Maize B73 small RNA miRNA Abundances

The data below are based on the microRNAs listed in the miRBase registry. Adjust libraries/reads to display on the control panel.


        miRNA         miRNA sequence Len Sum (norm) Average Max Min (>0)  Zm_B_IZm_B_LZm_B_RZm_B_SZm_BxB_EZm_BxMo17_EZm_BxP_EZm_B84_IZm_B84_LZm_B84_SZm_B84xB73_EZm_B84xB73_IZm_B84xB73_LZm_B84xB73_RZm_B84xB73_SZm_B84xB84_EZm_B84xMo17_EZm_B84xMo17_IZm_B84xMo17_LZm_B84xMo17_RZm_B84xMo17_SZm_B84xPH207_EZm_Mo17_IZm_Mo17_LZm_Mo17_RZm_Mo17_SZm_Mo17xB73_EZm_Mo17xB73_IZm_Mo17xB73_RZm_Mo17xB73_SZm_Mo17xMo17_EZm_Mo17xOh43_IZm_Mo17xOh43_LZm_Mo17xOh43_RZm_Mo17xOh43_SZm_Mo17xPH207_EZm_Mo17xPH207_IZm_Mo17xPH207_LZm_Mo17xPH207_RZm_Mo17xPH207_SZm_Mo17xPHG29_IZm_Mo17xPHG29_LZm_Mo17xPHG29_RZm_Mo17xPHG29_SZm_Oh43_IZm_Oh43_LZm_Oh43_RZm_Oh43_SZm_Oh43xB73_EZm_Oh43xB73_IZm_Oh43xB73_LZm_Oh43xB73_RZm_Oh43xB73_SZm_Oh43xMo17_EZm_Oh43xOh43_EZm_Oh43xPH207_EZm_P_IZm_P_LZm_P_RZm_P_SZm_PxB_EZm_PxB_IZm_PxB_RZm_PxB_SZm_PH207xMo17_EZm_PxP_EZm_PHB47_IZm_PHB47_LZm_PHB47_RZm_PHB47_SZm_PHB47xB73_IZm_PHB47xB73_LZm_PHB47xB73_RZm_PHB47xB73_SZm_PHB47xMo17_EZm_PHB47xMo17_IZm_PHB47xMo17_LZm_PHB47xMo17_RZm_PHB47xMo17_SZm_PHB47xPH207_EZm_PHB47xPHB47_EZm_PHG29_IZm_PHG29_LZm_PHG29_RZm_PHG29_SZm_PHG29xB73_EZm_PHG29xB73_IZm_PHG29xB73_LZm_PHG29xB73_RZm_PHG29xB73_SZm_PHG29xMo17_EZm_PHG29xPH207_EZm_PHG29xPHG29_EZm_PHJ40_IZm_PHJ40_RZm_PHJ40_SZm_PHJ40xB73_EZm_PHJ40xB73_IZm_PHJ40xB73_LZm_PHJ40xB73_RZm_PHJ40xB73_SZm_PHJ40xMo17_EZm_PHJ40xMo17_IZm_PHJ40xMo17_LZm_PHJ40xMo17_RZm_PHJ40xMo17_SZm_PHJ40xPH207_EZm_PHJ40xPHJ40_EZm_LH145xB73_EZm_LH145xB73_IZm_LH145xB73_LZm_LH145xB73_RZm_LH145xB73_SZm_PxB_LZm_Q381_IZm_Q381_LZm_Q381_RZm_Q381_SZm_Q381xB73_EZm_Q381xB73_IZm_Q381xB73_LZm_Q381xB73_RZm_Q381xB73_SZm_Q381xPH207_EZm_Q381xQ381_E
zma-miR11969-3p UUAUACCCAUCUCUCACCUUGCAA 24 19 0 14 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 14 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR11969-5p GCAAGGUCAGAGAAGGAUAUAAUC 24 8 0 4 2    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR11970-3p UGGUUUGGUUGCACGUUUGCA 21 119 1 15 1    1 2 1 0 4 2 2 0 0 0 0 0 0 5 0 3 2 0 0 2 0 0 0 0 1 0 0 0 2 0 1 6 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 3 0 4 0 0 2 1 4 3 0 0 0 0 0 0 0 1 0 0 1 15 0 0 0 0 0 0 0 0 3 2 0 0 1 1 2 2 0 0 4 0 3 0 0 0 4 0 6 9 0 0 0 3 0 1 0 0 0 2 0 1 0 0 2 0
zma-miR11970-5p CAAGCGUGCAAGCAAACCAUU 21 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR1432-3p GGGUGUCAUCUCGCCUGAAGCA 22 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR1432-5p CUCAGGAGAGAUGACACCGAC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR156a-3p GCUCACUUCUCUCUCUGUCAGU 22 1,514 12 117 1    0 0 18 70 4 0 2 0 0 49 0 0 0 32 39 0 0 0 0 11 8 0 0 0 1 9 0 0 11 25 0 0 0 23 42 3 0 0 5 28 0 0 0 10 0 0 25 71 7 0 0 18 33 0 6 0 0 0 4 28 2 0 20 34 4 2 0 0 14 53 0 0 20 55 5 0 0 11 37 0 1 0 0 21 22 7 0 0 30 17 7 2 0 0 58 42 0 0 0 32 87 0 0 0 11 18 1 3 0 0 0 8 117 0 0 0 19 35 3 0 0 25 105 0 4
zma-miR156a-5p UGACAGAAGAGAGUGAGCAC 20 396,830 3,175 17,795 6    13 2,104 2,573 8,265 568 938 219 8 1,639 6,242 1,329 24 1,717 6,122 5,749 452 1,514 50 1,614 3,924 6,859 1,480 40 520 3,496 5,084 715 23 11,172 5,014 407 18 1,878 9,746 9,343 259 21 2,089 5,091 8,043 50 2,393 4,485 5,379 68 1,685 3,769 8,752 474 16 1,785 17,795 8,738 177 540 235 7 2,186 1,243 5,928 613 11 15,466 7,549 201 318 14 1,085 1,779 3,722 10 3,055 12,974 906 520 24 2,484 5,985 9,967 178 513 10 404 4,554 4,382 311 8 2,471 13,493 2,792 478 365 577 48 4,739 5,336 1,201 18 1,091 8,172 10,243 265 22 604 4,721 4,435 238 470 247 8 2,623 6,079 15,552 2,723 36 781 2,853 12,249 894 6 2,404 13,760 15,293 88 345
zma-miR156b-3p GCUCACCCUCUAUCUGUCAGU 21 1,351 11 138 2    0 0 12 8 5 0 0 0 0 10 0 0 0 38 13 0 0 0 0 19 13 3 0 0 22 11 3 0 136 8 5 0 0 129 20 0 0 0 34 11 0 0 7 2 0 0 17 18 0 0 0 73 26 0 0 3 0 0 0 0 2 0 40 16 2 0 0 0 10 17 0 0 138 17 0 0 0 71 24 0 7 0 0 0 0 0 0 0 71 0 0 0 0 0 38 14 0 0 0 71 17 0 0 0 36 8 0 0 0 0 0 34 15 0 0 0 0 0 2 0 0 45 10 0 0
zma-miR156b-5p UGACAGAAGAGAGUGAGCAC 20 396,830 3,175 17,795 6    13 2,104 2,573 8,265 568 938 219 8 1,639 6,242 1,329 24 1,717 6,122 5,749 452 1,514 50 1,614 3,924 6,859 1,480 40 520 3,496 5,084 715 23 11,172 5,014 407 18 1,878 9,746 9,343 259 21 2,089 5,091 8,043 50 2,393 4,485 5,379 68 1,685 3,769 8,752 474 16 1,785 17,795 8,738 177 540 235 7 2,186 1,243 5,928 613 11 15,466 7,549 201 318 14 1,085 1,779 3,722 10 3,055 12,974 906 520 24 2,484 5,985 9,967 178 513 10 404 4,554 4,382 311 8 2,471 13,493 2,792 478 365 577 48 4,739 5,336 1,201 18 1,091 8,172 10,243 265 22 604 4,721 4,435 238 470 247 8 2,623 6,079 15,552 2,723 36 781 2,853 12,249 894 6 2,404 13,760 15,293 88 345
zma-miR156c UGACAGAAGAGAGUGAGCAC 20 396,830 3,175 17,795 6    13 2,104 2,573 8,265 568 938 219 8 1,639 6,242 1,329 24 1,717 6,122 5,749 452 1,514 50 1,614 3,924 6,859 1,480 40 520 3,496 5,084 715 23 11,172 5,014 407 18 1,878 9,746 9,343 259 21 2,089 5,091 8,043 50 2,393 4,485 5,379 68 1,685 3,769 8,752 474 16 1,785 17,795 8,738 177 540 235 7 2,186 1,243 5,928 613 11 15,466 7,549 201 318 14 1,085 1,779 3,722 10 3,055 12,974 906 520 24 2,484 5,985 9,967 178 513 10 404 4,554 4,382 311 8 2,471 13,493 2,792 478 365 577 48 4,739 5,336 1,201 18 1,091 8,172 10,243 265 22 604 4,721 4,435 238 470 247 8 2,623 6,079 15,552 2,723 36 781 2,853 12,249 894 6 2,404 13,760 15,293 88 345
zma-miR156d-3p GCUCACUUCUCUUUCUGUCAGC 22 7,559 60 425 1    3 58 73 425 7 26 0 0 35 381 5 1 32 156 157 0 4 6 7 36 231 0 9 9 58 81 14 1 76 103 23 0 26 81 235 0 3 28 58 390 0 17 33 149 2 25 87 280 0 0 24 99 203 8 0 1 0 58 13 185 2 0 67 210 2 0 2 28 27 212 2 79 55 93 2 3 21 65 260 0 8 0 12 53 168 1 0 30 67 72 5 1 0 1 83 299 12 0 4 85 224 3 0 9 6 106 16 20 0 2 32 45 237 90 3 19 58 258 0 0 10 84 275 0 9
zma-miR156d-5p UGACAGAAGAGAGUGAGCAC 20 396,830 3,175 17,795 6    13 2,104 2,573 8,265 568 938 219 8 1,639 6,242 1,329 24 1,717 6,122 5,749 452 1,514 50 1,614 3,924 6,859 1,480 40 520 3,496 5,084 715 23 11,172 5,014 407 18 1,878 9,746 9,343 259 21 2,089 5,091 8,043 50 2,393 4,485 5,379 68 1,685 3,769 8,752 474 16 1,785 17,795 8,738 177 540 235 7 2,186 1,243 5,928 613 11 15,466 7,549 201 318 14 1,085 1,779 3,722 10 3,055 12,974 906 520 24 2,484 5,985 9,967 178 513 10 404 4,554 4,382 311 8 2,471 13,493 2,792 478 365 577 48 4,739 5,336 1,201 18 1,091 8,172 10,243 265 22 604 4,721 4,435 238 470 247 8 2,623 6,079 15,552 2,723 36 781 2,853 12,249 894 6 2,404 13,760 15,293 88 345
zma-miR156e-3p GCUCACUGCUCUCUCUGUCAUC 22 3,675 29 190 1    1 169 21 79 0 7 0 1 135 67 0 1 137 44 26 0 4 0 45 14 35 6 0 43 8 37 6 0 31 28 13 0 32 42 44 0 2 46 24 109 0 50 10 42 0 77 8 53 0 0 74 50 45 0 2 0 0 84 6 64 0 0 73 46 0 0 0 52 8 34 0 174 57 21 5 0 54 61 70 1 0 0 16 15 37 1 1 115 50 27 2 0 0 1 10 19 0 0 38 26 50 0 0 16 15 14 4 6 0 0 190 32 67 101 0 38 0 66 0 0 101 63 76 0 0
zma-miR156e-5p UGACAGAAGAGAGUGAGCAC 20 396,830 3,175 17,795 6    13 2,104 2,573 8,265 568 938 219 8 1,639 6,242 1,329 24 1,717 6,122 5,749 452 1,514 50 1,614 3,924 6,859 1,480 40 520 3,496 5,084 715 23 11,172 5,014 407 18 1,878 9,746 9,343 259 21 2,089 5,091 8,043 50 2,393 4,485 5,379 68 1,685 3,769 8,752 474 16 1,785 17,795 8,738 177 540 235 7 2,186 1,243 5,928 613 11 15,466 7,549 201 318 14 1,085 1,779 3,722 10 3,055 12,974 906 520 24 2,484 5,985 9,967 178 513 10 404 4,554 4,382 311 8 2,471 13,493 2,792 478 365 577 48 4,739 5,336 1,201 18 1,091 8,172 10,243 265 22 604 4,721 4,435 238 470 247 8 2,623 6,079 15,552 2,723 36 781 2,853 12,249 894 6 2,404 13,760 15,293 88 345
zma-miR156f-3p GCUCACUUCUCUUUCUGUCAGC 22 7,559 60 425 1    3 58 73 425 7 26 0 0 35 381 5 1 32 156 157 0 4 6 7 36 231 0 9 9 58 81 14 1 76 103 23 0 26 81 235 0 3 28 58 390 0 17 33 149 2 25 87 280 0 0 24 99 203 8 0 1 0 58 13 185 2 0 67 210 2 0 2 28 27 212 2 79 55 93 2 3 21 65 260 0 8 0 12 53 168 1 0 30 67 72 5 1 0 1 83 299 12 0 4 85 224 3 0 9 6 106 16 20 0 2 32 45 237 90 3 19 58 258 0 0 10 84 275 0 9
zma-miR156f-5p UGACAGAAGAGAGUGAGCAC 20 396,830 3,175 17,795 6    13 2,104 2,573 8,265 568 938 219 8 1,639 6,242 1,329 24 1,717 6,122 5,749 452 1,514 50 1,614 3,924 6,859 1,480 40 520 3,496 5,084 715 23 11,172 5,014 407 18 1,878 9,746 9,343 259 21 2,089 5,091 8,043 50 2,393 4,485 5,379 68 1,685 3,769 8,752 474 16 1,785 17,795 8,738 177 540 235 7 2,186 1,243 5,928 613 11 15,466 7,549 201 318 14 1,085 1,779 3,722 10 3,055 12,974 906 520 24 2,484 5,985 9,967 178 513 10 404 4,554 4,382 311 8 2,471 13,493 2,792 478 365 577 48 4,739 5,336 1,201 18 1,091 8,172 10,243 265 22 604 4,721 4,435 238 470 247 8 2,623 6,079 15,552 2,723 36 781 2,853 12,249 894 6 2,404 13,760 15,293 88 345
zma-miR156g-3p GCUCACUUCUCUUUCUGUCAGC 22 7,559 60 425 1    3 58 73 425 7 26 0 0 35 381 5 1 32 156 157 0 4 6 7 36 231 0 9 9 58 81 14 1 76 103 23 0 26 81 235 0 3 28 58 390 0 17 33 149 2 25 87 280 0 0 24 99 203 8 0 1 0 58 13 185 2 0 67 210 2 0 2 28 27 212 2 79 55 93 2 3 21 65 260 0 8 0 12 53 168 1 0 30 67 72 5 1 0 1 83 299 12 0 4 85 224 3 0 9 6 106 16 20 0 2 32 45 237 90 3 19 58 258 0 0 10 84 275 0 9
zma-miR156g-5p UGACAGAAGAGAGUGAGCAC 20 396,830 3,175 17,795 6    13 2,104 2,573 8,265 568 938 219 8 1,639 6,242 1,329 24 1,717 6,122 5,749 452 1,514 50 1,614 3,924 6,859 1,480 40 520 3,496 5,084 715 23 11,172 5,014 407 18 1,878 9,746 9,343 259 21 2,089 5,091 8,043 50 2,393 4,485 5,379 68 1,685 3,769 8,752 474 16 1,785 17,795 8,738 177 540 235 7 2,186 1,243 5,928 613 11 15,466 7,549 201 318 14 1,085 1,779 3,722 10 3,055 12,974 906 520 24 2,484 5,985 9,967 178 513 10 404 4,554 4,382 311 8 2,471 13,493 2,792 478 365 577 48 4,739 5,336 1,201 18 1,091 8,172 10,243 265 22 604 4,721 4,435 238 470 247 8 2,623 6,079 15,552 2,723 36 781 2,853 12,249 894 6 2,404 13,760 15,293 88 345
zma-miR156h-3p GCUCACUGCUCUUUCUGUCAUC 22 1,337 11 59 2    0 0 12 8 8 16 12 0 0 11 18 0 0 54 10 5 2 0 0 10 8 16 0 0 17 2 2 0 37 11 7 0 0 39 4 14 0 0 24 31 0 0 27 8 0 0 15 6 20 0 0 31 7 21 19 7 0 0 5 9 10 0 36 6 9 47 0 0 7 2 0 0 21 7 14 0 0 58 13 9 27 0 0 31 0 20 0 0 28 0 15 12 25 0 22 5 52 0 0 32 7 31 0 0 21 6 11 59 9 0 0 8 6 0 0 0 0 3 24 0 0 43 5 11 32
zma-miR156h-5p UGACAGAAGAGAGUGAGCAC 20 396,830 3,175 17,795 6    13 2,104 2,573 8,265 568 938 219 8 1,639 6,242 1,329 24 1,717 6,122 5,749 452 1,514 50 1,614 3,924 6,859 1,480 40 520 3,496 5,084 715 23 11,172 5,014 407 18 1,878 9,746 9,343 259 21 2,089 5,091 8,043 50 2,393 4,485 5,379 68 1,685 3,769 8,752 474 16 1,785 17,795 8,738 177 540 235 7 2,186 1,243 5,928 613 11 15,466 7,549 201 318 14 1,085 1,779 3,722 10 3,055 12,974 906 520 24 2,484 5,985 9,967 178 513 10 404 4,554 4,382 311 8 2,471 13,493 2,792 478 365 577 48 4,739 5,336 1,201 18 1,091 8,172 10,243 265 22 604 4,721 4,435 238 470 247 8 2,623 6,079 15,552 2,723 36 781 2,853 12,249 894 6 2,404 13,760 15,293 88 345
zma-miR156i-3p GCUCACUGCUCUAUCUGUCAUC 22 1,519 12 107 1    0 0 30 15 15 5 5 0 2 25 14 0 0 95 10 9 2 0 0 31 11 9 0 0 17 4 3 0 56 3 4 0 0 65 5 14 0 0 44 11 0 0 33 17 0 0 23 12 2 0 0 58 17 3 3 6 0 0 11 11 9 1 107 16 5 6 0 0 21 4 0 0 37 14 7 0 0 56 10 3 8 0 0 49 16 2 0 0 74 3 0 0 5 1 29 16 5 0 0 78 19 7 0 0 17 4 1 0 13 0 0 34 9 0 0 0 19 15 14 0 1 66 13 0 5
zma-miR156i-5p UGACAGAAGAGAGUGAGCAC 20 396,830 3,175 17,795 6    13 2,104 2,573 8,265 568 938 219 8 1,639 6,242 1,329 24 1,717 6,122 5,749 452 1,514 50 1,614 3,924 6,859 1,480 40 520 3,496 5,084 715 23 11,172 5,014 407 18 1,878 9,746 9,343 259 21 2,089 5,091 8,043 50 2,393 4,485 5,379 68 1,685 3,769 8,752 474 16 1,785 17,795 8,738 177 540 235 7 2,186 1,243 5,928 613 11 15,466 7,549 201 318 14 1,085 1,779 3,722 10 3,055 12,974 906 520 24 2,484 5,985 9,967 178 513 10 404 4,554 4,382 311 8 2,471 13,493 2,792 478 365 577 48 4,739 5,336 1,201 18 1,091 8,172 10,243 265 22 604 4,721 4,435 238 470 247 8 2,623 6,079 15,552 2,723 36 781 2,853 12,249 894 6 2,404 13,760 15,293 88 345
zma-miR156j-3p UGCUCUCUGCUCUCACUGUCAUC 23 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR156j-5p UGACAGAAGAGAGAGAGCACA 21 3 0 2 1    0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR156k-3p GCUCGCUUCUCUUUCUGUCAGC 22 4,043 32 270 1    1 270 5 46 0 0 0 4 153 62 0 1 122 24 21 0 0 0 86 4 32 0 3 125 10 24 3 0 19 34 0 0 103 26 54 0 3 145 19 59 2 63 7 36 4 179 12 32 0 0 103 16 26 0 0 0 3 223 8 41 0 0 14 36 0 0 3 100 4 32 0 154 8 48 0 3 112 0 48 0 0 2 74 19 37 0 1 210 18 14 0 0 0 9 9 34 0 2 50 15 47 0 7 57 9 18 0 0 0 0 74 3 67 168 2 87 19 61 0 1 50 14 90 0 0
zma-miR156k-5p UGACAGAAGAGAGCGAGCAC 20 8,865 71 436 1    0 245 42 125 0 0 0 6 162 105 0 6 156 59 64 0 0 21 171 31 104 0 12 179 94 85 40 6 52 89 0 3 237 80 124 0 6 276 98 140 13 351 83 107 20 405 59 77 2 9 125 107 116 0 0 0 7 436 31 97 0 5 111 81 0 0 9 133 21 65 2 195 66 17 0 17 310 59 200 0 0 4 105 118 81 0 3 273 115 14 0 1 0 50 68 43 0 9 97 47 121 0 15 99 51 42 3 0 0 2 169 48 164 247 18 101 39 146 0 3 164 47 204 0 0
zma-miR156l-3p GCUCACUGCUCUAUCUGUCACC 22 11,170 89 752 1    1 0 174 70 35 49 7 3 0 126 193 0 6 266 69 196 247 0 0 225 74 214 0 0 166 133 21 0 585 84 32 0 0 558 123 3 0 0 386 171 0 0 269 80 0 0 206 118 12 0 2 369 92 13 23 4 0 3 71 97 33 0 579 105 9 4 0 0 185 50 0 0 426 65 31 0 0 752 124 41 110 0 0 246 102 4 0 0 465 85 8 3 13 0 129 40 88 0 0 317 44 14 0 0 179 48 34 96 30 0 0 244 47 0 0 0 101 201 20 0 0 423 92 5 2
zma-miR156l-5p UGACAGAAGAGAGUGAGCAC 20 396,830 3,175 17,795 6    13 2,104 2,573 8,265 568 938 219 8 1,639 6,242 1,329 24 1,717 6,122 5,749 452 1,514 50 1,614 3,924 6,859 1,480 40 520 3,496 5,084 715 23 11,172 5,014 407 18 1,878 9,746 9,343 259 21 2,089 5,091 8,043 50 2,393 4,485 5,379 68 1,685 3,769 8,752 474 16 1,785 17,795 8,738 177 540 235 7 2,186 1,243 5,928 613 11 15,466 7,549 201 318 14 1,085 1,779 3,722 10 3,055 12,974 906 520 24 2,484 5,985 9,967 178 513 10 404 4,554 4,382 311 8 2,471 13,493 2,792 478 365 577 48 4,739 5,336 1,201 18 1,091 8,172 10,243 265 22 604 4,721 4,435 238 470 247 8 2,623 6,079 15,552 2,723 36 781 2,853 12,249 894 6 2,404 13,760 15,293 88 345
zma-miR159a-3p UUUGGAUUGAAGGGAGCUCUG 21 259,297 2,074 8,165 22    1,895 7,209 605 1,260 187 250 52 2,174 5,668 2,532 28 2,122 6,321 1,377 898 22 65 2,976 4,118 981 2,572 131 2,052 5,336 2,415 1,703 506 1,656 903 1,348 54 1,335 2,384 2,375 2,263 24 2,024 2,556 1,963 2,818 2,775 3,024 1,894 2,853 5,528 7,648 2,673 2,590 98 1,177 2,868 1,989 1,528 34 93 62 5,051 5,993 1,710 2,270 109 859 2,439 1,528 60 94 6,633 3,181 2,099 1,323 854 4,478 1,643 3,766 156 2,257 4,330 1,846 3,566 201 103 3,732 3,058 4,794 2,690 84 913 3,467 1,864 537 105 104 96 8,165 4,816 1,428 252 788 1,436 1,634 1,753 78 2,863 2,250 2,060 1,528 358 453 62 1,223 3,613 1,184 1,789 4,336 6,772 1,517 1,431 6,170 313 1,145 3,287 1,956 2,406 66 180
zma-miR159a-5p GAGCUCCUAUCAUUCCAAUGA 21 21,195 170 1,117 1    683 56 4 549 3 16 2 32 21 180 2 778 32 14 401 0 6 180 29 17 396 6 271 20 17 208 16 258 62 547 11 15 44 67 473 0 110 24 36 670 132 43 23 457 883 127 20 411 2 165 20 94 561 0 9 1 981 45 11 489 5 93 81 449 0 0 1,117 428 12 158 76 50 89 251 2 142 110 93 439 0 8 1,007 14 50 485 0 418 35 112 205 0 1 1 505 22 135 2 102 40 99 535 7 263 42 38 263 6 6 0 61 42 26 360 34 479 7 14 475 12 247 51 61 600 0 0
zma-miR159b-3p UUUGGAUUGAAGGGAGCUCUG 21 259,297 2,074 8,165 22    1,895 7,209 605 1,260 187 250 52 2,174 5,668 2,532 28 2,122 6,321 1,377 898 22 65 2,976 4,118 981 2,572 131 2,052 5,336 2,415 1,703 506 1,656 903 1,348 54 1,335 2,384 2,375 2,263 24 2,024 2,556 1,963 2,818 2,775 3,024 1,894 2,853 5,528 7,648 2,673 2,590 98 1,177 2,868 1,989 1,528 34 93 62 5,051 5,993 1,710 2,270 109 859 2,439 1,528 60 94 6,633 3,181 2,099 1,323 854 4,478 1,643 3,766 156 2,257 4,330 1,846 3,566 201 103 3,732 3,058 4,794 2,690 84 913 3,467 1,864 537 105 104 96 8,165 4,816 1,428 252 788 1,436 1,634 1,753 78 2,863 2,250 2,060 1,528 358 453 62 1,223 3,613 1,184 1,789 4,336 6,772 1,517 1,431 6,170 313 1,145 3,287 1,956 2,406 66 180
zma-miR159b-5p GUGCUCCCUUCAAACCAAUAA 21 9 0 4 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR159c-3p CUUGGAUUGAAGGGAGCUCCU 21 237 2 20 1    2 0 0 0 0 0 0 2 0 0 0 6 0 9 10 0 0 2 0 9 5 0 0 0 1 0 0 3 0 6 0 0 0 9 0 0 2 0 5 0 2 2 3 2 0 0 2 0 0 0 0 8 2 0 0 0 0 0 2 2 0 0 20 0 0 0 1 0 2 0 2 0 8 7 0 2 1 4 0 0 0 0 0 13 0 0 0 0 5 0 0 1 0 10 9 2 0 0 0 11 0 0 7 0 11 0 0 0 0 2 0 0 0 0 0 0 5 3 2 0 0 11 2 0 0
zma-miR159c-5p GAGCUCCCUUCGAUCCAAUCC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR159d-3p CUUGGAUUGAAGGGAGCUCCU 21 237 2 20 1    2 0 0 0 0 0 0 2 0 0 0 6 0 9 10 0 0 2 0 9 5 0 0 0 1 0 0 3 0 6 0 0 0 9 0 0 2 0 5 0 2 2 3 2 0 0 2 0 0 0 0 8 2 0 0 0 0 0 2 2 0 0 20 0 0 0 1 0 2 0 2 0 8 7 0 2 1 4 0 0 0 0 0 13 0 0 0 0 5 0 0 1 0 10 9 2 0 0 0 11 0 0 7 0 11 0 0 0 0 2 0 0 0 0 0 0 5 3 2 0 0 11 2 0 0
zma-miR159d-5p GAGCUCCCUUCGAUCCAAUCC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR159e-3p AUUGGUUUGAAGGGAGCUCCA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR159e-5p CAGCUCCUGCAGCAUCUGUUC 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR159f-3p UUUGGAUUGAAGGGAGCUCUG 21 259,297 2,074 8,165 22    1,895 7,209 605 1,260 187 250 52 2,174 5,668 2,532 28 2,122 6,321 1,377 898 22 65 2,976 4,118 981 2,572 131 2,052 5,336 2,415 1,703 506 1,656 903 1,348 54 1,335 2,384 2,375 2,263 24 2,024 2,556 1,963 2,818 2,775 3,024 1,894 2,853 5,528 7,648 2,673 2,590 98 1,177 2,868 1,989 1,528 34 93 62 5,051 5,993 1,710 2,270 109 859 2,439 1,528 60 94 6,633 3,181 2,099 1,323 854 4,478 1,643 3,766 156 2,257 4,330 1,846 3,566 201 103 3,732 3,058 4,794 2,690 84 913 3,467 1,864 537 105 104 96 8,165 4,816 1,428 252 788 1,436 1,634 1,753 78 2,863 2,250 2,060 1,528 358 453 62 1,223 3,613 1,184 1,789 4,336 6,772 1,517 1,431 6,170 313 1,145 3,287 1,956 2,406 66 180
zma-miR159f-5p GAGCUCCUCUCAUUCCAAUGA 21 68 1 5 1    5 0 0 1 0 0 0 3 0 3 0 0 0 0 0 0 0 2 2 0 0 0 0 0 0 0 2 1 0 0 0 0 1 0 3 0 0 2 1 0 0 2 0 0 3 0 0 0 0 0 0 0 0 0 0 0 1 1 0 2 0 0 2 0 0 0 2 4 1 0 2 0 0 0 0 3 3 0 0 0 0 4 1 0 0 0 1 0 0 0 0 0 0 3 0 3 0 0 0 0 2 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR159g-3p UUUGGAGUGAAGGGAGUUCUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR159g-5p GUGCUCCCUUCACACCAAUAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR159h-3p UUUGGAGUGAAGGGAGCUCUG 21 31 0 5 1    0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5 0 2 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 5 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5 0 0 0 0 0 0
zma-miR159h-5p GUGCUCCCUUCACACCAAUAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR159i-3p UUUGGAGUGAAGGGAGCUCUG 21 31 0 5 1    0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5 0 2 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 5 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5 0 0 0 0 0 0
zma-miR159i-5p GUGCUCCCUUCACACCAAUAA 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR159j-3p UUUGGAUUGAAGGGAGCUCUG 21 259,297 2,074 8,165 22    1,895 7,209 605 1,260 187 250 52 2,174 5,668 2,532 28 2,122 6,321 1,377 898 22 65 2,976 4,118 981 2,572 131 2,052 5,336 2,415 1,703 506 1,656 903 1,348 54 1,335 2,384 2,375 2,263 24 2,024 2,556 1,963 2,818 2,775 3,024 1,894 2,853 5,528 7,648 2,673 2,590 98 1,177 2,868 1,989 1,528 34 93 62 5,051 5,993 1,710 2,270 109 859 2,439 1,528 60 94 6,633 3,181 2,099 1,323 854 4,478 1,643 3,766 156 2,257 4,330 1,846 3,566 201 103 3,732 3,058 4,794 2,690 84 913 3,467 1,864 537 105 104 96 8,165 4,816 1,428 252 788 1,436 1,634 1,753 78 2,863 2,250 2,060 1,528 358 453 62 1,223 3,613 1,184 1,789 4,336 6,772 1,517 1,431 6,170 313 1,145 3,287 1,956 2,406 66 180
zma-miR159j-5p GUGCUCCCUUCAAACCAAUAA 21 9 0 4 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR159k-3p UUUGGAUUGAAGGGAGCUCUG 21 259,297 2,074 8,165 22    1,895 7,209 605 1,260 187 250 52 2,174 5,668 2,532 28 2,122 6,321 1,377 898 22 65 2,976 4,118 981 2,572 131 2,052 5,336 2,415 1,703 506 1,656 903 1,348 54 1,335 2,384 2,375 2,263 24 2,024 2,556 1,963 2,818 2,775 3,024 1,894 2,853 5,528 7,648 2,673 2,590 98 1,177 2,868 1,989 1,528 34 93 62 5,051 5,993 1,710 2,270 109 859 2,439 1,528 60 94 6,633 3,181 2,099 1,323 854 4,478 1,643 3,766 156 2,257 4,330 1,846 3,566 201 103 3,732 3,058 4,794 2,690 84 913 3,467 1,864 537 105 104 96 8,165 4,816 1,428 252 788 1,436 1,634 1,753 78 2,863 2,250 2,060 1,528 358 453 62 1,223 3,613 1,184 1,789 4,336 6,772 1,517 1,431 6,170 313 1,145 3,287 1,956 2,406 66 180
zma-miR159k-5p GUGCUCCCUUCAAACCAAUAA 21 9 0 4 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR160a-3p GCGUGCAAGGGGCCAAGCAUG 21 71 1 11 1    1 0 0 0 0 0 0 0 2 0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 1 0 0 0 2 0 0 0 0 3 0 0 0 0 4 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 10 0 0 0 0 0 0 0 0 0 8 0 0 0 0 6 0 0 0 0 0 4 0 0 0 3 2 0 0 0 0 0 1 0 0 0 0 5 0 0 0 0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 11 0 0 0
zma-miR160a-5p UGCCUGGCUCCCUGUAUGCCA 21 13,602 109 780 1    32 780 72 101 16 14 10 272 464 147 12 34 208 139 57 13 6 48 205 57 138 4 49 156 87 90 27 31 100 56 45 21 214 135 179 7 55 256 253 247 26 261 116 184 48 711 99 49 5 11 285 110 66 5 34 3 56 690 68 118 7 4 95 61 18 8 44 142 68 130 3 410 44 48 14 23 334 130 348 9 16 47 242 103 80 1 16 390 80 17 5 6 3 45 127 64 5 7 151 94 202 3 24 87 40 34 6 31 2 21 295 74 111 359 42 171 82 154 8 13 221 124 259 5 13
zma-miR160b-3p GCGUGCAAGGAGCCAAGCAUG 21 677 5 50 1    8 22 0 15 0 0 0 9 2 3 0 3 15 3 8 0 0 4 11 1 3 0 0 17 1 0 5 0 6 3 2 0 32 4 5 3 0 21 5 11 2 17 0 5 0 14 3 10 0 4 28 3 0 0 3 0 0 7 0 12 3 1 4 6 0 0 3 9 0 13 0 50 3 0 2 2 29 2 6 3 1 2 6 4 5 6 0 38 5 0 0 1 0 2 3 5 0 2 4 7 8 0 2 7 0 0 0 0 0 0 32 0 3 34 0 2 5 3 0 1 9 9 5 0 0
zma-miR160b-5p UGCCUGGCUCCCUGUAUGCCA 21 13,602 109 780 1    32 780 72 101 16 14 10 272 464 147 12 34 208 139 57 13 6 48 205 57 138 4 49 156 87 90 27 31 100 56 45 21 214 135 179 7 55 256 253 247 26 261 116 184 48 711 99 49 5 11 285 110 66 5 34 3 56 690 68 118 7 4 95 61 18 8 44 142 68 130 3 410 44 48 14 23 334 130 348 9 16 47 242 103 80 1 16 390 80 17 5 6 3 45 127 64 5 7 151 94 202 3 24 87 40 34 6 31 2 21 295 74 111 359 42 171 82 154 8 13 221 124 259 5 13
zma-miR160c-3p GCGUGCAUGGUGCCAAGCAUA 21 42 0 14 1    1 0 0 0 0 0 0 14 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 4 0 0 0 1 0 0 0 0 1 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 7 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 2 0 0
zma-miR160c-5p UGCCUGGCUCCCUGUAUGCCA 21 13,602 109 780 1    32 780 72 101 16 14 10 272 464 147 12 34 208 139 57 13 6 48 205 57 138 4 49 156 87 90 27 31 100 56 45 21 214 135 179 7 55 256 253 247 26 261 116 184 48 711 99 49 5 11 285 110 66 5 34 3 56 690 68 118 7 4 95 61 18 8 44 142 68 130 3 410 44 48 14 23 334 130 348 9 16 47 242 103 80 1 16 390 80 17 5 6 3 45 127 64 5 7 151 94 202 3 24 87 40 34 6 31 2 21 295 74 111 359 42 171 82 154 8 13 221 124 259 5 13
zma-miR160d-3p GCGUGCGUGGAGCCAAGCAUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR160d-5p UGCCUGGCUCCCUGUAUGCCA 21 13,602 109 780 1    32 780 72 101 16 14 10 272 464 147 12 34 208 139 57 13 6 48 205 57 138 4 49 156 87 90 27 31 100 56 45 21 214 135 179 7 55 256 253 247 26 261 116 184 48 711 99 49 5 11 285 110 66 5 34 3 56 690 68 118 7 4 95 61 18 8 44 142 68 130 3 410 44 48 14 23 334 130 348 9 16 47 242 103 80 1 16 390 80 17 5 6 3 45 127 64 5 7 151 94 202 3 24 87 40 34 6 31 2 21 295 74 111 359 42 171 82 154 8 13 221 124 259 5 13
zma-miR160e UGCCUGGCUCCCUGUAUGCCA 21 13,602 109 780 1    32 780 72 101 16 14 10 272 464 147 12 34 208 139 57 13 6 48 205 57 138 4 49 156 87 90 27 31 100 56 45 21 214 135 179 7 55 256 253 247 26 261 116 184 48 711 99 49 5 11 285 110 66 5 34 3 56 690 68 118 7 4 95 61 18 8 44 142 68 130 3 410 44 48 14 23 334 130 348 9 16 47 242 103 80 1 16 390 80 17 5 6 3 45 127 64 5 7 151 94 202 3 24 87 40 34 6 31 2 21 295 74 111 359 42 171 82 154 8 13 221 124 259 5 13
zma-miR160f-3p GCGUGCGAGGUGCCAGGCAUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR160f-5p UGCCUGGCUCCCUGUAUGCCG 21 14 0 3 1    0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 1 0 0 0 0
zma-miR160g-3p GCGUGCAAGGAGCCAAGCAUG 21 677 5 50 1    8 22 0 15 0 0 0 9 2 3 0 3 15 3 8 0 0 4 11 1 3 0 0 17 1 0 5 0 6 3 2 0 32 4 5 3 0 21 5 11 2 17 0 5 0 14 3 10 0 4 28 3 0 0 3 0 0 7 0 12 3 1 4 6 0 0 3 9 0 13 0 50 3 0 2 2 29 2 6 3 1 2 6 4 5 6 0 38 5 0 0 1 0 2 3 5 0 2 4 7 8 0 2 7 0 0 0 0 0 0 32 0 3 34 0 2 5 3 0 1 9 9 5 0 0
zma-miR160g-5p UGCCUGGCUCCCUGUAUGCCA 21 13,602 109 780 1    32 780 72 101 16 14 10 272 464 147 12 34 208 139 57 13 6 48 205 57 138 4 49 156 87 90 27 31 100 56 45 21 214 135 179 7 55 256 253 247 26 261 116 184 48 711 99 49 5 11 285 110 66 5 34 3 56 690 68 118 7 4 95 61 18 8 44 142 68 130 3 410 44 48 14 23 334 130 348 9 16 47 242 103 80 1 16 390 80 17 5 6 3 45 127 64 5 7 151 94 202 3 24 87 40 34 6 31 2 21 295 74 111 359 42 171 82 154 8 13 221 124 259 5 13
zma-miR162-3p UCGAUAAACCUCUGCAUCCA 20 388 3 33 1    2 31 0 0 0 0 0 19 19 0 0 3 11 0 0 0 0 2 4 0 0 0 6 14 3 2 2 5 0 0 1 0 1 1 1 0 2 6 3 0 9 14 0 0 3 33 3 2 0 1 10 3 0 0 2 0 4 22 3 0 0 1 0 0 0 0 10 9 1 0 2 7 0 0 0 7 0 2 1 0 0 3 27 0 5 0 3 16 0 0 0 0 0 5 0 3 0 7 0 0 0 0 2 0 0 0 3 0 0 0 0 0 0 11 7 2 0 6 0 0 1 0 0 0 0
zma-miR162-5p GGGCGCAGUGGUUUAUCGAUC 21 232 2 11 1    5 5 0 0 0 0 0 2 5 3 0 9 9 0 0 0 0 4 4 0 3 0 3 3 0 2 3 1 0 0 0 0 7 0 0 0 5 5 0 0 7 3 0 2 11 11 0 4 0 3 4 0 2 0 0 0 2 7 0 0 0 4 2 0 0 0 8 2 0 0 2 5 0 0 0 2 3 0 0 0 0 6 5 0 2 0 0 11 0 0 0 0 0 6 0 0 0 5 0 1 3 0 9 0 0 0 0 3 0 2 0 0 0 0 2 7 0 4 0 3 1 0 0 0 0
zma-miR164a-3p CACGUGUUCUCCUUCUCCAUC 21 18 0 6 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 2 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 6 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR164a-5p UGGAGAAGCAGGGCACGUGCA 21 9,019 72 1,186 1    35 40 3 234 0 2 0 140 86 59 7 138 49 95 21 0 0 1,186 34 19 77 0 395 51 83 48 6 113 25 36 4 106 47 35 121 0 414 50 32 1,065 419 41 17 85 242 50 54 47 2 140 38 3 24 0 2 0 102 36 8 58 0 21 8 14 0 0 139 15 21 23 79 53 5 17 0 262 67 22 163 0 0 93 10 37 29 0 54 27 9 3 0 0 3 319 23 52 2 70 36 16 79 3 272 55 13 36 1 0 0 51 53 0 23 0 229 12 29 47 0 67 50 7 74 0 2
zma-miR164b-3p AUGUGCCCAUCUUCUCCACC 20 450 4 56 1    0 0 0 0 0 0 0 6 0 0 0 1 0 3 0 0 0 56 2 2 3 0 19 6 10 13 0 8 0 0 0 21 6 7 9 0 29 0 1 8 24 2 0 2 26 6 5 2 0 16 0 3 2 0 0 0 12 0 3 4 0 2 2 0 0 0 3 2 0 0 2 0 0 0 0 12 4 6 6 0 0 6 0 0 0 0 0 0 0 0 0 0 0 16 0 0 0 5 0 0 0 0 28 3 0 0 0 0 0 0 0 0 0 0 24 0 0 6 0 4 0 0 2 0 0
zma-miR164b-5p UGGAGAAGCAGGGCACGUGCA 21 9,019 72 1,186 1    35 40 3 234 0 2 0 140 86 59 7 138 49 95 21 0 0 1,186 34 19 77 0 395 51 83 48 6 113 25 36 4 106 47 35 121 0 414 50 32 1,065 419 41 17 85 242 50 54 47 2 140 38 3 24 0 2 0 102 36 8 58 0 21 8 14 0 0 139 15 21 23 79 53 5 17 0 262 67 22 163 0 0 93 10 37 29 0 54 27 9 3 0 0 3 319 23 52 2 70 36 16 79 3 272 55 13 36 1 0 0 51 53 0 23 0 229 12 29 47 0 67 50 7 74 0 2
zma-miR164c-3p CAUGUGCCCUUCUUCUCCAUC 21 642 5 70 1    31 2 0 8 0 0 0 51 7 10 0 40 2 0 3 0 2 70 4 0 5 0 31 3 0 2 0 27 0 0 0 0 1 0 5 0 13 0 0 11 11 2 0 3 0 0 0 0 0 10 4 0 5 5 0 0 0 0 0 0 0 2 0 2 2 0 52 0 0 23 2 2 0 7 0 10 1 0 28 1 0 0 0 0 0 0 4 0 0 0 0 0 0 34 0 6 2 16 2 0 8 0 20 4 0 8 0 0 0 8 0 0 9 0 0 0 0 0 0 13 0 0 8 0 0
zma-miR164c-5p UGGAGAAGCAGGGCACGUGCA 21 9,019 72 1,186 1    35 40 3 234 0 2 0 140 86 59 7 138 49 95 21 0 0 1,186 34 19 77 0 395 51 83 48 6 113 25 36 4 106 47 35 121 0 414 50 32 1,065 419 41 17 85 242 50 54 47 2 140 38 3 24 0 2 0 102 36 8 58 0 21 8 14 0 0 139 15 21 23 79 53 5 17 0 262 67 22 163 0 0 93 10 37 29 0 54 27 9 3 0 0 3 319 23 52 2 70 36 16 79 3 272 55 13 36 1 0 0 51 53 0 23 0 229 12 29 47 0 67 50 7 74 0 2
zma-miR164d-3p CACGUGGUCUCCUUCUCCAU 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR164d-5p UGGAGAAGCAGGGCACGUGCA 21 9,019 72 1,186 1    35 40 3 234 0 2 0 140 86 59 7 138 49 95 21 0 0 1,186 34 19 77 0 395 51 83 48 6 113 25 36 4 106 47 35 121 0 414 50 32 1,065 419 41 17 85 242 50 54 47 2 140 38 3 24 0 2 0 102 36 8 58 0 21 8 14 0 0 139 15 21 23 79 53 5 17 0 262 67 22 163 0 0 93 10 37 29 0 54 27 9 3 0 0 3 319 23 52 2 70 36 16 79 3 272 55 13 36 1 0 0 51 53 0 23 0 229 12 29 47 0 67 50 7 74 0 2
zma-miR164e-3p CAUGUGUCCGCCCUCUCCACC 21 44 0 5 1    0 0 1 0 1 0 0 0 0 0 0 0 0 5 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 0 2 0 0 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 5 0 0 3 0 0 0 0 0 0 0 0 0 0 4 0 0 0 0 0 0 3 0 0 0 0 2 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 3 0 2
zma-miR164e-5p UGGAGAAGCAGGACACGUGAG 21 495 4 42 1    0 2 9 32 0 5 7 0 0 0 12 0 2 27 0 0 2 0 0 6 3 1 0 0 8 0 11 0 9 0 1 0 0 12 1 7 0 0 5 14 0 0 7 0 0 0 28 0 5 0 2 21 0 5 0 0 0 0 0 2 0 0 24 0 9 0 0 2 4 6 0 3 18 0 2 0 0 17 4 4 0 0 0 8 0 0 0 0 7 0 0 1 0 0 42 2 12 0 4 19 3 0 0 0 9 0 0 0 4 0 0 8 0 0 0 0 19 0 0 0 0 11 2 0 5
zma-miR164f-3p CACGUGCGCUCCUUCUCCAAC 21 1 0 1 1    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR164f-5p UGGAGAAGCAGGGCACGUGCU 21 55 0 8 1    0 0 0 4 0 0 0 0 2 0 0 0 2 3 0 0 0 2 2 2 0 0 0 0 1 0 0 0 2 0 0 0 0 0 0 0 0 2 0 3 0 0 0 2 0 0 8 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 1 0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 4 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 5 0 0 0
zma-miR164g-3p CACGUGCUCCCCUUCUCCACC 21 187 1 22 1    8 0 1 1 0 0 0 10 0 2 0 1 0 0 0 0 0 0 0 0 3 4 6 0 0 0 2 4 3 3 0 3 0 1 0 0 3 0 4 22 0 0 0 2 7 0 0 4 0 6 0 0 0 3 0 0 6 0 1 4 0 4 0 0 0 0 9 0 0 2 5 0 2 0 0 5 0 2 4 0 0 3 0 1 3 0 1 0 2 0 5 1 0 2 0 0 0 0 0 5 2 0 4 0 2 2 0 0 0 0 0 0 0 0 1 0 0 1 0 3 0 0 2 0 0
zma-miR164g-5p UGGAGAAGCAGGGCACGUGCA 21 9,019 72 1,186 1    35 40 3 234 0 2 0 140 86 59 7 138 49 95 21 0 0 1,186 34 19 77 0 395 51 83 48 6 113 25 36 4 106 47 35 121 0 414 50 32 1,065 419 41 17 85 242 50 54 47 2 140 38 3 24 0 2 0 102 36 8 58 0 21 8 14 0 0 139 15 21 23 79 53 5 17 0 262 67 22 163 0 0 93 10 37 29 0 54 27 9 3 0 0 3 319 23 52 2 70 36 16 79 3 272 55 13 36 1 0 0 51 53 0 23 0 229 12 29 47 0 67 50 7 74 0 2
zma-miR164h-3p CAUGUGCCCUUCUUCUCCAUC 21 642 5 70 1    31 2 0 8 0 0 0 51 7 10 0 40 2 0 3 0 2 70 4 0 5 0 31 3 0 2 0 27 0 0 0 0 1 0 5 0 13 0 0 11 11 2 0 3 0 0 0 0 0 10 4 0 5 5 0 0 0 0 0 0 0 2 0 2 2 0 52 0 0 23 2 2 0 7 0 10 1 0 28 1 0 0 0 0 0 0 4 0 0 0 0 0 0 34 0 6 2 16 2 0 8 0 20 4 0 8 0 0 0 8 0 0 9 0 0 0 0 0 0 13 0 0 8 0 0
zma-miR164h-5p UGGAGAAGCAGGGCACGUGUG 21 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR166a-3p UCGGACCAGGCUUCAUUCCCC 21 21,028,411 168,227 355,194 5,061    149,797 236,657 46,020 119,323 89,894 153,885 103,542 178,134 265,779 146,320 86,340 182,366 300,886 304,487 128,293 60,234 93,272 170,402 216,541 101,733 133,305 140,622 169,049 206,474 132,825 182,804 141,340 155,193 221,115 152,748 49,317 54,807 184,040 334,138 184,786 42,969 161,250 261,714 139,482 186,272 171,689 332,690 148,219 170,793 173,119 331,244 74,877 190,850 75,499 107,176 258,657 228,255 178,133 44,867 78,505 67,711 145,435 310,901 20,812 219,138 96,279 68,782 352,169 205,376 41,548 76,329 286,628 227,557 151,169 114,356 88,110 355,194 352,515 5,061 71,349 179,841 240,535 219,749 246,361 68,700 73,622 171,691 118,524 217,322 260,205 51,879 104,452 318,665 347,486 87,580 48,820 45,827 74,876 317,625 285,225 182,015 108,879 97,590 193,297 332,498 256,062 26,658 241,227 186,798 180,320 111,642 91,871 101,433 143,232 78,906 265,768 153,905 188,005 319,925 298,821 135,950 95,142 340,078 139,649 113,894 263,991 305,985 280,695 37,346 88,697
zma-miR166a-5p GGAAUGUUGUCUGGCUCGGGG 21 5,360 43 505 1    35 7 13 160 0 0 0 68 4 7 5 455 4 33 44 0 2 308 4 12 24 0 89 0 21 6 0 175 39 106 1 12 10 27 64 3 149 6 39 505 141 3 13 73 75 14 53 22 2 107 12 42 9 5 0 0 26 4 7 11 0 22 22 16 0 0 78 0 24 27 109 12 52 0 0 143 8 22 107 1 0 49 1 83 16 0 143 22 25 3 0 0 0 84 34 18 0 108 2 27 101 0 381 3 21 12 1 0 0 57 21 11 94 0 57 0 5 6 2 124 7 38 105 0 0
zma-miR166b-3p UCGGACCAGGCUUCAUUCCC 20 129,831 1,039 2,906 58    924 1,398 426 884 789 926 714 806 1,505 1,014 677 862 1,852 2,168 754 425 671 824 1,086 681 973 819 781 784 1,390 1,218 849 885 2,129 1,025 462 279 853 2,804 1,365 211 781 1,392 856 1,113 1,040 2,906 957 1,141 1,033 1,629 1,206 1,198 479 563 1,262 1,706 1,066 230 656 374 750 1,527 337 1,305 478 308 2,141 1,253 368 523 2,024 1,015 1,549 901 542 2,032 2,368 58 597 977 1,309 1,824 1,610 430 619 878 669 1,657 1,374 282 571 1,410 2,324 485 313 253 516 1,498 1,731 979 589 438 836 1,888 1,716 119 1,251 725 1,098 586 372 677 848 500 1,727 1,272 1,342 1,770 1,750 539 655 2,217 743 612 1,109 1,917 2,187 172 590
zma-miR166b-5p GGAAUGUUGUCUGGUUCAAGG 21 39,130 313 2,000 4    245 13 102 1,594 86 68 134 297 12 167 168 1,638 28 1,195 1,245 17 12 656 9 95 295 59 160 0 303 190 21 870 506 1,323 202 21 12 438 1,009 58 380 21 217 1,433 441 0 113 1,061 230 17 328 557 253 531 14 238 474 69 97 147 201 7 138 216 156 138 258 346 22 13 466 6 315 166 439 21 288 65 312 502 11 495 1,071 89 144 307 4 642 286 27 691 60 242 215 40 27 80 257 486 364 197 422 12 688 2,000 54 831 21 117 370 67 235 9 327 32 117 757 11 213 5 120 156 24 660 23 176 1,964 4 36
zma-miR166c-3p UCGGACCAGGCUUCAUUCCC 20 129,831 1,039 2,906 58    924 1,398 426 884 789 926 714 806 1,505 1,014 677 862 1,852 2,168 754 425 671 824 1,086 681 973 819 781 784 1,390 1,218 849 885 2,129 1,025 462 279 853 2,804 1,365 211 781 1,392 856 1,113 1,040 2,906 957 1,141 1,033 1,629 1,206 1,198 479 563 1,262 1,706 1,066 230 656 374 750 1,527 337 1,305 478 308 2,141 1,253 368 523 2,024 1,015 1,549 901 542 2,032 2,368 58 597 977 1,309 1,824 1,610 430 619 878 669 1,657 1,374 282 571 1,410 2,324 485 313 253 516 1,498 1,731 979 589 438 836 1,888 1,716 119 1,251 725 1,098 586 372 677 848 500 1,727 1,272 1,342 1,770 1,750 539 655 2,217 743 612 1,109 1,917 2,187 172 590
zma-miR166c-5p GGAAUGUUGUCUGGCUCGAGG 21 8,285 66 412 6    21 65 37 166 105 37 137 43 21 16 412 141 34 85 59 82 71 155 14 55 37 44 34 14 90 13 27 106 147 120 97 6 17 114 80 89 102 25 55 202 132 14 30 76 25 36 69 24 258 66 38 97 28 95 131 50 14 116 34 37 33 17 121 24 44 47 53 18 73 27 71 35 89 0 31 150 28 96 107 33 43 22 26 97 22 27 44 87 74 7 52 29 67 38 92 32 323 70 18 99 108 20 168 6 53 10 36 42 21 62 11 90 132 34 30 14 63 19 44 71 17 90 158 27 48
zma-miR166d-3p UCGGACCAGGCUUCAUUCCC 20 129,831 1,039 2,906 58    924 1,398 426 884 789 926 714 806 1,505 1,014 677 862 1,852 2,168 754 425 671 824 1,086 681 973 819 781 784 1,390 1,218 849 885 2,129 1,025 462 279 853 2,804 1,365 211 781 1,392 856 1,113 1,040 2,906 957 1,141 1,033 1,629 1,206 1,198 479 563 1,262 1,706 1,066 230 656 374 750 1,527 337 1,305 478 308 2,141 1,253 368 523 2,024 1,015 1,549 901 542 2,032 2,368 58 597 977 1,309 1,824 1,610 430 619 878 669 1,657 1,374 282 571 1,410 2,324 485 313 253 516 1,498 1,731 979 589 438 836 1,888 1,716 119 1,251 725 1,098 586 372 677 848 500 1,727 1,272 1,342 1,770 1,750 539 655 2,217 743 612 1,109 1,917 2,187 172 590
zma-miR166d-5p GGAAUGUUGUCUGGUUCAAGG 21 39,130 313 2,000 4    245 13 102 1,594 86 68 134 297 12 167 168 1,638 28 1,195 1,245 17 12 656 9 95 295 59 160 0 303 190 21 870 506 1,323 202 21 12 438 1,009 58 380 21 217 1,433 441 0 113 1,061 230 17 328 557 253 531 14 238 474 69 97 147 201 7 138 216 156 138 258 346 22 13 466 6 315 166 439 21 288 65 312 502 11 495 1,071 89 144 307 4 642 286 27 691 60 242 215 40 27 80 257 486 364 197 422 12 688 2,000 54 831 21 117 370 67 235 9 327 32 117 757 11 213 5 120 156 24 660 23 176 1,964 4 36
zma-miR166e UCGGACCAGGCUUCAUUCCC 20 129,831 1,039 2,906 58    924 1,398 426 884 789 926 714 806 1,505 1,014 677 862 1,852 2,168 754 425 671 824 1,086 681 973 819 781 784 1,390 1,218 849 885 2,129 1,025 462 279 853 2,804 1,365 211 781 1,392 856 1,113 1,040 2,906 957 1,141 1,033 1,629 1,206 1,198 479 563 1,262 1,706 1,066 230 656 374 750 1,527 337 1,305 478 308 2,141 1,253 368 523 2,024 1,015 1,549 901 542 2,032 2,368 58 597 977 1,309 1,824 1,610 430 619 878 669 1,657 1,374 282 571 1,410 2,324 485 313 253 516 1,498 1,731 979 589 438 836 1,888 1,716 119 1,251 725 1,098 586 372 677 848 500 1,727 1,272 1,342 1,770 1,750 539 655 2,217 743 612 1,109 1,917 2,187 172 590
zma-miR166f UCGGACCAGGCUUCAUUCCC 20 129,831 1,039 2,906 58    924 1,398 426 884 789 926 714 806 1,505 1,014 677 862 1,852 2,168 754 425 671 824 1,086 681 973 819 781 784 1,390 1,218 849 885 2,129 1,025 462 279 853 2,804 1,365 211 781 1,392 856 1,113 1,040 2,906 957 1,141 1,033 1,629 1,206 1,198 479 563 1,262 1,706 1,066 230 656 374 750 1,527 337 1,305 478 308 2,141 1,253 368 523 2,024 1,015 1,549 901 542 2,032 2,368 58 597 977 1,309 1,824 1,610 430 619 878 669 1,657 1,374 282 571 1,410 2,324 485 313 253 516 1,498 1,731 979 589 438 836 1,888 1,716 119 1,251 725 1,098 586 372 677 848 500 1,727 1,272 1,342 1,770 1,750 539 655 2,217 743 612 1,109 1,917 2,187 172 590
zma-miR166g-3p UCGGACCAGGCUUCAUUCCC 20 129,831 1,039 2,906 58    924 1,398 426 884 789 926 714 806 1,505 1,014 677 862 1,852 2,168 754 425 671 824 1,086 681 973 819 781 784 1,390 1,218 849 885 2,129 1,025 462 279 853 2,804 1,365 211 781 1,392 856 1,113 1,040 2,906 957 1,141 1,033 1,629 1,206 1,198 479 563 1,262 1,706 1,066 230 656 374 750 1,527 337 1,305 478 308 2,141 1,253 368 523 2,024 1,015 1,549 901 542 2,032 2,368 58 597 977 1,309 1,824 1,610 430 619 878 669 1,657 1,374 282 571 1,410 2,324 485 313 253 516 1,498 1,731 979 589 438 836 1,888 1,716 119 1,251 725 1,098 586 372 677 848 500 1,727 1,272 1,342 1,770 1,750 539 655 2,217 743 612 1,109 1,917 2,187 172 590
zma-miR166g-5p GGAAUGUUGUCUGGUUGGAGA 21 11,154 89 763 1    153 15 1 79 0 0 0 150 2 16 0 432 6 0 67 2 0 451 5 4 16 0 256 17 1 22 2 493 19 112 0 88 25 6 47 0 525 11 11 50 584 12 3 112 398 41 0 32 0 457 14 8 40 0 2 0 278 25 1 19 0 138 6 24 0 0 363 15 2 23 300 17 18 0 0 474 22 6 100 0 0 324 12 6 34 0 375 14 12 17 0 0 1 763 3 35 0 583 6 8 133 0 751 18 2 32 1 0 0 218 11 0 129 11 281 9 14 28 0 525 26 9 145 0 0
zma-miR166h-3p UCGGACCAGGCUUCAUUCCC 20 129,831 1,039 2,906 58    924 1,398 426 884 789 926 714 806 1,505 1,014 677 862 1,852 2,168 754 425 671 824 1,086 681 973 819 781 784 1,390 1,218 849 885 2,129 1,025 462 279 853 2,804 1,365 211 781 1,392 856 1,113 1,040 2,906 957 1,141 1,033 1,629 1,206 1,198 479 563 1,262 1,706 1,066 230 656 374 750 1,527 337 1,305 478 308 2,141 1,253 368 523 2,024 1,015 1,549 901 542 2,032 2,368 58 597 977 1,309 1,824 1,610 430 619 878 669 1,657 1,374 282 571 1,410 2,324 485 313 253 516 1,498 1,731 979 589 438 836 1,888 1,716 119 1,251 725 1,098 586 372 677 848 500 1,727 1,272 1,342 1,770 1,750 539 655 2,217 743 612 1,109 1,917 2,187 172 590
zma-miR166h-5p GGAAUGACGUCCGGUCCGAAC 21 21 0 4 1    0 0 0 0 0 0 0 0 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 0 0 1 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 2 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0
zma-miR166i-3p UCGGACCAGGCUUCAUUCCC 20 129,831 1,039 2,906 58    924 1,398 426 884 789 926 714 806 1,505 1,014 677 862 1,852 2,168 754 425 671 824 1,086 681 973 819 781 784 1,390 1,218 849 885 2,129 1,025 462 279 853 2,804 1,365 211 781 1,392 856 1,113 1,040 2,906 957 1,141 1,033 1,629 1,206 1,198 479 563 1,262 1,706 1,066 230 656 374 750 1,527 337 1,305 478 308 2,141 1,253 368 523 2,024 1,015 1,549 901 542 2,032 2,368 58 597 977 1,309 1,824 1,610 430 619 878 669 1,657 1,374 282 571 1,410 2,324 485 313 253 516 1,498 1,731 979 589 438 836 1,888 1,716 119 1,251 725 1,098 586 372 677 848 500 1,727 1,272 1,342 1,770 1,750 539 655 2,217 743 612 1,109 1,917 2,187 172 590
zma-miR166i-5p GGAAUGUCGUCUGGCGCGAGA 21 112 1 14 1    2 0 0 7 0 0 0 9 0 0 0 14 0 0 5 0 0 2 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 0 0 0 2 0 0 0 7 0 0 0 1 0 2 0 0 13 0 0 0 0 0 0 1 0 0 0 0 1 0 0 0 0 1 0 0 2 0 0 0 0 0 5 0 0 0 0 0 2 0 0 0 0 3 0 0 0 0 0 0 3 0 0 0 2 0 0 2 0 6 0 0 0 0 0 0 4 0 3 3 0 1 0 0 0 0 1 0 0 5 0 0
zma-miR166j-3p UCGGACCAGGCUUCAAUCCCU 21 88,595 709 2,907 2    843 517 0 1,068 35 35 12 384 523 809 44 1,371 499 0 1,294 20 51 1,287 737 0 1,818 83 1,459 684 3 1,296 166 1,634 5 1,147 27 507 784 0 2,084 14 1,539 1,202 0 1,836 1,535 1,373 0 1,938 928 720 0 1,530 42 976 633 0 1,736 8 17 40 874 819 0 1,752 42 920 0 1,815 11 4 1,870 773 0 1,182 894 863 0 2,826 91 1,633 1,387 0 2,844 34 12 794 297 0 1,487 12 1,044 717 2 868 12 18 23 2,268 0 895 21 1,068 538 0 2,014 10 2,387 823 0 1,864 67 11 11 532 916 0 1,777 706 1,534 370 0 2,907 32 1,169 1,090 0 2,350 2 20
zma-miR166j-5p GGUUUGUUUGUCUGGUUCAAGG 22 178 1 19 1    1 5 0 3 0 0 0 3 2 7 0 1 0 0 13 0 0 0 0 0 11 0 3 0 0 4 0 4 0 17 0 0 0 0 9 0 0 2 0 3 0 0 0 7 3 0 0 0 0 0 0 0 7 0 0 0 0 0 0 0 0 1 0 6 0 0 0 0 0 0 0 0 0 0 0 2 0 0 6 0 0 0 0 0 0 0 1 0 0 0 0 0 0 2 0 3 0 0 4 0 19 0 0 0 0 10 0 0 0 0 0 0 9 0 0 0 0 0 0 0 0 0 10 0 0
zma-miR166k-3p UCGGACCAGGCUUCAAUCCCU 21 88,595 709 2,907 2    843 517 0 1,068 35 35 12 384 523 809 44 1,371 499 0 1,294 20 51 1,287 737 0 1,818 83 1,459 684 3 1,296 166 1,634 5 1,147 27 507 784 0 2,084 14 1,539 1,202 0 1,836 1,535 1,373 0 1,938 928 720 0 1,530 42 976 633 0 1,736 8 17 40 874 819 0 1,752 42 920 0 1,815 11 4 1,870 773 0 1,182 894 863 0 2,826 91 1,633 1,387 0 2,844 34 12 794 297 0 1,487 12 1,044 717 2 868 12 18 23 2,268 0 895 21 1,068 538 0 2,014 10 2,387 823 0 1,864 67 11 11 532 916 0 1,777 706 1,534 370 0 2,907 32 1,169 1,090 0 2,350 2 20
zma-miR166k-5p GGAUUGUUGUCUGGCUCGGGG 21 1,063 9 99 1    80 0 0 31 3 2 0 34 0 3 0 57 0 0 15 0 0 21 0 0 8 1 12 0 0 11 0 31 0 17 1 0 1 0 12 0 13 0 0 64 24 0 0 25 13 0 0 2 0 4 0 0 14 0 0 0 18 0 0 5 0 5 0 6 0 0 60 0 0 29 10 2 0 14 2 14 0 0 25 7 0 42 0 0 6 0 23 0 0 14 0 0 1 48 0 6 0 7 0 0 22 0 48 0 0 0 0 0 0 9 0 0 3 0 99 0 0 3 0 14 0 0 18 4 0
zma-miR166l-3p UCGGACCAGGCUUCAUUCCUC 21 77,091 617 2,637 3    637 1,223 12 700 52 56 55 523 1,373 900 30 799 1,224 70 869 28 51 731 1,035 30 999 100 663 1,113 44 1,358 175 863 68 1,103 22 261 894 103 1,427 17 765 1,368 35 1,068 955 1,255 56 1,366 682 1,312 15 1,465 42 568 941 29 1,285 8 25 42 704 1,030 3 1,330 64 405 48 1,413 22 30 1,978 1,035 34 1,132 510 1,650 43 196 46 1,163 1,430 37 2,378 92 33 710 457 48 1,447 17 521 1,146 44 718 13 15 25 1,755 90 1,082 43 576 590 55 1,699 0 1,427 917 34 988 94 51 51 337 1,801 32 1,318 706 1,474 438 5 2,637 85 622 1,155 52 2,071 20 29
zma-miR166l-5p GAAUGGAGGCUGGUCCAAGA 20 0 0 0 0    0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
zma-miR166m-3p UCGGACCAGGCUUCAUUCCUC 21 77,091 617 2,637 3    637 1,223 12 700 52 56 55 523 1,373 900 30 799 1,224 70 869 28 51 731 1,035 30 999 100 663 1,113 44 1,358 175 863 68 1,103 22 261 894 103 1,427 17 765 1,368 35 1,068 955 1,255 56 1,366 682 1,312 15 1,465 42 568 941 29 1,285 8 25 42 704 1,030 3 1,330 64 405 48 1,413 22 30 1,978 1,035 34 1,132 510 1,650 43 196 46 1,163 1,430 37 2,378 92 33 710 457 48 1,447 17 521 1,146 44 718 13 15 25 1,755 90 1,082 43 576 590 55 1,699 0 1,427 917 34 988 94 51 51 337 1,801 32 1,318 706 1,474 438 5 2,637 85 622 1,155 52 2,071 20 29
zma-miR166m-5p GGAAUGUUGGCUGGCUCGAGG 21 2,059 16 163 1    32 0 0 35 3 0 0 35 0 21 0 68 0 0 41 0 0 14 0 0 48 0 9 0 0 33 0 38 0 89 0 3 0 0 78 0 8 3 0 90 50 0 0 69 13 0 0 43 0 4 0 0 50 0 0 0 23 0 0 53 0 1 0 36 0 0 100 0 0 29 15 2 0 3 2 30 0 0 136 3 0 22 0 0 37 0 40 0 0 3 0 0 3 31 0 27 0 5 0 0 114 0 56 0 0 28 0 0 0 11 0 0 58 0 67 0 0 54 0 30 0 0 163 0 0
zma-miR166n-3p UCGGACCAGGCUUCAAUCCCU 21 88,595 709 2,907 2    843 517 0 1,068 35 35 12 384 523 809 44 1,371 499 0 1,294 20 51 1,287 737 0 1,818 83 1,459 684 3 1,296 166 1,634 5 1,147 27 507 784 0 2,084 14 1,539 1,202 0 1,836 1,535 1,373 0 1,938 928 720 0 1,530 42 976 633 0 1,736 8 17 40 874 819 0 1,752 42 920 0 1,815 11 4 1,870 773 0 1,182 894 863 0 2,826 91 1,633 1,387 0 2,844 34 12 794 297 0 1,487 12 1,044 717 2 868 12 18 23 2,268 0 895 21 1,068 538 0 2,014 10 2,387 823 0 1,864 67 11 11 532 916 0 1,777 706 1,534 370 0 2,907 32 1,169 1,090 0 2,350 2 20
zma-miR166n-5p GGAUUGUUGUCUGGCUCGGUG 21 2,224 18 230 1    25 0 0 37 0 0 0 43 0 38 0 31 0 0 28 0 0 8 0 0 61 0 6 0 0 48 0 26 0 56 1 3 0 0 57 0 5 2 0 78 0 0 0 49 36 0 0 101 0 14 0 0 101 0 2 0 33 0 0 57 0 14 0 105 0 0 38 0 0 44 3 0 0 230 0 3 0 0 81 3 0 34 0 0 78 0 8 0 0 72 0 0 0 23 0 50 0 7 0 0 116 0 26 0 0 64 0 0 0 0 0 0 44 0 0 0 0 108 5 14 0 0 108 0 0
zma-miR167a-3p GAUCAUGCAUGACAGCCUCAUU 22 308 2 42 1    0 0 0 0 19 0 42 0 0 2 7 0 0 2 0 9 8 0 0 0 0 7 0 0 0 0 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 10 0 1 0 0 16 0 0 0 4 30 0 0 0 0 0 0 2 0 0 0 0 0 0 3 9 0 0 0 0 11 0 0 0 0 5 9 16 0 0 0 5 0 0 0 0 0 0 0 0 0 1 0 8 0 0 0 0 0 0 0 0 0 12 0 0 0 0 27 36
zma-miR167a-5p UGAAGCUGCCAGCAUGAUCUA 21 6,394 51 879 1    2 60 61 37 229 40 299 1 61 36 163 0 32 64 5 190 55 0 23 19 27 87 0 14 45 29 32 1 52 17 23 0 18 78 27 82 0 11 94 25 0 7 37 22 0 19 78 4 74 0 18 39 12 5 9 36 0 16 29 19 191 0 79 14 27 581 0 9 27 13 0 31 32 10 7 0 25 87 42 64 110 0 4 121 11 94 0 38 46 0 82 76 325 0 35 6 55 0 10 75 15 0 0 3 17 10 34 20 62 0 21 21 32 11 1 2 39 16 223 0 20 61 24 93 879
zma-miR167b-3p GAUCAUGCUGUGACAGUUUCACU 23 804 6 77 1    0 0 17 0 0 0 0 0 0 0 0 0 0 12 3 0 0 0 0 7 0 1 0 0 10 4 0