUCUUUCUGUCAGC 22 51 2 11 1    0 0 0 5 2 0 0 0 0 0 0 0 4 1 0 0 0 1 2 7 3 5 3 11 7
zma-miR156k-5p UGACAGAAGAGAGCGAGCAC 20 88 4 16 2    0 0 2 16 2 3 5 4 0 0 2 3 6 4 9 4 12 0 0 2 0 3 0 5 6
zma-miR156l-3p GCUCACUGCUCUAUCUGUCACC 22 487 19 169 1    2 5 12 169 9 10 11 31 20 3 6 5 4 36 21 54 78 1 3 2 5 0 0 0 0
zma-miR156l-5p UGACAGAAGAGAGUGAGCAC 20 4,536 181 1,235 3    12 10 77 910 66 87 24 115 176 34 25 29 30 608 546 503 1,235 4 3 5 3 7 14 3 10
zma-miR159a-3p UUUGGAUUGAAGGGAGCUCUG 21 354,286 14,171 73,649 624    4,063 3,040 14,772 14,563 6,233 8,566 6,391 18,544 12,515 5,361 6,757 674 6,169 50,179 48,542 55,928 73,649 3,353 1,390 624 2,495 2,856 2,660 2,409 2,553
zma-miR159a-5p GAGCUCCUAUCAUUCCAAUGA 21 473 19 184 1    3 5 0 5 0 3 2 0 9 0 0 0 6 184 103 88 50 3 0 0 1 3 3 2 3
zma-miR159b-3p UUUGGAUUGAAGGGAGCUCUG 21 354,286 14,171 73,649 624    4,063 3,040 14,772 14,563 6,233 8,566 6,391 18,544 12,515 5,361 6,757 674 6,169 50,179 48,542 55,928 73,649 3,353 1,390 624 2,495 2,856 2,660 2,409 2,553
zma-miR159b-5p GUGCUCCCUUCAAACCAAUAA 21 680 27 123 3    20 3 59 38 22 17 34 93 112 14 6 27 123 12 10 11 19 14 6 5 3 8 6 11 7
zma-miR159c-3p CUUGGAUUGAAGGGAGCUCCU 21 75 3 24 1    2 1 0 0 2 0 2 4 2 0 0 0 0 7 19 24 12 0 0 0 0 0 0 0 0
zma-miR159c-5p GAGCUCCCUUCGAUCCAAUCC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR159d-3p CUUGGAUUGAAGGGAGCUCCU 21 75 3 24 1    2 1 0 0 2 0 2 4 2 0 0 0 0 7 19 24 12 0 0 0 0 0 0 0 0
zma-miR159d-5p GAGCUCCCUUCGAUCCAAUCC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR159e-3p AUUGGUUUGAAGGGAGCUCCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR159e-5p CAGCUCCUGCAGCAUCUGUUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR159f-3p UUUGGAUUGAAGGGAGCUCUG 21 354,286 14,171 73,649 624    4,063 3,040 14,772 14,563 6,233 8,566 6,391 18,544 12,515 5,361 6,757 674 6,169 50,179 48,542 55,928 73,649 3,353 1,390 624 2,495 2,856 2,660 2,409 2,553
zma-miR159f-5p GAGCUCCUCUCAUUCCAAUGA 21 2 0 2 2    0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0
zma-miR159g-3p UUUGGAGUGAAGGGAGUUCUG 21 5 0 2 1    0 0 0 0 0 0 0 0 2 1 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR159g-5p GUGCUCCCUUCACACCAAUAA 21 294 12 112 1    6 0 17 22 2 7 6 9 15 7 2 10 112 8 2 1 7 11 5 5 5 8 8 10 9
zma-miR159h-3p UUUGGAGUGAAGGGAGCUCUG 21 14,315 573 1,878 48    214 220 916 1,019 509 626 372 1,223 874 313 385 104 1,878 968 942 887 954 254 123 48 340 346 270 272 258
zma-miR159h-5p GUGCUCCCUUCACACCAAUAA 21 294 12 112 1    6 0 17 22 2 7 6 9 15 7 2 10 112 8 2 1 7 11 5 5 5 8 8 10 9
zma-miR159i-3p UUUGGAGUGAAGGGAGCUCUG 21 14,315 573 1,878 48    214 220 916 1,019 509 626 372 1,223 874 313 385 104 1,878 968 942 887 954 254 123 48 340 346 270 272 258
zma-miR159i-5p GUGCUCCCUUCACACCAAUAA 21 294 12 112 1    6 0 17 22 2 7 6 9 15 7 2 10 112 8 2 1 7 11 5 5 5 8 8 10 9
zma-miR159j-3p UUUGGAUUGAAGGGAGCUCUG 21 354,286 14,171 73,649 624    4,063 3,040 14,772 14,563 6,233 8,566 6,391 18,544 12,515 5,361 6,757 674 6,169 50,179 48,542 55,928 73,649 3,353 1,390 624 2,495 2,856 2,660 2,409 2,553
zma-miR159j-5p GUGCUCCCUUCAAACCAAUAA 21 680 27 123 3    20 3 59 38 22 17 34 93 112 14 6 27 123 12 10 11 19 14 6 5 3 8 6 11 7
zma-miR159k-3p UUUGGAUUGAAGGGAGCUCUG 21 354,286 14,171 73,649 624    4,063 3,040 14,772 14,563 6,233 8,566 6,391 18,544 12,515 5,361 6,757 674 6,169 50,179 48,542 55,928 73,649 3,353 1,390 624 2,495 2,856 2,660 2,409 2,553
zma-miR159k-5p GUGCUCCCUUCAAACCAAUAA 21 680 27 123 3    20 3 59 38 22 17 34 93 112 14 6 27 123 12 10 11 19 14 6 5 3 8 6 11 7
zma-miR160a-3p GCGUGCAAGGGGCCAAGCAUG 21 2 0 2 2    0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR160a-5p UGCCUGGCUCCCUGUAUGCCA 21 1,626 65 239 1    26 17 97 98 25 63 77 31 176 59 53 19 13 239 215 171 197 3 8 16 7 5 5 5 1
zma-miR160b-3p GCGUGCAAGGAGCCAAGCAUG 21 34 1 6 1    0 1 0 0 0 3 0 0 5 0 0 5 2 6 3 1 6 0 0 0 0 0 2 0 0
zma-miR160b-5p UGCCUGGCUCCCUGUAUGCCA 21 1,626 65 239 1    26 17 97 98 25 63 77 31 176 59 53 19 13 239 215 171 197 3 8 16 7 5 5 5 1
zma-miR160c-3p GCGUGCAUGGUGCCAAGCAUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR160c-5p UGCCUGGCUCCCUGUAUGCCA 21 1,626 65 239 1    26 17 97 98 25 63 77 31 176 59 53 19 13 239 215 171 197 3 8 16 7 5 5 5 1
zma-miR160d-3p GCGUGCGUGGAGCCAAGCAUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR160d-5p UGCCUGGCUCCCUGUAUGCCA 21 1,626 65 239 1    26 17 97 98 25 63 77 31 176 59 53 19 13 239 215 171 197 3 8 16 7 5 5 5 1
zma-miR160e UGCCUGGCUCCCUGUAUGCCA 21 1,626 65 239 1    26 17 97 98 25 63 77 31 176 59 53 19 13 239 215 171 197 3 8 16 7 5 5 5 1
zma-miR160f-3p GCGUGCGAGGUGCCAGGCAUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR160f-5p UGCCUGGCUCCCUGUAUGCCG 21 22 1 6 1    0 1 0 0 0 3 6 0 0 3 0 0 0 2 1 3 3 0 0 0 0 0 0 0 0
zma-miR160g-3p GCGUGCAAGGAGCCAAGCAUG 21 34 1 6 1    0 1 0 0 0 3 0 0 5 0 0 5 2 6 3 1 6 0 0 0 0 0 2 0 0
zma-miR160g-5p UGCCUGGCUCCCUGUAUGCCA 21 1,626 65 239 1    26 17 97 98 25 63 77 31 176 59 53 19 13 239 215 171 197 3 8 16 7 5 5 5 1
zma-miR162-3p UCGAUAAACCUCUGCAUCCA 20 72 3 23 1    0 0 0 0 1 3 0 0 5 4 2 2 2 23 7 12 11 0 0 0 0 0 0 0 0
zma-miR162-5p GGGCGCAGUGGUUUAUCGAUC 21 7 0 2 1    0 0 0 0 0 0 0 0 0 0 0 2 2 0 2 1 0 0 0 0 0 0 0 0 0
zma-miR164a-3p CACGUGUUCUCCUUCUCCAUC 21 4 0 3 1    0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 1 0 0 0 0 0 0 0 0 0
zma-miR164a-5p UGGAGAAGCAGGGCACGUGCA 21 361 14 88 1    6 1 5 11 1 7 6 0 14 3 14 9 17 43 59 42 88 4 5 4 1 5 6 10 0
zma-miR164b-3p AUGUGCCCAUCUUCUCCACC 20 29 1 8 2    0 0 0 0 0 0 2 0 2 0 0 0 0 5 8 8 4 0 0 0 0 0 0 0 0
zma-miR164b-5p UGGAGAAGCAGGGCACGUGCA 21 361 14 88 1    6 1 5 11 1 7 6 0 14 3 14 9 17 43 59 42 88 4 5 4 1 5 6 10 0
zma-miR164c-3p CAUGUGCCCUUCUUCUCCAUC 21 95 4 13 1    3 1 5 0 0 3 5 9 11 4 4 0 13 2 8 7 11 3 0 0 1 0 3 2 0
zma-miR164c-5p UGGAGAAGCAGGGCACGUGCA 21 361 14 88 1    6 1 5 11 1 7 6 0 14 3 14 9 17 43 59 42 88 4 5 4 1 5 6 10 0
zma-miR164d-3p CACGUGGUCUCCUUCUCCAU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR164d-5p UGGAGAAGCAGGGCACGUGCA 21 361 14 88 1    6 1 5 11 1 7 6 0 14 3 14 9 17 43 59 42 88 4 5 4 1 5 6 10 0
zma-miR164e-3p CAUGUGUCCGCCCUCUCCACC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR164e-5p UGGAGAAGCAGGACACGUGAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR164f-3p CACGUGCGCUCCUUCUCCAAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR164f-5p UGGAGAAGCAGGGCACGUGCU 21 5 0 2 1    0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 1 2 0 0 0 0 0 0 0 0
zma-miR164g-3p CACGUGCUCCCCUUCUCCACC 21 221 9 57 1    6 9 32 22 5 7 6 57 39 11 4 3 0 6 3 1 0 1 0 0 4 0 2 2 1
zma-miR164g-5p UGGAGAAGCAGGGCACGUGCA 21 361 14 88 1    6 1 5 11 1 7 6 0 14 3 14 9 17 43 59 42 88 4 5 4 1 5 6 10 0
zma-miR164h-3p CAUGUGCCCUUCUUCUCCAUC 21 95 4 13 1    3 1 5 0 0 3 5 9 11 4 4 0 13 2 8 7 11 3 0 0 1 0 3 2 0
zma-miR164h-5p UGGAGAAGCAGGGCACGUGUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR166a-3p UCGGACCAGGCUUCAUUCCCC 21 5,814,948 232,598 698,794 1,008    103,095 79,780 351,410 421,619 348,505 268,522 131,275 467,058 599,055 167,372 227,940 2,484 4,543 698,794 602,511 695,433 635,858 1,353 1,042 1,008 1,187 1,517 1,095 1,217 1,275
zma-miR166a-5p GGAAUGUUGUCUGGCUCGGGG 21 321 13 45 3    3 4 10 22 8 10 9 40 23 5 0 3 4 39 45 32 42 3 3 0 8 0 5 0 3
zma-miR166b-3p UCGGACCAGGCUUCAUUCCC 20 87,130 3,485 11,694 7    1,472 898 5,072 6,581 5,080 4,137 3,376 7,447 8,742 3,116 3,852 53 42 11,694 8,270 8,829 8,350 28 13 16 7 20 9 13 13
zma-miR166b-5p GGAAUGUUGUCUGGUUCAAGG 21 2,508 100 216 40    52 40 191 65 123 87 96 216 206 95 91 60 89 178 93 117 67 115 78 89 56 91 61 79 73
zma-miR166c-3p UCGGACCAGGCUUCAUUCCC 20 87,130 3,485 11,694 7    1,472 898 5,072 6,581 5,080 4,137 3,376 7,447 8,742 3,116 3,852 53 42 11,694 8,270 8,829 8,350 28 13 16 7 20 9 13 13
zma-miR166c-5p GGAAUGUUGUCUGGCUCGAGG 21 542 22 76 3    8 3 32 11 15 0 11 22 26 11 6 14 17 68 76 61 64 10 23 9 8 11 17 6 13
zma-miR166d-3p UCGGACCAGGCUUCAUUCCC 20 87,130 3,485 11,694 7    1,472 898 5,072 6,581 5,080 4,137 3,376 7,447 8,742 3,116 3,852 53 42 11,694 8,270 8,829 8,350 28 13 16 7 20 9 13 13
zma-miR166d-5p GGAAUGUUGUCUGGUUCAAGG 21 2,508 100 216 40    52 40 191 65 123 87 96 216 206 95 91 60 89 178 93 117 67 115 78 89 56 91 61 79 73
zma-miR166e UCGGACCAGGCUUCAUUCCC 20 87,130 3,485 11,694 7    1,472 898 5,072 6,581 5,080 4,137 3,376 7,447 8,742 3,116 3,852 53 42 11,694 8,270 8,829 8,350 28 13 16 7 20 9 13 13
zma-miR166f UCGGACCAGGCUUCAUUCCC 20 87,130 3,485 11,694 7    1,472 898 5,072 6,581 5,080 4,137 3,376 7,447 8,742 3,116 3,852 53 42 11,694 8,270 8,829 8,350 28 13 16 7 20 9 13 13
zma-miR166g-3p UCGGACCAGGCUUCAUUCCC 20 87,130 3,485 11,694 7    1,472 898 5,072 6,581 5,080 4,137 3,376 7,447 8,742 3,116 3,852 53 42 11,694 8,270 8,829 8,350 28 13 16 7 20 9 13 13
zma-miR166g-5p GGAAUGUUGUCUGGUUGGAGA 21 311 12 44 1    2 6 22 44 12 10 6 22 9 1 2 3 17 37 39 20 33 7 5 0 3 0 6 2 3
zma-miR166h-3p UCGGACCAGGCUUCAUUCCC 20 87,130 3,485 11,694 7    1,472 898 5,072 6,581 5,080 4,137 3,376 7,447 8,742 3,116 3,852 53 42 11,694 8,270 8,829 8,350 28 13 16 7 20 9 13 13
zma-miR166h-5p GGAAUGACGUCCGGUCCGAAC 21 7 0 3 1    0 0 0 0 1 0 0 0 0 0 0 0 0 3 3 0 0 0 0 0 0 0 0 0 0
zma-miR166i-3p UCGGACCAGGCUUCAUUCCC 20 87,130 3,485 11,694 7    1,472 898 5,072 6,581 5,080 4,137 3,376 7,447 8,742 3,116 3,852 53 42 11,694 8,270 8,829 8,350 28 13 16 7 20 9 13 13
zma-miR166i-5p GGAAUGUCGUCUGGCGCGAGA 21 4 0 2 1    0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 1 0 1 0 0 0 0 0 0 0
zma-miR166j-3p UCGGACCAGGCUUCAAUCCCU 21 162,273 6,491 35,753 235    1,391 982 5,166 4,239 3,148 3,570 2,494 4,635 6,980 2,565 2,844 314 533 35,753 23,758 33,809 27,474 458 235 269 327 400 304 309 316
zma-miR166j-5p GGUUUGUUUGUCUGGUUCAAGG 22 153 6 27 1    2 3 12 5 6 3 3 9 6 7 2 3 4 27 17 13 9 3 2 2 1 7 5 2 0
zma-miR166k-3p UCGGACCAGGCUUCAAUCCCU 21 162,273 6,491 35,753 235    1,391 982 5,166 4,239 3,148 3,570 2,494 4,635 6,980 2,565 2,844 314 533 35,753 23,758 33,809 27,474 458 235 269 327 400 304 309 316
zma-miR166k-5p GGAUUGUUGUCUGGCUCGGGG 21 248 10 34 1    2 2 7 27 8 3 8 18 14 3 6 9 11 34 17 26 23 7 3 9 1 5 2 0 3
zma-miR166l-3p UCGGACCAGGCUUCAUUCCUC 21 104,368 4,175 19,250 537    1,177 678 3,846 3,612 3,032 2,818 1,557 3,823 4,664 2,230 2,142 937 1,114 19,165 12,787 19,250 15,990 838 537 1,023 762 691 547 556 592
zma-miR166l-5p GAAUGGAGGCUGGUCCAAGA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR166m-3p UCGGACCAGGCUUCAUUCCUC 21 104,368 4,175 19,250 537    1,177 678 3,846 3,612 3,032 2,818 1,557 3,823 4,664 2,230 2,142 937 1,114 19,165 12,787 19,250 15,990 838 537 1,023 762 691 547 556 592
zma-miR166m-5p GGAAUGUUGGCUGGCUCGAGG 21 748 30 82 9    20 13 74 33 31 35 38 49 82 34 19 9 13 61 40 53 16 25 15 23 10 21 9 16 9
zma-miR166n-3p UCGGACCAGGCUUCAAUCCCU 21 162,273 6,491 35,753 235    1,391 982 5,166 4,239 3,148 3,570 2,494 4,635 6,980 2,565 2,844 314 533 35,753 23,758 33,809 27,474 458 235 269 327 400 304 309 316
zma-miR166n-5p GGAUUGUUGUCUGGCUCGGUG 21 945 38 217 8    12 13 42 38 16 21 21 40 23 21 8 26 23 217 75 101 39 37 34 27 25 21 29 27 9
zma-miR167a-3p GAUCAUGCAUGACAGCCUCAUU 22 11 0 3 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 3 0 2 0 2 0 2 0
zma-miR167a-5p UGAAGCUGCCAGCAUGAUCUA 21 745 30 83 8    8 8 20 38 12 21 28 0 18 22 10 78 83 45 39 58 74 16 23 41 15 21 23 29 15
zma-miR167b-3p GAUCAUGCUGUGACAGUUUCACU 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR167b-5p UGAAGCUGCCAGCAUGAUCUA 21 745 30 83 8    8 8 20 38 12 21 28 0 18 22 10 78 83 45 39 58 74 16 23 41 15 21 23 29 15
zma-miR167c-3p GAUCAUGCUGUGGCAGCCUCACU 23 1,413 57 132 2    35 32 129 120 87 94 31 132 88 48 37 20 40 85 125 91 108 14 2 12 4 31 15 10 23
zma-miR167c-5p UGAAGCUGCCAGCAUGAUCUA 21 745 30 83 8    8 8 20 38 12 21 28 0 18 22 10 78 83 45 39 58 74 16 23 41 15 21 23 29 15
zma-miR167d-3p GGUCAUGCUGCUGCAGCCUCACU 23 274 11 41 2    3 2 12 16 5 3 2 9 17 7 10 14 15 40 30 26 41 0 5 5 12 0 0 0 0
zma-miR167d-5p UGAAGCUGCCAGCAUGAUCUA 21 745 30 83 8    8 8 20 38 12 21 28 0 18 22 10 78 83 45 39 58 74 16 23 41 15 21 23 29 15
zma-miR167e-3p GAUCAUGCUGUGCAGUUUCAUC 22 31 1 11 2    0 0 0 0 0 0 0 0 0 0 0 0 4 2 3 2 11 0 0 5 4 0 0 0 0
zma-miR167e-5p UGAAGCUGCCAGCAUGAUCUG 21 6,188 248 3,640 2    12 16 35 109 36 42 38 49 69 41 39 3 6 445 1,147 444 3,640 3 0 2 3 2 2 2 3
zma-miR167f-3p GAUCGUGCUGCGCAGUUUCACC 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR167f-5p UGAAGCUGCCAGCAUGAUCUG 21 6,188 248 3,640 2    12 16 35 109 36 42 38 49 69 41 39 3 6 445 1,147 444 3,640 3 0 2 3 2 2 2 3
zma-miR167g-3p GGUCAUGCUGUAGUUUCAUC 20 48 2 6 2    0 0 0 5 0 0 2 0 0 0 0 3 4 0 0 2 3 4 3 5 4 2 2 6 3
zma-miR167g-5p UGAAGCUGCCAGCAUGAUCUG 21 6,188 248 3,640 2    12 16 35 109 36 42 38 49 69 41 39 3 6 445 1,147 444 3,640 3 0 2 3 2 2 2 3
zma-miR167h-3p GAUCAUGUUGCAGCUUCAC 19 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR167h-5p UGAAGCUGCCAGCAUGAUCUG 21 6,188 248 3,640 2    12 16 35 109 36 42 38 49 69 41 39 3 6 445 1,147 444 3,640 3 0 2 3 2 2 2 3
zma-miR167i-3p GAUCAUGUUGCAGCUUCAC 19 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR167i-5p UGAAGCUGCCAGCAUGAUCUG 21 6,188 248 3,640 2    12 16 35 109 36 42 38 49 69 41 39 3 6 445 1,147 444 3,640 3 0 2 3 2 2 2 3
zma-miR167j-3p GAUCAUGUGGCAGUUUCAUU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR167j-5p UGAAGCUGCCAGCAUGAUCUG 21 6,188 248 3,640 2    12 16 35 109 36 42 38 49 69 41 39 3 6 445 1,147 444 3,640 3 0 2 3 2 2 2 3
zma-miR168a-3p CCCGCCUUGCACCAAGUGAA 20 1,716 69 479 1    14 32 50 212 15 56 23 137 65 41 45 12 4 118 221 178 479 1 0 2 0 2 3 2 4
zma-miR168a-5p UCGCUUGGUGCAGAUCGGGAC 21 594,029 23,761 133,598 985    4,671 4,753 14,822 25,972 8,046 14,526 6,190 15,851 15,552 7,953 9,454 3,411 5,788 106,139 106,834 97,037 133,598 1,552 985 2,804 1,701 1,784 1,558 1,508 1,540
zma-miR168b-3p CCCGCCUUGCAUCAAGUGAA 20 3,348 134 541 1    28 80 116 354 22 157 47 252 203 124 212 7 11 379 362 441 541 0 3 2 1 0 0 2 4
zma-miR168b-5p UCGCUUGGUGCAGAUCGGGAC 21 594,029 23,761 133,598 985    4,671 4,753 14,822 25,972 8,046 14,526 6,190 15,851 15,552 7,953 9,454 3,411 5,788 106,139 106,834 97,037 133,598 1,552 985 2,804 1,701 1,784 1,558 1,508 1,540
zma-miR169a-3p GGCAAGUUGUUCUUGGCUACA 21 4 0 2 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 2 0 0 1
zma-miR169a-5p CAGCCAAGGAUGACUUGCCGA 21 115 5 24 1    0 3 5 0 0 3 2 0 2 3 6 2 0 20 13 24 16 1 2 4 3 3 0 0 3
zma-miR169b-3p GGCAAGUUGUUCUUGGCUACA 21 4 0 2 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 2 0 0 1
zma-miR169b-5p CAGCCAAGGAUGACUUGCCGA 21 115 5 24 1    0 3 5 0 0 3 2 0 2 3 6 2 0 20 13 24 16 1 2 4 3 3 0 0 3
zma-miR169c-3p GGCAAGUCUGUCCUUGGCUACA 22 33 1 11 1    0 0 0 0 0 0 2 0 0 1 0 0 0 11 7 2 8 0 0 2 0 0 0 0 0
zma-miR169c-5p CAGCCAAGGAUGACUUGCCGG 21 70 3 24 1    0 1 0 0 1 0 0 0 0 0 2 0 0 17 10 14 24 0 0 0 1 0 0 0 0
zma-miR169d UAGCCAAGGAGACUGCCUAUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169e UAGCCAAGGAGACUGCCUACG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169f-3p GGCAUGUCUUCCUUGGCUACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169f-5p UAGCCAAGGAUGACUUGCCUA 21 2 0 2 2    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0
zma-miR169g UAGCCAAGGAUGACUUGCCUA 21 2 0 2 2    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0
zma-miR169h UAGCCAAGGAUGACUUGCCUA 21 2 0 2 2    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0
zma-miR169i-3p GGCAGUCUCCUUGGCUAG 18 96 4 20 1    0 0 2 0 2 3 9 9 3 12 4 20 4 1 5 2 5 8 0 4 0 0 3 0 0
zma-miR169i-5p UAGCCAAGGAUGACUUGCCUG 21 263 11 36 1    8 1 15 16 14 10 5 22 8 3 4 24 17 15 17 29 36 6 0 5 3 0 2 3 0
zma-miR169j-3p GGCAGUCUCCUUGGCUAG 18 96 4 20 1    0 0 2 0 2 3 9 9 3 12 4 20 4 1 5 2 5 8 0 4 0 0 3 0 0
zma-miR169j-5p UAGCCAAGGAUGACUUGCCUG 21 263 11 36 1    8 1 15 16 14 10 5 22 8 3 4 24 17 15 17 29 36 6 0 5 3 0 2 3 0
zma-miR169k-3p GGCAGUCUCCUUGGCUAG 18 96 4 20 1    0 0 2 0 2 3 9 9 3 12 4 20 4 1 5 2 5 8 0 4 0 0 3 0 0
zma-miR169k-5p UAGCCAAGGAUGACUUGCCUG 21 263 11 36 1    8 1 15 16 14 10 5 22 8 3 4 24 17 15 17 29 36 6 0 5 3 0 2 3 0
zma-miR169l-3p GGCAAAUCAUCCCUGCUACC 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169l-5p UAGCCAGGGAUGAUUUGCCUG 21 2 0 2 2    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0
zma-miR169m-3p GGCAUCCAUUCUUGGCUAAG 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169m-5p UAGCCAAGAAUGGCUUGCCUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169n-3p GGCAGGCCUUCUUGGCUAAG 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169n-5p UAGCCAAGAAUGGCUUGCCUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169o-3p GGCAGGUCUUCUUGGCUAGC 20 1,932 77 247 2    107 127 131 169 247 101 47 234 151 76 53 17 6 130 96 153 42 7 8 2 12 2 0 10 4
zma-miR169o-5p UAGCCAAGAAUGACUUGCCUA 21 5 0 2 1    0 0 2 0 0 0 0 0 0 1 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169p-3p GGCAAGUCAUCUGGGGCUACG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169p-5p UAGCCAAGGAUGACUUGCCGG 21 16 1 10 1    0 0 0 0 0 0 0 0 0 0 0 0 0 1 10 2 3 0 0 0 0 0 0 0 0
zma-miR169q-3p GGCAGGCCUUCUGGCUAAG 19 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169q-5p UAGCCAAGAAUGGCUUGCCUA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169r-3p GGCAAGUUGUCCUUGGCUACA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR169r-5p CAGCCAAGGAUGACUUGCCGG 21 70 3 24 1    0 1 0 0 1 0 0 0 0 0 2 0 0 17 10 14 24 0 0 0 1 0 0 0 0
zma-miR171a-3p UGAUUGAGCCGCGCCAAUAU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171a-5p UAUUGGCGAGGUUCAAUCAGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171b-3p UUGAGCCGUGCCAAUAUCAC 20 8 0 4 1    0 0 0 0 1 0 0 0 0 0 0 0 0 4 2 1 0 0 0 0 0 0 0 0 0
zma-miR171b-5p GAUAUUGGCGCGGUUCAAUC 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171c-3p UGACUGAGCCGUGCCAAUAUC 21 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0
zma-miR171c-5p UAUUGGUGCGGUUCAAUCAGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171d-3p UGAUUGAGCCGUGCCAAUAUC 21 1,019 41 170 2    2 6 30 71 22 21 20 9 25 30 37 70 93 87 66 74 170 17 18 25 22 34 21 29 20
zma-miR171d-5p UGUUGGCUCGGCUCACUCAGA 21 1,357 54 179 5    32 33 72 60 62 31 43 53 59 51 33 77 51 179 113 118 136 21 18 52 27 15 5 6 10
zma-miR171e-3p UGAUUGAGCCGUGCCAAUAUC 21 1,019 41 170 2    2 6 30 71 22 21 20 9 25 30 37 70 93 87 66 74 170 17 18 25 22 34 21 29 20
zma-miR171e-5p UGUUGGCUCGGCUCACUCAGA 21 1,357 54 179 5    32 33 72 60 62 31 43 53 59 51 33 77 51 179 113 118 136 21 18 52 27 15 5 6 10
zma-miR171f-3p UUGAGCCGUGCCAAUAUCACA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171f-5p CGAUGUUGGCAUGGCUCAAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171g-3p GAGGUGAGCCGAGCCAAUAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171g-5p UAUUGACUUGGCUCAUCUCUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171h-3p GUGAGCCGAACCAAUAUCACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171h-5p UGGUAUUGUUUCGGCUCAUGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171i-3p UGAUUGAGCCGUGCCAAUAUC 21 1,019 41 170 2    2 6 30 71 22 21 20 9 25 30 37 70 93 87 66 74 170 17 18 25 22 34 21 29 20
zma-miR171i-5p UGUUGGCACGGUUCAAUCAAA 21 2 0 2 2    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0
zma-miR171j-3p UGAUUGAGCCGUGCCAAUAUC 21 1,019 41 170 2    2 6 30 71 22 21 20 9 25 30 37 70 93 87 66 74 170 17 18 25 22 34 21 29 20
zma-miR171j-5p UAUUGACGCGGUUCAAUUCGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171k-3p GUGAGCCGAACCAAUAUCACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171k-5p UGGUAUUGUUUCGGCUCAUGU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171l-3p GGAUUGAGCCGCGUCAAUAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171l-5p UAUUGGCGUGCCUCAAUCCGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171m-3p GGAUUGAGCCGCGUCAAUAUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171m-5p UAUUGGCGCGCCUCAAUCCGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR171n-3p UGAUUGAGCCGCGCCAAUAUC 21 2 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0
zma-miR171n-5p UAUUGGUGAGGUUCAAUCCGA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR172a AGAAUCUUGAUGAUGCUGCA 20 24 1 6 1    0 0 0 0 0 0 0 0 0 0 0 5 6 0 0 0 0 0 3 0 0 2 2 5 1
zma-miR172b-3p AGAAUCUUGAUGAUGCUGCA 20 24 1 6 1    0 0 0 0 0 0 0 0 0 0 0 5 6 0 0 0 0 0 3 0 0 2 2 5 1
zma-miR172b-5p CAGCACCAUCAAGAUUCACA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR172c-3p AGAAUCUUGAUGAUGCUGCA 20 24 1 6 1    0 0 0 0 0 0 0 0 0 0 0 5 6 0 0 0 0 0 3 0 0 2 2 5 1
zma-miR172c-5p CAGCACCACCAAGAUUCACA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR172d-3p AGAAUCUUGAUGAUGCUGCA 20 24 1 6 1    0 0 0 0 0 0 0 0 0 0 0 5 6 0 0 0 0 0 3 0 0 2 2 5 1
zma-miR172d-5p CAGCACCAUCAAGAUUCACA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR172e GGAAUCUUGAUGAUGCUGCAU 21 566 23 71 3    14 12 37 71 5 38 9 26 26 15 21 14 51 8 44 9 19 17 3 7 3 28 28 27 34
zma-miR2118a UUCCUGAUGCCUCUCAUUCCUA 22 605 24 56 4    11 6 12 27 35 17 29 18 22 21 4 56 25 29 10 28 7 37 13 45 22 31 35 31 34
zma-miR2118b UUCCCGAUGCCUCCCAUUCCUA 22 3,110 124 428 3    131 68 270 212 187 428 274 252 267 228 228 61 76 55 47 76 39 33 3 41 14 36 28 37 19
zma-miR2118c UUCCUAAUGCCUCCCAUUCCUA 22 255 10 26 2    5 4 17 11 13 0 8 4 9 7 2 26 21 4 6 7 3 10 13 23 12 7 9 16 18
zma-miR2118d UUCCUGAUGCCUCCCAUGCCUA 22 551 22 67 2    28 12 67 38 41 31 28 53 59 21 21 17 13 11 17 18 3 14 2 14 5 24 2 8 4
zma-miR2118e UUCCUGAUGUCUCCCAUUCCUA 22 149 6 23 1    0 0 0 0 12 0 9 0 12 1 6 19 6 4 0 2 1 3 0 23 1 11 8 18 13
zma-miR2118f UUCCCAAUGCCUUCCAUGCCUA 22 105 4 15 2    5 4 15 5 4 7 12 4 5 5 4 7 0 8 5 2 2 0 2 2 0 5 2 0 0
zma-miR2118g UUCCUGAUGCCUCCUAUUCCUA 22 1,696 68 326 13    52 53 124 71 59 70 60 53 89 44 41 193 326 66 62 50 43 34 13 46 19 47 31 31 19
zma-miR2275a-3p UUUGUUUUCCUCCAAUAUCUCA 22 1,859 74 307 11    26 11 69 11 40 38 60 44 72 58 39 307 256 78 53 111 41 95 79 119 100 46 49 29 28
zma-miR2275a-5p AGAGUUGGAGGAAAGCAAACC 21 108,192 4,328 12,780 485    1,139 646 8,921 10,352 6,349 5,560 1,582 12,086 3,847 2,208 1,350 10,420 12,780 2,487 1,358 1,500 1,077 4,752 3,898 8,984 4,614 644 664 485 489
zma-miR2275b-3p UUCAGUUUCCUCUAAUAUCUCA 22 4,989 200 578 60    159 62 260 60 139 101 136 110 339 172 97 578 555 207 125 237 94 352 201 280 265 111 136 124 89
zma-miR2275b-5p AGGAUUAGAGGCAACUGAACC 21 307,593 12,304 39,906 1,512    16,220 10,699 25,443 14,917 13,853 7,401 11,215 25,598 11,845 6,898 1,512 5,593 2,047 39,906 16,623 26,054 5,919 22,704 4,023 9,221 18,832 2,670 2,887 2,881 2,632
zma-miR2275c-3p UUCAGUUUCCUCUAAUAUCUCA 22 4,989 200 578 60    159 62 260 60 139 101 136 110 339 172 97 578 555 207 125 237 94 352 201 280 265 111 136 124 89
zma-miR2275c-5p AGGAUUAGAGGGACUUGAACC 21 15,788 632 1,947 32    1,490 302 1,515 719 1,403 647 1,511 1,744 1,077 688 119 148 32 339 482 391 148 1,947 292 148 0 109 144 169 224
zma-miR2275d-3p UUUGUUUUCCUCUAAUAUCUCA 22 2 0 2 2    0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR2275d-5p AGAGUUGGAGGAAAGAAAACU 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR319a-3p UUGGACUGAAGGGUGCUCCC 20 7,332 293 1,881 2    40 19 77 136 42 70 18 53 60 55 39 9 4 1,881 1,533 1,446 1,813 3 5 4 5 5 2 3 10
zma-miR319a-5p GAGCUCUCUUCAGUCCACUC 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR319b-3p UUGGACUGAAGGGUGCUCCC 20 7,332 293 1,881 2    40 19 77 136 42 70 18 53 60 55 39 9 4 1,881 1,533 1,446 1,813 3 5 4 5 5 2 3 10
zma-miR319b-5p AGAGCGUCCUUCAGUCCACUC 21 2,131 85 451 1    2 1 0 11 3 3 3 9 0 0 0 242 451 64 117 45 136 51 63 94 77 276 120 111 252
zma-miR319c-3p UUGGACUGAAGGGUGCUCCC 20 7,332 293 1,881 2    40 19 77 136 42 70 18 53 60 55 39 9 4 1,881 1,533 1,446 1,813 3 5 4 5 5 2 3 10
zma-miR319c-5p GAGCUCUCUUCAGUCCACUC 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR319d-3p UUGGACUGAAGGGUGCUCCC 20 7,332 293 1,881 2    40 19 77 136 42 70 18 53 60 55 39 9 4 1,881 1,533 1,446 1,813 3 5 4 5 5 2 3 10
zma-miR319d-5p AGAGCGUCCUUCAGUCCACUC 21 2,131 85 451 1    2 1 0 11 3 3 3 9 0 0 0 242 451 64 117 45 136 51 63 94 77 276 120 111 252
zma-miR390a-3p CGCUAUCUAUCCUGAGCUCCA 21 126 5 19 1    0 3 2 11 4 0 0 4 5 1 2 9 19 17 13 7 11 1 3 4 1 0 3 5 1
zma-miR390a-5p AAGCUCAGGAGGGAUAGCGCC 21 15,234 609 5,294 86    86 167 255 692 150 275 86 428 279 110 233 1,024 5,294 590 654 377 473 262 263 271 472 870 632 653 638
zma-miR390b-3p CGCUAUCUAUCCUGAGCUCCA 21 126 5 19 1    0 3 2 11 4 0 0 4 5 1 2 9 19 17 13 7 11 1 3 4 1 0 3 5 1
zma-miR390b-5p AAGCUCAGGAGGGAUAGCGCC 21 15,234 609 5,294 86    86 167 255 692 150 275 86 428 279 110 233 1,024 5,294 590 654 377 473 262 263 271 472 870 632 653 638
zma-miR393a-3p AUCAGUGCAAUCCCUUUGGAAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR393a-5p UCCAAAGGGAUCGCAUUGAUCU 22 51 2 20 1    0 2 5 5 1 0 0 0 0 0 2 0 0 3 7 6 20 0 0 0 0 0 0 0 0
zma-miR393b-3p AUCAAUGCGAUCCUUUUGGAGG 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR393b-5p UCCAAAGGGAUCGCAUUGAUCC 22 25 1 11 2    2 3 5 11 0 0 2 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR393c-3p GUCAGUGCAAUCCCUUUGGAAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR393c-5p UCCAAAGGGAUCGCAUUGAUCU 22 51 2 20 1    0 2 5 5 1 0 0 0 0 0 2 0 0 3 7 6 20 0 0 0 0 0 0 0 0
zma-miR394a-3p AGGUGGGCAUACUGCCAAUG 20 10 0 3 1    0 0 0 0 1 0 0 0 2 0 0 2 0 0 0 0 0 0 0 2 0 0 3 0 0
zma-miR394a-5p UUGGCAUUCUGUCCACCUCC 20 1,231 49 133 10    20 19 37 60 55 77 34 40 52 56 45 41 44 111 127 122 133 10 19 21 21 24 26 21 16
zma-miR394b-3p AGGUGGGCAUACUGCCAAUG 20 10 0 3 1    0 0 0 0 1 0 0 0 2 0 0 2 0 0 0 0 0 0 0 2 0 0 3 0 0
zma-miR394b-5p UUGGCAUUCUGUCCACCUCC 20 1,231 49 133 10    20 19 37 60 55 77 34 40 52 56 45 41 44 111 127 122 133 10 19 21 21 24 26 21 16
zma-miR395a-3p GUGAAGUGUUUGGGGGAACUC 21 11 0 5 1    0 0 0 5 0 3 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 1
zma-miR395a-5p GUUCUCCUCAAACCACUUCAGUU 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395b-3p GUGAAGUGUUUGGGGGAACUC 21 11 0 5 1    0 0 0 5 0 3 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 1
zma-miR395b-5p GUUCCCUACAAGCACUUCACAA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395c-3p GUGAAGUGUUUGGAGGAACUC 21 2 0 2 2    0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395c-5p GUUCCCUGCAAACACUUCACCA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395d-3p GUGAAGUGUUUGGGGGAACUC 21 11 0 5 1    0 0 0 5 0 3 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 1
zma-miR395d-5p GUUCUAUGCAAGCACUUCACGA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395e-3p GUGAAGUGUUUGGGGGAACUC 21 11 0 5 1    0 0 0 5 0 3 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 1
zma-miR395e-5p GUUCCCUUCAAGCACUUCACAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395f-3p GUGAAGUGUUUGGGGGAACUC 21 11 0 5 1    0 0 0 5 0 3 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 1
zma-miR395f-5p GUUACCUACAAGCACGUCUCGA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395g-3p GUGAAGUGUUUGGGGGAACUC 21 11 0 5 1    0 0 0 5 0 3 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 1
zma-miR395g-5p GUUCUAUGCAAGCACUUCACGA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395h-3p GUGAAGUGUUUGGGGGAACUC 21 11 0 5 1    0 0 0 5 0 3 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 1
zma-miR395h-5p GUUCCCUUCAAGCACUUCACAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395i-3p GUGAAGUGUUUGGGGGAACUC 21 11 0 5 1    0 0 0 5 0 3 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 1
zma-miR395i-5p GUUCCCUACAAGCACUUCACGA 22 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1
zma-miR395j-3p GUGAAGUGUUUGGGGGAACUC 21 11 0 5 1    0 0 0 5 0 3 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 1
zma-miR395j-5p GUUCCCUUCAAGCACUUCACAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395k-3p GUGAAGUGUUUGAGGAAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395k-5p GUUUCCUUCAAGCACUUCACAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395l-3p GUGAAGUGUUUGGAGGAACUC 21 2 0 2 2    0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395l-5p GUUCCUUCCAAACACUUCACCA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395m-3p GUGAAGUGUUUGGAGGAACUC 21 2 0 2 2    0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395m-5p GUUCCUUUCAAACACUUCACAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395n-3p GUGAAGUGUUUGGGGGAACUC 21 11 0 5 1    0 0 0 5 0 3 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 1
zma-miR395n-5p GUUCUCUACAAGCACUUCACGA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395o-3p GUGAAGUGUUUGGGUGAACUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395o-5p GUUCUCUUCAAGCACUUCACGA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR395p-3p GUGAAGUGUUUGGGGGAACUC 21 11 0 5 1    0 0 0 5 0 3 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 1
zma-miR395p-5p GUUCCCUUCAAGCACUUCACAU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR396a-3p GUUCAAUAAAGCUGUGGGAAA 21 2,162 86 713 2    2 12 25 71 18 24 3 18 17 7 19 14 91 300 387 325 713 27 10 7 16 13 5 18 20
zma-miR396a-5p UUCCACAGCUUUCUUGAACUG 21 31,313 1,253 8,153 60    162 222 851 1,030 247 612 491 371 1,491 341 601 92 406 4,534 6,056 4,966 8,153 65 107 73 60 127 78 76 101
zma-miR396b-3p GUUCAAUAAAGCUGUGGGAAA 21 2,162 86 713 2    2 12 25 71 18 24 3 18 17 7 19 14 91 300 387 325 713 27 10 7 16 13 5 18 20
zma-miR396b-5p UUCCACAGCUUUCUUGAACUG 21 31,313 1,253 8,153 60    162 222 851 1,030 247 612 491 371 1,491 341 601 92 406 4,534 6,056 4,966 8,153 65 107 73 60 127 78 76 101
zma-miR396c UUCCACAGGCUUUCUUGAACUG 22 158 6 35 1    0 0 2 11 1 7 0 13 11 0 0 0 0 19 35 28 31 0 0 0 0 0 0 0 0
zma-miR396d UUCCACAGGCUUUCUUGAACUG 22 158 6 35 1    0 0 2 11 1 7 0 13 11 0 0 0 0 19 35 28 31 0 0 0 0 0 0 0 0
zma-miR396e-3p GGUCAAGAAAGCCGUGGGAAG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR396e-5p UUCCACAGCUUUCUUGAACUU 21 15,936 637 5,202 1    63 59 198 294 24 35 44 62 125 34 33 5 19 5,202 2,778 4,254 2,680 1 6 0 3 2 3 5 7
zma-miR396f-3p GGUCAAGAAAGCUGUGGGAAG 21 729 29 232 1    0 1 2 5 0 3 0 0 0 3 2 7 6 212 165 232 74 1 0 2 0 5 3 3 3
zma-miR396f-5p UUCCACAGCUUUCUUGAACUU 21 15,936 637 5,202 1    63 59 198 294 24 35 44 62 125 34 33 5 19 5,202 2,778 4,254 2,680 1 6 0 3 2 3 5 7
zma-miR396g-3p GUUCAAGAAAGCUGUGGAAGA 21 4 0 2 1    0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 1 1 0 0 0 0 0 0 0 0
zma-miR396g-5p UCCCACAGCUUUAUUGAACUG 21 266 11 86 1    0 1 5 11 5 17 9 0 18 4 16 0 0 18 49 27 86 0 0 0 0 0 0 0 0
zma-miR396h UCCCACAGCUUUAUUGAACUG 21 266 11 86 1    0 1 5 11 5 17 9 0 18 4 16 0 0 18 49 27 86 0 0 0 0 0 0 0 0
zma-miR397a-3p UAGCCGUUAGCGCUCAUUAACU 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR397a-5p UCAUUGAGCGCAGCGUUGAUG 21 1,020 41 351 1    11 18 17 71 15 80 2 26 34 1 10 0 19 81 215 67 351 0 2 0 0 0 0 0 0
zma-miR397b-3p CCAGCGCUGCACUCAAUUACG 21 251 10 65 1    8 14 20 65 1 7 2 26 20 4 6 0 2 15 22 8 31 0 0 0 0 0 0 0 0
zma-miR397b-5p UCAUUGAGCGCAGCGUUGAUG 21 1,020 41 351 1    11 18 17 71 15 80 2 26 34 1 10 0 19 81 215 67 351 0 2 0 0 0 0 0 0
zma-miR398a-3p UGUGUUCUCAGGUCGCCCCCG 21 7,161 286 1,821 1    332 293 379 518 261 539 44 75 240 62 218 39 47 246 1,821 591 1,136 1 11 2 1 293 3 3 6
zma-miR398a-5p GGGGCGAACUGAGAACACAUG 21 4,263 171 823 1    393 279 478 823 337 449 21 57 176 36 72 9 25 117 525 130 314 6 15 0 1 0 0 0 0
zma-miR398b-3p UGUGUUCUCAGGUCGCCCCCG 21 7,161 286 1,821 1    332 293 379 518 261 539 44 75 240 62 218 39 47 246 1,821 591 1,136 1 11 2 1 293 3 3 6
zma-miR398b-5p GGGGCGGACUGGGAACACAUG 21 2,000 80 717 1    64 25 54 114 18 21 6 26 11 8 19 2 13 81 457 236 717 0 2 2 1 120 3 0 0
zma-miR399a-3p UGCCAAAGGAGAAUUGCCCUG 21 101 4 21 1    0 1 5 5 4 14 8 4 6 8 2 0 2 10 21 5 3 0 0 0 0 0 0 0 3
zma-miR399a-5p GUGCGGUUCUCCUCUGGCACG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR399b-3p UGCCAAAGGAGAGCUGUCCUG 21 7,034 281 1,666 1    34 36 99 33 1,666 1,364 129 569 891 481 607 5 19 68 659 244 107 1 3 16 3 0 0 0 0
zma-miR399b-5p GUGCAGCUCUCCUCUGGCAUG 21 3,960 158 1,131 1    31 26 47 11 1,001 1,131 58 269 502 243 348 0 13 14 167 58 15 1 2 16 7 0 0 0 0
zma-miR399c-3p UGCCAAAGGAGAAUUGCCCUG 21 101 4 21 1    0 1 5 5 4 14 8 4 6 8 2 0 2 10 21 5 3 0 0 0 0 0 0 0 3
zma-miR399c-5p GGGUACGUCUCCUUUGGCACA 21 20 1 5 1    2 0 0 5 0 0 2 0 3 0 0 0 0 0 5 0 0 0 0 0 0 0 2 0 1
zma-miR399d-3p UGCCAAAGGAGAGCUGCCCUG 21 2 0 2 2    0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR399d-5p GUGUGGCUCUCCUCUGGCAUG 21 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0
zma-miR399e-3p UGCCAAAGGAGAGUUGCCCUG 21 839 34 217 2    8 18 12 22 20 28 12 88 46 27 27 2 13 88 217 83 108 0 0 0 0 11 3 3 3
zma-miR399e-5p GGGCUUCUCUUUCUUGGCAGG 21 13 1 3 1    0 1 0 0 0 0 0 0 0 0 0 0 0 0 3 2 0 0 0 0 0 2 2 2 1
zma-miR399f-3p UGCCAAAGGAAAUUUGCCCCG 21 27 1 8 1    0 1 0 0 0 0 0 0 2 0 2 0 0 4 8 5 5 0 0 0 0 0 0 0 0
zma-miR399f-5p GGGCAACUUCUCCUUUGGCAGA 22 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0
zma-miR399g-3p UGCCAAAGGGGAUUUGCCCGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR399g-5p GGGCAACCCCCCGUUGGCAGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR399h-3p UGCCAAAGGAGAAUUGCCCUG 21 101 4 21 1    0 1 5 5 4 14 8 4 6 8 2 0 2 10 21 5 3 0 0 0 0 0 0 0 3
zma-miR399h-5p GUGCAGUUCUCCUCUGGCACG 21 2 0 2 2    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0
zma-miR399i-3p UGCCAAAGGAGAGUUGCCCUG 21 839 34 217 2    8 18 12 22 20 28 12 88 46 27 27 2 13 88 217 83 108 0 0 0 0 11 3 3 3
zma-miR399i-5p GUGCGGCUCUCCUCUGGCAUG 21 1 0 1 1    0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR399j-3p UGCCAAAGGAGAGUUGCCCUG 21 839 34 217 2    8 18 12 22 20 28 12 88 46 27 27 2 13 88 217 83 108 0 0 0 0 11 3 3 3
zma-miR399j-5p AGGCAGCUCUCCUCUGGCAGG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR408a CUGCACUGCCUCUUCCCUGGC 21 140,267 5,611 26,050 3    3,467 5,487 9,166 21,929 3,783 9,481 482 8,842 14,813 1,219 6,494 24 167 5,463 26,050 7,724 15,628 0 24 4 4 7 0 3 6
zma-miR408b-3p CUGCACUGCCUCUUCCCUGGC 21 140,267 5,611 26,050 3    3,467 5,487 9,166 21,929 3,783 9,481 482 8,842 14,813 1,219 6,494 24 167 5,463 26,050 7,724 15,628 0 24 4 4 7 0 3 6
zma-miR408b-5p CAGGGACGAGGCAGAGCAUGG 21 4,589 184 693 2    197 86 693 621 362 675 70 433 508 63 86 19 23 169 201 140 222 3 10 2 0 0 0 0 6
zma-miR444a UGCAGUUGUUGUCUCAAGCUU 21 1,855 74 319 6    14 10 72 71 42 31 23 75 72 48 47 31 87 236 241 220 319 13 6 34 30 34 37 27 35
zma-miR444b UGCAGUUGUUGUCUCAAGCUU 21 1,855 74 319 6    14 10 72 71 42 31 23 75 72 48 47 31 87 236 241 220 319 13 6 34 30 34 37 27 35
zma-miR482-3p UCUUCCUUGUUCCUCCCAUU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR482-5p UGGGAGAUGAAGGAGCCUU 19 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR528a-3p CCUGUGCCUGCCUCUUCCAUU 21 7,832 313 2,141 2    488 513 1,148 2,141 263 1,162 57 300 304 108 154 17 51 227 418 174 285 0 13 0 0 2 0 0 7
zma-miR528a-5p UGGAAGGGGCAUGCAGAGGAG 21 40,660 1,626 9,332 5    1,435 1,687 3,247 4,489 672 5,052 553 1,143 3,696 430 1,568 172 379 885 9,332 2,190 3,472 18 151 5 11 26 8 8 31
zma-miR528b-3p CCUGUGCCUGCCUCUUCCAUU 21 7,832 313 2,141 2    488 513 1,148 2,141 263 1,162 57 300 304 108 154 17 51 227 418 174 285 0 13 0 0 2 0 0 7
zma-miR528b-5p UGGAAGGGGCAUGCAGAGGAG 21 40,660 1,626 9,332 5    1,435 1,687 3,247 4,489 672 5,052 553 1,143 3,696 430 1,568 172 379 885 9,332 2,190 3,472 18 151 5 11 26 8 8 31
zma-miR529-3p GCUGUACCCUCUCUCUUCUUC 21 477 19 69 2    6 8 12 33 13 7 12 40 15 10 2 12 13 55 31 69 53 11 16 12 8 7 12 10 10
zma-miR529-5p AGAAGAGAGAGAGUACAGCCU 21 106,506 4,260 26,412 278    278 395 2,230 1,825 673 1,033 1,814 2,163 4,140 1,683 1,535 930 1,628 18,877 15,094 21,611 26,412 590 693 775 309 572 469 298 479
zma-miR827-3p UUAGAUGACCAUCAGCAAACA 21 3,071 123 379 3    61 29 50 71 67 115 84 137 351 231 294 65 66 379 241 375 306 3 0 11 23 24 21 29 38
zma-miR827-5p UUUGUUGGUGGUCAUUUAACC 21 145 6 20 1    2 1 10 5 3 0 3 4 5 4 16 3 8 10 20 14 18 0 2 0 3 3 2 8 1